Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Chemokine receptor homo‐ or heterodimerization activates distinct signaling pathways

Chemokine receptor homo‐ or heterodimerization activates distinct signaling pathways The EMBO Journal Vol. 20 No.10 pp. 2497-2507, 2001 Chemokine receptor homo- or heterodimerization activates distinct signaling pathways and a cytoplasmic C-terminal domain. The N-terminus Mario Mellado, Jose Miguel Rodriguez-Frade, and the extracellular domains have been implicated in Antonio J.Vila-Coro, Silvia Fernandez, receptor-ligand interaction, whereas the C-terminus and Ana Martin de Ana, David R.Jones, the intracellular domains cooperate to bind and activate Jose L.Toran and Carlos Martinez-A the G proteins (Bockaert and Pin, 1999). Department of Immunology and Oncology, Centro Nacional de After binding to their specific receptors, and as occurs Biotecnologfa/CSIC, Universidad Aut6noma de Madrid, for other GPCRs (Hebert et al., 1996; Romano et al., 1996; Campus de Cantoblanco, E-28049 Madrid, Spain Cvejic et al., 1997; Bai et al., 1998; Zeng et al., 1999), Corresponding author chemokines induce receptor homodimerization and sub­ e-mail: [email protected] sequently activate the receptor-associated JAK kinase, possibly by transphosphorylation on tyrosine residues Chemokine receptors of both the CC and CXC (Mellado et al., 2001). This may create Src homology 2 families have been demonstrated to undergo a ligand­ (SH2) docking sites, leading to the recruitment of ST AT mediated homodimerization process required for (signal transducers and activators of transcription) tran­ l+ Ca flux and chemotaxis. We show that, in the chemo­ scription factors. The highly conserved Tyr present in the kine response, heterodimerization is also permitted DRY motif is a primary target for chemokine receptor between given receptor pairs, specifically between phosphorylation; a Tyr-to-Phe mutation impairs G;-medi­ CCR2 and CCR5. This has functional consequences, 2+ ated Ca flux triggered by chemokine binding, as well as as the CCR2 and CCR5 ligands monocyte chemotactic G; association with the chemokine receptor (Mellado et al., protein-1 (MCP-1) and RANTES (!egulated upon 1998). This mutant form of the receptor behaves as a !!Ctivation, !!Ormal I cell-�xpressed and �ecreted) dominant negative, since co-transfection with wild-type cooperate to trigger calcium responses at concentra­ receptor impairs its function (Rodrfguez-Frade et al., tions 10- to 100-fold lower than the threshold for 1999b). In another member of the seven-transmembrane­ either chemokine alone. Heterodimerization results in domain receptor family, it has been demonstrated that the recruitment of each receptor-associated signaling response to y-aminobutyrate (GABA) requires hetero­ complex, but also recruits dissimilar signaling path­ dimerization of the GABA receptor type 1 (GBRl) and ways such as G association, and delays activation q1 GBR2 receptors (Kaupmann et al., 1998; White et al., of phosphatidyl inositol 3-kinase. The consequences 1998; Kuner et al., 1999), as physical interaction between l+ are a pertussis toxin-resistant Ca flux and trig­ GBRl and GBR2 appears to be essential for the activation gering of cell adhesion rather than chemotaxis. These of potassium channels. Another group of GPCRs, the results show the effect of heterodimer formation on opioid receptors, undergoes heterodimerization (Jordan increasing the sensitivity and dynamic range of the and Devi, 1999). In this case, there is clear biochemical chemokine response, and may aid in understanding and pharmacological evidence for the heterodimeriza­ the dynamics of leukocytes at limiting chemokine tion of two functional opioid receptors, ic and 6. concentrations in vivo. Heterodimerization of these receptors causes synergistic Keywords: chemokine receptor/dimerization/G proteins/ agonist binding and potentiates the biological signal, yet phosphatidyl inositol 3-kinase there are no biochemical data to explain this phenomenon. A polymorphism reported for the CCR2 receptor, in which Val64 is replaced by Ile (CCR2V64I) and which Introduction occurs at an allelic frequency of 10-25%, is associated The chemokines are a family of pro-inflammatory cyto­ with a 2-4 year delay in progression to acquired kines that attract and activate specific leukocyte types immunodeficiency sydrome (AIDS) (Lee et al., 1998). (Baggiolini, 1998). Based on the position of the first two Relatively few viral strains are reported to use CCR2 in canonical cysteine residues and the chromosomal location conjunction with CD4 to infect cells (Premack and Schall, of the corresponding genes, two main chemokine 1996; Berger et al., 1999); we have shown that the families have been identified: CC and CXC (Rollins, mechanism underlying this protective effect may be the 1997; Baggiolini, 1998). They act on monocytes, lympho­ ability of the CCR2V64I mutant receptor to heterodimer­ cytes, natural killer (NK) cells, basophils, eosinophils and ize with CCR5 and/or CXCR4 (Mellado et al., 1999). neutrophils (Rossi and Zlotnick, 2000). Chemokines The majority of chemokine receptors bind more than mediate their effects via interactions with seven-trans­ one chemokine; in addition, most cell types express membrane-domain glycoprotein receptors coupled to a multiple chemokine receptors, so that if one ligand or G protein signaling pathway (G-protein-coupled receptors receptor is defective, an alternative set of chemokines and or GPCRs). This type of receptor consists of a single their receptors can carry out the biological function polypeptide chain with an extracellular N-terminal domain (Wuyts et al., 1997; Wolf et al., 1998; Johnston et al., © European Molecular Biology Organization 2497 M.Mellado et al. 1999). Although in vitro studies show overlapping func­ HEK-293 CCR2b/CCRS tions for several chemokines, their in vivo expression and function appear to be finely controlled. Three mechanisms can be conceived to participate in this control: (i) chemo­ kine or chemokine receptor availability; (ii) ligand­ receptor interaction; and (iii) the signal transduction mechanism activated by the chemokine receptor. Here we examine the dynamic interactions between chemokines and cell surface chemokine receptors, and analyze how the presence of several chemokine receptors regulates the response to a specific chemokine. Our results provide 1 00 ■ 0. 1..M biochemical and functional evidence for CCR2 and CCR5 01.0nM receptor heterodimerization. These heterodimers are more D IOaM !lO efficient at inducing biological responses, illustrated by the .. 10- to 100- fold lower chemokine concentration required to # trigger these responses. This increase occurs via the synergistic interaction of several signaling complexes M0' -1 iwm:s 1Wff£$ recruited by each individual receptor. Furthermore, MCP-1 receptor heterodimerization associates specific signaling M,(kllo) -' pathways, such as recruitment of G , a G protein �'.:..J----:-:---=:::--=--, - l ll.S _r- � :=:: :'o"=:;:,,:;;:':"' --, - 101 insensitive to pertussis toxin (PTx). Heterodimeric chemo­ - 69 kine receptor interaction may have implications in under­ standing the in vivo processes that hinder leukocyte rolling on blood vessels and induce leukocyte parking in tissues during inflammatory responses. Ll lOl" 6 1 1 3 4 }6 +tisS '----- -�L...J L------' L...J CCltl =-ll'f'- cau cau Results The simultaneous presence of chemokines 3 MCP -1 6 medium triggers a synergistic response mediated by heterodimerization of their receptors Fig. 1. Simultaneous MCP-1 and RANTES co-activation of CCR2- and Using human embryonic kidney (HEK)-293 cells co­ CCRS-expressing cells increases sensitivity of chemokine responses transfected with CCR2b and CCR5 receptors, we evalu­ and promotes their heterodirnerization. (A) CCR2b/CCR5 double­ ated the potential of these chemokine receptors to induce transfected HEK-293 cells were incubated with biotin-labeled mAbs functional responses following stimulation with a com­ against CCR2 and CCRS or their respective isotype-matched control 2+ mAbs, followed by isothiocyanate-labeled streptavidin. (B) Ca bination of chemokine ligands. The expression levels of mobilization was induced by treatment with 10 nM MCP-1 or 10 nM the two receptors were quantified by flow cytometric RANTES in Auo-3-loaded CCR2/CCR5-co-transfected HEK-293 cells. analysis (Figure lA) (Poncelet and Lavabre-Bertrand, Results are expressed as a percentage of the chemokine-induced 1993) and by their ability to respond in chemotaxis and in calcium response. Five experiments were performed; the figure depicts one representative experiment. Arrows indicate addition of stimulus. Ca+ flux experiments to monocyte chemotactic protein- I 2+ (C) Ca mobilization was determined as in (B), following stimulation (MCP-1) or RANTES (regulated upon ;!Ctivation, _!!ormal with different concentrations of MCP-1 or RANTES as indicated, I cell-�xpressed and �ecreted) (Figure lB). In these cells, added separately or simultaneously. Results are expressed as a MCP-1 and RANTES sensitized responses to the homo­ percentage of the maximum chemokine-induced calcium response. The logous, but not to the heterologous chemokine. When mean ± SD of four independent experiments is shown. (D) CCR2/ CCRS-co-transfected HEK-293 cells were stimulated with chemokines MCP-1 and RANTES were added simultaneously to 2+ (10 nM for 5 min at 37 C) and, where indicated, cross-linked with CCR2-and CCR5-co-transfected HEK-293 cells, Ca 1 mM DSS. Cell lysates were immunoprecipitated with anti-CCR2 flux was triggered at a concentration much lower than antibody, electrophoresed and transferred to nitrocellulose membranes. that required to induce a response by either chemokine The western blot was analyzed with anti-CCRS antibody (left); as a alone (0.1 nM versus 1 nM; Figure 1 C), indicating a positive control, unstimulated CCR2/CCR5-co-transfected HEK-293 cells were immunoprecipitated with anti-CCRS antibody (lane 6). The cooperative effect when the two receptors bind their membrane was stripped and reprobed with anti-CCR2 antibody as a ligands simultaneously. control for protein loading (right). Arrows indicate the position to We have shown that the initiation of chemokine which monomers and dimers migrated. signaling through the CCR2, CCR5 and CXCR4 chemo­ kine receptors involves ligand-triggered receptor homo­ linked using disuccinirnidyl suberate (DSS), lysed and dimerization (Rodriguez-Frade et al., 1999a,b; Vila-Coro immunoprecipitated with an anti-CCR2 antibody, and et al., 1999). In an attempt to understand the mechanisms the western blot was developed with anti-CCR5 underlying the RANTES- and MCP-1-promoted syner­ (Figure ID, left) or anti-CCR2 antibodies (Figure ID, 2+ gistic response in Ca mobilization, and based on the right). In accordance with previous results (Rodriguez­ observed heterodimerization of other GPCRs, we tested Frade et al., 1999b ), stimulation with MCP-1 alone whether chemokine binding also triggered receptor induced dimerization of the CCR2 receptor (Figure 1D, heterodimerization. CCR2b/CCR5-co-transfected HEK- right), but not of the CCR5 receptor (Figure ID, left), as 293 cells were stimulated with MCP-1, RANTES or determined by the presence of higher molecular weight equimolar concentrations of both. Cells were then cross- complexes. In the converse experiment, RANTES induced 2498 Chemokine receptor heterodimerization homodimerization of the CCR5 receptor, but not of the HEK-293 CC1UbY139F/CCRS CCR2 receptor (not shown). The simultaneous presence of MCP-1 and RANTES promoted the formation of CCR2 homodimers (Figure 1D, right), CCR5 homodimers (not shown) and, interestingly, CCR2-CCR5 heterodimers (Figure 1D, left). The same results were obtained when double-transfectant HEK-293 cells were stimulated sim­ ultaneously with MCP-1 and RANTES, lysed and immunoprecipitated with anti-CCR5 antibody, and the western blot developed with anti-CCR2 antibody (not shown). We conclude, therefore, that the CCR2 and CCR5 receptors can form heterodimers following simultaneous stimulation with the ligands of both receptors. Neither synergistic chemokine responses nor heterodimerization were observed in cells expressing CCR2 and CXCR4 after MCP,. I SDF-lla. .MCP,I stimulation with MCP-1 and SDF-la (not shown). S.OF-[CI Chemokine receptor heterodimerization regulates chemokine responses We showed previously that the CCR2bY139F mutant under­ goes receptor homodimerization in response to MCP-1 and heterodimerization with the CCR2b wild-type receptor, blocking the response to MCP-1 (Rodn'.guez-Frade et al., 1999b). To evaluate the functional consequences of CCR5 and CCR2 heterodimerization, CCR5 and the dominant­ ,_ ____ __,L.J ,_ ____ __,L.J negative CCR2b Y139F mutant receptor (Rodriguez-Frade CCRl C05 --!PP- CCRl CCR1 et al., 1999b) were co-transfected into HEK-293 cells. '2 llllf!diu.m l MCM Receptor expression in these cells was quantified by , IW<TllS+l!fCJ>·l 6 -... flow cytometry using specific antibodies (Figure 2A). Fig. 2. The mutant CCR2bY139F receptor impairs the response to CCR2bY139F expression in HEK-293 cells resulted in an RANTES but to SDF-la. (A) CCR2bY139F/CCR5 double-transfected impaired response to MCP-1 (Figure 2B), as would be HEK-293 cells were incubated with biotin-labeled mAbs to CCR2, predicted based on previous results. Co-expression of CCR5 or CXCR4 or their respective isotype-matched control mAbs, 2+ CCR5 and CCR2b Y139F did not affect the RANTES Ca 2+ followed by isothiocyanate-labeled streptavidin. (B) Ca flux was mobilization response, but co-addition of MCP-1 and triggered by 10 nM RANTES, 10 nM MCP-1, or a combination of both chemokines (0.1 nM each) as indicated using CCR2bY139F/CCR5- RANTES blocked this response (Figure 2B). In control co-transfected HEK-293 cells. Results are expressed as a percentage of experiments, CCR2bY139F did not block the response to 2+ the maximum chemokine-induced Ca response. The figure depicts SDF-la, even with simultaneous addition of MCP-1 and 2+ one representative experiment of four performed. (C) Ca mobilization SDF-la (Figure 2C), whose receptor, CXCR4, is con­ was determined as in Figure lB, following stimulation of CCR2b­ Y139F/CCR5-co-transfected HEK-293 cells with different concen­ stitutively expressed in HEK-293 cells. Here we demon­ trations of MCP-1 or SDF-la, separately or simultaneously as strate that, in the presence of RANTES and MCP-1, the indicated. Results are expressed as a percentage of the maximum CCR2bY139F mutant also dimerizes with the CCR5 chemokine-induced response. The mean ± SD of three independent receptor. Indeed, when cells were cross-linked and experiments is shown. (D) HEK-293 cells co-transfected with the immunoprecipitated with anti-CCR2b antibody and the CCR2bY139F and CCR5 receptors were processed as in Figure 1D. Arrows indicate the monomer and the dimer. western blot developed with anti-CCR5 antibody (Figure 2D, left), we observed heterodimer formation cytometry using specific antibodies. In CCR5 wild-type only in the presence of both MCP-1 and RANTES + + (Figure 2D, left, lane 5). In anti-CCR2b antibody donors, 15-20% of CD3and 30-35% of CD14cells immunoprecipitates developed in western blotting with expressed both types of receptor, and very few cells were the same antibody, CCR2 dimers were observed after detected that expressed CCR2 or CCR5 alone. PBMC stimulation with MCP-1 or MCP-1 plus RANTES from the CCR5A32 donor showed similar CCR2 levels (Figure 2D, right). We conclude that these two receptors, and cell distribution, and no significant expression of CCR5 and CCR2bY139F, undergo heterodimerization CCR5 (Figure 3B). When combined, RANTES and after stimulation with MCP-1 plus RANTES, impairing MCP-1 triggered both a chemotactic response (Figure 3C, 2+ the downstream responses to RANTES. left) and Ca flux (Figure 3D, upper panel) at a To exclude the possibility that the synergistic response concentration 10-100 times lower than that of either one observed with the combination of RANTES and MCP-1 alone in CCR5 homozygotic donors. This synergistic was due to CCR5 and CCR2 receptor overexpression, we effect was not seen for the CCR5A32 (Figure 3D, lower tested the effects of these two chemokines on peripheral panel), although we observed a RANTES-mediated blood mononuclear cells (PBMC) derived from a CCR5 response when PBMC from this donor were stimulated homozygotic donor and on PBMC derived from a donor with the chemokine. This synergistic effect may be due to bearing the CCR5A32 mutation and therefore not express­ a RANTES-mediated response using a receptor other than ing the CCR5 receptor (Benkirane, 1997) (Figure 3A). CCR5; in fact, MIP-1�, a specific ligand for CCR5, Expression of CCR2 and CCR5 was assessed by flow promoted no response (not shown). To confirm that 2499 M.Mellado et al. heterodimerization requires specific, simultaneous acti­ A B CCR2wtlCCJU wt CCR2wt/CCRS t.32 vation of both receptors, we used antagonistic anti-CCR2 CCll5 o:al and -CCR5 monoclonal antibodies (mAbs) (Mellado et al., MW A�2 WT � 2 .Sb p. 1998; Rodrfguez-Frade et al., 1999a). Both of these mAbs �2tlbp. completely blocked the synergistic response in PBMC from CCR5 homozygous donors (Figure 3C, right), I. -� �m 0. 1 - §W □ ru ,ow cu suggesting that heterodimerization is involved in this CCR2 CCR2 """ response. Receptor heterodimerization results in recruitment of both receptor-associated signaling complexes We next analyzed whether heterodimers could recruit the signaling complex associated with either receptor. In RANTES-stimulated, CCR5-transfected HEK-293 cells, we identified JAKl, but not JAK2 or JAK3, associated with the CCR5 receptor, whereas in CCR2-transfected a.-bi::�Cikl(I HEK-293 cells, MCP-1 stimulation promoted JAK2 association with the receptor (Mellado et al., 1998; Rodrfguez-Frade et al., 1999a). The identification of the downstream signaling pathway activated by JAK1/JAK2 kinases has also revealed phosphorylated ST AT5 tran­ scription factors in anti-CCR5 immunoprecipitates (Rodrfguez-Frade et al., 1999a) and STAT3 in anti­ CCR2 immunoprecipitates (Mellado et al., 1998). As predicted, when CCR2- and CCR5-co-transfected HEK- 293 cells were stimulated with MCP-1, ST AT3 was observed in the immunoprecipitates obtained with the anti­ CCR2 antibody (Figure 4A, left). When these cells were stimulated with RANTES, however, anti-CCR5 antibody did not precipitate STAT3, as seen in the western blot (Figure 4A, center). When the cells were stimulated with both MCP-1 and RANTES, ST AT3 was found in the CCR5 receptor immunoprecipitates (Figure 4A, right). To Fig. 3. Simultaneous MCP-1 and RANTES co-activation of PBMC check that equivalent amounts of protein had been loaded, increases sensitivity of chemokine responses. (A) Amplification of gene membranes were stripped and probed with the immuno­ fragments corresponding to the CCR5 (245 bp) and CCR5A32 (213 bp) precipitating antibodies (Figure 4A, lower panels). Since with specific primers as described in Materials and methods using STAT3 does not associate with RANTES-activated CCR5, genomic DNA from PBMC isolated from CCR5-homozygous and CCR5A32-homozygous donors. (B) PBMC from CCR5 wild-type and it can be inferred that the simultaneous presence of MCP-1 CCR5A32 donors were incubated with anti-CCR2, anti-CCRS mAbs and RANTES triggers the formation of a CCR2-CCR5 or their respective isotype-matched control mAbs in the presence complex, which recruits the signaling machinery associ­ of an excess of human immunoglobulins, followed by fluorescein ated with each of the receptors. isothiocyanate-labeled anti-mouse IgG and phycoerythrin (PE)-labeled anti-mouse IgM antibodies. The figure also shows the percentage of Finally, we performed similar experiments in which double-staining cells and single positives. (C) PBMC from CCRS- and HEK-293 cells co-expressing CCR5 and the CCR2b­ CCR5A32-homozygous donors were allowed to migrate following Y139F mutant were stimulated with MCP-1 and/or stimulation with MCP-1 or RANTES, added separately or simul­ RANTES. STAT5b was detected in anti-CCR5 immuno­ taneously as indicated. The migration index was calculated as described precipitates after stimulation with RANTES, but not in Materials and methods. Data represent the mean of quadruplicate determinations, with the SD indicated. Migration of PBMC from after stimulation with MCP-1 and RANTES together CCR5-homozygous donors in response to 0.1 nM MCP-1 plus 0.1 nM (Figure 4B). These results and the impaired response to the RANTES was blocked by pre-treatment of the cells with antibodies combined stimulus in these co-transfected cells against CCR2 and CCR5 (50 µg/ml for 30 min at 37 C). As a control, 2+ (Figure 2A) lead us to conclude that CCR2bY139F acts pre-treatment with isotype-matched antibodies is also shown. (D) Ca flux was triggered by 10 nM or 0.1 nM RANTES, MCP-1, or a as a trans dominant-negative mutant, blocking RANTES combination, using PBMC from CCR5- and CCR5A32-homozygous responses by its ability to form non-productive complexes donors. Results are expressed as a percentage of the maximum with partners containing the functional domain; this chemokine-induced calcium response. The figure depicts one demonstrates the biological relevance of dimerization in representative experiment of four performed. chemokine responses. with both CCR2b and CCR5 were stimulated simultan­ Chemokine receptor heterodimers recruit unique eously with 0.1 nM MCP-1 and 0.1 nM RANTES, PTx did signaling pathways not block the response (Figure 4C, left), illustrating the We have attempted to establish the molecular basis of this presence of a unique signaling pathway activated through reduction in the threshold required to induce a biological receptor heterodimerization. Similar results were obtained response. Treatment with PTx abrogated both calcium when this assay was performed using PBMC derived from release and migration in response to MCP-1 or RANTES a normal donor, ruling out the possibility that this effect is (Figure 4C). However, when HEK-293 cells transfected an artifact due to the use of transfected cells (Figure 4C, � Chemokine receptor heterodimerization PBMC A HEK-293 CCR2/CCR5 D 0 I' .s · l:J' o 1· s· w 0 I' :J' l:J" ____ Lyw• L____J 4-..,. L____Jl.,ypte ISl�-CCRS IIDIH:CRl llllli-ccR!i HEK-293 CCIUY139F/CCR5 AANTES MCl'-1 (0, I ,,.,) MCl'-1 (l�••O (IOnM) STATj RANlE'l(Q.l oM) □ I' S' IS' 0 I' S' ll' 0 I' j' l:J' .., -....i""'.cot..,,.,,-, 2 1.¥ .... - wl - =-- � )-sa "" anri-CCRj I 4"ait HEK -293 CCR2/CCRS PBMC RAtmlS (IOoM) MCP ,l+ RANTI'.'i (Ql •Ml Fig. 4. Heterodimerization of chemokine receptors results in recruitment of specific signaling events. (A) Serum-starved CCR2/CCR5-transfected HEK-293 cells (10 X 10 ) were used alone or treated with 10 nM MCP-1, RANTES, or a combination of both for the times indicated. Cell lysates were immunoprecipitated with anti-CCR2 (left) or anti-CCR5 antibody (center and right), and western blots were developed with anti-STAT3 antibody. As a control, an unstimulated, unprecipitated transfected HEK-293 cell lysate was analyzed in a western blot with an anti-STAT3 antibody. In each case, CCR2 or CCR5 protein loading was assessed by reprobing membranes with anti-CCR2 or -CCR5 mAb. (B) Serum-starved, CCR2bY139F/CCR5-transfected HEK-293 cells were treated with 10 nM MCP-1, 10 nM RANTES, or a combination of MCP-1 and RANTES (10 nM of each). Cell lysates were immunoprecipitated with anti-CCR2 (left) or anti-CCR5 antibody (center and right) and western blots were developed with 2+ anti-STAT5b antibody. Protein loading was controlled for as in (A). (C) Ca mobilization induced by MCP-1 (10 nM), RANTES (10 nM) or MCP-1 plus RANTES (0.1 nM of each) was determined in CCR2-and CCR5-co-transfected HEK-293 cells, and in PBMC from CCR5 wild-type donors untreated or pre-incubated with PTx. The figure depicts one representative experiment of three performed. (D) PBMC from CCR5 wild-type donors were used alone or pre-incubated with PTx, as indicated, and allowed to migrate following stimulation with MCP-1 or RANTES, added separately (10 nM each) or simultaneously (0.1 nM of each) as indicated. The migration index was calculated as described in Materials and methods. Data represent the mean of quadruplicate determinations, with the SD indicated. (E) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were used alone or treated with 10 nM MCP-1, RANTES, or a combination of both ligands for the times indicated. Cell lysates were immunoprecipitated with anti-CCR2 or anti-CCR5 antibody, and western blots developed with anti-G antibody. As a control, an unstimulated, 1 1 unprecipitated transfected HEK-293 cell lysate was analyzed in a western blot with anti-G antibody. As a protein loading control, membranes were reprobed with the immunoprecipitating antibody. right). In contrast, the synergistic migration induced by but not when the chemokines were used individually heterodimerization was sensitive to PTx (Figure 4D), (Figure 4E). This association was also observed after suggesting that although Ga is needed for chemotaxis, immunoprecipitation with the CCR5-03 antibody follow­ other factors are probably also required. ing heterodimer formation, but not in homodimers. Some studies report that the calcium response to Finally, the failure of a specific antibody to detect G chemokines is not completely blocked by PTx (not shown) prompted the conclusion that heterodimeric (Al-Aoukaty et al., 1996; Arai and Charo, 1996; Kuang CCR2-CCR5 receptors associate specifically with Gu, et al., 1996), suggesting that chemokine receptors may We conclude, therefore, that, in chemokine responses, or G , couple to multiple G proteins, such as G , G distinct pathways can be activated in the simultaneous i 8 depending on the chemokine receptor and/or the chemo­ presence of chemokines able to bind receptors susceptible kine used. A CCR2-CCR5 receptor-associated protein to heterodimerization. The implication of Gu in hetero­ 2+ distinct from G was immunoprecipitated and detected in dimer activation would explain the resistance of Ca flux western blots using an anti-G m·specific antibody when to PTx treatment and the reduction in the chemokine cells were stimulated with the MCP-1-RANTES mixture, response threshold. 2501 M.Mellado et al. • RAl"lrm: IU IIM Q MCP,1 1 0, 11 _ M □ MCP.10.. l flM MCP l+RANTES ■ RAMES lllnN A RJ.NTES .. MCP<- 1 0. 1 � L------= == - 1 I l.yiat.i 0 r w � �- D r � � aml-CCR2 Ontl-CCR3 TJ 'l' l lllf!l {mln l ., PBMC HEK-293 CCR2B/CCRS 1 .0 -,- ---,------, �--� ,- ----,- ---,-- 120 '° $: • � ": � . . OMcP-1 lOO •• "-'<TE$ O hkd l"m i lO - r,..., tmi.o> o- - ,- - -□ -. ,- C h � mn ld11 .e ( �t J Fig. 5. Chemokine receptor heterodimerization promotes specific signaling events but not receptor down-regulation. (A) Serum-starved CCR2/CCR5- transfected HEK-293 cells (10 X 10 ) were incubated for the times indicated with 0.1 nM and 10 nM RANTES, 0.1 nM and 10 nM MCP-1, or 0.1 nM of both chemokines at 37 C. Surface CCR2 or CCR5 was detected by fluorescence-activated cell sorting (FACS) analysis using biotin-labeled CCR2-03 mAb or CCRS-03 mAb, followed by streptavidin-PE; an isotype-matched mAb was used as control. Results are expressed as the percentage of maximum binding obtained in the absence of chemokines, with the SD indicated. (B) A static adhesion assay was performed using CCR2b-and CCR5-transfected HEK-293 cells (right) or PBMC from CCR5 wild-type donors (left), as described in Materials and methods. Stimuli include MCP-1 (10 nM), RANTES (10 nM), or MCP-1 plus RANTES (0.1 nM of each) for transfected cells, and 10 nM or 0.1 nM of MCP-1, RANTES, or both chemokines together for PBMC, as indicated. Results are expressed as a percentage of the maximum adhesion observed after stimulation with a mixture of RANTES plus MCP-1. The figure shows the mean ± SD of seven independent experiments. *Significantly different (p <0.05); **significantly different (p <0.01) (Student 's t-test). (C) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were incubated for the times indicated with 10 nM RANTES, 10 nM MCP-1, or 0.1 nM of each of these chemokines at 37 C. Cell lysates were immunoprecipitated with anti-CCR2 or anti-CCR5 antibody as indicated, and western blots were developed with anti-p85 antibodies (upper panel). CCR2 or CCR5 protein loading was controlled for as in Figure 4A (lower panel). (D) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were incubated for the indicated times with 10 nM RANTES, 10 nM MCP-1, or 0.1 nM of each of these chemokines combined at 37 C. Cell lysates were immunoprecipitated with anti-CCR2 or anti -CCR5 antibody, and an in vitro kinase assay was performed as indicated (Materials and methods). The mean ± SD of three independent experiments is shown. Signaling through heterodimeric chemokine and in macrophage accumulation in inflammatory pro­ receptors fails to induce receptor down -regulation cesses (Sasaki et al., 2000). Other PI3K family members and triggers cell adhesion have active roles in chemokine-mediated adhesion, To characterize the biological consequences of the specific polarization and migration (Turner et al., 1995; Vicente­ signaling pathways activated by the heterodimer in greater Manzanares et al., 1999). Stimulation with MCP-1 or detail, we analyzed whether the simultaneous presence of RANTES alone promoted rapid association of the p85 MCP-1 and RANTES modified the internalization process regulatory subunit of PI3K with CCR2 and CCR5, mediated by the individual activation of CCR2 and CCR5 respectively, reaching a maximum 5 min after activation by their respective ligands. Surprisingly, the simultaneous (Figure 5C). This association was followed by rapid presence of these chemokines at concentrations that dissociation, which was almost complete 15-30 min after 2+ trigger receptor heterodimerization and Ca mobilization stimulation. When PI3K activity was evaluated in anti­ did not promote receptor down-regulation, as measured by CCR2 and anti-CCR5 immunoprecipitates, results agreed flow cytometry (Figure 5A). with those of p85 association (Figure 5D), concurring with Leukocyte recruitment is a multistep process that earlier reports (Turner et al., 1995, 1998). In contrast, involves cell rolling, adhesion and migration (Springer, simultaneous receptor activation with both ligands did not 2+ 1994); intracellular Ca levels play an important role in promote early PI3 K activation or p85 association with the all of these steps. We therefore analyzed adhesion of chemokine receptor, but rather led to a delayed and PBMC and CCR2-CCR5-co-transfected HEK-293 cells sustained activation, with a response peak at 15-30 min using collagen type VI as substrate. Simultaneous addition (Figure 5C and D). We conclude that there is a clear of these chemokines promoted more efficient cell adhesion difference in PI3K activation by homo- or heterodimers: than did the individual chemokines alone (Figure 5B). the former is early and transient, whereas the latter is slow Other signals in addition to Ca+ are proposed to regulate but sustained. The reduction in the chemokine response lymphocyte chemotaxis. Using phosphatidyl inositol 3- threshold, the inability to trigger receptor down-regula­ kinase (PI3K)y mice, the crucial role of this kinase has tion, the resistance to PTx and the sustained PI3 K been demonstrated in neutrophil migration (Li et al., 2000) activation promoted by the heterodimers indicate 2502 Chemokine receptor heterodimerization activation of a different pathway as a consequence of The K and B opioid receptors also heterodimerize heterodimer formation. (Jordan and Devi, 1999), forming a new receptor, with ligand-binding and functional properties distinct from those of either receptor alone; this new receptor can be Discussion activated synergistically by selective ligands (Jordan and The classical view of chemoattractant receptor signaling Devi, 1999). The heterodimeric chemokine receptor also 2+ requires activation of the G protein pathway after exhibits unique features, as Pfx-independent Ca flux chemokine binding. Signaling studies have revealed indicates distinct properties. The heterodimer promotes potent, chemokine-dependent inhibition of adenylyl specific G recruitment, explaining the Pfx-resistant q1 cyclase and mobilization of intracellular calcium, consist­calcium flux, and also shows differences in PI3K activa­ ent with receptor coupling to Ga;_. We have described the tion. The fact that Pfx blocks chemotaxis triggered by physical association of Ga with CCR2, CCR5 and the combination of chemokines may be surprising. CXCR4 in response to MCP-1, RANTES and SDF-la, Nonetheless, when this fact is considered together with respectively (Mellado et al., 1998; Rodriguez-Frade et al., G 11 1 activation, it concurs with previous reports showing 1999a; Vila-Coro et al., 1999). Consistent with G that G is not required for migration (Bowman et al., i 11 q1 association, the majority of these responses are inhibited 1998; Soede et al., 2000). G is, however, probably q1 by treatment with Pfx. Prior to G activation, initiation of implicated in other effects necessary for chemotaxis, such chemokine signaling through the CCR2, CCR5 and as integrin activation, which may be mediated via RhoA CXCR4 receptors involves ligand-triggered receptor (Katoh et al., 1998). It has also been shown that dimerization that enables activation of the JAK signaling chemokines can couple to more than one G protein pathway and chemokine-mediated STAT activation (Al-Aoukaty et al., 1996; Maghazachi, 1999), as has been (Wong and Fish, 1998; Mellado et al., 2001). reported for other GPCRs (Daaka et al., 1997; Luo et al., Here we show that simultaneous stimulation with 1999). Regulator of G-protein signaling (RGS) family MCP-1 and RANTES induces the formation of CCR2- members may also be involved in this process, as RGS CCR5 heterodimers. Compatible with this, the CCR2b­ proteins regulate cellular migratory and pro-adhesive Y139F mutant, which acts as dominant negative, blocking responses to chemoattractants (Bowman et al., 1998), a wild-type CCR2 (Rodriguez-Frade et al., 1999b), also fact related to the selectivity of RGS for G or G (Carman impairs CCR5 signaling through the formation of non­ et al., 1999). Both signals have an important role in the functional heterodimers. To our knowledge, this is the first sequential steps leading to leukocyte recruitment, includ­ case in which mutations in one chemokine receptor affect, ing cell rolling, adhesion and migration (Springer, 1994). in trans, the response to a ligand acting on a distinct, The crucial role of PI3Ky in neutrophil migration (Li et al, non-cross-reactive receptor. These results increase the 2000) and in the accumulation of macrophages in inflam­ complexity of chemokine response biology, as the simul­ matory processes has recently been shown (Sasaki et al, taneous presence of more than one chemokine may cause 2000). Although it appears that neutrophils from PI3Ky synergistic responses or, quite the opposite, suppress mice adhere to fibronectin-coated surfaces (Sasaki et al, +t physiological effects in the response to unrelated chemo­ 2000) as tightly as do PI3Ky - cells, suggesting that kines. This is in accordance with the fact that hetero­ decreased chemotaxis is due to impaired motility and dimerization probably occurs efficiently only between not to altered adhesion, it is known that other PI3K certain pairs of chemokine receptors. The implications of family members regulate cell adhesion and polarization this finding may be important in understanding the role of (Sanchez-Madrid et al., 1999). PI3Ky activation after chemokines in inflammation or as suppressors of human chemokine stimulation nonetheless occurs very rapidly, immunodeficiency virus (HlV)-1 infection, to mention just and is activated in vitro directly by G protein �y subunits two cases in which these molecules arouse interest (Cairns (Toker and Cantley, 1997). It is plausible, therefore, that and D' Souza, 1998; Lee et al., 1998; Littman, 1998; under our experimental conditions we were detecting Berger et al., 1999). activation not of this particular PI3K isoform, but rather of The response to GABA requires heterodimerization of other classical PI3K family members. We observed its two receptors (Kaupmann et al., 1998; White et al., association with the receptor after both homo- and 1998; Kuner et al., 1999). Physical interaction between heterodimer activation of the p85 regulatory subunit of GBR l and GBR2 seems to be essential for the coupling of PI3 K class la (not shown). In any case, the differences GABA receptors to G protein-coupled inwardly rectifying between homo- and heterodimers affect mainly a second, potassium channels, and for subsequent modulation of delayed wave of PI3K activity, and may be related to neurotransmission. GABA receptor dimerization appears differences in cell adhesion. The heterodimer receptor also to take place between the intracellular C-termini, probably promotes a reduction in the chemokine response threshold. through conserved coiled-coil domains, although other Increased sensitivity of hetero- compared with homo­ receptor regions may also intervene. The results presented dimers is also reported in the opioid response, in which the here, together with those showing the ability of CXCR4 to K-B heterodimer synergistically binds highly selective dimerize with the CCR2V64I mutant but not with wild­ agonists and potentiates biological responses (Jordan and type CCR2 (Mellado et al., 1999), suggest that V64, a Devi, 1999). residue located in the transmembrane I domain, is critical In chemotaxis in bacteria, the chemotactic receptors for dimer stabilization. It is also known that some GPCRs form higher-order complexes, thought to be important for may dimerize using transmembrane domains; for example, diversification of biological responses (Bray et al., 1998; dimerization of the �-adrenergic receptor involves trans­ Alon et al., 1999). We have shown that chemotactic membrane domain VI (Hebert et al, 1996). responses in leukocytes are also achieved by adaptive 2503 M.Mellado et al. or the chemokines produced would thus dramatically affect the ability of a chemokine to interact with a receptor. At low chemokine concentrations, receptor heterodimer­ ization would be favored, and so cell adhesion would be triggered and leukocyte rolling stopped. Under these conditions, following leukocyte migration into tissues, heterodimers would preferentially favor 'parking' of leukocytes (Figure 6). The sum of these findings may help understand the molecular mechanisms involved in chemokine receptor signaling desensitization through heterologous chemokines, as well as the mechanisms that regulate cell migration during immune and inflam­ matory responses. One selective advantage of receptor homo- or heterodimerization lies in the augmented sensi­ tivity of the system, such that chemokine responses increase with the spread of activity through a receptor array, illustrated by the abundance of chemokine receptors expressed on cell surfaces. Finally, chemokine receptors are critical in the control of inflammatory responses, and so are potential targets for the treatment of chronic disease (Broxmeyer et al., 1993) . I V. P. RKI Through these receptors, cells sense attractants over a LOW c: hcrnokmc ,n �c n lrul mn • concentration range of several orders of magnitude, raising H ETERODI M R anew the unsolved question as to how chemotactic responses achieve their combination of sensitivity and dynamic range. The results provided here may help to resolve this conundrum. Fig. 6. The physiological role of chemokine receptor dimerization. Leukocytes roll along the blood vessel endothelium (I) ; exposure to Materials and methods low chemokine concentrations causes the formation of chemokine receptor heterodimers and the cell adheres to the endothelium (II). Biological material s, proteins and antibod ies The inflammatory response produces higher chemokine concentrations, HEK-293 cells (ATCC TIB202) were from the American Type Culture triggering receptor homodimerization; this induces cell migration Collection (Manassas, VA). mAbs against CCR2, CCR5 and CXCR4 through the endothelium to inflammation sites (III), where low were generated in our laboratory (Mellado et al., 1998; Rodriguez-Frade chemokine concentrations favor heterodimerization, leading the et al., 1999a; Vila-Coro et al., 1999). MCP-1, RANTES and SDF- la cell to adhere ('park') in the tissues (IV). were from Peprotech (London, UK). Antibodies against STAT3 and G<Xqt were from Santa Cruz Biotech (Santa Cruz, CA), while that against PI3-kinase p85 was from Upstate Biotech (Lake Placid, NY). receptor clustering (Rodriguez-Frade et al., 1999a,b; mAbs against human CD3, CD14 and CD19 were from Immunotech Vila-Coro et al., 1999). One implication of receptor (Marseille, France). clustering as a consequence of chemotactic responses is that the activity of one receptor would influence that of its PBMC Freshly isolated whole blood from healthy donors, CCR5 homozygotes neighbors, such that a ligand could act in trans on a and the CCR5�32 homozygote was obtained in citrate buffer. Blood at receptor for which it is not specific. In this manner, the room temperature (RT) was added to Accuspin tubes (Sigma) and bound ligand induces changes in receptor signaling centrifuged (700 g for 15 min). The PBMC band was collected and activity, which are propagated to a large number of washed twice (220 g for 10 min at RT) and three times (100 g for 10 min neighboring receptors, amplifying the effect of a binding at RT) with Dulbecco 's phosphate-buffered saline (PBS), resulting in a + + + population containing 65-75% CD3 , 15-20% CD14 and 5-15% c019 event. In other words, chemokine binding triggers receptor cells. clustering that adapts to external stimuli. As shown here and previously (Rodriguez-Frade et al., 1999a,b; Flow cytometric analysis Vila-Coro et al., 1999), ligand binding causes aggregation Cells were centrifuged (250 g for 10 min at RT), plated in V-bottomed 96- well plates (2.5 X 10 cells/well) and incubated with 50 µ1/well biotin­ of chemokine receptors, allowing tyrosine phosphoryl­ labeled mAb (5 µg/ml for 30 min at 4 C). Cells were washed twice in PBS ation of cytoplasmic domains, recruitment of JAK tyrosine with 2% bovine serum albumin (BSA) and 2% fetal calf serum (FCS) and kinases and ST AT transcription factors, and downstream centrifuged (250 for 5 min at 4 C). Fluorescein isothiocyanate-labeled signal transmission. Here we broaden this to include streptavidin (Southern Biotechnologies, Birmingham, AL) was added, the receptor heterodimers as complexes able to mediate mixture was incubated (30 min at 4 C) and plates were washed twice. Cell-bound fluorescence was measured at 525 nm in a Profile XL flow activities different from those governed by homodimers. cytometer (Coulter, Miami, FL). Chemokine receptor expression was Receptor sensitivity can be regulated by the formation assessed by flow cytometry and quantified using a modification of the of signaling domain complexes dictated qualitatively by Dako Qifikit (Dako, Glostrup, Denmark), as described (Poncelet and chemokine availability. Chemokines are produced within Lavabre-Bertrand, 1993). specific tissues and immobilized by low-affinity binding to Calcium determination heparin-bearing proteoglycans on the vascular endothelial Cells (2.5 X 10 cells/ml) were resuspended in RPMI containing 10% barrier (Rollins, 1997); this would permit effective FCS and 10 mM HEPES, and incubated with Fluo-3 (Calbiochem; chemokine presentation to the rolling leukocytes. Varia­ 6 300 µM in dimethylsulfoxide, 10 µ1/10 cells, 30 min, 37 C). Cells were tions in the availability of these presentation molecules then washed, resuspended in RPMI containing 2 mM CaCI and 2504 Chemokine receptor heterodimerization maintained at 4 C before adding MCP-1, RANTES or SDF- la. Calcium Pl3 kinase assay flux was measured at 525 nm in an EPICS XL flow cytometer (Coulter). CCR2 or CCRS immunoprecipitates were washed twice with lysis buffer, When PTx pre-treatment was required, cells were incubated in culture and twice with 50 mM Tris-HCl pH 7 .4/100 µM EDTA before incubating medium with 0.1 µg/ml PTx (Sigma, St Louis, MO) overnight at 37 C. with phosphatidyl inositol (PI) in reaction buffer (25 mM MgCh, 2 + 32 After washing, cells were resuspended and Ca flux determined as above. 20 µM ATP, 50 mM Tris-HCI pH 7.4, 10 µCi [y-P]ATP) (Amersham For PBMC analysis, cells were loaded as before and calcium response Pharmacia) for 10 min at room temperature. The phosphorylation reaction evaluated separately in monocytes and lymphocytes. In this case, when was terminated by adding 1 M HCl, and lipids were extracted with PTx pre-treatment was required, cells were incubated (2 h at 37 C) in CHCI 'methanol. Radiolabeled lipids were resolved by thin-layer culture medium with 0.1 µg/ml PTx. chromatography and radioactivity was analyzed with a GS-525 Molecular Imager System (Bio-Rad, Hercules, CA) with Molecular Analyst v. 2.2 software. Transfection HEK-293 cells, which constitutively express the CXCR4 receptor, were Static adhesion assays co-transfected with CCR2, CCR2b Y139F or CCRS constructs by calcium Circles (0.5 cm diameter) were drawn on a glass slide using a wax pen phosphate precipitation (Mellado et al., 1998; Rodriguez-Frade et al., (Dako) and coated with human collagen type VI (Sigma) at 20 µg/ml in 1999b ). Transfected cells were selected in G-418 (Calbiochem) and 50 µI of endotoxin-free PBS (Gibco-BRL). As a negative control, 100% analyzed by flow cytometry for receptor expression using antibodies FCS was employed. After overnight incubation at 4 C, slides were against CCR2, -CCRS and -CXCR4. washed three times in Dulbecco 's PBS and blocked for 1 hat 37 C with 100% FCS. HEK-293 CCR2/CCR5 transfectants were added (0.4 X 10 Cell migration cells/ml in 50 µI), together with the indicated chemokines at a final Migration of HEK-293 cells stably transfected with CCR2/CCR5 or concentration of 1 nM. After incubation (3 min at 37 C), slides were CCR2bY139F/CCR5 was studied in a 96-well microchamber washed by dipping once in PBS to remove non-adherent cells, and bound (NeuroProbe Inc., Gaithersburg, MD). Chemokines at several concentra­ cells were fixed in 1.5% glutaraldehyde/PBS. Data are expressed as the tions were loaded in lower wells (30 µl/well), and cells (200 µl/well, percentage of the maximum number of adherent cells counted in three 3 X 10 cells/ml) were loaded in upper wells. Polyvinylpyrrolidone-free random microscope fields/circle. filters with 10 µm pores (NeuroProbe) were pre-coated for 2 hat 37 with 20 µg/ml type VI collagen (Sigma). The chamber was incubated Cell adhesion assays (37 C, 5% CO ) for 5 h, after which filters were removed and the cells in Flat-bottomed 96-well assay plates (Maxisorb, Nunc) were coated with the upper part wiped off. The cells present in the filters were fixed and 20 µg/ml collagen VI (Sigma) and blocked with 2% BSA. Freshly stained with crystal violet (0.5% crystal violet, 20% methanol). Blue isolated PBMC were labeled with BCECF-AM [2',7'-bis-(2-carboxy­ spots developed at positions at which cell migration had occurred, ethyl)-5- (and -6)-carbofluorescein, acetoxymethyl ester; Molecular allowing densitometric quantification of migration (National Institutes of Probes, Eugene, OR] as described (Sanz-Rodriguez et al., 2001), and Health Image software). The migration index was calculated by mean added in triplicate to the plate (10 cells/well). Plates were centrifuged at spot intensity. 30 for 15 s and incubated at 37 C for 6 min, and unbound cells were For analysis of PBMC migration, cells (0.25 X 10 cells in 0.1 ml) removed by three washes with Dulbecco 's modified Eagle's medium. were placed in the upper well of 24-well transmigration chambers (5 µm Bound cells were quantified using a fluorescent analyzer (Cytofluor 2300; pore size; Transwell; Costar Corp., Cambridge, MA) pre-coated for 2 h at Millipore, Bedford, MA). 37 C with 20 µg/ml type VI collagen (Sigma), and 0.1-10 nM MCP-1 (in 0.6 ml RPMI containing 0.25% BSA) was added to the lower well. Plates PCR reaction analysis of genomic DNA were incubated at 37 C for 120 min and cells that had migrated to the Genomic DNA was isolated from PBMC of selected donors using an Easy lower chamber were counted. Cell migration was calculated as the x-fold DNA kit (lnvitrogen). Upstream and downstream oligonucleotide primers increase in migration observed over the medium control. To block ligand­ used to amplify the CCRS gene corresponded to the second extracellular induced chemotaxis, cells (2.5 X 10 cells/ml) were first incubated for region; the sequences of the 5'- and 3' primers were CCTGGCTGT­ 30 min at 37 C with anti-CCR2, anti-CCRS or isotype-matched control CGTCCATGCTG and CAAGCAGCGGCAGGACCAGC, respectively. mAbs (50 µg/ml). Using this primer set, the wild-type CCRS allele gives rise to a 245 bp PCR fragment, whereas the deleted allele gives a 213 bp fragment. For each PCR (100 µI), 1 µg of genomic of DNA was denatured at 95 C for lmmunoprecipitation, SOS-PA GE and western blotting ° ° 5 min, and amplified by five PCR cycles (94 C for 45 s; 55 C for 45 s; Serum-starved cells (10 X 10 ) were lysed in a detergent buffer (20 mM ° ° ° 72 C for 45 s), followed by 35 additional cycles (94 C for 45 s; 63 C for triethanolamine pH 8.0, 300 mM NaCl, 2 mM EDTA, 20% glycerol, 1 % 45 s; 72 C for 30 s). The reaction products (25 µI) were run on 3% digitonin, with 10 µM sodium orthovanadate, 10 µg/ml leupeptin and Nusieve GTG agarose gel and DNA bands were stained by ethidium 10 µg/ml aprotinin) for 30 min at 4 C with continuous rocking, then bromide. In addition, CCRS PCR fragments were subcloned and centrifuged (15 000 for 15 min at 4 C) (Mellado et al., 1998). For sequenced automatically. immunoprecipitation, protein extracts that had been cleared by incubation with anti-mouse IgG-or anti-mouse IgM-agarose (Sigma; 10 µg for ° ° 60 min at 4 C) were centrifuged (15 000 for 1 min at 4 C) and Acknowledgements immunoprecipitated with the appropriate antibody (5 µg/sample for 120 min at 4 C), followed by anti-mouse IgG- or IgM-agarose (20 µg for We would like to thank Drs J.B.Stock, S.O' Brien and L.Birnbaumer for 60 min at 4 C). Immunoprecipitates or protein extracts were separated by reading the manuscript. We also thank Drs J.Stein and J.Teixid6 for help SDS-PAGE and transferred to nitrocellulose membranes. Western blot with adhesion experiments, M.C.Moreno and Dr I.Lopez for help with analysis was as described, using 5% non-fat dry milk in Tris-buffered flow cytometry, and C.Bastos and C.Mark for secretarial and editorial saline (TBS) as a blocking agent (Mellado et al., 1998). Membranes were assistance, respectively. This work was partially supported by grants from stripped using 62.5 mM Tris-HCl pH 7.8, containing 2% SDS and 0.5% Spanish National Plan for Scientific Development/FEDER EU and the �-mercaptoethanol (60 min, 60 C), washed with 0.1 % Tween-20 in TBS Comunidad de Madrid. The Department of Immunology and Oncology for 2 h, reblocked, reprobed and developed as above. In all cases, was founded and is supported by the Spanish National Research Council protein loading was controlled using a protein detection kit (Pierce, (CSIC) and the Pharmacia Corporation. Rockford, IL). Cross-linking References Serum-starved HEK-293 cells co-transfected with chemokine receptors (10 X 10 ) were stimulated with the indicated chemokines. The reaction Al-Aoukaty,A., Schall,T.J. and Maghazachi,A.A. (1996) Differential was terminated by adding 1 ml of cold PBS and centrifuged (250 for coupling of CC chemokine receptors to multiple heterotrimeric 10 min ). After washing twice with cold PBS, 10 µI of 100 mM DSS G proteins in human interleukin 2-activated natural killer cells. (Pierce) were added for 10 min at 4 C with continuous rocking Blood, 87, 4255-4260. (Rodriguez-Frade et al., 1999b). The reaction was terminated by adding Alon,U., Surette,M.G., Barkai,N. and Leibler,S. (1999) Robustness in 1 ml of cold PBS, centrifuged (15 000 g for 60 s) and then washed three bacterial chemotaxis. Nature, 397, 168-171. times. The pellet was lysed and immunoprecipitated as above. Aragay,A., Frade,J.M.R., Mellado,M., Serrano,A., Martinez-A.,C. and 2505 M.Mellado et al. Mayor,F.,Jr (1998) MCP-1-induced CCR2B receptor desensitization Mumby,S.M. and Muallem,S. (1999) Alternate coupling of receptors by the G protein-coupled receptor kinase-2. Proc. Natl Acad. Sci. to G, and G; in pancreatic and submandibular gland cells. J. Biol. USA , 95, 2985-2990. Chem., 274, 17684-17690. Arai,H. and Charo,I.F. (1996) Differential regulation of G-protein Maghazach i,A.A. (1999) Intracellular signaling pathways induced by mediated signaling by chemokine receptors. J. Biol. Chem. , 271, chemokines in natural killer cells. Cell. Si g nal., 11, 385-390. 21814-21819. Mellad o,M., Rodriguez-Frad e,J.M., Araga y,A.M., del Real,G., Baggiolini,M. (1998) Chemokines and leukocyte traffic. Nature, 392, Vila-Cor o,A.J., Martin de Ana,A.M., Serran o,A., Mayor,F.,Jr and 565-568. Martinez-A.,C. (1998) The chemokine MCP-1 triggers tyrosine Bai,M., Trivedi,S. and Brown, E.M. (1998) Dimerization of the phosphorylation of the CCR2B receptor and the JAK2/STAT3 extracellular calcium-sensing receptor (CaR) on the cell surface of pathway. J. Imm unol., 161, 805-813. CaR-transfected HEK293 cells. J. Biol. Ch em. , 273, 23605-23610. Mellado ,M., Rodriguez-Frad e,J.M., Vila-Coro ,A.J., Martin de Ana,A.M. Benkiran e,M., Jin,D-Y., Chun,R.F., Koup, R.A. and Jeang,K-T. (1997) and Martinez-A .,C. (1999) Chemokine control of HIV-1 infection. Mechanism of transdominant inhibition of CCR5-mediated HIV-1 Nature, 400, 273-274. infection by ccr5.ii32. J. Biol. Chem. , 272, 30603-30606. Mellado,M. Rodriguez-Frad e,J. M., Mafies,S. and Martinez-A .,C. (2001) Berge r,E.A., Murphy,P.M. and Farber, J.M. (1999) Chemokine receptors Chemokine signaling and functional responses: the role of receptor as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. dimerization and TK pathway activation. Annu. Rev. Imm unol., 19, Rev. Im munol., 17, 657-700. 397-421. Bockaert,J. and Pin,J.P. (1999) Molecular tinkering of G protein-coupled Poncelet,P.G. and Lavabre-Bertrand,T. (1993) Immunological detection receptors: an evolutionary success. EMB O J. , 18, 1723-1729. of membrane-bound antigens and receptors. In Masseyeff ,R.F., Bowma n,E.P., Carnpbe ll,J.J., Druey, K.M., Scheschonk a,A., Kehrl,J.H. Albert,W.H. and Staine s,N.A. (eds), Methods of Im munolo g ical and Butcher, E.C. (1998) Regulation of chemotactic and proadhesive Analysis. VCH, Weinheim, Germany, pp. 388-418. responses to chemoattractant receptors by RGS (regulator of G-protein Premack, B.A. and Schall, T.J. (1996) Chemokine receptors: gateways to signaling) family members. J. Biol. Chem. , 273, 28040-28048. inflammation and infection. Nature Med. , 2, 1174-117 8. Bray,D., Levin, M.D. and Morton-Fir th,C.J. (1998) Receptor clustering Rodriguez-Frad e, J.M., Vila-Cor o,A.J., Martin de Ana,A.M., Nieto,M., as a cellular mechanism to control sensitivity. Nature, 393, 85-8 8. Sanchez-Madrid,F., Proudfoo t,A.E.I., Well s,T.N.C., Martinez-A .,C. Broxmeye r,H.E., Sherry, B., Cooper,S., Lu,L., Maze, R.R., Beckmann, and Mellado,M. (1999a) Similarities and differences in RANTES­ M.P., Cerami,A. and Ralph,P. (1993) Comparative analysis of the and (AOP)-RANTES-triggered signals: implications for chemotaxis. human macrophage inflammatory protein fam ily of cytokines J. Cell Biol., 144, 755-765. (chemokines) on proliferation of human myeloid progenitor cells. Rodriguez-Frad e, J.M., Vila-Cor o,A., Martin de Ana,A.M., Albar,J .P., J. Im munol., 150, 3448-3458. Martinez-A .,C. and Mellado,M. (1999b) The chemokine monocyte Cairns,J.S. and D' Souza,M.P. (1998) Chemokines and HIV-1 second chemoattractant protein- I induces functional responses through receptors: the therapeutic connection. Nature Med. , 4, 563-56 8. dimerization of its receptor CCR2. Proc. Natl Acad. Sci. USA , 96, Carman, C.V., Parent,J.-L., Day,P.W., Proni n,A.N., Stemwei s,P.M., 3628-3633. Wedegaertner, P.B., Gilma n,A.G., Benovic,J.L. and Kozasa,T. (1999) Rollin s,B.J. (1997) Chemokines. Blood, 90, 909-928. Selective regulation of G<Xq by an RGS domain in the G protein­ /11 Romano,C., Yang,W.L. and O'Malley,K.L. (1996) Metabotropic coupled receptor kinase, GRK2. J. Biol. Ch em. , 274, 34483-34492. glutamate receptor 5 is a disulfide-linked dimer. J. Biol. Ch em. , 271, Cve jic,S. and Devi,L.A. (1997) Dimerization of the Ii opioid receptor: 28612-28616. implication for a role in receptor internalization. J. Biol. Chem., 272, Rossi,D. and Zlotnik,A. (2000) The biology of chemokines and their 26959-26964. receptors. Annu. Rev. Imm unol., 18, 217-242. Daaka,Y., Luttrell,L.M. and Lefkowit z,R.J. (1997) Switching of the Sanchez-Madrid,F. and del Pozo,M.A. (1999) Leukocyte polarization in coupling of the � -adrenergic receptor to different G proteins by cell migration and immune interactions. EMB O J., 18, 501-511. protein kinase A. Nature, 390, 88-91. Sanz-Rodriguez,F., Hidalgo,A. and Teixid6,J. (2001) Chemokine Heber t,T.E., Moffett ,S., Morell o,J.-P., Loisel, T.P., Bichet, D.G., stromal cell-derived factor- la modulates VLA-4 integrin-mediated Barret,C. and Bouvier,M. (1996) A peptide derived from a �z­ multiple myeloma cell adhesion to CS-1/fibronectin and VCAM-1. adrenergic receptor transmembrane inhibits both receptor dimerization Blood, 97, 346-351. and activation. J. Biol. Chem. , 271, 16384-16392. Sasaki,T. et al. (2000) Function of PI3Ky in thymocyte development, T Heber t,T.E., Loise l,T.P., Adam,L., Ethie r,N., Onge,S.S. and Bouvier,M. cell activation, and neutrophil migration. Science, 287, 1040-1046. (1998) Functional rescue of a constitutively desensitized �2AR Soede ,R.D.M., Wijnand s,Y.M., Kamp,M., van der Valk,M.A. and through receptor dimerization. Biochem. J., 330, 287-293. Roos,E. (2000) G; and G /11 proteins are involved in dissemination Johnsto n,B., Bums, A.R., Suematsu,M., Issekut z,T.B., Woodman ,R.C. of myeloid leukemia cells to the liver and spleen, whereas bone and Kubes,P. (1999) Chronic inflammation upregulates chemokine marrow colonization involves G but not G;. Blood, 96, 691-69 8. q1 receptors and induces neutrophil migration to monocyte Springe r,T.A. (1994) Traffic signals for lymphocyte recirculation and chemoattractant protein- I. J. Clin. Invest. , 103, 1269-1276. leukocyte emigration: the multistep paradigm. Cell, 76, 301-314. Jorda n,B.A. and Devi,L.A. (1999) G-protein-coupled receptor Toker,A. and Cantley,L.C. (1997) Signalling through the lipid products heterodimerization modulates receptor function. Nature, 399, of phosphoinositide-3-OH kinase. Nature, 387, 673-676. 697-700. Tume r,L., Ward,S.G. and Westwick,J. (1995) RANTES-activated Katoh,H., Aoki,J., Yamaguchi, Y., Kitano,Y., Ichikawa,A. and human T lymphocytes: a role for phosphoinositide 3-kinase. Negishi,M. (1998) Constitutively active Ga2, Gcx , and G<Xq 1 13 J. Im munol., 155, 2437-2444. induce Rho-dependent neurite retraction through different signaling Tume r,S.J., Domin,J., Waterfield, M.D., Ward,S.G. and Westwick,J. pathways. J. Biol. Chem. , 273, 28700-28707. (1998) The CC chemokine monocyte chemotactic peptide-I activates Kaupmann,K. et al. (1998) GABA -receptor subtypes assemble into both the class Y p85/pl 10 phosphatidylinositol 3-kinase and the class functional heteromeric complexes. Nature, 396, 683-687. II PI3K-C2cx. J. Biol. Chem. , 273, 25987-25995. Kuang, Y., Wu,Y., Jiang,H. and Wu,D. (1996) Selective G protein Vicente-Manzanares,M. et al. (1999) Involvement of phosphatidyl­ coupling by C-C chemokine receptors. J. Biol. Chem. , 271, inositol 3-kinase in stromal cell-derived fa ctor- la -induced 3975-397 8. lymphocyte polarization and chemotaxis. J. Imm unol., 163, Kuner,R., Kohr,G., Griinewal d,S., Eisenhardt,G., Bah,A. and Komau, 4001-4012. H.-C. (1999) Role of heteromer formation in GABA receptor Vila-Cor o,A.J., Rodriguez-Fra de,J.M., Martfn de Ana ,A.M., function. Science, 283, 74-77. Moreno-Ortf z, M.C., Martinez -A.,C. and Mellado,M. (1999) The Lee,B. et al. (1998) Influence of the CCR2-V64I polymorphism on chemokine SDF- lcx triggers CXCR4 receptor dimerization and HIV-1 coreceptor activity and chemokine receptor function of CCR2b, activates the JAK/STAT pathway. FA SEB J., 13, 1699-1710. CCR3, CCR5 and CXCR4. J. Vir al. , 72, 7450- 7458. Li,Z., Jiang,H., Xie,W., Zhang,Z., Smrcka, A.V. and Wu,D. (2000) Roles White,J .H. et al. (1998) Heterodimerization is required for the formation of PLC-�2 and -�3 and PI3Ky in chemoattractant-mediated signal of a functional GABA receptor. Nature, 396, 679-682. transduction. Science, 287, 1046-1049. Wolf ,M., Delgado,M .B., Jones, S.A., Dewal d,B., Clark-Lewis,I. and Littma n,D.R. (1998) Chemokine receptors: keys to AIDS pathogenesis. Baggiolini,M. (1998) Granulocyte chemotactic protein 2 acts via Cell, 93, 677-680. both IL-8 receptors CXCRl and CXCR2. Eur. J. Imm unol., 28, Luo,X., Zeng,W., Xu,X., Popov,S., Davignon,!., Wilkie, T.M., 164-170. 2506 Chemokine receptor heterodimerization Wong,M. and Fish,E.N. (1998) RANTES and MIP-la activate stats in T cells. J. Biol. Chem. , 273, 309-314. Wuyts,A., Van Osselaer,N., Haelens,A., Samson,Y., Herdewijn,P., Ben-Baruch,A., Oppenheim,J.J., Proost,P. and Van Damme,J. (1997) Characterization of synthetic human granulocyte chemotactic protein 2: usage of chemokine receptors CXCRl and CXCR2 and in vivo inflammatory properties. Biochemistry, 36, 2716--2723. Zeng,F.Y. and Wess,J. (1999) Identification and molecular characterization of m3 muscarinic receptor dimers. J. Biol. Chem., 274, 19487-19497. Received January 18, 2001; revised March 20, 2001; accepted March 22, 2001 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Chemokine receptor homo‐ or heterodimerization activates distinct signaling pathways

Download PDF
11 pages

Loading next page...
 
/lp/springer-journals/chemokine-receptor-homo-or-heterodimerization-activates-distinct-KfaeX6wZ0H

References (67)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 2001
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1093/emboj/20.10.2497
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal Vol. 20 No.10 pp. 2497-2507, 2001 Chemokine receptor homo- or heterodimerization activates distinct signaling pathways and a cytoplasmic C-terminal domain. The N-terminus Mario Mellado, Jose Miguel Rodriguez-Frade, and the extracellular domains have been implicated in Antonio J.Vila-Coro, Silvia Fernandez, receptor-ligand interaction, whereas the C-terminus and Ana Martin de Ana, David R.Jones, the intracellular domains cooperate to bind and activate Jose L.Toran and Carlos Martinez-A the G proteins (Bockaert and Pin, 1999). Department of Immunology and Oncology, Centro Nacional de After binding to their specific receptors, and as occurs Biotecnologfa/CSIC, Universidad Aut6noma de Madrid, for other GPCRs (Hebert et al., 1996; Romano et al., 1996; Campus de Cantoblanco, E-28049 Madrid, Spain Cvejic et al., 1997; Bai et al., 1998; Zeng et al., 1999), Corresponding author chemokines induce receptor homodimerization and sub­ e-mail: [email protected] sequently activate the receptor-associated JAK kinase, possibly by transphosphorylation on tyrosine residues Chemokine receptors of both the CC and CXC (Mellado et al., 2001). This may create Src homology 2 families have been demonstrated to undergo a ligand­ (SH2) docking sites, leading to the recruitment of ST AT mediated homodimerization process required for (signal transducers and activators of transcription) tran­ l+ Ca flux and chemotaxis. We show that, in the chemo­ scription factors. The highly conserved Tyr present in the kine response, heterodimerization is also permitted DRY motif is a primary target for chemokine receptor between given receptor pairs, specifically between phosphorylation; a Tyr-to-Phe mutation impairs G;-medi­ CCR2 and CCR5. This has functional consequences, 2+ ated Ca flux triggered by chemokine binding, as well as as the CCR2 and CCR5 ligands monocyte chemotactic G; association with the chemokine receptor (Mellado et al., protein-1 (MCP-1) and RANTES (!egulated upon 1998). This mutant form of the receptor behaves as a !!Ctivation, !!Ormal I cell-�xpressed and �ecreted) dominant negative, since co-transfection with wild-type cooperate to trigger calcium responses at concentra­ receptor impairs its function (Rodrfguez-Frade et al., tions 10- to 100-fold lower than the threshold for 1999b). In another member of the seven-transmembrane­ either chemokine alone. Heterodimerization results in domain receptor family, it has been demonstrated that the recruitment of each receptor-associated signaling response to y-aminobutyrate (GABA) requires hetero­ complex, but also recruits dissimilar signaling path­ dimerization of the GABA receptor type 1 (GBRl) and ways such as G association, and delays activation q1 GBR2 receptors (Kaupmann et al., 1998; White et al., of phosphatidyl inositol 3-kinase. The consequences 1998; Kuner et al., 1999), as physical interaction between l+ are a pertussis toxin-resistant Ca flux and trig­ GBRl and GBR2 appears to be essential for the activation gering of cell adhesion rather than chemotaxis. These of potassium channels. Another group of GPCRs, the results show the effect of heterodimer formation on opioid receptors, undergoes heterodimerization (Jordan increasing the sensitivity and dynamic range of the and Devi, 1999). In this case, there is clear biochemical chemokine response, and may aid in understanding and pharmacological evidence for the heterodimeriza­ the dynamics of leukocytes at limiting chemokine tion of two functional opioid receptors, ic and 6. concentrations in vivo. Heterodimerization of these receptors causes synergistic Keywords: chemokine receptor/dimerization/G proteins/ agonist binding and potentiates the biological signal, yet phosphatidyl inositol 3-kinase there are no biochemical data to explain this phenomenon. A polymorphism reported for the CCR2 receptor, in which Val64 is replaced by Ile (CCR2V64I) and which Introduction occurs at an allelic frequency of 10-25%, is associated The chemokines are a family of pro-inflammatory cyto­ with a 2-4 year delay in progression to acquired kines that attract and activate specific leukocyte types immunodeficiency sydrome (AIDS) (Lee et al., 1998). (Baggiolini, 1998). Based on the position of the first two Relatively few viral strains are reported to use CCR2 in canonical cysteine residues and the chromosomal location conjunction with CD4 to infect cells (Premack and Schall, of the corresponding genes, two main chemokine 1996; Berger et al., 1999); we have shown that the families have been identified: CC and CXC (Rollins, mechanism underlying this protective effect may be the 1997; Baggiolini, 1998). They act on monocytes, lympho­ ability of the CCR2V64I mutant receptor to heterodimer­ cytes, natural killer (NK) cells, basophils, eosinophils and ize with CCR5 and/or CXCR4 (Mellado et al., 1999). neutrophils (Rossi and Zlotnick, 2000). Chemokines The majority of chemokine receptors bind more than mediate their effects via interactions with seven-trans­ one chemokine; in addition, most cell types express membrane-domain glycoprotein receptors coupled to a multiple chemokine receptors, so that if one ligand or G protein signaling pathway (G-protein-coupled receptors receptor is defective, an alternative set of chemokines and or GPCRs). This type of receptor consists of a single their receptors can carry out the biological function polypeptide chain with an extracellular N-terminal domain (Wuyts et al., 1997; Wolf et al., 1998; Johnston et al., © European Molecular Biology Organization 2497 M.Mellado et al. 1999). Although in vitro studies show overlapping func­ HEK-293 CCR2b/CCRS tions for several chemokines, their in vivo expression and function appear to be finely controlled. Three mechanisms can be conceived to participate in this control: (i) chemo­ kine or chemokine receptor availability; (ii) ligand­ receptor interaction; and (iii) the signal transduction mechanism activated by the chemokine receptor. Here we examine the dynamic interactions between chemokines and cell surface chemokine receptors, and analyze how the presence of several chemokine receptors regulates the response to a specific chemokine. Our results provide 1 00 ■ 0. 1..M biochemical and functional evidence for CCR2 and CCR5 01.0nM receptor heterodimerization. These heterodimers are more D IOaM !lO efficient at inducing biological responses, illustrated by the .. 10- to 100- fold lower chemokine concentration required to # trigger these responses. This increase occurs via the synergistic interaction of several signaling complexes M0' -1 iwm:s 1Wff£$ recruited by each individual receptor. Furthermore, MCP-1 receptor heterodimerization associates specific signaling M,(kllo) -' pathways, such as recruitment of G , a G protein �'.:..J----:-:---=:::--=--, - l ll.S _r- � :=:: :'o"=:;:,,:;;:':"' --, - 101 insensitive to pertussis toxin (PTx). Heterodimeric chemo­ - 69 kine receptor interaction may have implications in under­ standing the in vivo processes that hinder leukocyte rolling on blood vessels and induce leukocyte parking in tissues during inflammatory responses. Ll lOl" 6 1 1 3 4 }6 +tisS '----- -�L...J L------' L...J CCltl =-ll'f'- cau cau Results The simultaneous presence of chemokines 3 MCP -1 6 medium triggers a synergistic response mediated by heterodimerization of their receptors Fig. 1. Simultaneous MCP-1 and RANTES co-activation of CCR2- and Using human embryonic kidney (HEK)-293 cells co­ CCRS-expressing cells increases sensitivity of chemokine responses transfected with CCR2b and CCR5 receptors, we evalu­ and promotes their heterodirnerization. (A) CCR2b/CCR5 double­ ated the potential of these chemokine receptors to induce transfected HEK-293 cells were incubated with biotin-labeled mAbs functional responses following stimulation with a com­ against CCR2 and CCRS or their respective isotype-matched control 2+ mAbs, followed by isothiocyanate-labeled streptavidin. (B) Ca bination of chemokine ligands. The expression levels of mobilization was induced by treatment with 10 nM MCP-1 or 10 nM the two receptors were quantified by flow cytometric RANTES in Auo-3-loaded CCR2/CCR5-co-transfected HEK-293 cells. analysis (Figure lA) (Poncelet and Lavabre-Bertrand, Results are expressed as a percentage of the chemokine-induced 1993) and by their ability to respond in chemotaxis and in calcium response. Five experiments were performed; the figure depicts one representative experiment. Arrows indicate addition of stimulus. Ca+ flux experiments to monocyte chemotactic protein- I 2+ (C) Ca mobilization was determined as in (B), following stimulation (MCP-1) or RANTES (regulated upon ;!Ctivation, _!!ormal with different concentrations of MCP-1 or RANTES as indicated, I cell-�xpressed and �ecreted) (Figure lB). In these cells, added separately or simultaneously. Results are expressed as a MCP-1 and RANTES sensitized responses to the homo­ percentage of the maximum chemokine-induced calcium response. The logous, but not to the heterologous chemokine. When mean ± SD of four independent experiments is shown. (D) CCR2/ CCRS-co-transfected HEK-293 cells were stimulated with chemokines MCP-1 and RANTES were added simultaneously to 2+ (10 nM for 5 min at 37 C) and, where indicated, cross-linked with CCR2-and CCR5-co-transfected HEK-293 cells, Ca 1 mM DSS. Cell lysates were immunoprecipitated with anti-CCR2 flux was triggered at a concentration much lower than antibody, electrophoresed and transferred to nitrocellulose membranes. that required to induce a response by either chemokine The western blot was analyzed with anti-CCRS antibody (left); as a alone (0.1 nM versus 1 nM; Figure 1 C), indicating a positive control, unstimulated CCR2/CCR5-co-transfected HEK-293 cells were immunoprecipitated with anti-CCRS antibody (lane 6). The cooperative effect when the two receptors bind their membrane was stripped and reprobed with anti-CCR2 antibody as a ligands simultaneously. control for protein loading (right). Arrows indicate the position to We have shown that the initiation of chemokine which monomers and dimers migrated. signaling through the CCR2, CCR5 and CXCR4 chemo­ kine receptors involves ligand-triggered receptor homo­ linked using disuccinirnidyl suberate (DSS), lysed and dimerization (Rodriguez-Frade et al., 1999a,b; Vila-Coro immunoprecipitated with an anti-CCR2 antibody, and et al., 1999). In an attempt to understand the mechanisms the western blot was developed with anti-CCR5 underlying the RANTES- and MCP-1-promoted syner­ (Figure ID, left) or anti-CCR2 antibodies (Figure ID, 2+ gistic response in Ca mobilization, and based on the right). In accordance with previous results (Rodriguez­ observed heterodimerization of other GPCRs, we tested Frade et al., 1999b ), stimulation with MCP-1 alone whether chemokine binding also triggered receptor induced dimerization of the CCR2 receptor (Figure 1D, heterodimerization. CCR2b/CCR5-co-transfected HEK- right), but not of the CCR5 receptor (Figure ID, left), as 293 cells were stimulated with MCP-1, RANTES or determined by the presence of higher molecular weight equimolar concentrations of both. Cells were then cross- complexes. In the converse experiment, RANTES induced 2498 Chemokine receptor heterodimerization homodimerization of the CCR5 receptor, but not of the HEK-293 CC1UbY139F/CCRS CCR2 receptor (not shown). The simultaneous presence of MCP-1 and RANTES promoted the formation of CCR2 homodimers (Figure 1D, right), CCR5 homodimers (not shown) and, interestingly, CCR2-CCR5 heterodimers (Figure 1D, left). The same results were obtained when double-transfectant HEK-293 cells were stimulated sim­ ultaneously with MCP-1 and RANTES, lysed and immunoprecipitated with anti-CCR5 antibody, and the western blot developed with anti-CCR2 antibody (not shown). We conclude, therefore, that the CCR2 and CCR5 receptors can form heterodimers following simultaneous stimulation with the ligands of both receptors. Neither synergistic chemokine responses nor heterodimerization were observed in cells expressing CCR2 and CXCR4 after MCP,. I SDF-lla. .MCP,I stimulation with MCP-1 and SDF-la (not shown). S.OF-[CI Chemokine receptor heterodimerization regulates chemokine responses We showed previously that the CCR2bY139F mutant under­ goes receptor homodimerization in response to MCP-1 and heterodimerization with the CCR2b wild-type receptor, blocking the response to MCP-1 (Rodn'.guez-Frade et al., 1999b). To evaluate the functional consequences of CCR5 and CCR2 heterodimerization, CCR5 and the dominant­ ,_ ____ __,L.J ,_ ____ __,L.J negative CCR2b Y139F mutant receptor (Rodriguez-Frade CCRl C05 --!PP- CCRl CCR1 et al., 1999b) were co-transfected into HEK-293 cells. '2 llllf!diu.m l MCM Receptor expression in these cells was quantified by , IW<TllS+l!fCJ>·l 6 -... flow cytometry using specific antibodies (Figure 2A). Fig. 2. The mutant CCR2bY139F receptor impairs the response to CCR2bY139F expression in HEK-293 cells resulted in an RANTES but to SDF-la. (A) CCR2bY139F/CCR5 double-transfected impaired response to MCP-1 (Figure 2B), as would be HEK-293 cells were incubated with biotin-labeled mAbs to CCR2, predicted based on previous results. Co-expression of CCR5 or CXCR4 or their respective isotype-matched control mAbs, 2+ CCR5 and CCR2b Y139F did not affect the RANTES Ca 2+ followed by isothiocyanate-labeled streptavidin. (B) Ca flux was mobilization response, but co-addition of MCP-1 and triggered by 10 nM RANTES, 10 nM MCP-1, or a combination of both chemokines (0.1 nM each) as indicated using CCR2bY139F/CCR5- RANTES blocked this response (Figure 2B). In control co-transfected HEK-293 cells. Results are expressed as a percentage of experiments, CCR2bY139F did not block the response to 2+ the maximum chemokine-induced Ca response. The figure depicts SDF-la, even with simultaneous addition of MCP-1 and 2+ one representative experiment of four performed. (C) Ca mobilization SDF-la (Figure 2C), whose receptor, CXCR4, is con­ was determined as in Figure lB, following stimulation of CCR2b­ Y139F/CCR5-co-transfected HEK-293 cells with different concen­ stitutively expressed in HEK-293 cells. Here we demon­ trations of MCP-1 or SDF-la, separately or simultaneously as strate that, in the presence of RANTES and MCP-1, the indicated. Results are expressed as a percentage of the maximum CCR2bY139F mutant also dimerizes with the CCR5 chemokine-induced response. The mean ± SD of three independent receptor. Indeed, when cells were cross-linked and experiments is shown. (D) HEK-293 cells co-transfected with the immunoprecipitated with anti-CCR2b antibody and the CCR2bY139F and CCR5 receptors were processed as in Figure 1D. Arrows indicate the monomer and the dimer. western blot developed with anti-CCR5 antibody (Figure 2D, left), we observed heterodimer formation cytometry using specific antibodies. In CCR5 wild-type only in the presence of both MCP-1 and RANTES + + (Figure 2D, left, lane 5). In anti-CCR2b antibody donors, 15-20% of CD3and 30-35% of CD14cells immunoprecipitates developed in western blotting with expressed both types of receptor, and very few cells were the same antibody, CCR2 dimers were observed after detected that expressed CCR2 or CCR5 alone. PBMC stimulation with MCP-1 or MCP-1 plus RANTES from the CCR5A32 donor showed similar CCR2 levels (Figure 2D, right). We conclude that these two receptors, and cell distribution, and no significant expression of CCR5 and CCR2bY139F, undergo heterodimerization CCR5 (Figure 3B). When combined, RANTES and after stimulation with MCP-1 plus RANTES, impairing MCP-1 triggered both a chemotactic response (Figure 3C, 2+ the downstream responses to RANTES. left) and Ca flux (Figure 3D, upper panel) at a To exclude the possibility that the synergistic response concentration 10-100 times lower than that of either one observed with the combination of RANTES and MCP-1 alone in CCR5 homozygotic donors. This synergistic was due to CCR5 and CCR2 receptor overexpression, we effect was not seen for the CCR5A32 (Figure 3D, lower tested the effects of these two chemokines on peripheral panel), although we observed a RANTES-mediated blood mononuclear cells (PBMC) derived from a CCR5 response when PBMC from this donor were stimulated homozygotic donor and on PBMC derived from a donor with the chemokine. This synergistic effect may be due to bearing the CCR5A32 mutation and therefore not express­ a RANTES-mediated response using a receptor other than ing the CCR5 receptor (Benkirane, 1997) (Figure 3A). CCR5; in fact, MIP-1�, a specific ligand for CCR5, Expression of CCR2 and CCR5 was assessed by flow promoted no response (not shown). To confirm that 2499 M.Mellado et al. heterodimerization requires specific, simultaneous acti­ A B CCR2wtlCCJU wt CCR2wt/CCRS t.32 vation of both receptors, we used antagonistic anti-CCR2 CCll5 o:al and -CCR5 monoclonal antibodies (mAbs) (Mellado et al., MW A�2 WT � 2 .Sb p. 1998; Rodrfguez-Frade et al., 1999a). Both of these mAbs �2tlbp. completely blocked the synergistic response in PBMC from CCR5 homozygous donors (Figure 3C, right), I. -� �m 0. 1 - §W □ ru ,ow cu suggesting that heterodimerization is involved in this CCR2 CCR2 """ response. Receptor heterodimerization results in recruitment of both receptor-associated signaling complexes We next analyzed whether heterodimers could recruit the signaling complex associated with either receptor. In RANTES-stimulated, CCR5-transfected HEK-293 cells, we identified JAKl, but not JAK2 or JAK3, associated with the CCR5 receptor, whereas in CCR2-transfected a.-bi::�Cikl(I HEK-293 cells, MCP-1 stimulation promoted JAK2 association with the receptor (Mellado et al., 1998; Rodrfguez-Frade et al., 1999a). The identification of the downstream signaling pathway activated by JAK1/JAK2 kinases has also revealed phosphorylated ST AT5 tran­ scription factors in anti-CCR5 immunoprecipitates (Rodrfguez-Frade et al., 1999a) and STAT3 in anti­ CCR2 immunoprecipitates (Mellado et al., 1998). As predicted, when CCR2- and CCR5-co-transfected HEK- 293 cells were stimulated with MCP-1, ST AT3 was observed in the immunoprecipitates obtained with the anti­ CCR2 antibody (Figure 4A, left). When these cells were stimulated with RANTES, however, anti-CCR5 antibody did not precipitate STAT3, as seen in the western blot (Figure 4A, center). When the cells were stimulated with both MCP-1 and RANTES, ST AT3 was found in the CCR5 receptor immunoprecipitates (Figure 4A, right). To Fig. 3. Simultaneous MCP-1 and RANTES co-activation of PBMC check that equivalent amounts of protein had been loaded, increases sensitivity of chemokine responses. (A) Amplification of gene membranes were stripped and probed with the immuno­ fragments corresponding to the CCR5 (245 bp) and CCR5A32 (213 bp) precipitating antibodies (Figure 4A, lower panels). Since with specific primers as described in Materials and methods using STAT3 does not associate with RANTES-activated CCR5, genomic DNA from PBMC isolated from CCR5-homozygous and CCR5A32-homozygous donors. (B) PBMC from CCR5 wild-type and it can be inferred that the simultaneous presence of MCP-1 CCR5A32 donors were incubated with anti-CCR2, anti-CCRS mAbs and RANTES triggers the formation of a CCR2-CCR5 or their respective isotype-matched control mAbs in the presence complex, which recruits the signaling machinery associ­ of an excess of human immunoglobulins, followed by fluorescein ated with each of the receptors. isothiocyanate-labeled anti-mouse IgG and phycoerythrin (PE)-labeled anti-mouse IgM antibodies. The figure also shows the percentage of Finally, we performed similar experiments in which double-staining cells and single positives. (C) PBMC from CCRS- and HEK-293 cells co-expressing CCR5 and the CCR2b­ CCR5A32-homozygous donors were allowed to migrate following Y139F mutant were stimulated with MCP-1 and/or stimulation with MCP-1 or RANTES, added separately or simul­ RANTES. STAT5b was detected in anti-CCR5 immuno­ taneously as indicated. The migration index was calculated as described precipitates after stimulation with RANTES, but not in Materials and methods. Data represent the mean of quadruplicate determinations, with the SD indicated. Migration of PBMC from after stimulation with MCP-1 and RANTES together CCR5-homozygous donors in response to 0.1 nM MCP-1 plus 0.1 nM (Figure 4B). These results and the impaired response to the RANTES was blocked by pre-treatment of the cells with antibodies combined stimulus in these co-transfected cells against CCR2 and CCR5 (50 µg/ml for 30 min at 37 C). As a control, 2+ (Figure 2A) lead us to conclude that CCR2bY139F acts pre-treatment with isotype-matched antibodies is also shown. (D) Ca flux was triggered by 10 nM or 0.1 nM RANTES, MCP-1, or a as a trans dominant-negative mutant, blocking RANTES combination, using PBMC from CCR5- and CCR5A32-homozygous responses by its ability to form non-productive complexes donors. Results are expressed as a percentage of the maximum with partners containing the functional domain; this chemokine-induced calcium response. The figure depicts one demonstrates the biological relevance of dimerization in representative experiment of four performed. chemokine responses. with both CCR2b and CCR5 were stimulated simultan­ Chemokine receptor heterodimers recruit unique eously with 0.1 nM MCP-1 and 0.1 nM RANTES, PTx did signaling pathways not block the response (Figure 4C, left), illustrating the We have attempted to establish the molecular basis of this presence of a unique signaling pathway activated through reduction in the threshold required to induce a biological receptor heterodimerization. Similar results were obtained response. Treatment with PTx abrogated both calcium when this assay was performed using PBMC derived from release and migration in response to MCP-1 or RANTES a normal donor, ruling out the possibility that this effect is (Figure 4C). However, when HEK-293 cells transfected an artifact due to the use of transfected cells (Figure 4C, � Chemokine receptor heterodimerization PBMC A HEK-293 CCR2/CCR5 D 0 I' .s · l:J' o 1· s· w 0 I' :J' l:J" ____ Lyw• L____J 4-..,. L____Jl.,ypte ISl�-CCRS IIDIH:CRl llllli-ccR!i HEK-293 CCIUY139F/CCR5 AANTES MCl'-1 (0, I ,,.,) MCl'-1 (l�••O (IOnM) STATj RANlE'l(Q.l oM) □ I' S' IS' 0 I' S' ll' 0 I' j' l:J' .., -....i""'.cot..,,.,,-, 2 1.¥ .... - wl - =-- � )-sa "" anri-CCRj I 4"ait HEK -293 CCR2/CCRS PBMC RAtmlS (IOoM) MCP ,l+ RANTI'.'i (Ql •Ml Fig. 4. Heterodimerization of chemokine receptors results in recruitment of specific signaling events. (A) Serum-starved CCR2/CCR5-transfected HEK-293 cells (10 X 10 ) were used alone or treated with 10 nM MCP-1, RANTES, or a combination of both for the times indicated. Cell lysates were immunoprecipitated with anti-CCR2 (left) or anti-CCR5 antibody (center and right), and western blots were developed with anti-STAT3 antibody. As a control, an unstimulated, unprecipitated transfected HEK-293 cell lysate was analyzed in a western blot with an anti-STAT3 antibody. In each case, CCR2 or CCR5 protein loading was assessed by reprobing membranes with anti-CCR2 or -CCR5 mAb. (B) Serum-starved, CCR2bY139F/CCR5-transfected HEK-293 cells were treated with 10 nM MCP-1, 10 nM RANTES, or a combination of MCP-1 and RANTES (10 nM of each). Cell lysates were immunoprecipitated with anti-CCR2 (left) or anti-CCR5 antibody (center and right) and western blots were developed with 2+ anti-STAT5b antibody. Protein loading was controlled for as in (A). (C) Ca mobilization induced by MCP-1 (10 nM), RANTES (10 nM) or MCP-1 plus RANTES (0.1 nM of each) was determined in CCR2-and CCR5-co-transfected HEK-293 cells, and in PBMC from CCR5 wild-type donors untreated or pre-incubated with PTx. The figure depicts one representative experiment of three performed. (D) PBMC from CCR5 wild-type donors were used alone or pre-incubated with PTx, as indicated, and allowed to migrate following stimulation with MCP-1 or RANTES, added separately (10 nM each) or simultaneously (0.1 nM of each) as indicated. The migration index was calculated as described in Materials and methods. Data represent the mean of quadruplicate determinations, with the SD indicated. (E) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were used alone or treated with 10 nM MCP-1, RANTES, or a combination of both ligands for the times indicated. Cell lysates were immunoprecipitated with anti-CCR2 or anti-CCR5 antibody, and western blots developed with anti-G antibody. As a control, an unstimulated, 1 1 unprecipitated transfected HEK-293 cell lysate was analyzed in a western blot with anti-G antibody. As a protein loading control, membranes were reprobed with the immunoprecipitating antibody. right). In contrast, the synergistic migration induced by but not when the chemokines were used individually heterodimerization was sensitive to PTx (Figure 4D), (Figure 4E). This association was also observed after suggesting that although Ga is needed for chemotaxis, immunoprecipitation with the CCR5-03 antibody follow­ other factors are probably also required. ing heterodimer formation, but not in homodimers. Some studies report that the calcium response to Finally, the failure of a specific antibody to detect G chemokines is not completely blocked by PTx (not shown) prompted the conclusion that heterodimeric (Al-Aoukaty et al., 1996; Arai and Charo, 1996; Kuang CCR2-CCR5 receptors associate specifically with Gu, et al., 1996), suggesting that chemokine receptors may We conclude, therefore, that, in chemokine responses, or G , couple to multiple G proteins, such as G , G distinct pathways can be activated in the simultaneous i 8 depending on the chemokine receptor and/or the chemo­ presence of chemokines able to bind receptors susceptible kine used. A CCR2-CCR5 receptor-associated protein to heterodimerization. The implication of Gu in hetero­ 2+ distinct from G was immunoprecipitated and detected in dimer activation would explain the resistance of Ca flux western blots using an anti-G m·specific antibody when to PTx treatment and the reduction in the chemokine cells were stimulated with the MCP-1-RANTES mixture, response threshold. 2501 M.Mellado et al. • RAl"lrm: IU IIM Q MCP,1 1 0, 11 _ M □ MCP.10.. l flM MCP l+RANTES ■ RAMES lllnN A RJ.NTES .. MCP<- 1 0. 1 � L------= == - 1 I l.yiat.i 0 r w � �- D r � � aml-CCR2 Ontl-CCR3 TJ 'l' l lllf!l {mln l ., PBMC HEK-293 CCR2B/CCRS 1 .0 -,- ---,------, �--� ,- ----,- ---,-- 120 '° $: • � ": � . . OMcP-1 lOO •• "-'<TE$ O hkd l"m i lO - r,..., tmi.o> o- - ,- - -□ -. ,- C h � mn ld11 .e ( �t J Fig. 5. Chemokine receptor heterodimerization promotes specific signaling events but not receptor down-regulation. (A) Serum-starved CCR2/CCR5- transfected HEK-293 cells (10 X 10 ) were incubated for the times indicated with 0.1 nM and 10 nM RANTES, 0.1 nM and 10 nM MCP-1, or 0.1 nM of both chemokines at 37 C. Surface CCR2 or CCR5 was detected by fluorescence-activated cell sorting (FACS) analysis using biotin-labeled CCR2-03 mAb or CCRS-03 mAb, followed by streptavidin-PE; an isotype-matched mAb was used as control. Results are expressed as the percentage of maximum binding obtained in the absence of chemokines, with the SD indicated. (B) A static adhesion assay was performed using CCR2b-and CCR5-transfected HEK-293 cells (right) or PBMC from CCR5 wild-type donors (left), as described in Materials and methods. Stimuli include MCP-1 (10 nM), RANTES (10 nM), or MCP-1 plus RANTES (0.1 nM of each) for transfected cells, and 10 nM or 0.1 nM of MCP-1, RANTES, or both chemokines together for PBMC, as indicated. Results are expressed as a percentage of the maximum adhesion observed after stimulation with a mixture of RANTES plus MCP-1. The figure shows the mean ± SD of seven independent experiments. *Significantly different (p <0.05); **significantly different (p <0.01) (Student 's t-test). (C) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were incubated for the times indicated with 10 nM RANTES, 10 nM MCP-1, or 0.1 nM of each of these chemokines at 37 C. Cell lysates were immunoprecipitated with anti-CCR2 or anti-CCR5 antibody as indicated, and western blots were developed with anti-p85 antibodies (upper panel). CCR2 or CCR5 protein loading was controlled for as in Figure 4A (lower panel). (D) Serum-starved CCR2-and CCR5-transfected HEK-293 cells (10 X 10 ) were incubated for the indicated times with 10 nM RANTES, 10 nM MCP-1, or 0.1 nM of each of these chemokines combined at 37 C. Cell lysates were immunoprecipitated with anti-CCR2 or anti -CCR5 antibody, and an in vitro kinase assay was performed as indicated (Materials and methods). The mean ± SD of three independent experiments is shown. Signaling through heterodimeric chemokine and in macrophage accumulation in inflammatory pro­ receptors fails to induce receptor down -regulation cesses (Sasaki et al., 2000). Other PI3K family members and triggers cell adhesion have active roles in chemokine-mediated adhesion, To characterize the biological consequences of the specific polarization and migration (Turner et al., 1995; Vicente­ signaling pathways activated by the heterodimer in greater Manzanares et al., 1999). Stimulation with MCP-1 or detail, we analyzed whether the simultaneous presence of RANTES alone promoted rapid association of the p85 MCP-1 and RANTES modified the internalization process regulatory subunit of PI3K with CCR2 and CCR5, mediated by the individual activation of CCR2 and CCR5 respectively, reaching a maximum 5 min after activation by their respective ligands. Surprisingly, the simultaneous (Figure 5C). This association was followed by rapid presence of these chemokines at concentrations that dissociation, which was almost complete 15-30 min after 2+ trigger receptor heterodimerization and Ca mobilization stimulation. When PI3K activity was evaluated in anti­ did not promote receptor down-regulation, as measured by CCR2 and anti-CCR5 immunoprecipitates, results agreed flow cytometry (Figure 5A). with those of p85 association (Figure 5D), concurring with Leukocyte recruitment is a multistep process that earlier reports (Turner et al., 1995, 1998). In contrast, involves cell rolling, adhesion and migration (Springer, simultaneous receptor activation with both ligands did not 2+ 1994); intracellular Ca levels play an important role in promote early PI3 K activation or p85 association with the all of these steps. We therefore analyzed adhesion of chemokine receptor, but rather led to a delayed and PBMC and CCR2-CCR5-co-transfected HEK-293 cells sustained activation, with a response peak at 15-30 min using collagen type VI as substrate. Simultaneous addition (Figure 5C and D). We conclude that there is a clear of these chemokines promoted more efficient cell adhesion difference in PI3K activation by homo- or heterodimers: than did the individual chemokines alone (Figure 5B). the former is early and transient, whereas the latter is slow Other signals in addition to Ca+ are proposed to regulate but sustained. The reduction in the chemokine response lymphocyte chemotaxis. Using phosphatidyl inositol 3- threshold, the inability to trigger receptor down-regula­ kinase (PI3K)y mice, the crucial role of this kinase has tion, the resistance to PTx and the sustained PI3 K been demonstrated in neutrophil migration (Li et al., 2000) activation promoted by the heterodimers indicate 2502 Chemokine receptor heterodimerization activation of a different pathway as a consequence of The K and B opioid receptors also heterodimerize heterodimer formation. (Jordan and Devi, 1999), forming a new receptor, with ligand-binding and functional properties distinct from those of either receptor alone; this new receptor can be Discussion activated synergistically by selective ligands (Jordan and The classical view of chemoattractant receptor signaling Devi, 1999). The heterodimeric chemokine receptor also 2+ requires activation of the G protein pathway after exhibits unique features, as Pfx-independent Ca flux chemokine binding. Signaling studies have revealed indicates distinct properties. The heterodimer promotes potent, chemokine-dependent inhibition of adenylyl specific G recruitment, explaining the Pfx-resistant q1 cyclase and mobilization of intracellular calcium, consist­calcium flux, and also shows differences in PI3K activa­ ent with receptor coupling to Ga;_. We have described the tion. The fact that Pfx blocks chemotaxis triggered by physical association of Ga with CCR2, CCR5 and the combination of chemokines may be surprising. CXCR4 in response to MCP-1, RANTES and SDF-la, Nonetheless, when this fact is considered together with respectively (Mellado et al., 1998; Rodriguez-Frade et al., G 11 1 activation, it concurs with previous reports showing 1999a; Vila-Coro et al., 1999). Consistent with G that G is not required for migration (Bowman et al., i 11 q1 association, the majority of these responses are inhibited 1998; Soede et al., 2000). G is, however, probably q1 by treatment with Pfx. Prior to G activation, initiation of implicated in other effects necessary for chemotaxis, such chemokine signaling through the CCR2, CCR5 and as integrin activation, which may be mediated via RhoA CXCR4 receptors involves ligand-triggered receptor (Katoh et al., 1998). It has also been shown that dimerization that enables activation of the JAK signaling chemokines can couple to more than one G protein pathway and chemokine-mediated STAT activation (Al-Aoukaty et al., 1996; Maghazachi, 1999), as has been (Wong and Fish, 1998; Mellado et al., 2001). reported for other GPCRs (Daaka et al., 1997; Luo et al., Here we show that simultaneous stimulation with 1999). Regulator of G-protein signaling (RGS) family MCP-1 and RANTES induces the formation of CCR2- members may also be involved in this process, as RGS CCR5 heterodimers. Compatible with this, the CCR2b­ proteins regulate cellular migratory and pro-adhesive Y139F mutant, which acts as dominant negative, blocking responses to chemoattractants (Bowman et al., 1998), a wild-type CCR2 (Rodriguez-Frade et al., 1999b), also fact related to the selectivity of RGS for G or G (Carman impairs CCR5 signaling through the formation of non­ et al., 1999). Both signals have an important role in the functional heterodimers. To our knowledge, this is the first sequential steps leading to leukocyte recruitment, includ­ case in which mutations in one chemokine receptor affect, ing cell rolling, adhesion and migration (Springer, 1994). in trans, the response to a ligand acting on a distinct, The crucial role of PI3Ky in neutrophil migration (Li et al, non-cross-reactive receptor. These results increase the 2000) and in the accumulation of macrophages in inflam­ complexity of chemokine response biology, as the simul­ matory processes has recently been shown (Sasaki et al, taneous presence of more than one chemokine may cause 2000). Although it appears that neutrophils from PI3Ky synergistic responses or, quite the opposite, suppress mice adhere to fibronectin-coated surfaces (Sasaki et al, +t physiological effects in the response to unrelated chemo­ 2000) as tightly as do PI3Ky - cells, suggesting that kines. This is in accordance with the fact that hetero­ decreased chemotaxis is due to impaired motility and dimerization probably occurs efficiently only between not to altered adhesion, it is known that other PI3K certain pairs of chemokine receptors. The implications of family members regulate cell adhesion and polarization this finding may be important in understanding the role of (Sanchez-Madrid et al., 1999). PI3Ky activation after chemokines in inflammation or as suppressors of human chemokine stimulation nonetheless occurs very rapidly, immunodeficiency virus (HlV)-1 infection, to mention just and is activated in vitro directly by G protein �y subunits two cases in which these molecules arouse interest (Cairns (Toker and Cantley, 1997). It is plausible, therefore, that and D' Souza, 1998; Lee et al., 1998; Littman, 1998; under our experimental conditions we were detecting Berger et al., 1999). activation not of this particular PI3K isoform, but rather of The response to GABA requires heterodimerization of other classical PI3K family members. We observed its two receptors (Kaupmann et al., 1998; White et al., association with the receptor after both homo- and 1998; Kuner et al., 1999). Physical interaction between heterodimer activation of the p85 regulatory subunit of GBR l and GBR2 seems to be essential for the coupling of PI3 K class la (not shown). In any case, the differences GABA receptors to G protein-coupled inwardly rectifying between homo- and heterodimers affect mainly a second, potassium channels, and for subsequent modulation of delayed wave of PI3K activity, and may be related to neurotransmission. GABA receptor dimerization appears differences in cell adhesion. The heterodimer receptor also to take place between the intracellular C-termini, probably promotes a reduction in the chemokine response threshold. through conserved coiled-coil domains, although other Increased sensitivity of hetero- compared with homo­ receptor regions may also intervene. The results presented dimers is also reported in the opioid response, in which the here, together with those showing the ability of CXCR4 to K-B heterodimer synergistically binds highly selective dimerize with the CCR2V64I mutant but not with wild­ agonists and potentiates biological responses (Jordan and type CCR2 (Mellado et al., 1999), suggest that V64, a Devi, 1999). residue located in the transmembrane I domain, is critical In chemotaxis in bacteria, the chemotactic receptors for dimer stabilization. It is also known that some GPCRs form higher-order complexes, thought to be important for may dimerize using transmembrane domains; for example, diversification of biological responses (Bray et al., 1998; dimerization of the �-adrenergic receptor involves trans­ Alon et al., 1999). We have shown that chemotactic membrane domain VI (Hebert et al, 1996). responses in leukocytes are also achieved by adaptive 2503 M.Mellado et al. or the chemokines produced would thus dramatically affect the ability of a chemokine to interact with a receptor. At low chemokine concentrations, receptor heterodimer­ ization would be favored, and so cell adhesion would be triggered and leukocyte rolling stopped. Under these conditions, following leukocyte migration into tissues, heterodimers would preferentially favor 'parking' of leukocytes (Figure 6). The sum of these findings may help understand the molecular mechanisms involved in chemokine receptor signaling desensitization through heterologous chemokines, as well as the mechanisms that regulate cell migration during immune and inflam­ matory responses. One selective advantage of receptor homo- or heterodimerization lies in the augmented sensi­ tivity of the system, such that chemokine responses increase with the spread of activity through a receptor array, illustrated by the abundance of chemokine receptors expressed on cell surfaces. Finally, chemokine receptors are critical in the control of inflammatory responses, and so are potential targets for the treatment of chronic disease (Broxmeyer et al., 1993) . I V. P. RKI Through these receptors, cells sense attractants over a LOW c: hcrnokmc ,n �c n lrul mn • concentration range of several orders of magnitude, raising H ETERODI M R anew the unsolved question as to how chemotactic responses achieve their combination of sensitivity and dynamic range. The results provided here may help to resolve this conundrum. Fig. 6. The physiological role of chemokine receptor dimerization. Leukocytes roll along the blood vessel endothelium (I) ; exposure to Materials and methods low chemokine concentrations causes the formation of chemokine receptor heterodimers and the cell adheres to the endothelium (II). Biological material s, proteins and antibod ies The inflammatory response produces higher chemokine concentrations, HEK-293 cells (ATCC TIB202) were from the American Type Culture triggering receptor homodimerization; this induces cell migration Collection (Manassas, VA). mAbs against CCR2, CCR5 and CXCR4 through the endothelium to inflammation sites (III), where low were generated in our laboratory (Mellado et al., 1998; Rodriguez-Frade chemokine concentrations favor heterodimerization, leading the et al., 1999a; Vila-Coro et al., 1999). MCP-1, RANTES and SDF- la cell to adhere ('park') in the tissues (IV). were from Peprotech (London, UK). Antibodies against STAT3 and G<Xqt were from Santa Cruz Biotech (Santa Cruz, CA), while that against PI3-kinase p85 was from Upstate Biotech (Lake Placid, NY). receptor clustering (Rodriguez-Frade et al., 1999a,b; mAbs against human CD3, CD14 and CD19 were from Immunotech Vila-Coro et al., 1999). One implication of receptor (Marseille, France). clustering as a consequence of chemotactic responses is that the activity of one receptor would influence that of its PBMC Freshly isolated whole blood from healthy donors, CCR5 homozygotes neighbors, such that a ligand could act in trans on a and the CCR5�32 homozygote was obtained in citrate buffer. Blood at receptor for which it is not specific. In this manner, the room temperature (RT) was added to Accuspin tubes (Sigma) and bound ligand induces changes in receptor signaling centrifuged (700 g for 15 min). The PBMC band was collected and activity, which are propagated to a large number of washed twice (220 g for 10 min at RT) and three times (100 g for 10 min neighboring receptors, amplifying the effect of a binding at RT) with Dulbecco 's phosphate-buffered saline (PBS), resulting in a + + + population containing 65-75% CD3 , 15-20% CD14 and 5-15% c019 event. In other words, chemokine binding triggers receptor cells. clustering that adapts to external stimuli. As shown here and previously (Rodriguez-Frade et al., 1999a,b; Flow cytometric analysis Vila-Coro et al., 1999), ligand binding causes aggregation Cells were centrifuged (250 g for 10 min at RT), plated in V-bottomed 96- well plates (2.5 X 10 cells/well) and incubated with 50 µ1/well biotin­ of chemokine receptors, allowing tyrosine phosphoryl­ labeled mAb (5 µg/ml for 30 min at 4 C). Cells were washed twice in PBS ation of cytoplasmic domains, recruitment of JAK tyrosine with 2% bovine serum albumin (BSA) and 2% fetal calf serum (FCS) and kinases and ST AT transcription factors, and downstream centrifuged (250 for 5 min at 4 C). Fluorescein isothiocyanate-labeled signal transmission. Here we broaden this to include streptavidin (Southern Biotechnologies, Birmingham, AL) was added, the receptor heterodimers as complexes able to mediate mixture was incubated (30 min at 4 C) and plates were washed twice. Cell-bound fluorescence was measured at 525 nm in a Profile XL flow activities different from those governed by homodimers. cytometer (Coulter, Miami, FL). Chemokine receptor expression was Receptor sensitivity can be regulated by the formation assessed by flow cytometry and quantified using a modification of the of signaling domain complexes dictated qualitatively by Dako Qifikit (Dako, Glostrup, Denmark), as described (Poncelet and chemokine availability. Chemokines are produced within Lavabre-Bertrand, 1993). specific tissues and immobilized by low-affinity binding to Calcium determination heparin-bearing proteoglycans on the vascular endothelial Cells (2.5 X 10 cells/ml) were resuspended in RPMI containing 10% barrier (Rollins, 1997); this would permit effective FCS and 10 mM HEPES, and incubated with Fluo-3 (Calbiochem; chemokine presentation to the rolling leukocytes. Varia­ 6 300 µM in dimethylsulfoxide, 10 µ1/10 cells, 30 min, 37 C). Cells were tions in the availability of these presentation molecules then washed, resuspended in RPMI containing 2 mM CaCI and 2504 Chemokine receptor heterodimerization maintained at 4 C before adding MCP-1, RANTES or SDF- la. Calcium Pl3 kinase assay flux was measured at 525 nm in an EPICS XL flow cytometer (Coulter). CCR2 or CCRS immunoprecipitates were washed twice with lysis buffer, When PTx pre-treatment was required, cells were incubated in culture and twice with 50 mM Tris-HCl pH 7 .4/100 µM EDTA before incubating medium with 0.1 µg/ml PTx (Sigma, St Louis, MO) overnight at 37 C. with phosphatidyl inositol (PI) in reaction buffer (25 mM MgCh, 2 + 32 After washing, cells were resuspended and Ca flux determined as above. 20 µM ATP, 50 mM Tris-HCI pH 7.4, 10 µCi [y-P]ATP) (Amersham For PBMC analysis, cells were loaded as before and calcium response Pharmacia) for 10 min at room temperature. The phosphorylation reaction evaluated separately in monocytes and lymphocytes. In this case, when was terminated by adding 1 M HCl, and lipids were extracted with PTx pre-treatment was required, cells were incubated (2 h at 37 C) in CHCI 'methanol. Radiolabeled lipids were resolved by thin-layer culture medium with 0.1 µg/ml PTx. chromatography and radioactivity was analyzed with a GS-525 Molecular Imager System (Bio-Rad, Hercules, CA) with Molecular Analyst v. 2.2 software. Transfection HEK-293 cells, which constitutively express the CXCR4 receptor, were Static adhesion assays co-transfected with CCR2, CCR2b Y139F or CCRS constructs by calcium Circles (0.5 cm diameter) were drawn on a glass slide using a wax pen phosphate precipitation (Mellado et al., 1998; Rodriguez-Frade et al., (Dako) and coated with human collagen type VI (Sigma) at 20 µg/ml in 1999b ). Transfected cells were selected in G-418 (Calbiochem) and 50 µI of endotoxin-free PBS (Gibco-BRL). As a negative control, 100% analyzed by flow cytometry for receptor expression using antibodies FCS was employed. After overnight incubation at 4 C, slides were against CCR2, -CCRS and -CXCR4. washed three times in Dulbecco 's PBS and blocked for 1 hat 37 C with 100% FCS. HEK-293 CCR2/CCR5 transfectants were added (0.4 X 10 Cell migration cells/ml in 50 µI), together with the indicated chemokines at a final Migration of HEK-293 cells stably transfected with CCR2/CCR5 or concentration of 1 nM. After incubation (3 min at 37 C), slides were CCR2bY139F/CCR5 was studied in a 96-well microchamber washed by dipping once in PBS to remove non-adherent cells, and bound (NeuroProbe Inc., Gaithersburg, MD). Chemokines at several concentra­ cells were fixed in 1.5% glutaraldehyde/PBS. Data are expressed as the tions were loaded in lower wells (30 µl/well), and cells (200 µl/well, percentage of the maximum number of adherent cells counted in three 3 X 10 cells/ml) were loaded in upper wells. Polyvinylpyrrolidone-free random microscope fields/circle. filters with 10 µm pores (NeuroProbe) were pre-coated for 2 hat 37 with 20 µg/ml type VI collagen (Sigma). The chamber was incubated Cell adhesion assays (37 C, 5% CO ) for 5 h, after which filters were removed and the cells in Flat-bottomed 96-well assay plates (Maxisorb, Nunc) were coated with the upper part wiped off. The cells present in the filters were fixed and 20 µg/ml collagen VI (Sigma) and blocked with 2% BSA. Freshly stained with crystal violet (0.5% crystal violet, 20% methanol). Blue isolated PBMC were labeled with BCECF-AM [2',7'-bis-(2-carboxy­ spots developed at positions at which cell migration had occurred, ethyl)-5- (and -6)-carbofluorescein, acetoxymethyl ester; Molecular allowing densitometric quantification of migration (National Institutes of Probes, Eugene, OR] as described (Sanz-Rodriguez et al., 2001), and Health Image software). The migration index was calculated by mean added in triplicate to the plate (10 cells/well). Plates were centrifuged at spot intensity. 30 for 15 s and incubated at 37 C for 6 min, and unbound cells were For analysis of PBMC migration, cells (0.25 X 10 cells in 0.1 ml) removed by three washes with Dulbecco 's modified Eagle's medium. were placed in the upper well of 24-well transmigration chambers (5 µm Bound cells were quantified using a fluorescent analyzer (Cytofluor 2300; pore size; Transwell; Costar Corp., Cambridge, MA) pre-coated for 2 h at Millipore, Bedford, MA). 37 C with 20 µg/ml type VI collagen (Sigma), and 0.1-10 nM MCP-1 (in 0.6 ml RPMI containing 0.25% BSA) was added to the lower well. Plates PCR reaction analysis of genomic DNA were incubated at 37 C for 120 min and cells that had migrated to the Genomic DNA was isolated from PBMC of selected donors using an Easy lower chamber were counted. Cell migration was calculated as the x-fold DNA kit (lnvitrogen). Upstream and downstream oligonucleotide primers increase in migration observed over the medium control. To block ligand­ used to amplify the CCRS gene corresponded to the second extracellular induced chemotaxis, cells (2.5 X 10 cells/ml) were first incubated for region; the sequences of the 5'- and 3' primers were CCTGGCTGT­ 30 min at 37 C with anti-CCR2, anti-CCRS or isotype-matched control CGTCCATGCTG and CAAGCAGCGGCAGGACCAGC, respectively. mAbs (50 µg/ml). Using this primer set, the wild-type CCRS allele gives rise to a 245 bp PCR fragment, whereas the deleted allele gives a 213 bp fragment. For each PCR (100 µI), 1 µg of genomic of DNA was denatured at 95 C for lmmunoprecipitation, SOS-PA GE and western blotting ° ° 5 min, and amplified by five PCR cycles (94 C for 45 s; 55 C for 45 s; Serum-starved cells (10 X 10 ) were lysed in a detergent buffer (20 mM ° ° ° 72 C for 45 s), followed by 35 additional cycles (94 C for 45 s; 63 C for triethanolamine pH 8.0, 300 mM NaCl, 2 mM EDTA, 20% glycerol, 1 % 45 s; 72 C for 30 s). The reaction products (25 µI) were run on 3% digitonin, with 10 µM sodium orthovanadate, 10 µg/ml leupeptin and Nusieve GTG agarose gel and DNA bands were stained by ethidium 10 µg/ml aprotinin) for 30 min at 4 C with continuous rocking, then bromide. In addition, CCRS PCR fragments were subcloned and centrifuged (15 000 for 15 min at 4 C) (Mellado et al., 1998). For sequenced automatically. immunoprecipitation, protein extracts that had been cleared by incubation with anti-mouse IgG-or anti-mouse IgM-agarose (Sigma; 10 µg for ° ° 60 min at 4 C) were centrifuged (15 000 for 1 min at 4 C) and Acknowledgements immunoprecipitated with the appropriate antibody (5 µg/sample for 120 min at 4 C), followed by anti-mouse IgG- or IgM-agarose (20 µg for We would like to thank Drs J.B.Stock, S.O' Brien and L.Birnbaumer for 60 min at 4 C). Immunoprecipitates or protein extracts were separated by reading the manuscript. We also thank Drs J.Stein and J.Teixid6 for help SDS-PAGE and transferred to nitrocellulose membranes. Western blot with adhesion experiments, M.C.Moreno and Dr I.Lopez for help with analysis was as described, using 5% non-fat dry milk in Tris-buffered flow cytometry, and C.Bastos and C.Mark for secretarial and editorial saline (TBS) as a blocking agent (Mellado et al., 1998). Membranes were assistance, respectively. This work was partially supported by grants from stripped using 62.5 mM Tris-HCl pH 7.8, containing 2% SDS and 0.5% Spanish National Plan for Scientific Development/FEDER EU and the �-mercaptoethanol (60 min, 60 C), washed with 0.1 % Tween-20 in TBS Comunidad de Madrid. The Department of Immunology and Oncology for 2 h, reblocked, reprobed and developed as above. In all cases, was founded and is supported by the Spanish National Research Council protein loading was controlled using a protein detection kit (Pierce, (CSIC) and the Pharmacia Corporation. Rockford, IL). Cross-linking References Serum-starved HEK-293 cells co-transfected with chemokine receptors (10 X 10 ) were stimulated with the indicated chemokines. The reaction Al-Aoukaty,A., Schall,T.J. and Maghazachi,A.A. (1996) Differential was terminated by adding 1 ml of cold PBS and centrifuged (250 for coupling of CC chemokine receptors to multiple heterotrimeric 10 min ). After washing twice with cold PBS, 10 µI of 100 mM DSS G proteins in human interleukin 2-activated natural killer cells. (Pierce) were added for 10 min at 4 C with continuous rocking Blood, 87, 4255-4260. (Rodriguez-Frade et al., 1999b). The reaction was terminated by adding Alon,U., Surette,M.G., Barkai,N. and Leibler,S. (1999) Robustness in 1 ml of cold PBS, centrifuged (15 000 g for 60 s) and then washed three bacterial chemotaxis. Nature, 397, 168-171. times. The pellet was lysed and immunoprecipitated as above. Aragay,A., Frade,J.M.R., Mellado,M., Serrano,A., Martinez-A.,C. and 2505 M.Mellado et al. Mayor,F.,Jr (1998) MCP-1-induced CCR2B receptor desensitization Mumby,S.M. and Muallem,S. (1999) Alternate coupling of receptors by the G protein-coupled receptor kinase-2. Proc. Natl Acad. Sci. to G, and G; in pancreatic and submandibular gland cells. J. Biol. USA , 95, 2985-2990. Chem., 274, 17684-17690. Arai,H. and Charo,I.F. (1996) Differential regulation of G-protein Maghazach i,A.A. (1999) Intracellular signaling pathways induced by mediated signaling by chemokine receptors. J. Biol. Chem. , 271, chemokines in natural killer cells. Cell. Si g nal., 11, 385-390. 21814-21819. Mellad o,M., Rodriguez-Frad e,J.M., Araga y,A.M., del Real,G., Baggiolini,M. (1998) Chemokines and leukocyte traffic. Nature, 392, Vila-Cor o,A.J., Martin de Ana,A.M., Serran o,A., Mayor,F.,Jr and 565-568. Martinez-A.,C. (1998) The chemokine MCP-1 triggers tyrosine Bai,M., Trivedi,S. and Brown, E.M. (1998) Dimerization of the phosphorylation of the CCR2B receptor and the JAK2/STAT3 extracellular calcium-sensing receptor (CaR) on the cell surface of pathway. J. Imm unol., 161, 805-813. CaR-transfected HEK293 cells. J. Biol. Ch em. , 273, 23605-23610. Mellado ,M., Rodriguez-Frad e,J.M., Vila-Coro ,A.J., Martin de Ana,A.M. Benkiran e,M., Jin,D-Y., Chun,R.F., Koup, R.A. and Jeang,K-T. (1997) and Martinez-A .,C. (1999) Chemokine control of HIV-1 infection. Mechanism of transdominant inhibition of CCR5-mediated HIV-1 Nature, 400, 273-274. infection by ccr5.ii32. J. Biol. Chem. , 272, 30603-30606. Mellado,M. Rodriguez-Frad e,J. M., Mafies,S. and Martinez-A .,C. (2001) Berge r,E.A., Murphy,P.M. and Farber, J.M. (1999) Chemokine receptors Chemokine signaling and functional responses: the role of receptor as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. dimerization and TK pathway activation. Annu. Rev. Imm unol., 19, Rev. Im munol., 17, 657-700. 397-421. Bockaert,J. and Pin,J.P. (1999) Molecular tinkering of G protein-coupled Poncelet,P.G. and Lavabre-Bertrand,T. (1993) Immunological detection receptors: an evolutionary success. EMB O J. , 18, 1723-1729. of membrane-bound antigens and receptors. In Masseyeff ,R.F., Bowma n,E.P., Carnpbe ll,J.J., Druey, K.M., Scheschonk a,A., Kehrl,J.H. Albert,W.H. and Staine s,N.A. (eds), Methods of Im munolo g ical and Butcher, E.C. (1998) Regulation of chemotactic and proadhesive Analysis. VCH, Weinheim, Germany, pp. 388-418. responses to chemoattractant receptors by RGS (regulator of G-protein Premack, B.A. and Schall, T.J. (1996) Chemokine receptors: gateways to signaling) family members. J. Biol. Chem. , 273, 28040-28048. inflammation and infection. Nature Med. , 2, 1174-117 8. Bray,D., Levin, M.D. and Morton-Fir th,C.J. (1998) Receptor clustering Rodriguez-Frad e, J.M., Vila-Cor o,A.J., Martin de Ana,A.M., Nieto,M., as a cellular mechanism to control sensitivity. Nature, 393, 85-8 8. Sanchez-Madrid,F., Proudfoo t,A.E.I., Well s,T.N.C., Martinez-A .,C. Broxmeye r,H.E., Sherry, B., Cooper,S., Lu,L., Maze, R.R., Beckmann, and Mellado,M. (1999a) Similarities and differences in RANTES­ M.P., Cerami,A. and Ralph,P. (1993) Comparative analysis of the and (AOP)-RANTES-triggered signals: implications for chemotaxis. human macrophage inflammatory protein fam ily of cytokines J. Cell Biol., 144, 755-765. (chemokines) on proliferation of human myeloid progenitor cells. Rodriguez-Frad e, J.M., Vila-Cor o,A., Martin de Ana,A.M., Albar,J .P., J. Im munol., 150, 3448-3458. Martinez-A .,C. and Mellado,M. (1999b) The chemokine monocyte Cairns,J.S. and D' Souza,M.P. (1998) Chemokines and HIV-1 second chemoattractant protein- I induces functional responses through receptors: the therapeutic connection. Nature Med. , 4, 563-56 8. dimerization of its receptor CCR2. Proc. Natl Acad. Sci. USA , 96, Carman, C.V., Parent,J.-L., Day,P.W., Proni n,A.N., Stemwei s,P.M., 3628-3633. Wedegaertner, P.B., Gilma n,A.G., Benovic,J.L. and Kozasa,T. (1999) Rollin s,B.J. (1997) Chemokines. Blood, 90, 909-928. Selective regulation of G<Xq by an RGS domain in the G protein­ /11 Romano,C., Yang,W.L. and O'Malley,K.L. (1996) Metabotropic coupled receptor kinase, GRK2. J. Biol. Ch em. , 274, 34483-34492. glutamate receptor 5 is a disulfide-linked dimer. J. Biol. Ch em. , 271, Cve jic,S. and Devi,L.A. (1997) Dimerization of the Ii opioid receptor: 28612-28616. implication for a role in receptor internalization. J. Biol. Chem., 272, Rossi,D. and Zlotnik,A. (2000) The biology of chemokines and their 26959-26964. receptors. Annu. Rev. Imm unol., 18, 217-242. Daaka,Y., Luttrell,L.M. and Lefkowit z,R.J. (1997) Switching of the Sanchez-Madrid,F. and del Pozo,M.A. (1999) Leukocyte polarization in coupling of the � -adrenergic receptor to different G proteins by cell migration and immune interactions. EMB O J., 18, 501-511. protein kinase A. Nature, 390, 88-91. Sanz-Rodriguez,F., Hidalgo,A. and Teixid6,J. (2001) Chemokine Heber t,T.E., Moffett ,S., Morell o,J.-P., Loisel, T.P., Bichet, D.G., stromal cell-derived factor- la modulates VLA-4 integrin-mediated Barret,C. and Bouvier,M. (1996) A peptide derived from a �z­ multiple myeloma cell adhesion to CS-1/fibronectin and VCAM-1. adrenergic receptor transmembrane inhibits both receptor dimerization Blood, 97, 346-351. and activation. J. Biol. Chem. , 271, 16384-16392. Sasaki,T. et al. (2000) Function of PI3Ky in thymocyte development, T Heber t,T.E., Loise l,T.P., Adam,L., Ethie r,N., Onge,S.S. and Bouvier,M. cell activation, and neutrophil migration. Science, 287, 1040-1046. (1998) Functional rescue of a constitutively desensitized �2AR Soede ,R.D.M., Wijnand s,Y.M., Kamp,M., van der Valk,M.A. and through receptor dimerization. Biochem. J., 330, 287-293. Roos,E. (2000) G; and G /11 proteins are involved in dissemination Johnsto n,B., Bums, A.R., Suematsu,M., Issekut z,T.B., Woodman ,R.C. of myeloid leukemia cells to the liver and spleen, whereas bone and Kubes,P. (1999) Chronic inflammation upregulates chemokine marrow colonization involves G but not G;. Blood, 96, 691-69 8. q1 receptors and induces neutrophil migration to monocyte Springe r,T.A. (1994) Traffic signals for lymphocyte recirculation and chemoattractant protein- I. J. Clin. Invest. , 103, 1269-1276. leukocyte emigration: the multistep paradigm. Cell, 76, 301-314. Jorda n,B.A. and Devi,L.A. (1999) G-protein-coupled receptor Toker,A. and Cantley,L.C. (1997) Signalling through the lipid products heterodimerization modulates receptor function. Nature, 399, of phosphoinositide-3-OH kinase. Nature, 387, 673-676. 697-700. Tume r,L., Ward,S.G. and Westwick,J. (1995) RANTES-activated Katoh,H., Aoki,J., Yamaguchi, Y., Kitano,Y., Ichikawa,A. and human T lymphocytes: a role for phosphoinositide 3-kinase. Negishi,M. (1998) Constitutively active Ga2, Gcx , and G<Xq 1 13 J. Im munol., 155, 2437-2444. induce Rho-dependent neurite retraction through different signaling Tume r,S.J., Domin,J., Waterfield, M.D., Ward,S.G. and Westwick,J. pathways. J. Biol. Chem. , 273, 28700-28707. (1998) The CC chemokine monocyte chemotactic peptide-I activates Kaupmann,K. et al. (1998) GABA -receptor subtypes assemble into both the class Y p85/pl 10 phosphatidylinositol 3-kinase and the class functional heteromeric complexes. Nature, 396, 683-687. II PI3K-C2cx. J. Biol. Chem. , 273, 25987-25995. Kuang, Y., Wu,Y., Jiang,H. and Wu,D. (1996) Selective G protein Vicente-Manzanares,M. et al. (1999) Involvement of phosphatidyl­ coupling by C-C chemokine receptors. J. Biol. Chem. , 271, inositol 3-kinase in stromal cell-derived fa ctor- la -induced 3975-397 8. lymphocyte polarization and chemotaxis. J. Imm unol., 163, Kuner,R., Kohr,G., Griinewal d,S., Eisenhardt,G., Bah,A. and Komau, 4001-4012. H.-C. (1999) Role of heteromer formation in GABA receptor Vila-Cor o,A.J., Rodriguez-Fra de,J.M., Martfn de Ana ,A.M., function. Science, 283, 74-77. Moreno-Ortf z, M.C., Martinez -A.,C. and Mellado,M. (1999) The Lee,B. et al. (1998) Influence of the CCR2-V64I polymorphism on chemokine SDF- lcx triggers CXCR4 receptor dimerization and HIV-1 coreceptor activity and chemokine receptor function of CCR2b, activates the JAK/STAT pathway. FA SEB J., 13, 1699-1710. CCR3, CCR5 and CXCR4. J. Vir al. , 72, 7450- 7458. Li,Z., Jiang,H., Xie,W., Zhang,Z., Smrcka, A.V. and Wu,D. (2000) Roles White,J .H. et al. (1998) Heterodimerization is required for the formation of PLC-�2 and -�3 and PI3Ky in chemoattractant-mediated signal of a functional GABA receptor. Nature, 396, 679-682. transduction. Science, 287, 1046-1049. Wolf ,M., Delgado,M .B., Jones, S.A., Dewal d,B., Clark-Lewis,I. and Littma n,D.R. (1998) Chemokine receptors: keys to AIDS pathogenesis. Baggiolini,M. (1998) Granulocyte chemotactic protein 2 acts via Cell, 93, 677-680. both IL-8 receptors CXCRl and CXCR2. Eur. J. Imm unol., 28, Luo,X., Zeng,W., Xu,X., Popov,S., Davignon,!., Wilkie, T.M., 164-170. 2506 Chemokine receptor heterodimerization Wong,M. and Fish,E.N. (1998) RANTES and MIP-la activate stats in T cells. J. Biol. Chem. , 273, 309-314. Wuyts,A., Van Osselaer,N., Haelens,A., Samson,Y., Herdewijn,P., Ben-Baruch,A., Oppenheim,J.J., Proost,P. and Van Damme,J. (1997) Characterization of synthetic human granulocyte chemotactic protein 2: usage of chemokine receptors CXCRl and CXCR2 and in vivo inflammatory properties. Biochemistry, 36, 2716--2723. Zeng,F.Y. and Wess,J. (1999) Identification and molecular characterization of m3 muscarinic receptor dimers. J. Biol. Chem., 274, 19487-19497. Received January 18, 2001; revised March 20, 2001; accepted March 22, 2001

Journal

The EMBO Journal – Springer Journals

Published: May 15, 2001

Keywords: chemokine receptor; dimerization; G proteins; phosphatidyl inositol 3‐kinase

There are no references for this article.