Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Phosphatidylinositol 3-Kinase Signaling Inhibits DAF-16 DNA Binding and Function via 14-3-3-dependent and 14-3-3-independent Pathways

Phosphatidylinositol 3-Kinase Signaling Inhibits DAF-16 DNA Binding and Function via... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 16, Issue of April 20, pp. 13402–13410, 2001 © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Phosphatidylinositol 3-Kinase Signaling Inhibits DAF-16 DNA Binding and Function via 14-3-3-dependent and 14-3-3-independent Pathways* Received for publication, November 3, 2000, and in revised form, December 19, 2000 Published, JBC Papers in Press, December 20, 2000, DOI 10.1074/jbc.M010042200 Catherine M. Cahill‡§, Guri Tzivion§¶, Nargis Nasrin‡, Scott Oggi, Justin Dore‡, Gary Ruvkuni, and Maria Alexander-Bridges‡** From the ‡Diabetes Unit, Massachusetts General Hospital and Department of Medicine, Harvard Medical School, the ¶Diabetes Research Laboratory, Department of Molecular Biology, Massachusetts General Hospital and Department of Medicine, Harvard Medical School, and the iDepartment of Molecular Biology, Massachusetts General Hospital and Department of Genetics, Harvard Medical School, Boston, Massachusetts 02114 In Caenorhabditis elegans, an insulin-like signaling insulin-like signaling pathway, which includes an insulin/IGF- 1 -like receptor (DAF-2), phosphatidylinositol 3-kinase (PI pathway to phosphatidylinositol 3-kinase (PI 3-kinase) and AKT negatively regulates the activity of DAF-16, a 3-kinase; AGE-1), and protein kinase B (also known as AKT) Forkhead transcription factor. We show that in mamma- controls life cycle, metabolism, and longevity (1–5). This path- lian cells, C. elegans DAF-16 is a direct target of AKT and way negatively regulates the activity of DAF-16, a member of that AKT phosphorylation generates 14-3-3 binding sites the Forkhead (FKH) family of transcription factors (3, 6 – 8). and regulates the nuclear/cytoplasmic distribution of In mammalian cells, insulin/IGF-1 signaling via PI 3-kinase DAF-16 as previously shown for its mammalian ho- and AKT mediates diverse effects on cell metabolism, growth, mologs FKHR and FKHRL1. In vitro, interaction of AKT- and survival (9 –11). Biochemical studies to date suggest that phosphorylated DAF-16 with 14-3-3 prevents DAF-16 PI 3-kinase is important to the metabolic actions of insulin binding to its target site in the insulin-like growth factor including its effects on gene transcription. A common DNA binding protein-1 gene, the insulin response element. In sequence, referred to as the insulin response element (IRE), HepG2 cells, insulin signaling to PI 3-kinase/AKT inhib- binds members of the Forkhead transcription factor family and its the ability of a GAL4 DNA binding domain/DAF-16 mediates the negative effect of insulin on transcription of the fusion protein to activate transcription via the insulin- insulin-like growth factor binding protein-1 (IGFBP-1) and like growth factor binding protein-1-insulin response phosphoenolpyruvate carboxykinase (PEPCK) genes (12). In element, but not the GAL4 DNA binding site, which sug- hepatoma cells, insulin- inhibition of IRE-directed gene tran- gests that insulin inhibits the interaction of DAF-16 with scription is mediated via a PI 3-kinase-dependent signaling its cognate DNA site. Elimination of the DAF-16/1433 pathway (13). Accordingly, work in several laboratories aimed association by mutation of the AKT/14-3-3 sites in DAF- at identifying the downstream targets of insulin signaling to 16, prevents 14-3-3 inhibition of DAF-16 DNA binding the nucleus has focused on the role of mammalian homologues and insulin inhibition of DAF-16 function. Similarly, in- of DAF-16, FKHR, FKHRL1, and AFX in mediating the nega- hibition of the DAF-16/14-3-3 association by exposure of cells to the PI 3-kinase inhibitor LY294002, enhances tive effect of insulin/IGF-1 signaling on gene transcription. In DAF-16 DNA binding and transcription activity. Sur- the absence of insulin/IGF-1, FKHRL1 (14), AFX (15), and prisingly constitutively nuclear DAF-16 mutants that FKHR (16 –18) activate gene transcription via the IGFBPzIRE. lack AKT/14-3-3 binding sites also show enhanced DNA Insulin/IGF-1 signaling (19 –21) or overexpression of AKT (17, binding and transcription activity in response to 19) stimulates phosphorylation of these factors and inhibits LY294002, pointing to a 14-3-3-independent mode of reg- their activating effect (16, 17). ulation. Thus, our results demonstrate at least two The prevailing view of the mechanism underlying insulin/ mechanisms, one 14-3-3-dependent and the other 14-3-3- IGF-1 inhibition of FKHRL1 and other DAF-16 homologs is independent, whereby PI 3-kinase signaling regulates that phosphorylation of FKHRL1 by AKT at two sites, Thr-32 DAF-16 DNA binding and transcription function. and Ser-253 promotes retention of these proteins in the cyto- plasm (14). AKT preferentially phosphorylates substrates that carry the RXRXXS, which is contained within certain consen- In Caenorhabditis elegans, genetic evidence indicates that an p p p sus 14-3-3 binding motifs RSXS XP, or RXXXS XP where S represents phosphoserine (22). Hence, AKT phosphorylation of its target proteins may create 14-3-3 binding sites. For exam- * This work was supported by National Institutes of Health NCI Grant CA73818-1, by National Institutes of Health Grant ple, the AKT site at T32 in FKHRL1 is a 14-3-3 consensus DK57200A01, by institutional support from Massachusetts General binding sequence; AKT phosphorylation of FKHRL1 at sites Hospital, and by National Institutes of Health Training Grant T32 Thr-32 and Ser-253 promotes interaction of FKHRL1 with 14- DK07028 –24 (to N. N.) and Grants AG05790 (to N. N.) and AG14161 3-3 and cytoplasmic retention of FKHRL1 (14). The 14-3-3 and GM58012 (to S. O. and G. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The abbreviations used are: IGF, insulin-like growth factor; FKH, § These authors contributed equally to this work. forkhead, PKB, protein kinase B; PI 3-kinase, phosphatidylinositol 3 ** To whom correspondence should be addressed: 306 Wellman, Di- kinase; IGFBP-1, insulin-like growth factor binding protein-1; IRE, abetes Unit, Dept. of Medicine, Massachusetts General Hospital, 50 insulin response element; PEPCK, phosphoenolpyruvate carboxyki- Blossom St., Boston, MA 02114. Tel.: 617-726-6998; Fax: 617-726-6954; nase; GST, glutathione S-transferase; PAGE, polyacrylamide gel elec- E-mail: [email protected]. trophoresis; WT, wild-type. 13402 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. 14-3-3-dependent and -independent Regulation of DAF-16 13403 KCl, 10% glycerol, 0.1% bovine serum albumin, and 1 mg of poly(dG/dC) family of proteins has also been shown to play a role in nuclear in each sample. For competition assays, 103 cold IRE or mutant IRE export and/or cytoplasmic retention of the yeast protein Cdc25 was added prior to the addition of P-labeled IRE probe. For supershift (23–25). In addition to promoting changes in cellular localiza- assays, the reaction was pre-incubated with 1 mg of either specific tion, binding of 14-3-3 to certain of its target proteins directly DAF-16 antibody (for detection of GST fusion proteins) or M2 antibody affects their activity. For example, 14-3-3 can stimulate the (against the Flag tag for detection of DAF-16 expressed in mammalian catalytic activity of the serine/threonine kinase c-Raf-1 (26, 27), cells) for 15 min at 4 °C prior to the addition of P-labeled IRE probe. To demonstrate inhibition of DNA binding by 14-3-3, DAF-16 (2 mg) was the DNA binding activity of p53 (28), and other targets (29 –31). phosphorylated with GST-AKT (2 mg) for 30 min at 30 °C, followed by The Thr-32 and Ser-253 sites are conserved within DAF-16 addition of 14-3-3 (2 mg). The reaction was further incubated at 4 °C for (Thr-54 and Ser-240/Thr-242), FKHRL1 (Thr-32, Ser-253) (14), 15 min, at which time labeled P-IRE probe was added. Samples were FKHR (Thr-24, Ser-253) (32), and AFX (Thr-28, Ser-258) (15). resolved on 4% Tris-glycine PAGE at 100 V for 3 h. Nuclear and Accordingly, regulation of nuclear export by growth factor sig- cytoplasmic extracts were prepared using the NE-PER kit (Pierce) naling to PI 3-kinase and AKT has been demonstrated for according to the manufacturer’s instructions. Transfections—For transcriptional analysis, HepG2 cells were trans- FKHR1 (32), FKHR (33), and AFX (34). We questioned whether fected using the CaPO method in 30-mm six-well plates with IGFBP- the Thr-54 site in DAF-16 would function as a 14-3-3 binding LUC (15 mg) reporter plasmid and pcDNA3-DAF-16 variants (2 mg) or site and, if so, whether PI 3-kinase signaling would regulate pcDNA3 control vector (2 mg) per 1.5 ml of precipitate. The RSV-b- the interaction of C. elegans DAF-16 with elements of the galactosidase vector (2 mg) was used to control for transfection effi- mammalian nuclear import/export machinery as is the case for ciency. In the experiments described in Figs. 3 and 5, 2 mg of GAL4 DNA the mammalian homologs of DAF-16. binding domain control vector or GAL4-DAF-16 fusion protein vector variants cotransfected with either the IGFBP-luciferase reporter gene We therefore examined the effect of AKT phosphorylation or a luciferase reporter gene driven by five GAL4 DNA binding sites and 14-3-3 association on several aspects of DAF-16 function, cloned upstream of the TK109 promoter. Cells were shocked for 1 min including its ability to localize to the nucleus, bind DNA and with 10% Me SO and the incubation continued in the absence of serum. activate transcription. We find evidence for PI 3-kinase-de- Insulin was added during the last 16 h of the incubation. pendent inhibition of DAF-16 DNA binding activity via 14-3-3- For the DAF-16/14-3-3 association experiments, 293 cells were trans- dependent and 14-3-3-independent mechanisms. Thus, our ob- fected using LipofectAMINE (Life Technologies, Inc.) in 10-cm plates with 2 mg each of GST-14-3-3 or GST-AKT and 4 mg of pcDNA3-DAF-16 servations suggest a more complex mode of DAF-16 regulation variants. For the DAF-16 localization and DNA binding experiments, than previously anticipated. 293 cells were transfected with 5 mg of the pcDNA3-DAF-16 variants or pcDNA3 alone. EXPERIMENTAL PROCEDURES Plasmids and Reagents—The DAF-16a1 HindIII/NheI insert from RESULTS pGEM-FLAG-DAF-16a1 was ligated into the HindIII/XbaI site of AKT Phosphorylates DAF-16 and Promotes Its Association pcDNA3 (1) (Invitrogen) to generate pcDNA3-Flag DAF-16a1. The DAF-16a1 BstYI insert from pGEM-FLAG-DAF-16a1 was ligated into with 14-3-3—Consistent with the genetic data that positions the BamHI site of pGEX-4T-1 (Amersham Pharmacia Biotech) to gen- DAF-16 downstream of the PI 3-kinase-regulated serine/thre- erate pGEX-DAF-16a1. Phosphorylation site mutants were prepared onine kinase AKT in C. elegans, there are four consensus AKT using the QuickChange site-directed mutagenesis kit (Stratagene). The phosphorylation sites in DAF-16 (Fig. 1A). As has been estab- DAF-16a1 BstYI insert from pGEM-FLAG-DAF-16a1 was ligated into lished for the mammalian DAF-16 orthologs FKHR (16, 19, 32), the BamHI site of the GAL4 DNA binding domain plasmid to generate FKHRL1 (14), and AFX (15, 34), AKT can phosphorylate GAL4-DAF-16 derivatives. The rat IGF-BP-1 promoter (nucleotides 2921 to 179) cloned in PGL3-LUC was a gift from M. Rechler (National DAF-16 on at least three of its four potential AKT sites, and Institutes of Health, Bethesda, MD). Preparation of pMT2-Myc-14-3-3, these sites serve as the only AKT-phosphorylation sites in vitro pGEX-GST-14-3-3, and the pGEX-GST-14-3-3 dimerization mutant has (Fig. 1B, top). Phosphospecific antibodies generated against been described previously (26, 27). The pEBG-GST-AKT plasmid was a 14-3-3-binding consensus sequences can specifically recognize gift from J. R. Woodgett (Toronto, Canada). Specific DAF-16 antibodies DAF-16 phosphorylated by AKT but not unphosphorylated were produced in rabbits using the Forkhead DNA binding domain of DAF-16 cloned into GST as the antigen. The competitor 14-3-3 binding DAF-16 (Fig. 1B, compare lane 2 to lane 1). This antibody phosphopeptide LPKINRSA(Sp)EPSLHR (PP, corresponding to c-Raf-1 recognizes phosphorylation of DAF-16 at threonine 54 (Fig. 1B, amino acids 613– 627) and the unphosphorylated version (P) were syn- middle, lane 2 versus lane 3). Phosphorylation of recombinant thesized by QCB (Boston, MA). Anti-phosphopeptide specific antibodies prokaryotic GST-DAF-16 by AKT induces its binding to recom- against 14-3-3 binding consensus were a gift from M. Comb (New binant mammalian 14-3-3z in vitro (Fig. 1C). This association England Biolabs, Beverly, MA). is inhibited by a competitor phosphopeptide corresponding to a Kinase Assay—For experiments to phosphorylate DAF-16 in vitro, GST-DAF-16 proteins were purified from bacteria and GST-AKT was 14-3-3 binding site on c-Raf-1 but not by the unphosphorylated expressed in 293 cells and subsequently affinity-purified on GSH beads form of the peptide (compare lane 2 with lanes 3 and 4). The (Amersham Pharmacia Biotech). Kinase assays were performed using 2 association with 14-3-3 is also inhibited by mutation of the mg of GST-AKT as the kinase and 2 mg of GST-DAF-16 or DAF-16 AKT-phosphorylation sites on DAF-16 (compare lane 2 with mutant as the substrate in a kinase buffer containing 40 mM Tris-HCl, lanes 5, 7, and 8). In particular, the AKT-phosphorylation site pH 7.5, 0.1 mM EDTA, 5 mM MgCl ,2mM dithiothreitol, and 100 mM at threonine 54, a site matching closest to the 14-3-3 binding ATP (cold assay) supplemented with [g- P]ATP (10 –20 mCi/reaction) consensus, represents a site whose phosphorylation is indis- (hot assay) at 30 °C for 40 min. Protein Interaction Assays—Myc epitope-tagged 14-3-3 expressed in pensable for 14-3-3 binding in vitro (compare lane 2 with 293 cells was absorbed to anti-Myc epitope antibodies (clone 9E10) lane 5). pre-coupled to protein-A beads and incubated with 2 mg of AKT- phos- 14-3-3 Association with Wild-type DAF-16 Inhibits Its DNA phorylated wild-type and mutant GST-DAF-16 for 90 min at 4 °C. Binding Activity—Homologues of DAF-16 bind and activate Following extensive washes, the associated proteins were separated on transcription through the IRE in the IGFBP gene (14, 16). SDS-PAGE and phosphorylated DAF-16 was detected by autoradiogra- phy. Both wild-type and mutant GST-DAF-16 variants were detected by Accordingly we also find that DAF-16 binds specifically to the anti-GST immunoblotting. IRE (Fig. 2A). A DAF-16 derivative L201P, with a leucine to Electrophoretic Mobility Shift Assay—Samples containing 2 mgof proline substitution in the forkhead DNA binding domain, does GST-DAF-16 or 5–10 mg of nuclear extracts, treated as indicated in the not bind to the P-labeled IRE, nor does an amino-terminal figure legends were incubated with 50,000 cpm of P-labeled IGFBP- fragment (1– 69) of DAF-16 that lacks the forkhead DNA bind- IRE probe (caaaacaaacttattttgaa) or G-C/A-C mutant probe (caaaa- ing domain (Fig. 2, compare lane 4 to lanes 6 and 7). A specific gaaacttcttttgaa) for 15 min at 4 °C in a buffer containing 40 mM Tris- HCl, pH 7.5, 5 mM MgCl , 0.1 mM EDTA, 1 mM dithiothreitol, 50 mM antibody raised against DAF-16 supershifts the DAF-16/DNA 2 13404 14-3-3-dependent and -independent Regulation of DAF-16 Phosphorylation of DAF-16 by AKT did not by itself affect DAF-16-DNA binding (Fig. 2B, compare lanes 1 and 3); how- ever, the addition of 14-3-3 to AKT-phosphorylated DAF-16 resulted in an almost complete inhibition of DAF-16 DNA bind- ing activity (Fig. 2B, compare lanes 3 and 4). The addition of 14-3-3 had no effect on DAF-16 DNA binding when AKT was omitted (Fig. 2B, compare lanes 2 and 4), or when ATP was omitted (Fig. 2C, compare lanes 7 and 3) from the kinase reaction. Moreover, the competitor 14-3-3 binding phosphopep- tide selectively blocked the ability of 14-3-3 to inhibit DAF-16 DNA binding while the unphosphorylated version had no effect (Fig. 2B, compare lanes 5 and 6) demonstrating the require- ment of the 14-3-3-phosphopeptide binding domain for the in- hibition. Thus, the ability of 14-3-3 to inhibit DAF-16 DNA binding required the association of 14-3-3 with phospho-DAF- 16. The DNA binding activity of DAF-16 mutants impaired in their ability to bind 14-3-3, DAF-16 54A (T54A), and DAF-16 4A (T54A, S240A, T242A, S314A) was unaffected by AKT/14- 3-3 (Fig. 2D, compare lanes 1 and 2 with lanes 4 and 5 and lanes 7 and 8). Conversely, the DNA binding activity of the DAF-16 2A (240/242A) mutant that retains the ability to bind 14-3-3 was inhibited (Fig. 2D, lanes 13 and 14). Although the DAF-16 (S314A) mutant retains the ability to bind 14-3-3 following AKT phosphorylation (data not shown), 14-3-3 does not inhibit its ability to bind DNA (Fig. 2D, lanes 10 and 11). The inability of the dimerization-deficient 14-3-3 mutant to inhibit DAF-16 DNA binding (Fig. 2C, compare lane 3 with lane 6), together with the ability of wild- type 14-3-3 to inhibit mutant DAF-16 2A (S240A/T242A), but not mutant DAF-16 (T54A) or (S314A) DNA binding, suggests that dimeric 14-3-3 interacts with DAF-16 at sites Thr-54 and Ser-314. This interaction may, in turn, mask the forkhead DNA binding domain of DAF-16. Insulin Inhibition of DAF-16 Activity Is Mediated at the Level of DNA Binding—We have shown that AKT phosphorylation of DAF-16 WT allows association of 14-3-3 and that this associa- FIG.1. AKT phosphorylates DAF-16 on four distinct sites and tion inhibits binding of DAF-16 to DNA. In HepG2 cells, insulin mediates 14-3-3 binding. A, linear map of DAF-16 protein showing inhibits transcription activation by DAF-16 and this effect re- the amino acid sequence of the putative AKT consensus (RXRXXS) phosphorylation sites at Thr-54, Ser-240, Thr-242, and Ser-314. The quires the AKT/14-3-3 sites in DAF-16 (21). If insulin inhibition indicated mutants were constructed for expression in both mammalian of DAF-16 activity results from an interaction of DAF-16 with and bacterial cells: 1A (T54A); 2A (S240A and T242A); 3A (T54A, 14-3-3 that inhibits DNA binding, we would not expect to see S240A, and T242A); 4A (all four sites mutated to alanine). B, phospho- insulin inhibition of DAF-16 activity if the protein were teth- rylation of GST-DAF-16 in vitro by AKT. Recombinant prokaryotic GST-fused DAF-16 (lanes 1 and 2) and the indicated mutants (lanes ered to the promoter by way of a heterologous DNA binding 3– 6), 2 mg each, were incubated in a kinase buffer containing 2 mgof domain. Therefore, we compared the effect of insulin on the active recombinant mammalian GST-AKT (lanes 2– 6) or vehicle (lane activity of a fusion protein encoding the GAL4 DNA binding 1) for 40 min at 30 °C. Following SDS-PAGE, the samples were blotted with phosphopeptide antibodies against degenerated 14-3-3 binding domain and DAF-16 using the IRE DNA site in IGFBP-1 or consensus (XXXXXRSXS(p)XPXXXXX) (a gift from M. Comb). Autora- GAL4 DNA (Fig. 3). diogram showing GST-DAF-16 phosphorylation (top) and immunoblot In HepG2 cells, DAF-16 expressed in a pcDNA vector acti- showing reactivity with the phosphospecific antibodies (middle) and an vates transcription of the IGFBP promoter by 4-fold (Fig. 3A, anti-GST immunoblot showing equal protein loading (bottom) are pre- compare bars A and D) and this effect is inhibited by insulin sented. C, in vitro binding of AKT phosphorylated GST-DAF-16 to 14-3-3. Unphosphorylated GST-DAF-16 (lane 1), AKT-phosphorylated (bar E) or by overexpression of constitutively active AKT (bar GST-DAF-16 (lanes 2– 4 and 9), or the indicated GST-DAF-16 mutants F). The AKT site mutant DAF-16 4A is resistant to the effect of (lanes 5– 8) were incubated with immobilized Myc-tagged 14-3-3 (pre- insulin and AKT on IGFBP gene transcription (compare bar G pared using anti-Myc antibodies and protein A beads) from 293 cells (lanes 1– 8) or control beads (lane 9) in the presence of competitor 14-3-3 to bars H and I, respectively). Thus, in HepG2 cells, the inhib- binding phosphopeptide (PP,1mM, lane 3) or unphosphorylated control itory effect of insulin and AKT on DAF-16 is dependent on its peptide (P,1mM, lane 4)for2hat4 °C. Following washes to remove AKT/14-3-3 sites (16, 21). nonspecific binding, bound proteins retained on the immobilized Myc- DAF-16 WT and DAF-16 4A mutant were expressed as fu- tagged 14-3-3 beads were subjected to SDS-PAGE, transferred to a sion proteins with the GAL4 DNA binding domain (Fig. 3, polyvinylidene difluoride membrane, and tested for phospho-GST- DAF-16 by autoradiography (top). Anti-GST immunoblot (middle) was panel B) and their response to insulin was assessed using the used for the detection of both DAF-16 WT and AKT site mutant DAF-16 IGFBPzIRE (bars A–D) or the GAL4 DNA site (bars E–H)to derivatives bound to the Myc-14-3-3 column. The DAF-16 mutants 3A drive transcription. The GAL4-DAF-16 fusion protein stimu- and 4A are only partially phosphorylated or not at all and can not be detected by autoradiography. A Coomassie stain of the blot (bottom)is lated basal IGFBP gene transcription 4-fold, identical to the shown to demonstrate equal 14-3-3 input. DAF-16 derivatives expressed in the pcDNA expression system (data not shown). As expected, when activity was assessed complex (Fig. 2A, lane 5). We examined whether AKT phospho- using the IGFBP-1 promoter (containing the IRE), GAL4- rylation and/or subsequent association of DAF-16 with 14-3-3 DAF-16 activity was inhibited by insulin (Fig. 3, panel B, could alter the ability of DAF-16 to bind its target IRE site. compare bars A and B), while the activity of GAL4-DAF-16 – 14-3-3-dependent and -independent Regulation of DAF-16 13405 FIG.2. AKT phosphorylation and subsequent 14-3-3 binding inhibit DAF-16 DNA binding. A, DAF-16 binds to IRE DNA. Prokaryotic recombinant GST-DAF-16 (lanes 1–5), GST-DAF-16 (L201P, mutation in the DNA binding domain) (lane 6), and GST-DAF-16 (amino acids 1– 69, lane 7), 2 mg each, were incubated with P-labeled IGFBP IRE (50,000 cpm) in electrophoretic mobility shift assay binding buffer alone (lanes 1, 4, 6, and 7) or in the presence of 103 cold competitor wild-type IRE (lane 2) or mutant IRE (lane 3) or in the presence of anti-DAF-16 antibody (lane 5) and resolved on a 4% nondenaturating gel as described under “Experimental Procedures.” An autoradiogram of the gel is presented. The positions of DAF-16/DNA complexes and complexes supershifted with antibody are indicated. B, AKT phosphorylation of DAF-16 and 14-3-3 association prevents DAF-16 binding to IRE DNA. GST-DAF-16 (2 mg) was incubated in a kinase buffer containing 2 mg of active GST-AKT (lanes 3– 6) or vehicle (lane 1 and 2) for 40 min at 30 °C, followed by a 30-min incubation with prokaryotic recombinant GST-14-3-3 (lanes 2 and 4–6), or vehicle (lanes 1 and 3). The presence of competitor phosphopeptide (pp,1mM, lane 5) or unphosphorylated peptide (p,1mM, lane 6) is indicated. GST-DAF-16 was assayed for DNA binding as in panel A. C, Inhibition of DAF-16 binding to the IRE requires active AKT and an intact 14-3-3 dimer. GST-DAF-16 (2 mg) was incubated in a kinase buffer containing 2 mg of active GST-AKT in the presence (lanes 1– 6) or absence (lanes 7–10) of ATP, followed by a 30-min incubation with GST-14-3-3 (lanes 2–5 and 7–9), vehicle (lane 1), or a dimerization-deficient GST-14-3-3 (dm, lanes 6 and 10) in the presence of competitor phosphopeptide (pp,1mM, lanes 4 and 8) or unphosphorylated peptide (p,1mM, lanes 5 and 9). The samples were assayed for DNA binding as in panel A. D, inhibition of DAF-16 binding to the IRE by AKT/14-3-3 requires intact AKT sites Thr-54 and Ser-314 on DAF-16. GST-DAF-16 (lanes 1–3), GST-DAF-16(T54A) (lanes 4 – 6), GST-DAF-16(4A) (lanes 7–9), GST-DAF-16(314A) (lanes 10 –12), and GST-DAF-16(2A) (lanes 13–15), 2 mg each, were incubated in a kinase buffer containing 2 mg of active GST-AKT (lanes 2, 5, 8, 11, and 14) or vehicle (all others) for 40 min at 30 °C followed by 30-min incubation with prokaryotic recombinant GST-14-3-3 (lanes 2, 5, 8, 11, and 14) or vehicle (all others). The samples were assayed for binding to mutant (lanes 3, 6, 9, 12, and 15) or wild type (all others) P-IRE probes as in panel A. 4A, which fails to bind 14-3-3, was not affected by insulin (Fig. the observation that GAL4-DAF-16 is resistant to insulin sig- 3, panel B, compare bars C and D). By contrast, although the naling when the protein is tethered to the GAL4 DNA target GAL4-DAF-16 and GAL4-DAF-16 4A fusion proteins activated site suggests that 14-3-3 inhibition of DAF-16 DNA binding transcription similarly when assessed on the GAL4 DNA bind- may be a first step in the negative regulation of DAF-16 activ- ing site (bars E–H), neither wild-type GAL4-DAF-16, nor ity allowing subsequent changes in DAF-16 subcellular local- GAL4-DAF-16 – 4A were inhibited by insulin (panel B, bars E ization to occur. and F and bars G and H). PI 3-Kinase Signaling Regulates DAF-16/14-3-3 Interaction The observation that GAL4-DAF-16 responds to insulin and Consequent Subcellular Distribution—Our in vitro DNA when its activity is assessed using an IRE site, but not a GAL binding results imply that the association of DAF-16 with 4 site, indicates that the response of this fusion protein is 14-3-3 plays a crucial role in the negative regulation of DAF-16 analogous to that of the native DAF-16 protein. If insulin’s DNA binding. As HepG2 cells do not express sufficient DAF-16 action to inhibit DAF-16 activity resulted from a direct effect on to enable detection by DNA binding assay, we were unable to the intrinsic transcription activity of GAL4-DAF-16 or from study direct effects of insulin on DAF-16 DNA binding in these nuclear export of GAL4-DAF-16, we would expect to see the cells. However, coexpression studies of GST-tagged 14-3-3 and negative effect of insulin on both the GAL4 and the IRE DNA Flag-tagged DAF-16 proteins in 293 cells demonstrate that binding sites. Inasmuch as we observe the inhibitory effect of 14-3-3 and DAF-16 can associate both in serum-deprived cells insulin on the IRE alone, we conclude that insulin’s effect is and in cells growing exponentially in serum (Fig. 4A, compare mediated at the level of DAF-16 DNA binding. Furthermore, lanes 2 and 4). Treatment of serum-starved cells with the PI 13406 14-3-3-dependent and -independent Regulation of DAF-16 FIG.3. Insulin inhibition of DAF-16 activity in HepG2 cells is dependent on the AKT sites and is mediated at the level of DNA binding. A, insulin and AKT/PKB inhibits the transcription activity of DAF-16 WT but not AKT site mutant DAF-16 4A. HepG2 cells were transiently cotransfected with the IGFBP-luciferase reporter gene (15 mg) and the expression vector pcDNA3 (1 mg/ml) (bars A–C), wild-type pcDNAzDAF-16 (1 mg/ml) (bars D–F), or a mutant of DAF-16 in which an alanine residue was inserted in place of serine or threonine at the four putative AKT sites, DAF-16 4A (1 mg/ml) (bars G–I), and constitutively active PKB (2 mg/ml) (bars C, F, and I). Serum-starved cells were incubated with insulin (1 milliunit/ml) (bars B, E, and H) or vehicle (bars A, C, D, F, G, and I) during the last 16 h of the incubation. Luciferase activity is shown corrected for b-galactosidase gene expression. B, insulin mediates its inhibitory effects on DAF-16 at the level of DNA binding. HepG2 cells were transiently cotransfected with an expression vector encoding wild-type GAL4zDAF-16 (bars A, B, E, and F), or mutant GAL4zDAF-16 derivative 4A (bars C, D, G, and H) and either the IGFBP-luciferase reporter containing the IRE (bars A–D) or the GAL4-LUC reporter gene (bars E–H) (15 mg) together with the RSV-b-galactosidase reporter gene. Cells were stimulated with vehicle (bars A, C, E, and F) or with insulin (bars B, D, F, and H) as described in panel A. Luciferase activity was corrected for b-galactosidase and plotted as percentage of the unstimulated control. 3-kinase-specific inhibitor LY294002 caused a marked de- LY294002 on DAF-16 DNA binding activity in these cells. crease in 14-3-3/DAF-16 association (Fig. 4A, compare lane 2 Nuclear extracts were isolated from 293 cells transiently trans- with 3 and lane 11 with 12). These findings suggested that PI fected with expression plasmids encoding Flag-tagged DAF-16 3-kinase signaling to AKT and phosphorylation of DAF-16 (Fig. 5). The identity of DAF-16 overexpressed in HEK 293 cells could regulate its association with mammalian 14-3-3 as it does was demonstrated by supershift experiments using antibodies for FKHRL1 (14). against the Flag epitope tag on DAF-16 (Fig. 5A, compare lanes Accordingly, we found that the 14-3-3/DAF-16 association 2 and 5). depended on the presence of the AKT-phosphorylation site at We detected low DAF-16 DNA binding activity in the nuclear residue Thr-54 on DAF-16 (Fig. 4A, lanes 13–15)in vivo,asis extracts of 293 cells growing exponentially in serum (Fig. 5B, the case in vitro. However, the alanine mutations at residues lane 2); inhibition of PI 3-kinase by LY294002 markedly in- 240/242, which did not prevent association of DAF-16 2A with creased DAF-16 DNA binding activity (compare lanes 2 and 3). 14-3-3 in vitro, greatly reduced 14-3-3 association in vivo (lanes This increase was not simply a reflection of an increase in 16 –18). Mutation of site Thr-54 and sites Ser-240/Thr-242 in DAF-16 protein in the LY294002 treated nuclear extracts due DAF 3A completely prevented DAF-16/14-3-3 association to nuclear translocation, because extracts containing equal (lanes 19 –21). amounts of DAF-16 were employed (Fig. 5B, see Western blot The ability of DAF-16 derivatives to associate with mamma- (lower panel); compare lanes 4 and 6). Thus, the increase in lian 14-3-3 correlated with the subcellular localization of DAF- DAF-16 DNA binding activity shown reflects an increase in its 16. In exponentially growing cells, recombinant DAF-16 was specific DNA binding activity indicating that LY294002 can present both in the cytoplasm and in the nucleus (Fig. 4B, lanes prevent negative regulation of DAF-16 DNA binding activity by 2– 4 and 15–17). Mutants of DAF-16 impaired in 14-3-3 bind- a PI 3-kinase-mediated mechanism. ing, DAF-16 T54A, 2A, and 4A were confined strictly to the We also examined the effect of PI 3-kinase inhibition on nucleus (Fig. 4B, compare lanes 2 and 3 with lanes 5 and 6, regulation of DAF-16 AKT site mutants that do not bind 14-3-3 lanes 8 and 9, and lanes 11 and 12). Thus, DAF-16 can interact in vivo, DAF-16 2A and DAF-16 4A (Fig. 5C, upper panel). Both with mammalian import/export proteins. LY294002 and wortmannin increased the DNA binding activity Inhibition of PI 3-kinase signaling with LY294002 caused a of wild-type DAF-16 (Fig. 5C, upper panel, compare lane 4 to shift of DAF-16 to the nucleus and an almost complete disap- lanes 5 and 6). In exponentially growing cells mutants of pearance of DAF-16 from the cytoplasm (Fig. 4B, compare lanes DAF-16 impaired in 14-3-3 binding, DAF-16 2A, 3A, and 4A 15 and 16 with lanes 18 and 19 and lane 21 and 22). The finding were confined strictly to the nucleus (Fig. 5C, lower panel, that the C. elegans transcription factor DAF-16 can couple to compare lanes 9 and 10, lanes 11 and 12, and lanes 13 and 14). mammalian AKT, 14-3-3, and the mammalian import/export Nevertheless, similar to DAF-16 WT (Fig. 5C, lanes 4 and 5), machinery demonstrates it functions in an analogous manner the DNA binding activity of DAF-16 2A and DAF-16 4A was to its mammalian homologs FKRH and FKHRL1 (14, 32). enhanced by PI 3-kinase inhibition (Fig. 5C, upper panel, com- Inhibition of Endogenous PI 3-Kinase Signaling Enhances pare lanes 7 and 8 and lanes 9 and 10). DAF-16 DNA Binding Activity Independent of DAF-16 AKT In the insulin-responsive HepG2 cell line, serum inhibits the Phosphorylation Sites—Having demonstrated that inhibition effect of endogenous factors on IGFBP gene transcription by of PI 3-kinase signaling with LY294002 leads to dissociation of 90% (Fig. 5D, bar B) relative to the activity seen in serum- DAF-16/14-3-3 in 293 cells, we examined the effect of deprived cells (bar A). The PI 3-kinase inhibitor enhances IG- 14-3-3-dependent and -independent Regulation of DAF-16 13407 FIG.4. Serum growth factors signaling to PI 3-kinase regulate DAF-16 nuclear/cytoplasmic distribution by regulating DAF-16/ 14-3-3 association. A, in vivo pull-down of Flag epitope-tagged DAF-16 with GST-tagged 14-3-3 or GST-AKT. Flag epitope-tagged DAF-16 (lanes 2– 4, 6–8, and 10 –12), DAF-16 mutants; T54A (lanes 13–15), 2A (lanes 16 –18), 3A (lanes 19 –21), or control vector (lanes 1, 5, and 9) were coexpressed in 293 cells with GST-14-3-3 (lanes 1– 4 and 9 –21) or GST-AKT (lanes 5– 8). After transfection (24 h), cells were either grown in serum (lanes 4, 8, 10, 13, 16, and 19) or were serum-deprived in the presence of the PI 3-kinase inhibitor LY294002 (lanes 3, 7, 12, 15, 18, and 21) or vehicle (lanes 1, 2, 5, 6, 9, 11, 14, 17, and 20) for 24 h. Following affinity purification of GST fusions on GSH beads, associated DAF-16 was detected by anti-Flag immunoblot (using monoclonal antibody M2 (Sigma), top panel). The blots were Coomassie-stained for GST fusion recovery evaluation (middle panel). Representative samples of total lysates were analyzed for DAF-16 expression by anti-Flag immunoblot (bottom panel). B, subcellular localization of DAF-16 WT and AKT site mutant derivatives in HEK 293 cells. Flag-epitope-tagged DAF-16 (lanes 2– 4 and 15–23), DAF-16 mutants T54A (lanes 5–7), 2A (lanes 8 –10), 4A (lanes 11–13), or control vector (lane 1) were expressed in 293 cells. 24 h after transfection, cells were maintained in serum (lanes 1–17) or deprived of serum in the presence of PI 3-kinase inhibitors: LY294002 (10 mM, lanes 18 –20)or wortmannin (10 nM, lanes 21–23). Cells were harvested and fractionated into nuclear and cytoplasmic fractions using the NE-PER kit (Pierce). 30 mg of nuclear (N, lanes 3, 6, 9, 12, 16, 19, and 22), 100 mg of cytoplasmic (C, lanes 2, 5, 8, 11, 15, 18, and 21), and a combination of 15 mg of nuclear and 50 mg of cytoplasmic (N/C, lanes 1, 4, 7, 10, 13, 14, 17, 20, and 23) extracts were resolved on SDS-PAGE and assayed for the presence of DAF-16 by anti-Flag immunoblot. FBP-1 gene transcription 2-fold above that seen in serum- pression system (panel D) or as GAL4 fusion proteins compare starved cells (compare bars A and C). DAF-16 activates the (panel E), their activity is stimulated above basal in response to IGFBP promoter (compare bar A to bar D) and serum inhibits LY294002 (Fig. 5E, bars B, D, and F). However, when activity the activity of exogenous DAF-16 by 50% (compare bars D and is assessed using the GAL4 DNA binding site to direct gene E), while LY294002 increases DAF-16 activity 2.5-fold over expression, LY294002 does not activate the GAL4-DAF-16 de- control levels (compare bars D and F). rivatives (Fig. 5F, bars B, D, and F). Thus, we conclude that the The transcriptional activity of both wild type and mutant stimulatory effect of LY29004 is also mediated at the level of derivatives of DAF-16 was similarly regulated by PI 3-kinase DNA binding in vivo. inhibition in HepG2 cells (Fig. 5E). Whether wild- type or The enhancing effect of LY294002 on GAL4-DAF-16 WT is mutant DAF-16 derivatives are expressed in the pcDNA ex- greater than its enhancing effect on GAL4-DAF-16 3A and 4A 13408 14-3-3-dependent and -independent Regulation of DAF-16 FIG.5. PI 3-kinase inhibition enhances DAF-16 DNA binding and transcriptional activity via an AKT/14-3-3 site-independent pathway. A, identification of DAF-16 DNA binding activity in 293 cell nuclear extract. Nuclear extract was isolated from 293 cells expressing Flag epitope-tagged DAF-16 (M2-DAF-16) (lanes 3–5) or pcDNA alone (lanes 1 and 2) and assayed for binding to the P-labeled IGFBP-IRE as in Fig. 2A. Preimmune serum (PI, lanes 1 and 4) or anti-Flag antibody (M2, lanes 2 and 5) was used to supershift DAF-16/DNA complexes. The location of the DAF-16/DNA complex and M2/DAF-16/DNA complex (supershift) is indicated. B, inhibition of endogenous PI 3-kinase activity enhances binding of DAF-16 to IRE DNA. Upper panel, nuclear extracts of 293 cells expressing Flag-epitope-tagged DAF-16 (M2-DAF-16) (lanes 2 and 3)or vehicle (lane 1) grown in serum (lanes 1 and 2) or serum-deprived in the presence of LY294002 (10 mM, lane 3) were prepared as in Fig. 4B and assayed for binding to the IGFBP-IRE as described in Fig. 2A and “Experimental Procedures.” Lower panel, expression of DAF-16 in the nuclear (N) and cytoplasmic (C) fractions of the extracts shown was determined by anti-Flag immunoblotting. C, inhibition of endogenous PI 3-kinase with LY294002 enhances binding of DAF-16 AKT site mutants to IRE DNA. Upper panel, nuclear extract was isolated from 293 cells transfected with pcDNA alone (lanes 1–3), Flag-epitope-tagged DAF-16 (lanes 4 – 6), DAF-16 2A (lanes 7 and 8), or DAF-16 4A (lanes 9 and 10). Cells were grown in serum (lanes 1, 4, 7, and 9) or serum-deprived in the presence of LY294002 (10 mM, lanes 2, 5, 8, and 10) or wortmannin (10 nM, lanes 3 and 6). Binding to IGFBPzIRE was assayed as in Fig. 2A. Lower panel, expression of DAF-16 in the nuclear (N) and cytoplasmic (C) fractions was determined by anti-Flag immunoblotting. D, serum growth factors regulate DAF-16 transcription activation. Insulin-responsive HepG2 hepatoma cells were cotransfected with a luciferase reporter gene under the control of the native IGFBP promoter (15 mg) and pcDNA3-DAF-16 (2 mg/ml) (bars D–F) or a control pcDNA3 vector (2 mg/ml) (bars A-C) together with RSV- b-galactosidase to correct for transfection efficiency. 4 h after transfection, cells were changed to serum-containing media (bars B and E) or serum deprivation media (starved) (bars A, C, D, and F)inthe absence (bars A and D) or presence (bars C and F) of LY294002 (10 mM). Cells were harvested and assayed for luciferase (Promega kit) and b-galactosidase (Tropix kit) expression according to the manufacturers instructions. The mean ratios 6 S.E. of luciferase/b-galactosidase triplicates are presented. E, inhibition of endogenous PI 3-kinase activity enhances transcription activity of DAF-16 WT and AKT site mutants DAF-16 3A and DAF-16 4A on the IGFBPzIRE. HepG2 cells were transiently cotransfected with an expression vector encoding the wild-type GAL4zDAF-16 (bars A and B), or mutant GAL4zDAF-16 derivatives 3A (bars C and D)or4A(bars E and F)(2 mg), the IGFBP-luciferase reporter gene (15 mg), and the RSV-b galactosidase reporter gene (2 mg). Control cells growing exponentially in serum were stimulated with vehicle (bars A, C, and E) or serum-starved cells were stimulated with LY294002 (bars B, D, and F). The effect of LY294002 is shown as the percentage of control value. F, inhibition of endogenous PI 3-kinase activity does not affect transcriptional activity of DAF-16 WT or mutants on the GAL4 site. HepG2 cells were transiently cotransfected with GAL4zDAF-16 derivatives (2 mg/ml) and the GAL4-LUC (15 mg) reporter gene. Control cells growing exponentially in serum (bars A, C, and E) were compared with serum-starved cells stimulated with LY294002 (bars B, D, and F). Luciferase activity was normalized for b-galactosidase gene expression and is presented as the percentage of the serum value for each plasmid. on the IGFBP-IRE (Fig. 5E, compare bar B to bars D and F), mechanism can control DAF-16 DNA binding and transcription which suggests that DAF-16 WT is subject to both 14-3-3-de- activity. pendent and independent regulation by LY294002 in vivo. The DISCUSSION ability of LY294002 to enhance the activity of DAF-16 AKT/14- 3-3 site mutants that are confined strictly to the nucleus (Fig. Our results reveal the existence of at least two mechanisms 5C, lower panel, lanes 9 –14, DAF-16 2A, 3A, and 4A) indicates that cooperate to inhibit DAF-16 DNA binding in response to that a PI 3-kinase-responsive, 14-3-3/AKT site-independent factors that activate PI 3-kinase-dependent signaling path- 14-3-3-dependent and -independent Regulation of DAF-16 13409 TABLE I Inhibition of DAF-16 DNA binding via 14 –3-3-dependent (I) and -independent (II) pathways Pathway I, 14 –3-3 associates with AKT-phosphorylated DAF-16 WT in vitro and blocks its ability to bind to the IRE DNA. In vivo DAF-16 WT associates with 14 –3-3 and is translocated from the nucleus to the cytoplasm. Insulin inhibits transcription activation of DAF-16 WT when activity is assessed on IRE DNA, but not GAL4 DNA pointing to the importance of DAF-16/IRE binding as a mode of regulation by insulin. Insulin does not regulate the activity of the AKT/14 –3-3 site mutant DAF-16 4A. Pathway II, a 14 –3-3-independent mode of DAF-16 regulation is manifested by DAF-16 4A, which lacks all four AKT sites, does not bind 14 –3-3, is not exported from the nucleus but, like DAF-16 WT, is subject to DNA binding regulation by the PI3 kinase inhibitor LY294002. LY294002 enhances DNA binding and transcription activity of both DAF-16 WT and 4A and therefore mediates its effect at least in part via an AKT site/14 –3-3-independent pathway. Again regulation by LY294002 of GAL4 DAF-16 WT and 4A on an IRE but not a GAL4 DNA site, indicates that this effect is mediated primarily at the level of DNA binding. Association in Ability of 14-3-3 to Association in Insulin LY294002 Effect of insulin or Pathway DAF-16 vitro with 14- inhibit DNA binding in vivo with 14- Translocation inhibition on activation on LY294002 on 3-3 vitro 3-3 IRE site IRE site GAL4 site IWT 11 1 1 1 1 2 II 4A 22 2 2 2 1 2 FIG.6. Proposed model of DAF-16 regulation by growth factor signaling to PI 3-kinase. Under conditions in which PI 3-kinase is inactive, DAF-16 is found in the nucleus and is bound to DNA. Pathway I, following growth factor stimulation and activation of PI 3-kinase, AKT phosphorylates DAF-16 on Thr-54, Ser-240/242, and Ser-314, 14-3-3 binds the Thr-54 and Ser-314 sites and prevents the interaction of DAF-16 with DNA. DAF-16 is then translocated to the cytoplasm. Pathway II, endogenous PI 3-kinase signaling to DAF-16 WT and DAF-16 4A, which lacks AKT/14-3-3 binding sites, inhibits their ability to binding DNA. This effect occurs in the absence of 14-3-3 association or DAF-16 translocation. We propose that endogenous PI 3-kinase activates a kinase (or phosphatase) other than AKT that phosphorylates DAF-16 4A and inhibits DAF-16 4A DNA binding activity directly or by recruiting a cofactor that interacts with DAF-16 in a manner analogous to 14-3-3. Alternatively AKT or another kinase could phosphorylate the cofactor that interacts with DAF-164A. Regulation of DAF-16 WT DNA binding in vivo may occur via a combination of pathways I and II. ways. First, we show that in addition to its proposed role in DAF-16 in response to PI 3-kinase signaling. In a third sce- promoting nuclear export/cytoplasmic retention of forkhead nario, a non-AKT kinase (or phosphatase) downstream of en- proteins, 14-3-3 can directly inhibit binding of AKT- phospho- dogenous PI 3-kinase could directly phosphorylate DAF-16 or rylated DAF-16 to DNA (Table I and Fig. 6, pathway I). Second DAF-16 4A and inhibit their ability to bind DNA. we describe a novel PI 3-kinase-dependent pathway that inhib- In HepG2 cells, we find that insulin inhibition of DAF-16 its the DNA binding activity of DAF-16 4A, an AKT/14-3-3 site function occurs via an AKT/14-3-3 site-dependent pathway mutant that cannot bind 14-3-3 and is not subject to PI 3-kinase- (Fig. 6, pathway I), consistent with the observed ability of dependent nuclear export (Table I and Fig. 6, pathway II). The dimeric 14-3-3 to bind AKT phosphorylated DAF-16. Our ob- ability of endogenous PI 3-kinase signaling to prevent DAF-16 servation that insulin fails to inhibit the activity of GAL4- DNA binding independent of 14-3-3 may involve a phospho- DAF16 bound to the GAL4 DNA site, as opposed to the IRE rylation-dependent interaction of DAF-16 with an interacting DNA site, implies that GAL4-DAF-16 is not subject to insulin- protein. This cofactor could have an analogous function to mediated inhibition of DNA binding or nuclear export when it 14-3-3 and inhibit DAF-16 DNA binding activity in response to is tethered to GAL4 DNA. Thus, we propose that, in HepG2 and PI 3-kinase signaling. On the other hand, a cofactor that acts to 293 cells, growth factors that regulate PI 3-kinase activity may stabilize DAF-16 DNA binding activity might dissociate from act primarily to inhibit DAF-16 DNA binding via an interaction 13410 14-3-3-dependent and -independent Regulation of DAF-16 with 14-3-3 and that this step is permissive for nuclear export. The proposed model of multistep regulation of DAF-16 at the Our finding that insulin inhibition of DAF-16 is prevented by level of DNA binding as well as regulation of subcellular local- mutation of its AKT sites in HepG2 cells confirms that of Guo ization by 14-3-3 underscores the complexity of the PI 3-kinase et al. (16), who reported similar results for FKHR. In Fig. 6 signaling pathways to forkhead proteins. Analogous results (pathway II), we propose a role for a kinase (or phosphatase) have been described for PHO4, where four distinct phosphoryl- other than AKT in mediating the effect of PI 3-kinase signaling ation sites cooperate to regulate nuclear import, nuclear ex- on DAF-16 DNA binding and function. Two observations sug- port, and transcription activation of the target gene for PHO5 gest that the endogenous PI 3-kinase activity observed in se- (38). Understanding the complex regulation of DAF-16 and its rum-starved HepG2 and 293 cells may act via a distinct path- mammalian homologues will provide valuable insights into the way from that which mediates the effect of insulin in HepG2 mechanism that underlie the diverse effects of insulin on the cells. First, whereas insulin signaling via PI 3-kinase inhibits metabolism, growth, and survival of its target tissues. DAF-16 function via its AKT sites in HepG2 cells (Fig. 3), the Acknowledgments—We thank Joseph Avruch, Jack Rogers, and Phil effect of LY294002 to inhibit endogenous PI 3-kinase activity Daniel for critical reading of the manuscript. We thank Simin Nui for and enhance DAF-16 DNA binding and transcription function construction of GAL4zDAF-16 plasmids. is seen on both wild-type DAF-16 and DAF-16 4A (Fig. 5). Second, in our hands LY294002 stimulated wild-type and mu- REFERENCES tant DAF-16 4A activity over the control levels observed in 1. Kimura, K. D., Tissenbaum, H. A., Liu, Y., and Ruvkun, G. (1997) Science 277, 942–946 serum-starved 293 and HepG2 cells (Fig. 5) rather than simply 2. Morris, J. Z., Tissenbaum, H. A., and Ruvkun, G. (1996) Nature 382, 536 –539 reversing the negative effect of serum or insulin (14, 16). Thus, 3. Paradis, S., and Ruvkun, G. (1998) Genes Dev. 12, 2488 –2498 we conclude that the endogenous PI 3-kinase activity expressed 4. Paradis, S., Ailion, M., Toker, A., Thomas, J. H., and Ruvkun, G. (1999) Genes Dev. 13, 1438 –1452 in serum-starved 293 and HepG2 cells signals to a kinase other 5. Ogg, S., and Ruvkun, G. (1998) Mol. Cell 2, 887– 893 than AKT. Alternatively, endogenous PI 3-kinase signaling to 6. Lin, K., Dorman, J. B., Rodan, A., and Kenyon, C. (1997) Science 278, 1319 –1322 AKT could modify the phosphorylation of a cofactor that inter- 7. Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A., acts with DAF-16/Daf-16 4A. and Ruvkun, G. (1997) Nature 389, 994 –999 8. Gottlieb, S., and Ruvkun, G. (1994) Genetics 137, 107–120 The observation that growth factor signaling activates dis- 9. Alessi, D. R., and Cohen, P. (1998) Curr. Opin. Genet. Dev. 8, 55– 62 tinct effectors downstream of PI 3-kinase to regulate the activ- 10. Cheatham, B., Vlahos, C., Cheatham, L., Wang, L., Blenis, J., and Khan, C. ity of DAF-16-like proteins is supported by three published (1994) Mol. Cell. Biol. 14, 4902– 4911 11. Avruch, J. (1998) Mol. Cell. Biochem. 183, 31– 48 reports. First, in the insulin-responsive H4 hepatoma cell line, 12. O’Brien, R. M., Noisin, E. L., Suwanichkul, A., Yamasaki, T., Lucas, P. C., insulin signaling via an AKT site-independent mechanism in- Wang, J., Powell, D. R., and Granner, D. K. (1995) Mol. Cell. Biol. 15, hibits the transcription activity of GAL4-FKHR; this effect 1747–1758 13. Cichy, S. B., Uddin, S., Danilkovich, A., Guo, S., Klippel, A., and Unterman, occurs whether activity is assessed using the GAL4 DNA bind- T. G. (1998) J. Biol. Chem. 273, 6482– 6487 ing site or the IGFBP-IRE site (35). This observation is con- 14. Brunet, A., Bonni, A., Zigmond, M., Lin, M., Juo, P., Hu, L., Anderson, M., Arden, K., Blenis, J., and Greenberg, M. (1999) Cell 96, 857– 868 sistent with a direct effect of insulin on FKHR transcription 15. Kops, G., de Ruiter, N., De Vries-Smits, A., Powell, D., Bos, J., and Burgering, activity or localization and suggests that distinct insulin sig- B. (1999) Nature 398, 630 – 634 naling pathways to DAF-16-like FKH proteins may be opera- 16. Guo, S., Rena, G., Cichy, S., He, X., Cohen, P., and Unterman, T. (1999) J. Biol. Chem. 274, 17184 –17192 tive in specific cells. It is notable that the existence of insulin- 17. Tang, E., Nunez, G., Barr, F., and Guan, K.-L. (1999) J. Biol. Chem. 274, regulated, AKT-independent mechanisms for DAF-16 16741–16746 18. Durham, S., Suwanichkul, A., Scheimann, A., Yee, D., Jackson, J., Barr, F., regulation were proposed based on genetic data in C. elegans and Powell, D. (1999) Endocrinology 140, 3140 –3146 (3). Second, although the DAF-16 homolog FKHRL1 can bind 19. Rena, G., Guo, S., Cichy, S., Unterman, T., and Cohen, P. (1999) J. Biol. Chem. multimers of the PEPCK-IRE site and mediate the negative 274, 17179 –17183 20. Nakae, J., Park, B.-C., and Accili, D. (1999) J. Biol. Chem. 274, 15982–15985 effect of insulin in H4IIE cells, mutation of the AKT sites in 21. Nasrin, N., Ogg, S., Cahill, C., W., B., Nui, S., Dore, J., Calvo, D., Shi, Y., FKHRL1 inhibits the effect of insulin by 50% (36). Further- Ruvkun, G., and Alexander-Bridges, M. C. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10412–10417 more, insulin activation of AKT does not appear to explain all 22. Yaffe, M. B., Rittinger, K., Volinia, S., Caron, P. R., Aitken, A., Leffers, H., the effects of insulin-stimulated PI 3-kinase activity on PEPCK Smerdon, S. J., and Cantley, L. C. (1997) Cell 7, 961–971 gene transcription; negative regulation of this gene in H4 hep- 23. Lopez-Girona, A., Furnari, B., Mondesert, O., and Russell, P. (1999) Nature 172–175 atoma cells requires downstream effectors of PI 3-kinase dis- 24. Kumagai, A., and Dunphy, W. G. (1999) Genes Dev. 13, 1067–1072 tinct from AKT, the atypical protein kinase Cl and Rac (37). 25. Yang, J., Winkler, K., Yoshida, M., and Kornbluth, S. (1999) EMBO J. 18, 2174 –2183 Third, although insulin and IGF-1 can stimulate AKT activity 26. Tzivion, G., Luo, Z. J., and Avruch, J. (1998) Nature 394, 88 –92 equivalently in wild-type and insulin receptor-deficient SV40- 27. Luo, Z.-J., Zhang, X.-F., Rapp, U., and Avruch, J. (1995) J. Biol. Chem. 270, transformed hepatocytes, respectively, only insulin stimulates 23681–23687 28. Waterman, M., Stavridi, E., Waterman, J., and Halazonetis, T. (1998) Nat. phosphorylation of FKHR at site Thr-24 in these cells (33); Genet. 19, 175–178 thus, only insulin, and not IGF-1, stimulates nuclear export of 29. Matta-Yelin, M., Aitken, A., and Ravid, S. (1997) Mol. Biol. Cell 8, 1889 –1899 30. Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., and Greenberg, FKHR in these cells. M. E. (1997) Cell 91, 231–241 In HepG2 cells both insulin and LY294002 regulate IGFBP 31. Zha, J., Harda, H., Yang, E., Jockel, J., and Korsmeyer, S. J. (1996) Cell 87, promoter activity in the absence of exogenously expressed 619 – 628 32. Biggs, W. H., Meisenhelder, J., Hunter, T., Cavenee, W. K., and Arden, K. C. DAF-16. This observation suggests that the pathways we de- (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 7421–7426 scribe for DAF-16 are also relevant for endogenously expressed 33. Nakae, J., Barr, V., and Accili, D. (2000) EMBO J. 19, 989 –996 34. Takaishi, H., Konishi, H., Matsuzaki, H., Ono, Y., Shirai, Y., Saito, N., mammalian homologues such as FKHR (16) in HepG2 cells. Kitamura, T., Ogawa, W., Kasuga, M., Kikkawa, U., and Nishizuka, Y. Although it is formally possible that LY294002 activation of (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 11836 –11841 endogenous FKHR could require new protein synthesis, we 35. Tomizawa, M., Kumar, A., Perrot, V., Nakae, J., Accili, D., and Rechler, M. M. (2000) J. Biol. Chem. 275, 7289 –7295 show in Fig. 5B that the effect of LY294002 to enhance DAF-16 36. Hall, R. K., Yamasaki, T., Kucera, T., O’Brien, R. M., and Granner, D. K. DNA binding activity is not due to an increase in DAF-16 (2000) J. Biol. Chem. 275, 30169 –30175 37. Kotani, K., Ogawa, W., Matsumoto, M., Kitamura, T., Sakaue, H., Hino, Y., protein expression or nuclear content. Thus, LY294002 appears Miyake, K., Sano, W., Akimoto, K., and Kasuga, M. (1998) Mol. Cell. Biol. to have a direct effect on the specific DNA binding activity of 18, 6972– 6982 DAF-16. 38. Komeili, A., and O’Shea, E. K. (1999) Science 284, 977–980 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Phosphatidylinositol 3-Kinase Signaling Inhibits DAF-16 DNA Binding and Function via 14-3-3-dependent and 14-3-3-independent Pathways

Download PDF
9 pages

Loading next page...
 
/lp/unpaywall/phosphatidylinositol-3-kinase-signaling-inhibits-daf-16-dna-binding-tEt006meug

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m010042200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 16, Issue of April 20, pp. 13402–13410, 2001 © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Phosphatidylinositol 3-Kinase Signaling Inhibits DAF-16 DNA Binding and Function via 14-3-3-dependent and 14-3-3-independent Pathways* Received for publication, November 3, 2000, and in revised form, December 19, 2000 Published, JBC Papers in Press, December 20, 2000, DOI 10.1074/jbc.M010042200 Catherine M. Cahill‡§, Guri Tzivion§¶, Nargis Nasrin‡, Scott Oggi, Justin Dore‡, Gary Ruvkuni, and Maria Alexander-Bridges‡** From the ‡Diabetes Unit, Massachusetts General Hospital and Department of Medicine, Harvard Medical School, the ¶Diabetes Research Laboratory, Department of Molecular Biology, Massachusetts General Hospital and Department of Medicine, Harvard Medical School, and the iDepartment of Molecular Biology, Massachusetts General Hospital and Department of Genetics, Harvard Medical School, Boston, Massachusetts 02114 In Caenorhabditis elegans, an insulin-like signaling insulin-like signaling pathway, which includes an insulin/IGF- 1 -like receptor (DAF-2), phosphatidylinositol 3-kinase (PI pathway to phosphatidylinositol 3-kinase (PI 3-kinase) and AKT negatively regulates the activity of DAF-16, a 3-kinase; AGE-1), and protein kinase B (also known as AKT) Forkhead transcription factor. We show that in mamma- controls life cycle, metabolism, and longevity (1–5). This path- lian cells, C. elegans DAF-16 is a direct target of AKT and way negatively regulates the activity of DAF-16, a member of that AKT phosphorylation generates 14-3-3 binding sites the Forkhead (FKH) family of transcription factors (3, 6 – 8). and regulates the nuclear/cytoplasmic distribution of In mammalian cells, insulin/IGF-1 signaling via PI 3-kinase DAF-16 as previously shown for its mammalian ho- and AKT mediates diverse effects on cell metabolism, growth, mologs FKHR and FKHRL1. In vitro, interaction of AKT- and survival (9 –11). Biochemical studies to date suggest that phosphorylated DAF-16 with 14-3-3 prevents DAF-16 PI 3-kinase is important to the metabolic actions of insulin binding to its target site in the insulin-like growth factor including its effects on gene transcription. A common DNA binding protein-1 gene, the insulin response element. In sequence, referred to as the insulin response element (IRE), HepG2 cells, insulin signaling to PI 3-kinase/AKT inhib- binds members of the Forkhead transcription factor family and its the ability of a GAL4 DNA binding domain/DAF-16 mediates the negative effect of insulin on transcription of the fusion protein to activate transcription via the insulin- insulin-like growth factor binding protein-1 (IGFBP-1) and like growth factor binding protein-1-insulin response phosphoenolpyruvate carboxykinase (PEPCK) genes (12). In element, but not the GAL4 DNA binding site, which sug- hepatoma cells, insulin- inhibition of IRE-directed gene tran- gests that insulin inhibits the interaction of DAF-16 with scription is mediated via a PI 3-kinase-dependent signaling its cognate DNA site. Elimination of the DAF-16/1433 pathway (13). Accordingly, work in several laboratories aimed association by mutation of the AKT/14-3-3 sites in DAF- at identifying the downstream targets of insulin signaling to 16, prevents 14-3-3 inhibition of DAF-16 DNA binding the nucleus has focused on the role of mammalian homologues and insulin inhibition of DAF-16 function. Similarly, in- of DAF-16, FKHR, FKHRL1, and AFX in mediating the nega- hibition of the DAF-16/14-3-3 association by exposure of cells to the PI 3-kinase inhibitor LY294002, enhances tive effect of insulin/IGF-1 signaling on gene transcription. In DAF-16 DNA binding and transcription activity. Sur- the absence of insulin/IGF-1, FKHRL1 (14), AFX (15), and prisingly constitutively nuclear DAF-16 mutants that FKHR (16 –18) activate gene transcription via the IGFBPzIRE. lack AKT/14-3-3 binding sites also show enhanced DNA Insulin/IGF-1 signaling (19 –21) or overexpression of AKT (17, binding and transcription activity in response to 19) stimulates phosphorylation of these factors and inhibits LY294002, pointing to a 14-3-3-independent mode of reg- their activating effect (16, 17). ulation. Thus, our results demonstrate at least two The prevailing view of the mechanism underlying insulin/ mechanisms, one 14-3-3-dependent and the other 14-3-3- IGF-1 inhibition of FKHRL1 and other DAF-16 homologs is independent, whereby PI 3-kinase signaling regulates that phosphorylation of FKHRL1 by AKT at two sites, Thr-32 DAF-16 DNA binding and transcription function. and Ser-253 promotes retention of these proteins in the cyto- plasm (14). AKT preferentially phosphorylates substrates that carry the RXRXXS, which is contained within certain consen- In Caenorhabditis elegans, genetic evidence indicates that an p p p sus 14-3-3 binding motifs RSXS XP, or RXXXS XP where S represents phosphoserine (22). Hence, AKT phosphorylation of its target proteins may create 14-3-3 binding sites. For exam- * This work was supported by National Institutes of Health NCI Grant CA73818-1, by National Institutes of Health Grant ple, the AKT site at T32 in FKHRL1 is a 14-3-3 consensus DK57200A01, by institutional support from Massachusetts General binding sequence; AKT phosphorylation of FKHRL1 at sites Hospital, and by National Institutes of Health Training Grant T32 Thr-32 and Ser-253 promotes interaction of FKHRL1 with 14- DK07028 –24 (to N. N.) and Grants AG05790 (to N. N.) and AG14161 3-3 and cytoplasmic retention of FKHRL1 (14). The 14-3-3 and GM58012 (to S. O. and G. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The abbreviations used are: IGF, insulin-like growth factor; FKH, § These authors contributed equally to this work. forkhead, PKB, protein kinase B; PI 3-kinase, phosphatidylinositol 3 ** To whom correspondence should be addressed: 306 Wellman, Di- kinase; IGFBP-1, insulin-like growth factor binding protein-1; IRE, abetes Unit, Dept. of Medicine, Massachusetts General Hospital, 50 insulin response element; PEPCK, phosphoenolpyruvate carboxyki- Blossom St., Boston, MA 02114. Tel.: 617-726-6998; Fax: 617-726-6954; nase; GST, glutathione S-transferase; PAGE, polyacrylamide gel elec- E-mail: [email protected]. trophoresis; WT, wild-type. 13402 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. 14-3-3-dependent and -independent Regulation of DAF-16 13403 KCl, 10% glycerol, 0.1% bovine serum albumin, and 1 mg of poly(dG/dC) family of proteins has also been shown to play a role in nuclear in each sample. For competition assays, 103 cold IRE or mutant IRE export and/or cytoplasmic retention of the yeast protein Cdc25 was added prior to the addition of P-labeled IRE probe. For supershift (23–25). In addition to promoting changes in cellular localiza- assays, the reaction was pre-incubated with 1 mg of either specific tion, binding of 14-3-3 to certain of its target proteins directly DAF-16 antibody (for detection of GST fusion proteins) or M2 antibody affects their activity. For example, 14-3-3 can stimulate the (against the Flag tag for detection of DAF-16 expressed in mammalian catalytic activity of the serine/threonine kinase c-Raf-1 (26, 27), cells) for 15 min at 4 °C prior to the addition of P-labeled IRE probe. To demonstrate inhibition of DNA binding by 14-3-3, DAF-16 (2 mg) was the DNA binding activity of p53 (28), and other targets (29 –31). phosphorylated with GST-AKT (2 mg) for 30 min at 30 °C, followed by The Thr-32 and Ser-253 sites are conserved within DAF-16 addition of 14-3-3 (2 mg). The reaction was further incubated at 4 °C for (Thr-54 and Ser-240/Thr-242), FKHRL1 (Thr-32, Ser-253) (14), 15 min, at which time labeled P-IRE probe was added. Samples were FKHR (Thr-24, Ser-253) (32), and AFX (Thr-28, Ser-258) (15). resolved on 4% Tris-glycine PAGE at 100 V for 3 h. Nuclear and Accordingly, regulation of nuclear export by growth factor sig- cytoplasmic extracts were prepared using the NE-PER kit (Pierce) naling to PI 3-kinase and AKT has been demonstrated for according to the manufacturer’s instructions. Transfections—For transcriptional analysis, HepG2 cells were trans- FKHR1 (32), FKHR (33), and AFX (34). We questioned whether fected using the CaPO method in 30-mm six-well plates with IGFBP- the Thr-54 site in DAF-16 would function as a 14-3-3 binding LUC (15 mg) reporter plasmid and pcDNA3-DAF-16 variants (2 mg) or site and, if so, whether PI 3-kinase signaling would regulate pcDNA3 control vector (2 mg) per 1.5 ml of precipitate. The RSV-b- the interaction of C. elegans DAF-16 with elements of the galactosidase vector (2 mg) was used to control for transfection effi- mammalian nuclear import/export machinery as is the case for ciency. In the experiments described in Figs. 3 and 5, 2 mg of GAL4 DNA the mammalian homologs of DAF-16. binding domain control vector or GAL4-DAF-16 fusion protein vector variants cotransfected with either the IGFBP-luciferase reporter gene We therefore examined the effect of AKT phosphorylation or a luciferase reporter gene driven by five GAL4 DNA binding sites and 14-3-3 association on several aspects of DAF-16 function, cloned upstream of the TK109 promoter. Cells were shocked for 1 min including its ability to localize to the nucleus, bind DNA and with 10% Me SO and the incubation continued in the absence of serum. activate transcription. We find evidence for PI 3-kinase-de- Insulin was added during the last 16 h of the incubation. pendent inhibition of DAF-16 DNA binding activity via 14-3-3- For the DAF-16/14-3-3 association experiments, 293 cells were trans- dependent and 14-3-3-independent mechanisms. Thus, our ob- fected using LipofectAMINE (Life Technologies, Inc.) in 10-cm plates with 2 mg each of GST-14-3-3 or GST-AKT and 4 mg of pcDNA3-DAF-16 servations suggest a more complex mode of DAF-16 regulation variants. For the DAF-16 localization and DNA binding experiments, than previously anticipated. 293 cells were transfected with 5 mg of the pcDNA3-DAF-16 variants or pcDNA3 alone. EXPERIMENTAL PROCEDURES Plasmids and Reagents—The DAF-16a1 HindIII/NheI insert from RESULTS pGEM-FLAG-DAF-16a1 was ligated into the HindIII/XbaI site of AKT Phosphorylates DAF-16 and Promotes Its Association pcDNA3 (1) (Invitrogen) to generate pcDNA3-Flag DAF-16a1. The DAF-16a1 BstYI insert from pGEM-FLAG-DAF-16a1 was ligated into with 14-3-3—Consistent with the genetic data that positions the BamHI site of pGEX-4T-1 (Amersham Pharmacia Biotech) to gen- DAF-16 downstream of the PI 3-kinase-regulated serine/thre- erate pGEX-DAF-16a1. Phosphorylation site mutants were prepared onine kinase AKT in C. elegans, there are four consensus AKT using the QuickChange site-directed mutagenesis kit (Stratagene). The phosphorylation sites in DAF-16 (Fig. 1A). As has been estab- DAF-16a1 BstYI insert from pGEM-FLAG-DAF-16a1 was ligated into lished for the mammalian DAF-16 orthologs FKHR (16, 19, 32), the BamHI site of the GAL4 DNA binding domain plasmid to generate FKHRL1 (14), and AFX (15, 34), AKT can phosphorylate GAL4-DAF-16 derivatives. The rat IGF-BP-1 promoter (nucleotides 2921 to 179) cloned in PGL3-LUC was a gift from M. Rechler (National DAF-16 on at least three of its four potential AKT sites, and Institutes of Health, Bethesda, MD). Preparation of pMT2-Myc-14-3-3, these sites serve as the only AKT-phosphorylation sites in vitro pGEX-GST-14-3-3, and the pGEX-GST-14-3-3 dimerization mutant has (Fig. 1B, top). Phosphospecific antibodies generated against been described previously (26, 27). The pEBG-GST-AKT plasmid was a 14-3-3-binding consensus sequences can specifically recognize gift from J. R. Woodgett (Toronto, Canada). Specific DAF-16 antibodies DAF-16 phosphorylated by AKT but not unphosphorylated were produced in rabbits using the Forkhead DNA binding domain of DAF-16 cloned into GST as the antigen. The competitor 14-3-3 binding DAF-16 (Fig. 1B, compare lane 2 to lane 1). This antibody phosphopeptide LPKINRSA(Sp)EPSLHR (PP, corresponding to c-Raf-1 recognizes phosphorylation of DAF-16 at threonine 54 (Fig. 1B, amino acids 613– 627) and the unphosphorylated version (P) were syn- middle, lane 2 versus lane 3). Phosphorylation of recombinant thesized by QCB (Boston, MA). Anti-phosphopeptide specific antibodies prokaryotic GST-DAF-16 by AKT induces its binding to recom- against 14-3-3 binding consensus were a gift from M. Comb (New binant mammalian 14-3-3z in vitro (Fig. 1C). This association England Biolabs, Beverly, MA). is inhibited by a competitor phosphopeptide corresponding to a Kinase Assay—For experiments to phosphorylate DAF-16 in vitro, GST-DAF-16 proteins were purified from bacteria and GST-AKT was 14-3-3 binding site on c-Raf-1 but not by the unphosphorylated expressed in 293 cells and subsequently affinity-purified on GSH beads form of the peptide (compare lane 2 with lanes 3 and 4). The (Amersham Pharmacia Biotech). Kinase assays were performed using 2 association with 14-3-3 is also inhibited by mutation of the mg of GST-AKT as the kinase and 2 mg of GST-DAF-16 or DAF-16 AKT-phosphorylation sites on DAF-16 (compare lane 2 with mutant as the substrate in a kinase buffer containing 40 mM Tris-HCl, lanes 5, 7, and 8). In particular, the AKT-phosphorylation site pH 7.5, 0.1 mM EDTA, 5 mM MgCl ,2mM dithiothreitol, and 100 mM at threonine 54, a site matching closest to the 14-3-3 binding ATP (cold assay) supplemented with [g- P]ATP (10 –20 mCi/reaction) consensus, represents a site whose phosphorylation is indis- (hot assay) at 30 °C for 40 min. Protein Interaction Assays—Myc epitope-tagged 14-3-3 expressed in pensable for 14-3-3 binding in vitro (compare lane 2 with 293 cells was absorbed to anti-Myc epitope antibodies (clone 9E10) lane 5). pre-coupled to protein-A beads and incubated with 2 mg of AKT- phos- 14-3-3 Association with Wild-type DAF-16 Inhibits Its DNA phorylated wild-type and mutant GST-DAF-16 for 90 min at 4 °C. Binding Activity—Homologues of DAF-16 bind and activate Following extensive washes, the associated proteins were separated on transcription through the IRE in the IGFBP gene (14, 16). SDS-PAGE and phosphorylated DAF-16 was detected by autoradiogra- phy. Both wild-type and mutant GST-DAF-16 variants were detected by Accordingly we also find that DAF-16 binds specifically to the anti-GST immunoblotting. IRE (Fig. 2A). A DAF-16 derivative L201P, with a leucine to Electrophoretic Mobility Shift Assay—Samples containing 2 mgof proline substitution in the forkhead DNA binding domain, does GST-DAF-16 or 5–10 mg of nuclear extracts, treated as indicated in the not bind to the P-labeled IRE, nor does an amino-terminal figure legends were incubated with 50,000 cpm of P-labeled IGFBP- fragment (1– 69) of DAF-16 that lacks the forkhead DNA bind- IRE probe (caaaacaaacttattttgaa) or G-C/A-C mutant probe (caaaa- ing domain (Fig. 2, compare lane 4 to lanes 6 and 7). A specific gaaacttcttttgaa) for 15 min at 4 °C in a buffer containing 40 mM Tris- HCl, pH 7.5, 5 mM MgCl , 0.1 mM EDTA, 1 mM dithiothreitol, 50 mM antibody raised against DAF-16 supershifts the DAF-16/DNA 2 13404 14-3-3-dependent and -independent Regulation of DAF-16 Phosphorylation of DAF-16 by AKT did not by itself affect DAF-16-DNA binding (Fig. 2B, compare lanes 1 and 3); how- ever, the addition of 14-3-3 to AKT-phosphorylated DAF-16 resulted in an almost complete inhibition of DAF-16 DNA bind- ing activity (Fig. 2B, compare lanes 3 and 4). The addition of 14-3-3 had no effect on DAF-16 DNA binding when AKT was omitted (Fig. 2B, compare lanes 2 and 4), or when ATP was omitted (Fig. 2C, compare lanes 7 and 3) from the kinase reaction. Moreover, the competitor 14-3-3 binding phosphopep- tide selectively blocked the ability of 14-3-3 to inhibit DAF-16 DNA binding while the unphosphorylated version had no effect (Fig. 2B, compare lanes 5 and 6) demonstrating the require- ment of the 14-3-3-phosphopeptide binding domain for the in- hibition. Thus, the ability of 14-3-3 to inhibit DAF-16 DNA binding required the association of 14-3-3 with phospho-DAF- 16. The DNA binding activity of DAF-16 mutants impaired in their ability to bind 14-3-3, DAF-16 54A (T54A), and DAF-16 4A (T54A, S240A, T242A, S314A) was unaffected by AKT/14- 3-3 (Fig. 2D, compare lanes 1 and 2 with lanes 4 and 5 and lanes 7 and 8). Conversely, the DNA binding activity of the DAF-16 2A (240/242A) mutant that retains the ability to bind 14-3-3 was inhibited (Fig. 2D, lanes 13 and 14). Although the DAF-16 (S314A) mutant retains the ability to bind 14-3-3 following AKT phosphorylation (data not shown), 14-3-3 does not inhibit its ability to bind DNA (Fig. 2D, lanes 10 and 11). The inability of the dimerization-deficient 14-3-3 mutant to inhibit DAF-16 DNA binding (Fig. 2C, compare lane 3 with lane 6), together with the ability of wild- type 14-3-3 to inhibit mutant DAF-16 2A (S240A/T242A), but not mutant DAF-16 (T54A) or (S314A) DNA binding, suggests that dimeric 14-3-3 interacts with DAF-16 at sites Thr-54 and Ser-314. This interaction may, in turn, mask the forkhead DNA binding domain of DAF-16. Insulin Inhibition of DAF-16 Activity Is Mediated at the Level of DNA Binding—We have shown that AKT phosphorylation of DAF-16 WT allows association of 14-3-3 and that this associa- FIG.1. AKT phosphorylates DAF-16 on four distinct sites and tion inhibits binding of DAF-16 to DNA. In HepG2 cells, insulin mediates 14-3-3 binding. A, linear map of DAF-16 protein showing inhibits transcription activation by DAF-16 and this effect re- the amino acid sequence of the putative AKT consensus (RXRXXS) phosphorylation sites at Thr-54, Ser-240, Thr-242, and Ser-314. The quires the AKT/14-3-3 sites in DAF-16 (21). If insulin inhibition indicated mutants were constructed for expression in both mammalian of DAF-16 activity results from an interaction of DAF-16 with and bacterial cells: 1A (T54A); 2A (S240A and T242A); 3A (T54A, 14-3-3 that inhibits DNA binding, we would not expect to see S240A, and T242A); 4A (all four sites mutated to alanine). B, phospho- insulin inhibition of DAF-16 activity if the protein were teth- rylation of GST-DAF-16 in vitro by AKT. Recombinant prokaryotic GST-fused DAF-16 (lanes 1 and 2) and the indicated mutants (lanes ered to the promoter by way of a heterologous DNA binding 3– 6), 2 mg each, were incubated in a kinase buffer containing 2 mgof domain. Therefore, we compared the effect of insulin on the active recombinant mammalian GST-AKT (lanes 2– 6) or vehicle (lane activity of a fusion protein encoding the GAL4 DNA binding 1) for 40 min at 30 °C. Following SDS-PAGE, the samples were blotted with phosphopeptide antibodies against degenerated 14-3-3 binding domain and DAF-16 using the IRE DNA site in IGFBP-1 or consensus (XXXXXRSXS(p)XPXXXXX) (a gift from M. Comb). Autora- GAL4 DNA (Fig. 3). diogram showing GST-DAF-16 phosphorylation (top) and immunoblot In HepG2 cells, DAF-16 expressed in a pcDNA vector acti- showing reactivity with the phosphospecific antibodies (middle) and an vates transcription of the IGFBP promoter by 4-fold (Fig. 3A, anti-GST immunoblot showing equal protein loading (bottom) are pre- compare bars A and D) and this effect is inhibited by insulin sented. C, in vitro binding of AKT phosphorylated GST-DAF-16 to 14-3-3. Unphosphorylated GST-DAF-16 (lane 1), AKT-phosphorylated (bar E) or by overexpression of constitutively active AKT (bar GST-DAF-16 (lanes 2– 4 and 9), or the indicated GST-DAF-16 mutants F). The AKT site mutant DAF-16 4A is resistant to the effect of (lanes 5– 8) were incubated with immobilized Myc-tagged 14-3-3 (pre- insulin and AKT on IGFBP gene transcription (compare bar G pared using anti-Myc antibodies and protein A beads) from 293 cells (lanes 1– 8) or control beads (lane 9) in the presence of competitor 14-3-3 to bars H and I, respectively). Thus, in HepG2 cells, the inhib- binding phosphopeptide (PP,1mM, lane 3) or unphosphorylated control itory effect of insulin and AKT on DAF-16 is dependent on its peptide (P,1mM, lane 4)for2hat4 °C. Following washes to remove AKT/14-3-3 sites (16, 21). nonspecific binding, bound proteins retained on the immobilized Myc- DAF-16 WT and DAF-16 4A mutant were expressed as fu- tagged 14-3-3 beads were subjected to SDS-PAGE, transferred to a sion proteins with the GAL4 DNA binding domain (Fig. 3, polyvinylidene difluoride membrane, and tested for phospho-GST- DAF-16 by autoradiography (top). Anti-GST immunoblot (middle) was panel B) and their response to insulin was assessed using the used for the detection of both DAF-16 WT and AKT site mutant DAF-16 IGFBPzIRE (bars A–D) or the GAL4 DNA site (bars E–H)to derivatives bound to the Myc-14-3-3 column. The DAF-16 mutants 3A drive transcription. The GAL4-DAF-16 fusion protein stimu- and 4A are only partially phosphorylated or not at all and can not be detected by autoradiography. A Coomassie stain of the blot (bottom)is lated basal IGFBP gene transcription 4-fold, identical to the shown to demonstrate equal 14-3-3 input. DAF-16 derivatives expressed in the pcDNA expression system (data not shown). As expected, when activity was assessed complex (Fig. 2A, lane 5). We examined whether AKT phospho- using the IGFBP-1 promoter (containing the IRE), GAL4- rylation and/or subsequent association of DAF-16 with 14-3-3 DAF-16 activity was inhibited by insulin (Fig. 3, panel B, could alter the ability of DAF-16 to bind its target IRE site. compare bars A and B), while the activity of GAL4-DAF-16 – 14-3-3-dependent and -independent Regulation of DAF-16 13405 FIG.2. AKT phosphorylation and subsequent 14-3-3 binding inhibit DAF-16 DNA binding. A, DAF-16 binds to IRE DNA. Prokaryotic recombinant GST-DAF-16 (lanes 1–5), GST-DAF-16 (L201P, mutation in the DNA binding domain) (lane 6), and GST-DAF-16 (amino acids 1– 69, lane 7), 2 mg each, were incubated with P-labeled IGFBP IRE (50,000 cpm) in electrophoretic mobility shift assay binding buffer alone (lanes 1, 4, 6, and 7) or in the presence of 103 cold competitor wild-type IRE (lane 2) or mutant IRE (lane 3) or in the presence of anti-DAF-16 antibody (lane 5) and resolved on a 4% nondenaturating gel as described under “Experimental Procedures.” An autoradiogram of the gel is presented. The positions of DAF-16/DNA complexes and complexes supershifted with antibody are indicated. B, AKT phosphorylation of DAF-16 and 14-3-3 association prevents DAF-16 binding to IRE DNA. GST-DAF-16 (2 mg) was incubated in a kinase buffer containing 2 mg of active GST-AKT (lanes 3– 6) or vehicle (lane 1 and 2) for 40 min at 30 °C, followed by a 30-min incubation with prokaryotic recombinant GST-14-3-3 (lanes 2 and 4–6), or vehicle (lanes 1 and 3). The presence of competitor phosphopeptide (pp,1mM, lane 5) or unphosphorylated peptide (p,1mM, lane 6) is indicated. GST-DAF-16 was assayed for DNA binding as in panel A. C, Inhibition of DAF-16 binding to the IRE requires active AKT and an intact 14-3-3 dimer. GST-DAF-16 (2 mg) was incubated in a kinase buffer containing 2 mg of active GST-AKT in the presence (lanes 1– 6) or absence (lanes 7–10) of ATP, followed by a 30-min incubation with GST-14-3-3 (lanes 2–5 and 7–9), vehicle (lane 1), or a dimerization-deficient GST-14-3-3 (dm, lanes 6 and 10) in the presence of competitor phosphopeptide (pp,1mM, lanes 4 and 8) or unphosphorylated peptide (p,1mM, lanes 5 and 9). The samples were assayed for DNA binding as in panel A. D, inhibition of DAF-16 binding to the IRE by AKT/14-3-3 requires intact AKT sites Thr-54 and Ser-314 on DAF-16. GST-DAF-16 (lanes 1–3), GST-DAF-16(T54A) (lanes 4 – 6), GST-DAF-16(4A) (lanes 7–9), GST-DAF-16(314A) (lanes 10 –12), and GST-DAF-16(2A) (lanes 13–15), 2 mg each, were incubated in a kinase buffer containing 2 mg of active GST-AKT (lanes 2, 5, 8, 11, and 14) or vehicle (all others) for 40 min at 30 °C followed by 30-min incubation with prokaryotic recombinant GST-14-3-3 (lanes 2, 5, 8, 11, and 14) or vehicle (all others). The samples were assayed for binding to mutant (lanes 3, 6, 9, 12, and 15) or wild type (all others) P-IRE probes as in panel A. 4A, which fails to bind 14-3-3, was not affected by insulin (Fig. the observation that GAL4-DAF-16 is resistant to insulin sig- 3, panel B, compare bars C and D). By contrast, although the naling when the protein is tethered to the GAL4 DNA target GAL4-DAF-16 and GAL4-DAF-16 4A fusion proteins activated site suggests that 14-3-3 inhibition of DAF-16 DNA binding transcription similarly when assessed on the GAL4 DNA bind- may be a first step in the negative regulation of DAF-16 activ- ing site (bars E–H), neither wild-type GAL4-DAF-16, nor ity allowing subsequent changes in DAF-16 subcellular local- GAL4-DAF-16 – 4A were inhibited by insulin (panel B, bars E ization to occur. and F and bars G and H). PI 3-Kinase Signaling Regulates DAF-16/14-3-3 Interaction The observation that GAL4-DAF-16 responds to insulin and Consequent Subcellular Distribution—Our in vitro DNA when its activity is assessed using an IRE site, but not a GAL binding results imply that the association of DAF-16 with 4 site, indicates that the response of this fusion protein is 14-3-3 plays a crucial role in the negative regulation of DAF-16 analogous to that of the native DAF-16 protein. If insulin’s DNA binding. As HepG2 cells do not express sufficient DAF-16 action to inhibit DAF-16 activity resulted from a direct effect on to enable detection by DNA binding assay, we were unable to the intrinsic transcription activity of GAL4-DAF-16 or from study direct effects of insulin on DAF-16 DNA binding in these nuclear export of GAL4-DAF-16, we would expect to see the cells. However, coexpression studies of GST-tagged 14-3-3 and negative effect of insulin on both the GAL4 and the IRE DNA Flag-tagged DAF-16 proteins in 293 cells demonstrate that binding sites. Inasmuch as we observe the inhibitory effect of 14-3-3 and DAF-16 can associate both in serum-deprived cells insulin on the IRE alone, we conclude that insulin’s effect is and in cells growing exponentially in serum (Fig. 4A, compare mediated at the level of DAF-16 DNA binding. Furthermore, lanes 2 and 4). Treatment of serum-starved cells with the PI 13406 14-3-3-dependent and -independent Regulation of DAF-16 FIG.3. Insulin inhibition of DAF-16 activity in HepG2 cells is dependent on the AKT sites and is mediated at the level of DNA binding. A, insulin and AKT/PKB inhibits the transcription activity of DAF-16 WT but not AKT site mutant DAF-16 4A. HepG2 cells were transiently cotransfected with the IGFBP-luciferase reporter gene (15 mg) and the expression vector pcDNA3 (1 mg/ml) (bars A–C), wild-type pcDNAzDAF-16 (1 mg/ml) (bars D–F), or a mutant of DAF-16 in which an alanine residue was inserted in place of serine or threonine at the four putative AKT sites, DAF-16 4A (1 mg/ml) (bars G–I), and constitutively active PKB (2 mg/ml) (bars C, F, and I). Serum-starved cells were incubated with insulin (1 milliunit/ml) (bars B, E, and H) or vehicle (bars A, C, D, F, G, and I) during the last 16 h of the incubation. Luciferase activity is shown corrected for b-galactosidase gene expression. B, insulin mediates its inhibitory effects on DAF-16 at the level of DNA binding. HepG2 cells were transiently cotransfected with an expression vector encoding wild-type GAL4zDAF-16 (bars A, B, E, and F), or mutant GAL4zDAF-16 derivative 4A (bars C, D, G, and H) and either the IGFBP-luciferase reporter containing the IRE (bars A–D) or the GAL4-LUC reporter gene (bars E–H) (15 mg) together with the RSV-b-galactosidase reporter gene. Cells were stimulated with vehicle (bars A, C, E, and F) or with insulin (bars B, D, F, and H) as described in panel A. Luciferase activity was corrected for b-galactosidase and plotted as percentage of the unstimulated control. 3-kinase-specific inhibitor LY294002 caused a marked de- LY294002 on DAF-16 DNA binding activity in these cells. crease in 14-3-3/DAF-16 association (Fig. 4A, compare lane 2 Nuclear extracts were isolated from 293 cells transiently trans- with 3 and lane 11 with 12). These findings suggested that PI fected with expression plasmids encoding Flag-tagged DAF-16 3-kinase signaling to AKT and phosphorylation of DAF-16 (Fig. 5). The identity of DAF-16 overexpressed in HEK 293 cells could regulate its association with mammalian 14-3-3 as it does was demonstrated by supershift experiments using antibodies for FKHRL1 (14). against the Flag epitope tag on DAF-16 (Fig. 5A, compare lanes Accordingly, we found that the 14-3-3/DAF-16 association 2 and 5). depended on the presence of the AKT-phosphorylation site at We detected low DAF-16 DNA binding activity in the nuclear residue Thr-54 on DAF-16 (Fig. 4A, lanes 13–15)in vivo,asis extracts of 293 cells growing exponentially in serum (Fig. 5B, the case in vitro. However, the alanine mutations at residues lane 2); inhibition of PI 3-kinase by LY294002 markedly in- 240/242, which did not prevent association of DAF-16 2A with creased DAF-16 DNA binding activity (compare lanes 2 and 3). 14-3-3 in vitro, greatly reduced 14-3-3 association in vivo (lanes This increase was not simply a reflection of an increase in 16 –18). Mutation of site Thr-54 and sites Ser-240/Thr-242 in DAF-16 protein in the LY294002 treated nuclear extracts due DAF 3A completely prevented DAF-16/14-3-3 association to nuclear translocation, because extracts containing equal (lanes 19 –21). amounts of DAF-16 were employed (Fig. 5B, see Western blot The ability of DAF-16 derivatives to associate with mamma- (lower panel); compare lanes 4 and 6). Thus, the increase in lian 14-3-3 correlated with the subcellular localization of DAF- DAF-16 DNA binding activity shown reflects an increase in its 16. In exponentially growing cells, recombinant DAF-16 was specific DNA binding activity indicating that LY294002 can present both in the cytoplasm and in the nucleus (Fig. 4B, lanes prevent negative regulation of DAF-16 DNA binding activity by 2– 4 and 15–17). Mutants of DAF-16 impaired in 14-3-3 bind- a PI 3-kinase-mediated mechanism. ing, DAF-16 T54A, 2A, and 4A were confined strictly to the We also examined the effect of PI 3-kinase inhibition on nucleus (Fig. 4B, compare lanes 2 and 3 with lanes 5 and 6, regulation of DAF-16 AKT site mutants that do not bind 14-3-3 lanes 8 and 9, and lanes 11 and 12). Thus, DAF-16 can interact in vivo, DAF-16 2A and DAF-16 4A (Fig. 5C, upper panel). Both with mammalian import/export proteins. LY294002 and wortmannin increased the DNA binding activity Inhibition of PI 3-kinase signaling with LY294002 caused a of wild-type DAF-16 (Fig. 5C, upper panel, compare lane 4 to shift of DAF-16 to the nucleus and an almost complete disap- lanes 5 and 6). In exponentially growing cells mutants of pearance of DAF-16 from the cytoplasm (Fig. 4B, compare lanes DAF-16 impaired in 14-3-3 binding, DAF-16 2A, 3A, and 4A 15 and 16 with lanes 18 and 19 and lane 21 and 22). The finding were confined strictly to the nucleus (Fig. 5C, lower panel, that the C. elegans transcription factor DAF-16 can couple to compare lanes 9 and 10, lanes 11 and 12, and lanes 13 and 14). mammalian AKT, 14-3-3, and the mammalian import/export Nevertheless, similar to DAF-16 WT (Fig. 5C, lanes 4 and 5), machinery demonstrates it functions in an analogous manner the DNA binding activity of DAF-16 2A and DAF-16 4A was to its mammalian homologs FKRH and FKHRL1 (14, 32). enhanced by PI 3-kinase inhibition (Fig. 5C, upper panel, com- Inhibition of Endogenous PI 3-Kinase Signaling Enhances pare lanes 7 and 8 and lanes 9 and 10). DAF-16 DNA Binding Activity Independent of DAF-16 AKT In the insulin-responsive HepG2 cell line, serum inhibits the Phosphorylation Sites—Having demonstrated that inhibition effect of endogenous factors on IGFBP gene transcription by of PI 3-kinase signaling with LY294002 leads to dissociation of 90% (Fig. 5D, bar B) relative to the activity seen in serum- DAF-16/14-3-3 in 293 cells, we examined the effect of deprived cells (bar A). The PI 3-kinase inhibitor enhances IG- 14-3-3-dependent and -independent Regulation of DAF-16 13407 FIG.4. Serum growth factors signaling to PI 3-kinase regulate DAF-16 nuclear/cytoplasmic distribution by regulating DAF-16/ 14-3-3 association. A, in vivo pull-down of Flag epitope-tagged DAF-16 with GST-tagged 14-3-3 or GST-AKT. Flag epitope-tagged DAF-16 (lanes 2– 4, 6–8, and 10 –12), DAF-16 mutants; T54A (lanes 13–15), 2A (lanes 16 –18), 3A (lanes 19 –21), or control vector (lanes 1, 5, and 9) were coexpressed in 293 cells with GST-14-3-3 (lanes 1– 4 and 9 –21) or GST-AKT (lanes 5– 8). After transfection (24 h), cells were either grown in serum (lanes 4, 8, 10, 13, 16, and 19) or were serum-deprived in the presence of the PI 3-kinase inhibitor LY294002 (lanes 3, 7, 12, 15, 18, and 21) or vehicle (lanes 1, 2, 5, 6, 9, 11, 14, 17, and 20) for 24 h. Following affinity purification of GST fusions on GSH beads, associated DAF-16 was detected by anti-Flag immunoblot (using monoclonal antibody M2 (Sigma), top panel). The blots were Coomassie-stained for GST fusion recovery evaluation (middle panel). Representative samples of total lysates were analyzed for DAF-16 expression by anti-Flag immunoblot (bottom panel). B, subcellular localization of DAF-16 WT and AKT site mutant derivatives in HEK 293 cells. Flag-epitope-tagged DAF-16 (lanes 2– 4 and 15–23), DAF-16 mutants T54A (lanes 5–7), 2A (lanes 8 –10), 4A (lanes 11–13), or control vector (lane 1) were expressed in 293 cells. 24 h after transfection, cells were maintained in serum (lanes 1–17) or deprived of serum in the presence of PI 3-kinase inhibitors: LY294002 (10 mM, lanes 18 –20)or wortmannin (10 nM, lanes 21–23). Cells were harvested and fractionated into nuclear and cytoplasmic fractions using the NE-PER kit (Pierce). 30 mg of nuclear (N, lanes 3, 6, 9, 12, 16, 19, and 22), 100 mg of cytoplasmic (C, lanes 2, 5, 8, 11, 15, 18, and 21), and a combination of 15 mg of nuclear and 50 mg of cytoplasmic (N/C, lanes 1, 4, 7, 10, 13, 14, 17, 20, and 23) extracts were resolved on SDS-PAGE and assayed for the presence of DAF-16 by anti-Flag immunoblot. FBP-1 gene transcription 2-fold above that seen in serum- pression system (panel D) or as GAL4 fusion proteins compare starved cells (compare bars A and C). DAF-16 activates the (panel E), their activity is stimulated above basal in response to IGFBP promoter (compare bar A to bar D) and serum inhibits LY294002 (Fig. 5E, bars B, D, and F). However, when activity the activity of exogenous DAF-16 by 50% (compare bars D and is assessed using the GAL4 DNA binding site to direct gene E), while LY294002 increases DAF-16 activity 2.5-fold over expression, LY294002 does not activate the GAL4-DAF-16 de- control levels (compare bars D and F). rivatives (Fig. 5F, bars B, D, and F). Thus, we conclude that the The transcriptional activity of both wild type and mutant stimulatory effect of LY29004 is also mediated at the level of derivatives of DAF-16 was similarly regulated by PI 3-kinase DNA binding in vivo. inhibition in HepG2 cells (Fig. 5E). Whether wild- type or The enhancing effect of LY294002 on GAL4-DAF-16 WT is mutant DAF-16 derivatives are expressed in the pcDNA ex- greater than its enhancing effect on GAL4-DAF-16 3A and 4A 13408 14-3-3-dependent and -independent Regulation of DAF-16 FIG.5. PI 3-kinase inhibition enhances DAF-16 DNA binding and transcriptional activity via an AKT/14-3-3 site-independent pathway. A, identification of DAF-16 DNA binding activity in 293 cell nuclear extract. Nuclear extract was isolated from 293 cells expressing Flag epitope-tagged DAF-16 (M2-DAF-16) (lanes 3–5) or pcDNA alone (lanes 1 and 2) and assayed for binding to the P-labeled IGFBP-IRE as in Fig. 2A. Preimmune serum (PI, lanes 1 and 4) or anti-Flag antibody (M2, lanes 2 and 5) was used to supershift DAF-16/DNA complexes. The location of the DAF-16/DNA complex and M2/DAF-16/DNA complex (supershift) is indicated. B, inhibition of endogenous PI 3-kinase activity enhances binding of DAF-16 to IRE DNA. Upper panel, nuclear extracts of 293 cells expressing Flag-epitope-tagged DAF-16 (M2-DAF-16) (lanes 2 and 3)or vehicle (lane 1) grown in serum (lanes 1 and 2) or serum-deprived in the presence of LY294002 (10 mM, lane 3) were prepared as in Fig. 4B and assayed for binding to the IGFBP-IRE as described in Fig. 2A and “Experimental Procedures.” Lower panel, expression of DAF-16 in the nuclear (N) and cytoplasmic (C) fractions of the extracts shown was determined by anti-Flag immunoblotting. C, inhibition of endogenous PI 3-kinase with LY294002 enhances binding of DAF-16 AKT site mutants to IRE DNA. Upper panel, nuclear extract was isolated from 293 cells transfected with pcDNA alone (lanes 1–3), Flag-epitope-tagged DAF-16 (lanes 4 – 6), DAF-16 2A (lanes 7 and 8), or DAF-16 4A (lanes 9 and 10). Cells were grown in serum (lanes 1, 4, 7, and 9) or serum-deprived in the presence of LY294002 (10 mM, lanes 2, 5, 8, and 10) or wortmannin (10 nM, lanes 3 and 6). Binding to IGFBPzIRE was assayed as in Fig. 2A. Lower panel, expression of DAF-16 in the nuclear (N) and cytoplasmic (C) fractions was determined by anti-Flag immunoblotting. D, serum growth factors regulate DAF-16 transcription activation. Insulin-responsive HepG2 hepatoma cells were cotransfected with a luciferase reporter gene under the control of the native IGFBP promoter (15 mg) and pcDNA3-DAF-16 (2 mg/ml) (bars D–F) or a control pcDNA3 vector (2 mg/ml) (bars A-C) together with RSV- b-galactosidase to correct for transfection efficiency. 4 h after transfection, cells were changed to serum-containing media (bars B and E) or serum deprivation media (starved) (bars A, C, D, and F)inthe absence (bars A and D) or presence (bars C and F) of LY294002 (10 mM). Cells were harvested and assayed for luciferase (Promega kit) and b-galactosidase (Tropix kit) expression according to the manufacturers instructions. The mean ratios 6 S.E. of luciferase/b-galactosidase triplicates are presented. E, inhibition of endogenous PI 3-kinase activity enhances transcription activity of DAF-16 WT and AKT site mutants DAF-16 3A and DAF-16 4A on the IGFBPzIRE. HepG2 cells were transiently cotransfected with an expression vector encoding the wild-type GAL4zDAF-16 (bars A and B), or mutant GAL4zDAF-16 derivatives 3A (bars C and D)or4A(bars E and F)(2 mg), the IGFBP-luciferase reporter gene (15 mg), and the RSV-b galactosidase reporter gene (2 mg). Control cells growing exponentially in serum were stimulated with vehicle (bars A, C, and E) or serum-starved cells were stimulated with LY294002 (bars B, D, and F). The effect of LY294002 is shown as the percentage of control value. F, inhibition of endogenous PI 3-kinase activity does not affect transcriptional activity of DAF-16 WT or mutants on the GAL4 site. HepG2 cells were transiently cotransfected with GAL4zDAF-16 derivatives (2 mg/ml) and the GAL4-LUC (15 mg) reporter gene. Control cells growing exponentially in serum (bars A, C, and E) were compared with serum-starved cells stimulated with LY294002 (bars B, D, and F). Luciferase activity was normalized for b-galactosidase gene expression and is presented as the percentage of the serum value for each plasmid. on the IGFBP-IRE (Fig. 5E, compare bar B to bars D and F), mechanism can control DAF-16 DNA binding and transcription which suggests that DAF-16 WT is subject to both 14-3-3-de- activity. pendent and independent regulation by LY294002 in vivo. The DISCUSSION ability of LY294002 to enhance the activity of DAF-16 AKT/14- 3-3 site mutants that are confined strictly to the nucleus (Fig. Our results reveal the existence of at least two mechanisms 5C, lower panel, lanes 9 –14, DAF-16 2A, 3A, and 4A) indicates that cooperate to inhibit DAF-16 DNA binding in response to that a PI 3-kinase-responsive, 14-3-3/AKT site-independent factors that activate PI 3-kinase-dependent signaling path- 14-3-3-dependent and -independent Regulation of DAF-16 13409 TABLE I Inhibition of DAF-16 DNA binding via 14 –3-3-dependent (I) and -independent (II) pathways Pathway I, 14 –3-3 associates with AKT-phosphorylated DAF-16 WT in vitro and blocks its ability to bind to the IRE DNA. In vivo DAF-16 WT associates with 14 –3-3 and is translocated from the nucleus to the cytoplasm. Insulin inhibits transcription activation of DAF-16 WT when activity is assessed on IRE DNA, but not GAL4 DNA pointing to the importance of DAF-16/IRE binding as a mode of regulation by insulin. Insulin does not regulate the activity of the AKT/14 –3-3 site mutant DAF-16 4A. Pathway II, a 14 –3-3-independent mode of DAF-16 regulation is manifested by DAF-16 4A, which lacks all four AKT sites, does not bind 14 –3-3, is not exported from the nucleus but, like DAF-16 WT, is subject to DNA binding regulation by the PI3 kinase inhibitor LY294002. LY294002 enhances DNA binding and transcription activity of both DAF-16 WT and 4A and therefore mediates its effect at least in part via an AKT site/14 –3-3-independent pathway. Again regulation by LY294002 of GAL4 DAF-16 WT and 4A on an IRE but not a GAL4 DNA site, indicates that this effect is mediated primarily at the level of DNA binding. Association in Ability of 14-3-3 to Association in Insulin LY294002 Effect of insulin or Pathway DAF-16 vitro with 14- inhibit DNA binding in vivo with 14- Translocation inhibition on activation on LY294002 on 3-3 vitro 3-3 IRE site IRE site GAL4 site IWT 11 1 1 1 1 2 II 4A 22 2 2 2 1 2 FIG.6. Proposed model of DAF-16 regulation by growth factor signaling to PI 3-kinase. Under conditions in which PI 3-kinase is inactive, DAF-16 is found in the nucleus and is bound to DNA. Pathway I, following growth factor stimulation and activation of PI 3-kinase, AKT phosphorylates DAF-16 on Thr-54, Ser-240/242, and Ser-314, 14-3-3 binds the Thr-54 and Ser-314 sites and prevents the interaction of DAF-16 with DNA. DAF-16 is then translocated to the cytoplasm. Pathway II, endogenous PI 3-kinase signaling to DAF-16 WT and DAF-16 4A, which lacks AKT/14-3-3 binding sites, inhibits their ability to binding DNA. This effect occurs in the absence of 14-3-3 association or DAF-16 translocation. We propose that endogenous PI 3-kinase activates a kinase (or phosphatase) other than AKT that phosphorylates DAF-16 4A and inhibits DAF-16 4A DNA binding activity directly or by recruiting a cofactor that interacts with DAF-16 in a manner analogous to 14-3-3. Alternatively AKT or another kinase could phosphorylate the cofactor that interacts with DAF-164A. Regulation of DAF-16 WT DNA binding in vivo may occur via a combination of pathways I and II. ways. First, we show that in addition to its proposed role in DAF-16 in response to PI 3-kinase signaling. In a third sce- promoting nuclear export/cytoplasmic retention of forkhead nario, a non-AKT kinase (or phosphatase) downstream of en- proteins, 14-3-3 can directly inhibit binding of AKT- phospho- dogenous PI 3-kinase could directly phosphorylate DAF-16 or rylated DAF-16 to DNA (Table I and Fig. 6, pathway I). Second DAF-16 4A and inhibit their ability to bind DNA. we describe a novel PI 3-kinase-dependent pathway that inhib- In HepG2 cells, we find that insulin inhibition of DAF-16 its the DNA binding activity of DAF-16 4A, an AKT/14-3-3 site function occurs via an AKT/14-3-3 site-dependent pathway mutant that cannot bind 14-3-3 and is not subject to PI 3-kinase- (Fig. 6, pathway I), consistent with the observed ability of dependent nuclear export (Table I and Fig. 6, pathway II). The dimeric 14-3-3 to bind AKT phosphorylated DAF-16. Our ob- ability of endogenous PI 3-kinase signaling to prevent DAF-16 servation that insulin fails to inhibit the activity of GAL4- DNA binding independent of 14-3-3 may involve a phospho- DAF16 bound to the GAL4 DNA site, as opposed to the IRE rylation-dependent interaction of DAF-16 with an interacting DNA site, implies that GAL4-DAF-16 is not subject to insulin- protein. This cofactor could have an analogous function to mediated inhibition of DNA binding or nuclear export when it 14-3-3 and inhibit DAF-16 DNA binding activity in response to is tethered to GAL4 DNA. Thus, we propose that, in HepG2 and PI 3-kinase signaling. On the other hand, a cofactor that acts to 293 cells, growth factors that regulate PI 3-kinase activity may stabilize DAF-16 DNA binding activity might dissociate from act primarily to inhibit DAF-16 DNA binding via an interaction 13410 14-3-3-dependent and -independent Regulation of DAF-16 with 14-3-3 and that this step is permissive for nuclear export. The proposed model of multistep regulation of DAF-16 at the Our finding that insulin inhibition of DAF-16 is prevented by level of DNA binding as well as regulation of subcellular local- mutation of its AKT sites in HepG2 cells confirms that of Guo ization by 14-3-3 underscores the complexity of the PI 3-kinase et al. (16), who reported similar results for FKHR. In Fig. 6 signaling pathways to forkhead proteins. Analogous results (pathway II), we propose a role for a kinase (or phosphatase) have been described for PHO4, where four distinct phosphoryl- other than AKT in mediating the effect of PI 3-kinase signaling ation sites cooperate to regulate nuclear import, nuclear ex- on DAF-16 DNA binding and function. Two observations sug- port, and transcription activation of the target gene for PHO5 gest that the endogenous PI 3-kinase activity observed in se- (38). Understanding the complex regulation of DAF-16 and its rum-starved HepG2 and 293 cells may act via a distinct path- mammalian homologues will provide valuable insights into the way from that which mediates the effect of insulin in HepG2 mechanism that underlie the diverse effects of insulin on the cells. First, whereas insulin signaling via PI 3-kinase inhibits metabolism, growth, and survival of its target tissues. DAF-16 function via its AKT sites in HepG2 cells (Fig. 3), the Acknowledgments—We thank Joseph Avruch, Jack Rogers, and Phil effect of LY294002 to inhibit endogenous PI 3-kinase activity Daniel for critical reading of the manuscript. We thank Simin Nui for and enhance DAF-16 DNA binding and transcription function construction of GAL4zDAF-16 plasmids. is seen on both wild-type DAF-16 and DAF-16 4A (Fig. 5). Second, in our hands LY294002 stimulated wild-type and mu- REFERENCES tant DAF-16 4A activity over the control levels observed in 1. Kimura, K. D., Tissenbaum, H. A., Liu, Y., and Ruvkun, G. (1997) Science 277, 942–946 serum-starved 293 and HepG2 cells (Fig. 5) rather than simply 2. Morris, J. Z., Tissenbaum, H. A., and Ruvkun, G. (1996) Nature 382, 536 –539 reversing the negative effect of serum or insulin (14, 16). Thus, 3. Paradis, S., and Ruvkun, G. (1998) Genes Dev. 12, 2488 –2498 we conclude that the endogenous PI 3-kinase activity expressed 4. Paradis, S., Ailion, M., Toker, A., Thomas, J. H., and Ruvkun, G. (1999) Genes Dev. 13, 1438 –1452 in serum-starved 293 and HepG2 cells signals to a kinase other 5. Ogg, S., and Ruvkun, G. (1998) Mol. Cell 2, 887– 893 than AKT. Alternatively, endogenous PI 3-kinase signaling to 6. Lin, K., Dorman, J. B., Rodan, A., and Kenyon, C. (1997) Science 278, 1319 –1322 AKT could modify the phosphorylation of a cofactor that inter- 7. Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A., acts with DAF-16/Daf-16 4A. and Ruvkun, G. (1997) Nature 389, 994 –999 8. Gottlieb, S., and Ruvkun, G. (1994) Genetics 137, 107–120 The observation that growth factor signaling activates dis- 9. Alessi, D. R., and Cohen, P. (1998) Curr. Opin. Genet. Dev. 8, 55– 62 tinct effectors downstream of PI 3-kinase to regulate the activ- 10. Cheatham, B., Vlahos, C., Cheatham, L., Wang, L., Blenis, J., and Khan, C. ity of DAF-16-like proteins is supported by three published (1994) Mol. Cell. Biol. 14, 4902– 4911 11. Avruch, J. (1998) Mol. Cell. Biochem. 183, 31– 48 reports. First, in the insulin-responsive H4 hepatoma cell line, 12. O’Brien, R. M., Noisin, E. L., Suwanichkul, A., Yamasaki, T., Lucas, P. C., insulin signaling via an AKT site-independent mechanism in- Wang, J., Powell, D. R., and Granner, D. K. (1995) Mol. Cell. Biol. 15, hibits the transcription activity of GAL4-FKHR; this effect 1747–1758 13. Cichy, S. B., Uddin, S., Danilkovich, A., Guo, S., Klippel, A., and Unterman, occurs whether activity is assessed using the GAL4 DNA bind- T. G. (1998) J. Biol. Chem. 273, 6482– 6487 ing site or the IGFBP-IRE site (35). This observation is con- 14. Brunet, A., Bonni, A., Zigmond, M., Lin, M., Juo, P., Hu, L., Anderson, M., Arden, K., Blenis, J., and Greenberg, M. (1999) Cell 96, 857– 868 sistent with a direct effect of insulin on FKHR transcription 15. Kops, G., de Ruiter, N., De Vries-Smits, A., Powell, D., Bos, J., and Burgering, activity or localization and suggests that distinct insulin sig- B. (1999) Nature 398, 630 – 634 naling pathways to DAF-16-like FKH proteins may be opera- 16. Guo, S., Rena, G., Cichy, S., He, X., Cohen, P., and Unterman, T. (1999) J. Biol. Chem. 274, 17184 –17192 tive in specific cells. It is notable that the existence of insulin- 17. Tang, E., Nunez, G., Barr, F., and Guan, K.-L. (1999) J. Biol. Chem. 274, regulated, AKT-independent mechanisms for DAF-16 16741–16746 18. Durham, S., Suwanichkul, A., Scheimann, A., Yee, D., Jackson, J., Barr, F., regulation were proposed based on genetic data in C. elegans and Powell, D. (1999) Endocrinology 140, 3140 –3146 (3). Second, although the DAF-16 homolog FKHRL1 can bind 19. Rena, G., Guo, S., Cichy, S., Unterman, T., and Cohen, P. (1999) J. Biol. Chem. multimers of the PEPCK-IRE site and mediate the negative 274, 17179 –17183 20. Nakae, J., Park, B.-C., and Accili, D. (1999) J. Biol. Chem. 274, 15982–15985 effect of insulin in H4IIE cells, mutation of the AKT sites in 21. Nasrin, N., Ogg, S., Cahill, C., W., B., Nui, S., Dore, J., Calvo, D., Shi, Y., FKHRL1 inhibits the effect of insulin by 50% (36). Further- Ruvkun, G., and Alexander-Bridges, M. C. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10412–10417 more, insulin activation of AKT does not appear to explain all 22. Yaffe, M. B., Rittinger, K., Volinia, S., Caron, P. R., Aitken, A., Leffers, H., the effects of insulin-stimulated PI 3-kinase activity on PEPCK Smerdon, S. J., and Cantley, L. C. (1997) Cell 7, 961–971 gene transcription; negative regulation of this gene in H4 hep- 23. Lopez-Girona, A., Furnari, B., Mondesert, O., and Russell, P. (1999) Nature 172–175 atoma cells requires downstream effectors of PI 3-kinase dis- 24. Kumagai, A., and Dunphy, W. G. (1999) Genes Dev. 13, 1067–1072 tinct from AKT, the atypical protein kinase Cl and Rac (37). 25. Yang, J., Winkler, K., Yoshida, M., and Kornbluth, S. (1999) EMBO J. 18, 2174 –2183 Third, although insulin and IGF-1 can stimulate AKT activity 26. Tzivion, G., Luo, Z. J., and Avruch, J. (1998) Nature 394, 88 –92 equivalently in wild-type and insulin receptor-deficient SV40- 27. Luo, Z.-J., Zhang, X.-F., Rapp, U., and Avruch, J. (1995) J. Biol. Chem. 270, transformed hepatocytes, respectively, only insulin stimulates 23681–23687 28. Waterman, M., Stavridi, E., Waterman, J., and Halazonetis, T. (1998) Nat. phosphorylation of FKHR at site Thr-24 in these cells (33); Genet. 19, 175–178 thus, only insulin, and not IGF-1, stimulates nuclear export of 29. Matta-Yelin, M., Aitken, A., and Ravid, S. (1997) Mol. Biol. Cell 8, 1889 –1899 30. Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., and Greenberg, FKHR in these cells. M. E. (1997) Cell 91, 231–241 In HepG2 cells both insulin and LY294002 regulate IGFBP 31. Zha, J., Harda, H., Yang, E., Jockel, J., and Korsmeyer, S. J. (1996) Cell 87, promoter activity in the absence of exogenously expressed 619 – 628 32. Biggs, W. H., Meisenhelder, J., Hunter, T., Cavenee, W. K., and Arden, K. C. DAF-16. This observation suggests that the pathways we de- (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 7421–7426 scribe for DAF-16 are also relevant for endogenously expressed 33. Nakae, J., Barr, V., and Accili, D. (2000) EMBO J. 19, 989 –996 34. Takaishi, H., Konishi, H., Matsuzaki, H., Ono, Y., Shirai, Y., Saito, N., mammalian homologues such as FKHR (16) in HepG2 cells. Kitamura, T., Ogawa, W., Kasuga, M., Kikkawa, U., and Nishizuka, Y. Although it is formally possible that LY294002 activation of (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 11836 –11841 endogenous FKHR could require new protein synthesis, we 35. Tomizawa, M., Kumar, A., Perrot, V., Nakae, J., Accili, D., and Rechler, M. M. (2000) J. Biol. Chem. 275, 7289 –7295 show in Fig. 5B that the effect of LY294002 to enhance DAF-16 36. Hall, R. K., Yamasaki, T., Kucera, T., O’Brien, R. M., and Granner, D. K. DNA binding activity is not due to an increase in DAF-16 (2000) J. Biol. Chem. 275, 30169 –30175 37. Kotani, K., Ogawa, W., Matsumoto, M., Kitamura, T., Sakaue, H., Hino, Y., protein expression or nuclear content. Thus, LY294002 appears Miyake, K., Sano, W., Akimoto, K., and Kasuga, M. (1998) Mol. Cell. Biol. to have a direct effect on the specific DNA binding activity of 18, 6972– 6982 DAF-16. 38. Komeili, A., and O’Shea, E. K. (1999) Science 284, 977–980

Journal

Journal of Biological Chemistry – Unpaywall

Published: Apr 1, 2001

There are no references for this article.