Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer

Association of c-Raf expression with survival and its targeting with antisense oligonucleotides... British Journal of Cancer(2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign doi: 10.1054/ bjoc.2001.2139, available online at http://www.idealibrary.com on http://www.bjcancer.com Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer 1 1 2 1 2 1 1 F McPhillips, P Mullen, BP Monia, AA Ritchie, FA Dorr, JF Smythand SP Langdon 1 2 ICRF Medical Oncology Unit, Western General Hospital, Edinburgh EH4 2XU, UK; ISIS Pharmaceuticals Inc, Carlsbad, CA, USA Summary c-Raf is an essential component of the extracellular related kinase (ERK) signal transduction pathway. Immunohistochemical staining indicated that c-Raf was present in 49/53 ovarian adenocarcinomas investigated and high c-Raf expression correlated si gnificantly with poor survival ( P = 0.002). c-Raf protein was detected in 15 ovarian cancer cell lines. Antisense oligodeoxynucleotides (ODNs) (ISIS 5132 and ISIS 13650) reduced c-Raf protein levels and inhibited cell proliferation in vitro. Selectivity was demonstrated by the lack of effect of ISIS 5132 on A-Raf or ERK, while a random ODN produced only minor effects on growth and did not influence c-Raf expression. ISIS 513 2 produced enhanced apoptosis and cells accumulated in S and G /M phases of the cell cycle. In vivo, ISIS 5132 inhibited growth of the s.c. SKOV-3 xenograft while a mismatch ODN had no effect. These data indicate that high levels of c-Raf expression may be important in ovarian cancer and use of antisense ODNs targeted to c-Raf could provide a strategy for the treatment of this disease. © 2001 Cancer Res earch Campaign http://www.bjcancer.com Keywords: Raf; antisense; ovarian; cancer; oligodeoxynucleotide c-Raf is a ubiquitously expressed 74 kDa serine/threonine protein cancer cells (Monia et al, 1996a; Lau et al, 1998). Second genera- kinase which is central to the ERK pathway (Daum et al, 1994) tion antisense ODNs containing 2′-methoxyethyl sugar modifica- and has long been implicated in oncogenesis (Rapp et al, 1988; tions, such as ISIS 13650, have also been developed and these may Storm et al, 1990). Despite this, little information on c-Raf protein be more potent inhibitors of mRNA expression (Monia, 1997). expression in ovarian cancer is available. c-Raf is activated by To investigate the role and function of c-Raf in ovarian cancer, phosphorylation after translocation to the plasma membrane by a we have measured c-Raf expression in primary tumours and mechanism that involves Ras (Avruch et al, 1994). Mutations in ovarian cancer cell lines and studied relationships between protein ras genes have been frequently detected in ovarian tumours and expression and histology, grade of differentiation, tumour stage Ras protein is downstream of receptors such as the EGF/erbB and patient survival time. To explore the therapeutic potential of receptor tyrosine kinases (Rozakis-Adcock et al, 1993; Teneriello first- and second-generation c-Raf antisense ODNs in ovarian et al, 1993). Compared to normal ovary and benign ovarian cancer, the extent of growth inhibition following antisense ODN tumours, malignant ovarian tumours have increased expression of treatment was investigated in ovarian cancer cell lines and a EGF receptor (erbB-1) (Stewart et al, 1992) and erbB2 (Meden xenograft model. Our findings demonstrate that high levels of and Kuhn, 1997). The erbB receptors and Ras are currently being c-Raf expression are important in ovarian cancer and use of anti- investigated as potential targets for growth inhibitors in cancer sense ODNs targeted to c-Raf may provide a novel strategy for the (Cowsert, 1997; Fan and Mendelsohn, 1998; Witters et al, 1999). treatment of this disease. Targeting growth inhibitors to c-Raf in cancer cells would elimi- nate c-Raf-mediated cell proliferation signals from these upstream MATERIALS AND METHODS effectors and prevent cell proliferation arising from over- expression of c-Raf. Tumour samples Targeting genes using antisense technology provides a highly selective, sequence-specific mechanism for inhibiting the expres- Fresh primary ovarian tumour tissue was obtained from 53 previ- sion of a chosen gene product. A number of antisense oli- ously untreated patients with epithelial ovarian cancer at initial godeoxynucleotides (ODNs) are currently undergoing clinical debulking surgery, transferred to liquid nitrogen, then formalin- trials for the treatment of cancer (Cho-Chung, 1999; Nemunaitis fixed and embedded in paraffin. Tumour histology was assessed et al, 1999; Yuen et al, 1999). ISIS 5132, a 20-mer phosphoroth- on paraffin embedded sections and classified according to WHO ioate antisense ODN (first generation compound) that targets the criteria (details in Table 1). 3′ untranslated region of c-Raf mRNA, inhibits the expression of c-Raf mRNA and protein in lung, colon, cervical and prostate Cell lines Received 6 August 2001 CDDP PEO1, PEO1 , PEO4, PEO6, PEO14 and PEO16 were estab- Accepted 31 August 2001 lished as described previously (Langdon et al, 1988); SKOV-3 and Correspondence to:SP Langdon CaOV3 cells were obtained from the American Type Culture 1753 1754 F McPhillips et al Collection (Manassas, VA, USA); OVCAR3, OVCAR4 and were blocked with 1% blocking agent in TBS (20 mM Tris-HCl, OVCAR5 were obtained from Dr TC Hamilton (Fox Chase 137 mM NaCI, pH 7.5) before probing with the appropriate Institute, Philadelphia, PA, USA); 41M, 59M, OAW42 and A2780 primary antibody, anti-c-Raf (R19120, Transduction Laboratories, cells were obtained from the European Tissue Collection (Porton Lexington, KY), anti-A-Raf (R14320, Transduction Laboratories), Down). All cell lines were routinely grown as monolayer cultures anti-ERK (E16220, Transduction Laboratories) overnight at 4˚C. in RPMI 1640 (Life Technologies Inc, Gaithersburg, MD) supple- Immunoreactive bands were detected using enhanced chemilumi- –1 mented with 10% heat-inactivated fetal calf serum and 100 iu ml nescent reagents (1520709, Boehringer Mannheim) and Hyperfilm penicillin/streptomycin. Cells were maintained at 37˚C in a 5% ECL (Amersham, Buckinghamshire, UK). CO humidified incubator. Antisense ODNs Immunohistochemistry Antisense ODNs targeted to the 3′ untranslated region of c-Raf Sections (3 µm) were deparaffinised and rehydrated. Endogenous mRNA (sequence: TCCCGCCTGTGACATGCATT) were supplied peroxidase activity was blocked by incubating sections in 3% by ISIS Pharmaceuticals (Carlsbad, CA). Two forms of the anti- H O for 30 min immersing in citric acid buffer (0.005M, pH 6.0) sense ODNs were used: a first generation compound (ISIS 5132) 2 2 and microwaving for 3 × 5 min. Slides were washed in 0.05M which has a phosphorothioate backbone and a second generation Tris/HCI buffer (pH 7.6) then incubated in 20% fetal calf serum in compound (ISIS 13650) which also has a phosphorothioate back- the above Tris buffer for 10 min. Anti-c-Raf antibody (R19120, bone and the addition of 2′ methoxyethyl groups on the sugar Transduction Laboratories) was used at 1:10 –1:20 dilution in 20% moiety. 2 control ODNs were available: a second generation random fetal calf serum and sections were incubated for 1.5–2 h. A ODN (ISIS 16971; sequence, TCACATTGGCGCTTAGCCGT) streptavidin–biotin multilink method (StrAviGen Multilink kit; and a first generation mismatch ODN (ISIS 10353 sequence, Biogenex, San Ramon, CA) was used to detect reactivity. Sections TCCCGCGCACTTGATGCATT). were stained with a secondary multilink antibody at a 1:20 dilution for 30 min, then incubated with a horseradish-peroxidase-labelled Growth and protein inhibition experiments streptavidin complex at a 1:20 dilution for 30 min. Diaminobenzidine tetrachloride was used as chromagen and For growth inhibition experiments, log phase cells were applied for 5 min. Sections were lightly counterstained in haema- trypsinized and seeded into 24-well tissue culture plates (1 × 10 in toxylin, dehydrated and mounted. Negative controls for each 1 ml) and incubated to reach 40–60% confluence. Cells were then tumour section were included by replacing the primary antibody washed with PBS before adding 250 µl of Optimem (Gibco-BRL) –1 with Tris buffer. Immunoreactive scores between 0 and 12 were containing ‘Lipofectin’ (Gibco-BRL) (6 µlml ). Antisense and generated for each sample and represent the product of intensity (0 = random ODNs were added (50 nM–200 nM) from 50 µM stock negative, 1 = weak, 2 = moderate, 3 = strong) and percentage posi- solutions. Cells were incubated at 37˚C for 3 h, washed with PBS, –1 tive cell staining (0 = 0%, 1 = 1–25%, 2 = 26–50%, 3 = 51–75%, replenished with RPMI (plus 10% fetal calf serum and 100 iu ml 4 = 76–100%). penicillin/streptomycin) and replaced in the incubator for the remainder of the time course. Cells were trypsinized and counted at the appropriate time point using a ‘ZM’ Coulter Counter. Statistics c-Raf protein inhibition experiments were carried out as above Relationships between variables were analysed using the Fisher’s except that cells (2.5 × 10 in 4 ml) were plated into 60 mm diam- exact test, the student t-test and the Mann–Whitney test where eter petri dishes and washed with PBS (2 ml) prior to addition of appropriate. Differences in survival were determined using the Optimem/Lipofectin/ODN (1 ml). Cells were lysed and analysed Kaplan–Meier method and groups were compared using the log- by Western blotting as previously described. rank test and χ test. Cell cycle analysis Western blotting DNA analysis of treated cells was carried out on a Becton Cells were grown to 70% confluence, washed twice with PBS, and Dickinson ‘FACSCalibur’ flow cytometer using methodology lysed in ice cold hypotonic lysis buffer (50 mM Tris-HCI (pH 7.5), described by Levack et al (1987). 5 mM EGTA (pH 8.5), 150 mM NaCl, 1% Triton X-100, 2 mM sodium orthovanadate, 50 mM sodium fluoride, 1 mM phenyl- Apoptosis assay –1 –1 methanesulfonylfluoride, 10 µg ml leupeptin, 10 µg ml apro- tinin and 10 mM sodium molybdate). Lysates were centrifuged for SKOV-3 cells were treated with ODNs as described above and 6 min at 13 000 rpm in a microfuge. Tumour samples (100 mg) apoptosis was measured using the TACS Annexin V-FITC kit were finely chopped, then homogenized on ice in a Silverson (R& D Systems) following the prescribed protocol. homogenizer in 1.8 ml lysis buffer (excluding Triton X-100). Samples were incubated on ice after the addition of 1% Triton X- Xenograft experiments 100, then centrifuged 14 000 rpm for 30 min. Protein concentra- tions of supernatants were determined using the Bio-rad Protein Female adult nude (nu/nu) mice were obtained from ICRF Assay Kit (Bio-rad, Richmond, CA). Cell lysates (30 µg) or (Clare Hall, South Mimms, UK) and maintained in negative pres- tumour lysates (50 µg) were resolved on 10% or 12% SDS-PAGE sure isolators. SKOV-3 cells (5 × 10 cells/injection) were injected then transferred electrophoretically overnight onto Immobilon-P into both flanks of 2 groups of mice. The control group membranes (Millipore, Bedford, MA). After transfer, membranes consisted of 10 mice (2 tumours/mouse) and the treatment groups British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign c-Raf in ovarian cancer 1755 consisted of 5 mice. ODNs were administered i.p. daily in PBS on the days indicated. Tumour volumes, assessed twice weekly by caliper measurements of the tumour in 2 dimensions, were calcu- lated by the formula π/6 × length × width . Treatment was initiated either 24 h after cell implantation or when tumours had reached a median diameter of 4 mm. Relative tumour volume was evaluated by dividing the volume at day × (the number of days after the start of treatment) by the volume at day 0 (the day treatment started). UKCCCR Guidelines (1998) were followed throughout. RESULTS Immunoscore 0 −6 (n = 38) c-Raf expression in primary ovarian cancer c-Raf expression was identified in 49 of 53 ovarian cancer sections Immunoscore 7 −12 (n = 14) and varied from weak to intense staining (examples are illustrated in Figure 1A). Immunoreactivity was found almost exclusively in 1 2345 6789 10 the epithelial cells with only minor staining in the stroma. The Years relationships between immunoreactive scores and clinical and Figure 1 High c-Raf expression is associated with poor survival in ovarian pathological parameters are represented in Table 1. Serous adeno- cancer. (A) Examples of c-Raf immunoreactivity, detected as described in ‘Materials and Methods ’. Epithelial cells are diaminobenzidine positive carcinomas expressed higher levels of c-Raf than all other (brown) and counterstain is hematoxylin (blue). Low and high power subtypes combined (P = 0.005, Fisher’s exact test). No significant magnifications. (B) Kaplan–Meier survival curves with log-rank analysis; high associations between c-Raf expression level and either stage (I / II expressers vs low expressers ( P = 0.002) vs III / IV, P = 0.18 Fisher’s exact test) or grade of differentiation c-Raf expression in ovarian cancer cell lines (poor vs moderate/well, P = 0.17, Fisher’s exact test) were observed. c-Raf protein, detected by Western blotting, was evident in all 15 Survival data were available for 52/53 patients. High c-Raf expres- cell lines analysed. Levels of c-Raf varied 24-fold between cell sion was linked with poor survival in this group (Figure 1B). The lines, compared to only a 2.5-fold and 11-fold variation in ERK survival of patients whose tumours had an immunoreactive score ≥ 7 and A-Raf respectively (Figure 2A and 2B). (n = 14) was significantly poorer than that of patients with scores ≤ 6 (n = 38) (P = 0.002, log-rank test). Since histology and stage are Antisense oligonucleotides reduce c-Raf protein levels major prognostic variables, we also analysed survival in patients in SKOV-3 cells having stage III serous adenocarcinomas which represented a The ability of the antisense ODNs ISIS 13650 and ISIS 5132 to majority sub-group (n = 28). Again patients whose tumours had a selectively reduce the amount of c-Raf protein was investigated in higher level of c-Raf expression (immunoreactive score of ≥ 7) (n = 12) had significantly poorer survival (P = 0.035, log-rank test) than patients with tumours expressing lower levels of c-Raf (n = 16). .. , ..• C-Raf Table 1 c-Raf expression in primary ovarian cancer . - . (74kD) ..... --­ Number of patients with A-Raf Immunoscore immunoscore a •• .,, (68kD) _.(!IL ••••• 0–6 7–12 P value ERK All tumours 39 14 (42kD) Stage I / II 13 2 0.18 III / IV 23 12 Differentiation Well / moderate 14 2 0.17 Poor 21 11 Histology Serous 16 12 Endometrioid 17 1 0.005 [. p I I p I • i •• -i 11 i Clear cell 5 1 Mucinous 1 0 The expression of c-Raf was determined by immunohistochemical staining as described in Materials and Methods and scores between 0 and 12 were Figure 2 (A) Expression of c-Raf, A-Raf and ERK2 in 15 ovarian cancer generated for each sample. 53 patient samples were analysed for cell lines. Cells were lysed and samples electrophoresed as described in expression but information on stage and grade were available for 50 and ‘Materials and Methods ’. Blots were probed with anti-c-Raf, anti-A-Raf or b c 48 patients respectively. Fisher’s exact test. Fisher’s exact test (serous vs anti-ERK2. Data shown is a typical result of n = 3. (B) Densitometric analysis rest). (Integrated Optical Density units) of c-Raf expression, n = 3 © 2001 Cancer Research Campaign British Journal of Cancer (2001) 85(11), 1753–1758 Survival (%) C-Raf expression (IOD) PE01 PE01 PEO1cddp PEO1cddp PE04 PE04 PE06 PE06 PE014 PE014 PEO16 PEO16 OVCAR3 OVCAR3 OVCAR4 OVCAR4 OVCAR5 OVCAR5 41M 41M 59M 59M OAW42 OAW42 SKOV-3 SKOV-3 CaOV3 CaOV3 A2780 A2780 1756 F McPhillips et al A B ISIS 5132 (nM) c-Raf ISIS 13650 c-Raf 60 * c-Raf ISIS 5132 A-Raf *P < 0.05 * c-Raf ISIS 16971 ERK 50 nM 100 nM 200 nM 5132 13650 16971 C Time (h): 24 48 *P < 0.05 c-Raf 24 48 72 Figure 3 Effect of c-Raf antisense ODNs on c-Raf protein level in SKOV-3 Hours after treatment cells. After treatment with ISIS 5132, ISIS 13650 or ISIS 16971, cells were _ _.,,. __ lysed and samples electrophoresed and probed with anti-c-Raf, anti-A-Raf or ---0-- --+- 5132 13650 --·• ··· 16971 No oligo anti-ERK antibodies as described in ‘Materials and Methods ’. (A) Suppression of c-Raf protein by c-Raf antisense oligonucleotides but not a random ODN. (B) Suppression of c-Raf but not A-Raf and ERK by ISIS 5132 at 48 h after treatment. (C) Effect of time of c-Raf protein reduction by ISIS 5132 and ISIS [] SKOV-3 cells. After 48 h, both ODNs reduced c-Raf levels at 100 nM and 200 nM (Figure 3A). In comparison, similar concen- trations of the random control ODN ISIS 16971 had no effect on c-Raf levels. The specificity of ISIS 5132 for c-Raf was examined by measuring its effects on A-Raf and ERK and after 48 h, ISIS 5132 (200 nM) had no effect on the expression of either of these Figure 4 C-Raf antisense ODNs inhibit growth in ovarian cancer cell lines. proteins (Figure 3B). To determine the time required for c-Raf (A) 72 h after treatment with ISIS 5132, ISIS 13650 or ISIS 16971 SKOV-3 antisense ODNs to exert their effects on c-Raf protein, the level of cells were trypsinized and counted on a ‘ZM’ Coulter Counter. Cell counts taken at day 0 (the day treatment began) are deducted from the 72 h cell c-Raf present in SKOV-3 cells was assayed at various intervals count. The value at each concentration is expressed as the percentage following antisense treatment. Both ISIS 13650 (200 nM) and growth compared to 100%, the value obtained from untreated cells grown for ISIS 5132 (200 nM) reduced c-Raf levels by > 50% at 24 h and 72 h. (B) SKOV-3 cells were counted at 24, 48 and 72 h after treatment with ISIS 5132, ISIS 13650 or ISIS 16971. ( C) 72 h after treatment with ISIS 5132 almost complete removal of c-Raf protein was observed at 48 h or ISIS 13650 cells were trypsinized and counted. In all cell lines except (Figure 3C). OVCAR5 growth rates of treated cells are significantly different from untreated cells (P < 0.05; student t-test) c-Raf antisense ODNs inhibit cellular proliferation in Effect of c-Raf antisense ODNs in a panel of ovarian SKOV-3 cells cancer cell lines To evaluate the effectiveness of c-Raf antisense ODNs as anti- The ability of c-Raf antisense ODNs to inhibit cell growth was proliferative agents, SKOV-3 cells were treated with ISIS 13650, further investigated in a panel of 12 ovarian cancer cell lines 48 h ISIS 5132 or random ODN and the cell number determined 72 h after treatment. Both ISIS 13650 and ISIS 5132 inhibited cell after treatment. At 200 nM both ISIS 13650 and ISIS 5132 proliferation by ≥ 60% in 9/12 cell lines examined (Figure 4C) demonstrated > 80% inhibition of cell growth, compared to <30% compared to < 30% inhibition shown by the random ODN in inhibition shown by the random ODN (Figure 4A). The time selected cell lines. required for c-Raf antisense ODNs to exert their effects on cell proliferation was investigated in SKOV-3 cells. Cells not exposed ISIS 5132 causes cell cycle arrest and enhanced to ODN (control cells) and cells treated with mismatch ODN (200 apoptosis in SKOV-3 cells nM) grew steadily over the time course demonstrating a 3-fold increase in cell number over the 72 h period (Figure 4B). In DNA analysis showed an accumulation of cells arrested in the S contrast, the addition of 200 nM ISIS 5132 or ISIS 13650 resulted and G /M phases of the cell cycle with a concomitant reduction in in marked growth inhibition at all time points investigated, with the G /G phase. These specific effects were dose-dependent and 0 1 both antisense ODNs preventing cell growth in the first 24 h after not seen in either untreated cells or cells treated with ISIS 16971 treatment (Figure 4B). (Figure 5A). A dose-dependent enhancement of apoptosis was British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign 100 nM No oligo 200 nM ISIS 13650 ISIS 5132 ISIS 13650 ISIS 5132 No oligo Relative growth (% of control) Cell count Relative growth (% of control) SKOV-3 OAW42 PE04 OVCAR3 PEO1cddp PEO14 OVCAR4 PEO1 41m A2780 CaOV3 OVCAR5 c-Raf in ovarian cancer 1757 I I i I no oligo . i I 5132 (200 nM ) -- - 11 - _L 5132 (nM) 16971 (nM) DNA content Treatment period * G0/G1 S G2/M D • ra 10 * * * 10 * 0 * * 010 20 30 40 Day ·· ··O ·· ·· 5132—10 mg/kg 5132—25 mg/kg ····b. ··· · 10353 Vehicle Ii 111 I ••• 1 Control 5132 (nM) 16971 (nM) ISIS 5132 Figure 5 Effect of c-Raf antisense ODNs on cell cycle distribution and apoptosis in SKOV-3 cells. ( A) 48 h after treatment with ISIS 5132 or ISIS 16971 cells were trypsinized and stained for total DNA content using propidium iodide. Cell cycle distribution was carried out using a ‘FACSCalibur’ flow cytometer and results analysed using ‘Modfit’ software. The relative proportion of cells in the G0/G1, S and G2/M phase of the cycle is shown along with representative DNA histograms. ( B) Apoptosis levels were also assayed after 48 h in similarly treated SKOV-3 cells that had been 3 5 exposed to FITC-labelled annexin V and counterstained with propidium iodide Day Figure 6 Effect of ISIS 5132 on in vivo growth of SKOV-3 cells. similarly seen in cells treated with ISIS 5132 compared with 6 (A) Treatment initiated 24 h after implantation of 5 × 10 cells s.c. ISIS 5132 –1 –1 was administered i.p. at 25 or 10 mg kg day for 21 days and compared untreated cells or cells exposed to ISIS 16971 (Figure 5B). –1 –1 with a mismatch control (ISIS 10353 –25 mg kg day ) or vehicle only. (B) ISIS 5132 treatment of advanced SKOV-3 tumours. Tumours were allowed to grow for 35 days before treatment (mean diameter = 4 mm). ISIS 5132 inhibits growth of SKOV-3 ovarian cancer Relative tumour volumes after 3 and 5 days treatment are shown. Mean ± xenografts standard errors of at least 10 tumours indicated. *significantly different from vehicle, P < 0.05 (t-test) ISIS 5132 inhibited the growth of SKOV-3 cells implanted as a subcutaneous xenograft in the flanks of nude mice. Treatment previously been identified in ovarian cancer cell lines and attributed initiated 24 h after implantation of cells reduced the growth rate of to an increase in MEK and c-Raf activity (Hoshino et al, 1999). In –1 –1 these tumours at both 10 and 25 mg kg day compared to a addition, ERK activation has been shown to correlate linearly with vehicle control (Figure 6A). A mismatch control (ISIS 10353) was increasing concentrations of MEK (Zheng and Guan, 1993). These available for these studies and had no effect on growth. When data in combination with our finding that c-Raf is highly expressed treatment was delayed until tumours had reached a median size of in most of the ovarian cancer cell lines suggest that an increase in –1 –1 4 mm, ISIS 5132 (25 mg kg day ) again produced a significant c-Raf level may contribute to increased signalling through the ERK effect on growth (Figure 6B). pathway. Further analysis of the ERK signalling pathway in ovarian cancer cell lines is essential to elucidate the role of c-Raf in this disease, and will form the basis of future studies. DISCUSSION The use of antisense ODNs has allowed us to establish that c-Raf In the present study, which is the first to look at the prognostic plays an important role in the proliferation of ovarian cancer cell significance of c-Raf expression in ovarian cancer, we show that lines, supporting conclusions of other studies that c-Raf is a critical high c-Raf expression is a negative prognostic factor. c-Raf was mediator of oncogenic transformation (Storm et al, 1990; Daum present in 92% of the ovarian adenocarcinomas investigated and a et al, 1994). We have shown that both ISIS 5132 and ISIS 13650 high level of c-Raf expression correlated significantly with both reduce c-Raf protein in SKOV-3 ovarian cancer cells, in line with poor survival and serous histology. Within the serous subset, there observations in other disease types (Monia et al, 1996a; Monia, was again a significant correlation between expression and 1997; Lau et al, 1998). Evidence to support specificity was provided survival, indicating that high c-Raf expression is associated with by the observations that while c-Raf was reduced, related signalling poor survival irrespective of other parameters such as histology molecules were unaffected and a random ODN (ISIS 16971) had no and stage. The epithelial tumour cells were highly positive for c- effect on c-Raf protein expression. Raf staining compared to stromal cells, which showed little c-Raf Investigation of the effects of antisense ODNs in a panel of expression. ovarian cancer cell lines has allowed an insight into the efficiency The c-Raf signalling pathway plays an important role in the of these antisense compounds in a range of cell types with variable growth regulation of some ovarian cancers. ERK activation has amounts of c-Raf protein. Despite a 24-fold variation in c-Raf © 2001 Cancer Research Campaign British Journal of Cancer (2001) 85(11), 1753–1758 Annexin V positivity (%) percentage No oligo No oligo 25 50 Mean tumour volume (mm) Mean relative tumour volume 1758 F McPhillips et al Cho-Chung YS (1999) Antisense oligonucleotide inhibition of serine/threonine protein levels between the cell lines, both ISIS 5132 and ISIS kinases: an innovative approach to cancer treatment. Pharmacol Ther 82: 13650 substantially reduced cell growth. Most of the cell lines 437–449 were > 60% growth inhibited, while 3 cell lines (A2780, OVCAR5 Cowsert LM (1997) In vitro and in vivo activity of antisense inhibitors of ras: and CaOV3) were < 40% growth inhibited by antisense ODNs. potential for clinical development. Anticancer Drug Des 12: 359–371 These intercellular growth inhibitory differences cannot be Daum G, Eisenmann-Tapp I, Fries H-W, Troppmair J and Rapp UR (1994) The inns and outs of raf kinases. TIBS 19: 474–480 accounted for by the variation in c-Raf protein levels between the Fan Z and Mendelsohn J (1998) Therapeutic application of anti-growth factor cell lines. Explanations for these differences are likely to come from receptor antibodies. Curr Opin Oncol 10: 67–73 further analysis of the growth signalling pathways in these cells. It Hoshino R, Chatani Y, Yamori T, Tsuruo T, Oka H, Yoshida O, Shimada Y, Ari-IS, is also possible that some cell lines do not require c-Raf for Wada H, Fujimoto J and Kohno M (1999) Constitutive activation of the 41-/43-kDa mitogen-activated protein kinase signaling pathway in human cellular proliferation. Such observations have been reported in a tumors. Oncogene 18: 813–822 study investigating constitutive activation of the ERK signalling Langdon SP, Lawrie SS, Hay FG, Hawkes MM, McDonald A, Hayward IP, Schol pathway in over 100 different tumour cell lines, including DJ, Hilgers J, Leonard RC and Smyth JF (1988) Characterization and OVCAR3, SKOV-3 and OVCAR5 (Hoshino et al, 1999). Both properties of nine human ovarian adenocarcinoma cell lines. Cancer Res 4: OVCAR3 and SKOV-3 demonstrated high constitutive activation 6166–6172 Lau QC, Brusselbach S and Muller R (1998) Abrogation of c-Raf expression of the ERK pathway and in our study these cell lines were growth induces apoptosis in tumour cells. Oncogene 16: 1899–1902 inhibited to a great degree by c-Raf antisense ODNs. In contrast, Levack PA, Mullen P, Anderson TJ, Miller WR and Forrest APM (1987) DNA OVCAR5 exhibited minimal constitutive ERK activation that was analysis of breast tumour fine needle aspirates using flow cytometry. Br J not increased upon stimulation with serum (Hoshino et al, 1999). Cancer 56: 643–646 Meden H and Kuhn W (1997) Overexpression of the oncogene c-erbB-2 This suggests that OVCAR5 may not signal predominantly (HER2/neu) in ovarian cancer: a new prognostic factor. Eur J Obstet Gynecol through c-Raf, and may explain our inability to inhibit OVCAR5 Reprod Biol 71: 173–179 cell proliferation with antisense ODN. Consequently, some Monia BP (1997) First- and second-generation antisense inhibitors targeted to human ovarian cancer types may be highly responsive to therapies that c-raf kinase: in vitro and in vivo studies. Anticancer Drug Des 12: 327–339 target c-Raf, while others may not. Monia BP, Johnston JF, Geiger T, Muller M and Fabbro D (1996a) Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against Finally, we have demonstrated that ISIS 5132 is effective in vivo, C-raf kinase. Nature Med 2: 668–675 significantly inhibiting the growth of the SKOV-3 xenograft. ISIS Monia BP, Sasmor H, Johnston JF, Freier SM, Lesnik EA, Muller M, Geiger T, 5132 is presently undergoing clinical trials and has been shown to Altmann KH, Moser H and Fabbro D (1996b) Sequence-specific antitumor significantly reduce levels of c-raf mRNA in peripheral blood activity of a phosphorothioate oligodeoxyribonucleotide targeted to human C- raf kinase supports an antisense mechanism of action in vivo. Proc Natl Acad mononuclear cells. This was associated with clinical benefits in Sci USA 93: 15481–15484 2 out of 14 patients with a mixture of advanced solid tumours Nemunaitis J, Holmlund JT, Kraynak M, Richards D. Bruce J, Ognoskie N, Kwoh (O’Dwyer et al, 1999). ISIS 5132 has been rigorously examined and TJ, Geary R, Dorr A, Von Hoff D and Eckhardt SG (1999) Phase I evaluation an antisense mechanism of action has been confirmed (Monia et al, of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase C-alpha, in 1996b). Our data further support the validity of ISIS 5132 as an anti- patients with advanced cancer. J Clin Oncol 17: 3586–3595 O’Dwyer PJ, Stevenson JP, Gallagher M, Cassella A Vasilevskaya I, Monia BP, cancer drug that specifically targets c-Raf. In addition we provide Holmlund J, Dorr FA and Yao KS (1999) c-Raf-1 depletion and tumor evidence that the 2nd generation c-Raf antisense oligonucleotide responses in patients treated with the c-raf-1 antisense oligodeoxynucleotide (ISIS 13650) reduces c-Raf protein levels and inhibits cellular ISIS 5132 (CGP 69846A). Clin Cancer Res 5: 3977–3982 proliferation with potency comparable to ISIS 5132 in vitro. Rapp UR, Cleveland JL, Bonner TI and Storm SM (1988a) The Raf oncogenes. In: Reddy EP, Skalka AM and Curran T (eds), pp 213–253 The Oncoge ne In summary, our findings demonstrate an association between Handbook,. Amsterdam, the Netherlands. Elsevier Science Publishers B.V. 1988 high levels of c-Raf expression and reduced survival time for Rapp UR, Huleihel M, Pawson T, Linnoila I, Minna JD, Heidecker G, Cleveland JL, patients with ovarian adenocarcinomas suggesting an important role Beck T, Forchhammer J and Storm SM (1988b) Role of raf oncogenes in lung for c-Raf in tumour growth, although the extent of tumour types that carcinogenisis. J Int Assoc Study Lung Cancer 4: 162 heavily depend on c-Raf remains to be explored. We have shown Rozakis-Adcock M, Fernley R, Wade J, Pawson T and Bowtell D (1993) The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras that ODNs that specifically target c-Raf are effective growth activator mSos1. Nature 363: 83–85 inhibitors for the majority of ovarian cancer cells. In addition, the Stewart CJ, Owens OJ, Richmond JA and McNicol AM (1992) Expression of use of antisense ODNs will help identify cells that rely on c-Raf for epidermal growth factor receptor in normal ovary and in ovarian tumors. Int J growth. Studies examining the effects of ISIS 5132 and ISIS 13650 Gynecol Pathol 11: 266–272 Storm SM, Brennscheidt U, Sithanandam G and Rapp UR (1990) Raf oncogenes in in vivo and in combination with other standard chemotherapeutic carcinogenesis. Crit Rev Oncog 2: 1–8 agents will give further information on the practical application of Teneriello MG, Ebina M, Linnoila RI, Henry M, Nash JD, Park RC and Birrer MJ antisense ODNs for the treatment of cancer. (1993) p53 and Ki-ras gene mutations in epithelial ovarian neoplasms. Cancer Res 53: 3103–3108 UKCCCR (1998) United Kingdom co-ordinating committee on cancer research (UKCCCR) Guidelines for the welfare of animals in experimental neoplasia. ACKNOWLEDGEMENTS Br J Cancer 77: 1–10 We thank Dr Jon Holmlund for advice and critical review of the Witters L, Kumar R, Mandal M, Bennett CF, Miraglia L and Lipton A (1999) Antisense oligonucleotides to the epidermal growth factor receptor. Breast manuscript. Cancer Res Treat 53: 41–50 Yuen AR, Halsey J, Fisher GA, Holmlund JT, Geary RS, Kwoh TJ, Dorr A and Sikic BI (1999) Phase I study of an antisense oligonucleotide to protein kinase REFERENCES C-alpha (ISIS 3521/CGP64128A) in patients with cancer. Clin Cancer Res 5: 3357–3363 Avruch J, Zhang XF and Kyriakis JM (1994) Raf meets Ras: completing the Zheng CF and Guan KL (1993) Properties of MEKs, the kinases that phosphorylate framework of a signal transduction pathway. Trends Biochem Sci and activate the extracellular signal-regulated kinases. J Biol Chem 268: 19: 279–283 23933–23939 British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png British Journal of Cancer Springer Journals

Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer

Download PDF
6 pages

Loading next page...
 
/lp/springer-journals/association-of-c-raf-expression-with-survival-and-its-targeting-with-7Hi8XxZEj2

References (24)

Publisher
Springer Journals
Copyright
Copyright © 2001 by The Author(s)
Subject
Biomedicine; Biomedicine, general; Cancer Research; Epidemiology; Molecular Medicine; Oncology; Drug Resistance
ISSN
0007-0920
eISSN
1532-1827
DOI
10.1054/bjoc.2001.2139
Publisher site
See Article on Publisher Site

Abstract

British Journal of Cancer(2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign doi: 10.1054/ bjoc.2001.2139, available online at http://www.idealibrary.com on http://www.bjcancer.com Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer 1 1 2 1 2 1 1 F McPhillips, P Mullen, BP Monia, AA Ritchie, FA Dorr, JF Smythand SP Langdon 1 2 ICRF Medical Oncology Unit, Western General Hospital, Edinburgh EH4 2XU, UK; ISIS Pharmaceuticals Inc, Carlsbad, CA, USA Summary c-Raf is an essential component of the extracellular related kinase (ERK) signal transduction pathway. Immunohistochemical staining indicated that c-Raf was present in 49/53 ovarian adenocarcinomas investigated and high c-Raf expression correlated si gnificantly with poor survival ( P = 0.002). c-Raf protein was detected in 15 ovarian cancer cell lines. Antisense oligodeoxynucleotides (ODNs) (ISIS 5132 and ISIS 13650) reduced c-Raf protein levels and inhibited cell proliferation in vitro. Selectivity was demonstrated by the lack of effect of ISIS 5132 on A-Raf or ERK, while a random ODN produced only minor effects on growth and did not influence c-Raf expression. ISIS 513 2 produced enhanced apoptosis and cells accumulated in S and G /M phases of the cell cycle. In vivo, ISIS 5132 inhibited growth of the s.c. SKOV-3 xenograft while a mismatch ODN had no effect. These data indicate that high levels of c-Raf expression may be important in ovarian cancer and use of antisense ODNs targeted to c-Raf could provide a strategy for the treatment of this disease. © 2001 Cancer Res earch Campaign http://www.bjcancer.com Keywords: Raf; antisense; ovarian; cancer; oligodeoxynucleotide c-Raf is a ubiquitously expressed 74 kDa serine/threonine protein cancer cells (Monia et al, 1996a; Lau et al, 1998). Second genera- kinase which is central to the ERK pathway (Daum et al, 1994) tion antisense ODNs containing 2′-methoxyethyl sugar modifica- and has long been implicated in oncogenesis (Rapp et al, 1988; tions, such as ISIS 13650, have also been developed and these may Storm et al, 1990). Despite this, little information on c-Raf protein be more potent inhibitors of mRNA expression (Monia, 1997). expression in ovarian cancer is available. c-Raf is activated by To investigate the role and function of c-Raf in ovarian cancer, phosphorylation after translocation to the plasma membrane by a we have measured c-Raf expression in primary tumours and mechanism that involves Ras (Avruch et al, 1994). Mutations in ovarian cancer cell lines and studied relationships between protein ras genes have been frequently detected in ovarian tumours and expression and histology, grade of differentiation, tumour stage Ras protein is downstream of receptors such as the EGF/erbB and patient survival time. To explore the therapeutic potential of receptor tyrosine kinases (Rozakis-Adcock et al, 1993; Teneriello first- and second-generation c-Raf antisense ODNs in ovarian et al, 1993). Compared to normal ovary and benign ovarian cancer, the extent of growth inhibition following antisense ODN tumours, malignant ovarian tumours have increased expression of treatment was investigated in ovarian cancer cell lines and a EGF receptor (erbB-1) (Stewart et al, 1992) and erbB2 (Meden xenograft model. Our findings demonstrate that high levels of and Kuhn, 1997). The erbB receptors and Ras are currently being c-Raf expression are important in ovarian cancer and use of anti- investigated as potential targets for growth inhibitors in cancer sense ODNs targeted to c-Raf may provide a novel strategy for the (Cowsert, 1997; Fan and Mendelsohn, 1998; Witters et al, 1999). treatment of this disease. Targeting growth inhibitors to c-Raf in cancer cells would elimi- nate c-Raf-mediated cell proliferation signals from these upstream MATERIALS AND METHODS effectors and prevent cell proliferation arising from over- expression of c-Raf. Tumour samples Targeting genes using antisense technology provides a highly selective, sequence-specific mechanism for inhibiting the expres- Fresh primary ovarian tumour tissue was obtained from 53 previ- sion of a chosen gene product. A number of antisense oli- ously untreated patients with epithelial ovarian cancer at initial godeoxynucleotides (ODNs) are currently undergoing clinical debulking surgery, transferred to liquid nitrogen, then formalin- trials for the treatment of cancer (Cho-Chung, 1999; Nemunaitis fixed and embedded in paraffin. Tumour histology was assessed et al, 1999; Yuen et al, 1999). ISIS 5132, a 20-mer phosphoroth- on paraffin embedded sections and classified according to WHO ioate antisense ODN (first generation compound) that targets the criteria (details in Table 1). 3′ untranslated region of c-Raf mRNA, inhibits the expression of c-Raf mRNA and protein in lung, colon, cervical and prostate Cell lines Received 6 August 2001 CDDP PEO1, PEO1 , PEO4, PEO6, PEO14 and PEO16 were estab- Accepted 31 August 2001 lished as described previously (Langdon et al, 1988); SKOV-3 and Correspondence to:SP Langdon CaOV3 cells were obtained from the American Type Culture 1753 1754 F McPhillips et al Collection (Manassas, VA, USA); OVCAR3, OVCAR4 and were blocked with 1% blocking agent in TBS (20 mM Tris-HCl, OVCAR5 were obtained from Dr TC Hamilton (Fox Chase 137 mM NaCI, pH 7.5) before probing with the appropriate Institute, Philadelphia, PA, USA); 41M, 59M, OAW42 and A2780 primary antibody, anti-c-Raf (R19120, Transduction Laboratories, cells were obtained from the European Tissue Collection (Porton Lexington, KY), anti-A-Raf (R14320, Transduction Laboratories), Down). All cell lines were routinely grown as monolayer cultures anti-ERK (E16220, Transduction Laboratories) overnight at 4˚C. in RPMI 1640 (Life Technologies Inc, Gaithersburg, MD) supple- Immunoreactive bands were detected using enhanced chemilumi- –1 mented with 10% heat-inactivated fetal calf serum and 100 iu ml nescent reagents (1520709, Boehringer Mannheim) and Hyperfilm penicillin/streptomycin. Cells were maintained at 37˚C in a 5% ECL (Amersham, Buckinghamshire, UK). CO humidified incubator. Antisense ODNs Immunohistochemistry Antisense ODNs targeted to the 3′ untranslated region of c-Raf Sections (3 µm) were deparaffinised and rehydrated. Endogenous mRNA (sequence: TCCCGCCTGTGACATGCATT) were supplied peroxidase activity was blocked by incubating sections in 3% by ISIS Pharmaceuticals (Carlsbad, CA). Two forms of the anti- H O for 30 min immersing in citric acid buffer (0.005M, pH 6.0) sense ODNs were used: a first generation compound (ISIS 5132) 2 2 and microwaving for 3 × 5 min. Slides were washed in 0.05M which has a phosphorothioate backbone and a second generation Tris/HCI buffer (pH 7.6) then incubated in 20% fetal calf serum in compound (ISIS 13650) which also has a phosphorothioate back- the above Tris buffer for 10 min. Anti-c-Raf antibody (R19120, bone and the addition of 2′ methoxyethyl groups on the sugar Transduction Laboratories) was used at 1:10 –1:20 dilution in 20% moiety. 2 control ODNs were available: a second generation random fetal calf serum and sections were incubated for 1.5–2 h. A ODN (ISIS 16971; sequence, TCACATTGGCGCTTAGCCGT) streptavidin–biotin multilink method (StrAviGen Multilink kit; and a first generation mismatch ODN (ISIS 10353 sequence, Biogenex, San Ramon, CA) was used to detect reactivity. Sections TCCCGCGCACTTGATGCATT). were stained with a secondary multilink antibody at a 1:20 dilution for 30 min, then incubated with a horseradish-peroxidase-labelled Growth and protein inhibition experiments streptavidin complex at a 1:20 dilution for 30 min. Diaminobenzidine tetrachloride was used as chromagen and For growth inhibition experiments, log phase cells were applied for 5 min. Sections were lightly counterstained in haema- trypsinized and seeded into 24-well tissue culture plates (1 × 10 in toxylin, dehydrated and mounted. Negative controls for each 1 ml) and incubated to reach 40–60% confluence. Cells were then tumour section were included by replacing the primary antibody washed with PBS before adding 250 µl of Optimem (Gibco-BRL) –1 with Tris buffer. Immunoreactive scores between 0 and 12 were containing ‘Lipofectin’ (Gibco-BRL) (6 µlml ). Antisense and generated for each sample and represent the product of intensity (0 = random ODNs were added (50 nM–200 nM) from 50 µM stock negative, 1 = weak, 2 = moderate, 3 = strong) and percentage posi- solutions. Cells were incubated at 37˚C for 3 h, washed with PBS, –1 tive cell staining (0 = 0%, 1 = 1–25%, 2 = 26–50%, 3 = 51–75%, replenished with RPMI (plus 10% fetal calf serum and 100 iu ml 4 = 76–100%). penicillin/streptomycin) and replaced in the incubator for the remainder of the time course. Cells were trypsinized and counted at the appropriate time point using a ‘ZM’ Coulter Counter. Statistics c-Raf protein inhibition experiments were carried out as above Relationships between variables were analysed using the Fisher’s except that cells (2.5 × 10 in 4 ml) were plated into 60 mm diam- exact test, the student t-test and the Mann–Whitney test where eter petri dishes and washed with PBS (2 ml) prior to addition of appropriate. Differences in survival were determined using the Optimem/Lipofectin/ODN (1 ml). Cells were lysed and analysed Kaplan–Meier method and groups were compared using the log- by Western blotting as previously described. rank test and χ test. Cell cycle analysis Western blotting DNA analysis of treated cells was carried out on a Becton Cells were grown to 70% confluence, washed twice with PBS, and Dickinson ‘FACSCalibur’ flow cytometer using methodology lysed in ice cold hypotonic lysis buffer (50 mM Tris-HCI (pH 7.5), described by Levack et al (1987). 5 mM EGTA (pH 8.5), 150 mM NaCl, 1% Triton X-100, 2 mM sodium orthovanadate, 50 mM sodium fluoride, 1 mM phenyl- Apoptosis assay –1 –1 methanesulfonylfluoride, 10 µg ml leupeptin, 10 µg ml apro- tinin and 10 mM sodium molybdate). Lysates were centrifuged for SKOV-3 cells were treated with ODNs as described above and 6 min at 13 000 rpm in a microfuge. Tumour samples (100 mg) apoptosis was measured using the TACS Annexin V-FITC kit were finely chopped, then homogenized on ice in a Silverson (R& D Systems) following the prescribed protocol. homogenizer in 1.8 ml lysis buffer (excluding Triton X-100). Samples were incubated on ice after the addition of 1% Triton X- Xenograft experiments 100, then centrifuged 14 000 rpm for 30 min. Protein concentra- tions of supernatants were determined using the Bio-rad Protein Female adult nude (nu/nu) mice were obtained from ICRF Assay Kit (Bio-rad, Richmond, CA). Cell lysates (30 µg) or (Clare Hall, South Mimms, UK) and maintained in negative pres- tumour lysates (50 µg) were resolved on 10% or 12% SDS-PAGE sure isolators. SKOV-3 cells (5 × 10 cells/injection) were injected then transferred electrophoretically overnight onto Immobilon-P into both flanks of 2 groups of mice. The control group membranes (Millipore, Bedford, MA). After transfer, membranes consisted of 10 mice (2 tumours/mouse) and the treatment groups British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign c-Raf in ovarian cancer 1755 consisted of 5 mice. ODNs were administered i.p. daily in PBS on the days indicated. Tumour volumes, assessed twice weekly by caliper measurements of the tumour in 2 dimensions, were calcu- lated by the formula π/6 × length × width . Treatment was initiated either 24 h after cell implantation or when tumours had reached a median diameter of 4 mm. Relative tumour volume was evaluated by dividing the volume at day × (the number of days after the start of treatment) by the volume at day 0 (the day treatment started). UKCCCR Guidelines (1998) were followed throughout. RESULTS Immunoscore 0 −6 (n = 38) c-Raf expression in primary ovarian cancer c-Raf expression was identified in 49 of 53 ovarian cancer sections Immunoscore 7 −12 (n = 14) and varied from weak to intense staining (examples are illustrated in Figure 1A). Immunoreactivity was found almost exclusively in 1 2345 6789 10 the epithelial cells with only minor staining in the stroma. The Years relationships between immunoreactive scores and clinical and Figure 1 High c-Raf expression is associated with poor survival in ovarian pathological parameters are represented in Table 1. Serous adeno- cancer. (A) Examples of c-Raf immunoreactivity, detected as described in ‘Materials and Methods ’. Epithelial cells are diaminobenzidine positive carcinomas expressed higher levels of c-Raf than all other (brown) and counterstain is hematoxylin (blue). Low and high power subtypes combined (P = 0.005, Fisher’s exact test). No significant magnifications. (B) Kaplan–Meier survival curves with log-rank analysis; high associations between c-Raf expression level and either stage (I / II expressers vs low expressers ( P = 0.002) vs III / IV, P = 0.18 Fisher’s exact test) or grade of differentiation c-Raf expression in ovarian cancer cell lines (poor vs moderate/well, P = 0.17, Fisher’s exact test) were observed. c-Raf protein, detected by Western blotting, was evident in all 15 Survival data were available for 52/53 patients. High c-Raf expres- cell lines analysed. Levels of c-Raf varied 24-fold between cell sion was linked with poor survival in this group (Figure 1B). The lines, compared to only a 2.5-fold and 11-fold variation in ERK survival of patients whose tumours had an immunoreactive score ≥ 7 and A-Raf respectively (Figure 2A and 2B). (n = 14) was significantly poorer than that of patients with scores ≤ 6 (n = 38) (P = 0.002, log-rank test). Since histology and stage are Antisense oligonucleotides reduce c-Raf protein levels major prognostic variables, we also analysed survival in patients in SKOV-3 cells having stage III serous adenocarcinomas which represented a The ability of the antisense ODNs ISIS 13650 and ISIS 5132 to majority sub-group (n = 28). Again patients whose tumours had a selectively reduce the amount of c-Raf protein was investigated in higher level of c-Raf expression (immunoreactive score of ≥ 7) (n = 12) had significantly poorer survival (P = 0.035, log-rank test) than patients with tumours expressing lower levels of c-Raf (n = 16). .. , ..• C-Raf Table 1 c-Raf expression in primary ovarian cancer . - . (74kD) ..... --­ Number of patients with A-Raf Immunoscore immunoscore a •• .,, (68kD) _.(!IL ••••• 0–6 7–12 P value ERK All tumours 39 14 (42kD) Stage I / II 13 2 0.18 III / IV 23 12 Differentiation Well / moderate 14 2 0.17 Poor 21 11 Histology Serous 16 12 Endometrioid 17 1 0.005 [. p I I p I • i •• -i 11 i Clear cell 5 1 Mucinous 1 0 The expression of c-Raf was determined by immunohistochemical staining as described in Materials and Methods and scores between 0 and 12 were Figure 2 (A) Expression of c-Raf, A-Raf and ERK2 in 15 ovarian cancer generated for each sample. 53 patient samples were analysed for cell lines. Cells were lysed and samples electrophoresed as described in expression but information on stage and grade were available for 50 and ‘Materials and Methods ’. Blots were probed with anti-c-Raf, anti-A-Raf or b c 48 patients respectively. Fisher’s exact test. Fisher’s exact test (serous vs anti-ERK2. Data shown is a typical result of n = 3. (B) Densitometric analysis rest). (Integrated Optical Density units) of c-Raf expression, n = 3 © 2001 Cancer Research Campaign British Journal of Cancer (2001) 85(11), 1753–1758 Survival (%) C-Raf expression (IOD) PE01 PE01 PEO1cddp PEO1cddp PE04 PE04 PE06 PE06 PE014 PE014 PEO16 PEO16 OVCAR3 OVCAR3 OVCAR4 OVCAR4 OVCAR5 OVCAR5 41M 41M 59M 59M OAW42 OAW42 SKOV-3 SKOV-3 CaOV3 CaOV3 A2780 A2780 1756 F McPhillips et al A B ISIS 5132 (nM) c-Raf ISIS 13650 c-Raf 60 * c-Raf ISIS 5132 A-Raf *P < 0.05 * c-Raf ISIS 16971 ERK 50 nM 100 nM 200 nM 5132 13650 16971 C Time (h): 24 48 *P < 0.05 c-Raf 24 48 72 Figure 3 Effect of c-Raf antisense ODNs on c-Raf protein level in SKOV-3 Hours after treatment cells. After treatment with ISIS 5132, ISIS 13650 or ISIS 16971, cells were _ _.,,. __ lysed and samples electrophoresed and probed with anti-c-Raf, anti-A-Raf or ---0-- --+- 5132 13650 --·• ··· 16971 No oligo anti-ERK antibodies as described in ‘Materials and Methods ’. (A) Suppression of c-Raf protein by c-Raf antisense oligonucleotides but not a random ODN. (B) Suppression of c-Raf but not A-Raf and ERK by ISIS 5132 at 48 h after treatment. (C) Effect of time of c-Raf protein reduction by ISIS 5132 and ISIS [] SKOV-3 cells. After 48 h, both ODNs reduced c-Raf levels at 100 nM and 200 nM (Figure 3A). In comparison, similar concen- trations of the random control ODN ISIS 16971 had no effect on c-Raf levels. The specificity of ISIS 5132 for c-Raf was examined by measuring its effects on A-Raf and ERK and after 48 h, ISIS 5132 (200 nM) had no effect on the expression of either of these Figure 4 C-Raf antisense ODNs inhibit growth in ovarian cancer cell lines. proteins (Figure 3B). To determine the time required for c-Raf (A) 72 h after treatment with ISIS 5132, ISIS 13650 or ISIS 16971 SKOV-3 antisense ODNs to exert their effects on c-Raf protein, the level of cells were trypsinized and counted on a ‘ZM’ Coulter Counter. Cell counts taken at day 0 (the day treatment began) are deducted from the 72 h cell c-Raf present in SKOV-3 cells was assayed at various intervals count. The value at each concentration is expressed as the percentage following antisense treatment. Both ISIS 13650 (200 nM) and growth compared to 100%, the value obtained from untreated cells grown for ISIS 5132 (200 nM) reduced c-Raf levels by > 50% at 24 h and 72 h. (B) SKOV-3 cells were counted at 24, 48 and 72 h after treatment with ISIS 5132, ISIS 13650 or ISIS 16971. ( C) 72 h after treatment with ISIS 5132 almost complete removal of c-Raf protein was observed at 48 h or ISIS 13650 cells were trypsinized and counted. In all cell lines except (Figure 3C). OVCAR5 growth rates of treated cells are significantly different from untreated cells (P < 0.05; student t-test) c-Raf antisense ODNs inhibit cellular proliferation in Effect of c-Raf antisense ODNs in a panel of ovarian SKOV-3 cells cancer cell lines To evaluate the effectiveness of c-Raf antisense ODNs as anti- The ability of c-Raf antisense ODNs to inhibit cell growth was proliferative agents, SKOV-3 cells were treated with ISIS 13650, further investigated in a panel of 12 ovarian cancer cell lines 48 h ISIS 5132 or random ODN and the cell number determined 72 h after treatment. Both ISIS 13650 and ISIS 5132 inhibited cell after treatment. At 200 nM both ISIS 13650 and ISIS 5132 proliferation by ≥ 60% in 9/12 cell lines examined (Figure 4C) demonstrated > 80% inhibition of cell growth, compared to <30% compared to < 30% inhibition shown by the random ODN in inhibition shown by the random ODN (Figure 4A). The time selected cell lines. required for c-Raf antisense ODNs to exert their effects on cell proliferation was investigated in SKOV-3 cells. Cells not exposed ISIS 5132 causes cell cycle arrest and enhanced to ODN (control cells) and cells treated with mismatch ODN (200 apoptosis in SKOV-3 cells nM) grew steadily over the time course demonstrating a 3-fold increase in cell number over the 72 h period (Figure 4B). In DNA analysis showed an accumulation of cells arrested in the S contrast, the addition of 200 nM ISIS 5132 or ISIS 13650 resulted and G /M phases of the cell cycle with a concomitant reduction in in marked growth inhibition at all time points investigated, with the G /G phase. These specific effects were dose-dependent and 0 1 both antisense ODNs preventing cell growth in the first 24 h after not seen in either untreated cells or cells treated with ISIS 16971 treatment (Figure 4B). (Figure 5A). A dose-dependent enhancement of apoptosis was British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign 100 nM No oligo 200 nM ISIS 13650 ISIS 5132 ISIS 13650 ISIS 5132 No oligo Relative growth (% of control) Cell count Relative growth (% of control) SKOV-3 OAW42 PE04 OVCAR3 PEO1cddp PEO14 OVCAR4 PEO1 41m A2780 CaOV3 OVCAR5 c-Raf in ovarian cancer 1757 I I i I no oligo . i I 5132 (200 nM ) -- - 11 - _L 5132 (nM) 16971 (nM) DNA content Treatment period * G0/G1 S G2/M D • ra 10 * * * 10 * 0 * * 010 20 30 40 Day ·· ··O ·· ·· 5132—10 mg/kg 5132—25 mg/kg ····b. ··· · 10353 Vehicle Ii 111 I ••• 1 Control 5132 (nM) 16971 (nM) ISIS 5132 Figure 5 Effect of c-Raf antisense ODNs on cell cycle distribution and apoptosis in SKOV-3 cells. ( A) 48 h after treatment with ISIS 5132 or ISIS 16971 cells were trypsinized and stained for total DNA content using propidium iodide. Cell cycle distribution was carried out using a ‘FACSCalibur’ flow cytometer and results analysed using ‘Modfit’ software. The relative proportion of cells in the G0/G1, S and G2/M phase of the cycle is shown along with representative DNA histograms. ( B) Apoptosis levels were also assayed after 48 h in similarly treated SKOV-3 cells that had been 3 5 exposed to FITC-labelled annexin V and counterstained with propidium iodide Day Figure 6 Effect of ISIS 5132 on in vivo growth of SKOV-3 cells. similarly seen in cells treated with ISIS 5132 compared with 6 (A) Treatment initiated 24 h after implantation of 5 × 10 cells s.c. ISIS 5132 –1 –1 was administered i.p. at 25 or 10 mg kg day for 21 days and compared untreated cells or cells exposed to ISIS 16971 (Figure 5B). –1 –1 with a mismatch control (ISIS 10353 –25 mg kg day ) or vehicle only. (B) ISIS 5132 treatment of advanced SKOV-3 tumours. Tumours were allowed to grow for 35 days before treatment (mean diameter = 4 mm). ISIS 5132 inhibits growth of SKOV-3 ovarian cancer Relative tumour volumes after 3 and 5 days treatment are shown. Mean ± xenografts standard errors of at least 10 tumours indicated. *significantly different from vehicle, P < 0.05 (t-test) ISIS 5132 inhibited the growth of SKOV-3 cells implanted as a subcutaneous xenograft in the flanks of nude mice. Treatment previously been identified in ovarian cancer cell lines and attributed initiated 24 h after implantation of cells reduced the growth rate of to an increase in MEK and c-Raf activity (Hoshino et al, 1999). In –1 –1 these tumours at both 10 and 25 mg kg day compared to a addition, ERK activation has been shown to correlate linearly with vehicle control (Figure 6A). A mismatch control (ISIS 10353) was increasing concentrations of MEK (Zheng and Guan, 1993). These available for these studies and had no effect on growth. When data in combination with our finding that c-Raf is highly expressed treatment was delayed until tumours had reached a median size of in most of the ovarian cancer cell lines suggest that an increase in –1 –1 4 mm, ISIS 5132 (25 mg kg day ) again produced a significant c-Raf level may contribute to increased signalling through the ERK effect on growth (Figure 6B). pathway. Further analysis of the ERK signalling pathway in ovarian cancer cell lines is essential to elucidate the role of c-Raf in this disease, and will form the basis of future studies. DISCUSSION The use of antisense ODNs has allowed us to establish that c-Raf In the present study, which is the first to look at the prognostic plays an important role in the proliferation of ovarian cancer cell significance of c-Raf expression in ovarian cancer, we show that lines, supporting conclusions of other studies that c-Raf is a critical high c-Raf expression is a negative prognostic factor. c-Raf was mediator of oncogenic transformation (Storm et al, 1990; Daum present in 92% of the ovarian adenocarcinomas investigated and a et al, 1994). We have shown that both ISIS 5132 and ISIS 13650 high level of c-Raf expression correlated significantly with both reduce c-Raf protein in SKOV-3 ovarian cancer cells, in line with poor survival and serous histology. Within the serous subset, there observations in other disease types (Monia et al, 1996a; Monia, was again a significant correlation between expression and 1997; Lau et al, 1998). Evidence to support specificity was provided survival, indicating that high c-Raf expression is associated with by the observations that while c-Raf was reduced, related signalling poor survival irrespective of other parameters such as histology molecules were unaffected and a random ODN (ISIS 16971) had no and stage. The epithelial tumour cells were highly positive for c- effect on c-Raf protein expression. Raf staining compared to stromal cells, which showed little c-Raf Investigation of the effects of antisense ODNs in a panel of expression. ovarian cancer cell lines has allowed an insight into the efficiency The c-Raf signalling pathway plays an important role in the of these antisense compounds in a range of cell types with variable growth regulation of some ovarian cancers. ERK activation has amounts of c-Raf protein. Despite a 24-fold variation in c-Raf © 2001 Cancer Research Campaign British Journal of Cancer (2001) 85(11), 1753–1758 Annexin V positivity (%) percentage No oligo No oligo 25 50 Mean tumour volume (mm) Mean relative tumour volume 1758 F McPhillips et al Cho-Chung YS (1999) Antisense oligonucleotide inhibition of serine/threonine protein levels between the cell lines, both ISIS 5132 and ISIS kinases: an innovative approach to cancer treatment. Pharmacol Ther 82: 13650 substantially reduced cell growth. Most of the cell lines 437–449 were > 60% growth inhibited, while 3 cell lines (A2780, OVCAR5 Cowsert LM (1997) In vitro and in vivo activity of antisense inhibitors of ras: and CaOV3) were < 40% growth inhibited by antisense ODNs. potential for clinical development. Anticancer Drug Des 12: 359–371 These intercellular growth inhibitory differences cannot be Daum G, Eisenmann-Tapp I, Fries H-W, Troppmair J and Rapp UR (1994) The inns and outs of raf kinases. TIBS 19: 474–480 accounted for by the variation in c-Raf protein levels between the Fan Z and Mendelsohn J (1998) Therapeutic application of anti-growth factor cell lines. Explanations for these differences are likely to come from receptor antibodies. Curr Opin Oncol 10: 67–73 further analysis of the growth signalling pathways in these cells. It Hoshino R, Chatani Y, Yamori T, Tsuruo T, Oka H, Yoshida O, Shimada Y, Ari-IS, is also possible that some cell lines do not require c-Raf for Wada H, Fujimoto J and Kohno M (1999) Constitutive activation of the 41-/43-kDa mitogen-activated protein kinase signaling pathway in human cellular proliferation. Such observations have been reported in a tumors. Oncogene 18: 813–822 study investigating constitutive activation of the ERK signalling Langdon SP, Lawrie SS, Hay FG, Hawkes MM, McDonald A, Hayward IP, Schol pathway in over 100 different tumour cell lines, including DJ, Hilgers J, Leonard RC and Smyth JF (1988) Characterization and OVCAR3, SKOV-3 and OVCAR5 (Hoshino et al, 1999). Both properties of nine human ovarian adenocarcinoma cell lines. Cancer Res 4: OVCAR3 and SKOV-3 demonstrated high constitutive activation 6166–6172 Lau QC, Brusselbach S and Muller R (1998) Abrogation of c-Raf expression of the ERK pathway and in our study these cell lines were growth induces apoptosis in tumour cells. Oncogene 16: 1899–1902 inhibited to a great degree by c-Raf antisense ODNs. In contrast, Levack PA, Mullen P, Anderson TJ, Miller WR and Forrest APM (1987) DNA OVCAR5 exhibited minimal constitutive ERK activation that was analysis of breast tumour fine needle aspirates using flow cytometry. Br J not increased upon stimulation with serum (Hoshino et al, 1999). Cancer 56: 643–646 Meden H and Kuhn W (1997) Overexpression of the oncogene c-erbB-2 This suggests that OVCAR5 may not signal predominantly (HER2/neu) in ovarian cancer: a new prognostic factor. Eur J Obstet Gynecol through c-Raf, and may explain our inability to inhibit OVCAR5 Reprod Biol 71: 173–179 cell proliferation with antisense ODN. Consequently, some Monia BP (1997) First- and second-generation antisense inhibitors targeted to human ovarian cancer types may be highly responsive to therapies that c-raf kinase: in vitro and in vivo studies. Anticancer Drug Des 12: 327–339 target c-Raf, while others may not. Monia BP, Johnston JF, Geiger T, Muller M and Fabbro D (1996a) Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against Finally, we have demonstrated that ISIS 5132 is effective in vivo, C-raf kinase. Nature Med 2: 668–675 significantly inhibiting the growth of the SKOV-3 xenograft. ISIS Monia BP, Sasmor H, Johnston JF, Freier SM, Lesnik EA, Muller M, Geiger T, 5132 is presently undergoing clinical trials and has been shown to Altmann KH, Moser H and Fabbro D (1996b) Sequence-specific antitumor significantly reduce levels of c-raf mRNA in peripheral blood activity of a phosphorothioate oligodeoxyribonucleotide targeted to human C- raf kinase supports an antisense mechanism of action in vivo. Proc Natl Acad mononuclear cells. This was associated with clinical benefits in Sci USA 93: 15481–15484 2 out of 14 patients with a mixture of advanced solid tumours Nemunaitis J, Holmlund JT, Kraynak M, Richards D. Bruce J, Ognoskie N, Kwoh (O’Dwyer et al, 1999). ISIS 5132 has been rigorously examined and TJ, Geary R, Dorr A, Von Hoff D and Eckhardt SG (1999) Phase I evaluation an antisense mechanism of action has been confirmed (Monia et al, of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase C-alpha, in 1996b). Our data further support the validity of ISIS 5132 as an anti- patients with advanced cancer. J Clin Oncol 17: 3586–3595 O’Dwyer PJ, Stevenson JP, Gallagher M, Cassella A Vasilevskaya I, Monia BP, cancer drug that specifically targets c-Raf. In addition we provide Holmlund J, Dorr FA and Yao KS (1999) c-Raf-1 depletion and tumor evidence that the 2nd generation c-Raf antisense oligonucleotide responses in patients treated with the c-raf-1 antisense oligodeoxynucleotide (ISIS 13650) reduces c-Raf protein levels and inhibits cellular ISIS 5132 (CGP 69846A). Clin Cancer Res 5: 3977–3982 proliferation with potency comparable to ISIS 5132 in vitro. Rapp UR, Cleveland JL, Bonner TI and Storm SM (1988a) The Raf oncogenes. In: Reddy EP, Skalka AM and Curran T (eds), pp 213–253 The Oncoge ne In summary, our findings demonstrate an association between Handbook,. Amsterdam, the Netherlands. Elsevier Science Publishers B.V. 1988 high levels of c-Raf expression and reduced survival time for Rapp UR, Huleihel M, Pawson T, Linnoila I, Minna JD, Heidecker G, Cleveland JL, patients with ovarian adenocarcinomas suggesting an important role Beck T, Forchhammer J and Storm SM (1988b) Role of raf oncogenes in lung for c-Raf in tumour growth, although the extent of tumour types that carcinogenisis. J Int Assoc Study Lung Cancer 4: 162 heavily depend on c-Raf remains to be explored. We have shown Rozakis-Adcock M, Fernley R, Wade J, Pawson T and Bowtell D (1993) The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras that ODNs that specifically target c-Raf are effective growth activator mSos1. Nature 363: 83–85 inhibitors for the majority of ovarian cancer cells. In addition, the Stewart CJ, Owens OJ, Richmond JA and McNicol AM (1992) Expression of use of antisense ODNs will help identify cells that rely on c-Raf for epidermal growth factor receptor in normal ovary and in ovarian tumors. Int J growth. Studies examining the effects of ISIS 5132 and ISIS 13650 Gynecol Pathol 11: 266–272 Storm SM, Brennscheidt U, Sithanandam G and Rapp UR (1990) Raf oncogenes in in vivo and in combination with other standard chemotherapeutic carcinogenesis. Crit Rev Oncog 2: 1–8 agents will give further information on the practical application of Teneriello MG, Ebina M, Linnoila RI, Henry M, Nash JD, Park RC and Birrer MJ antisense ODNs for the treatment of cancer. (1993) p53 and Ki-ras gene mutations in epithelial ovarian neoplasms. Cancer Res 53: 3103–3108 UKCCCR (1998) United Kingdom co-ordinating committee on cancer research (UKCCCR) Guidelines for the welfare of animals in experimental neoplasia. ACKNOWLEDGEMENTS Br J Cancer 77: 1–10 We thank Dr Jon Holmlund for advice and critical review of the Witters L, Kumar R, Mandal M, Bennett CF, Miraglia L and Lipton A (1999) Antisense oligonucleotides to the epidermal growth factor receptor. Breast manuscript. Cancer Res Treat 53: 41–50 Yuen AR, Halsey J, Fisher GA, Holmlund JT, Geary RS, Kwoh TJ, Dorr A and Sikic BI (1999) Phase I study of an antisense oligonucleotide to protein kinase REFERENCES C-alpha (ISIS 3521/CGP64128A) in patients with cancer. Clin Cancer Res 5: 3357–3363 Avruch J, Zhang XF and Kyriakis JM (1994) Raf meets Ras: completing the Zheng CF and Guan KL (1993) Properties of MEKs, the kinases that phosphorylate framework of a signal transduction pathway. Trends Biochem Sci and activate the extracellular signal-regulated kinases. J Biol Chem 268: 19: 279–283 23933–23939 British Journal of Cancer (2001) 85(11), 1753–1758 © 2001 Cancer Research Campaign

Journal

British Journal of Cancer – Springer Journals

Published: Nov 27, 2001

There are no references for this article.