Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Survivin 2α: a novel Survivin splice variant expressed in human malignancies

Survivin 2α: a novel Survivin splice variant expressed in human malignancies Background: Survivin and its alternative splice forms are involved in critical cellular processes, including cell division and programmed cell death. Survivin is expressed in the majority of human cancers, but minimally in differentiated normal tissues. Expression levels correlate with tumor aggressiveness and resistance to therapy. Results: In the present study, we identify and characterize a novel survivin isoform that we designate survivin 2α. Structurally, the transcript consists of 2 exons: exon 1 and exon 2, as well as a 3' 197 bp region of intron 2. Acquisition of a new in-frame stop codon within intron 2 results in an open reading frame of 225 nucleotides, predicting a truncated 74 amino acid protein. Survivin 2α is expressed at high levels in several malignant cell lines and primary tumors. Functional assays show that survivin 2α attenuates the anti-apoptotic activity of survivin. Subcellular localization and immunoprecipitation of survivin 2α suggests a physical interaction with survivin. Conclusion: We characterized a novel survivin splice variant that we designated survivin 2α. We hypothesize that survivin 2α can alter the anti-apoptotic functions of survivin in malignant cells. Thus survivin 2α may be useful as a therapeutic tool in sensitizing chemoresistant tumor cells to chemotherapy. Survivin was originally identified by structural homology Background Alternative splicing is estimated to occur in 40–60% of all to IAPs in human B-cell lymphoma [4]. It is composed of human genes, accounting for some of the discrepancies a single BIR domain and an extended carboxy-terminal between the large number of known proteins and the coiled coil domain [5]. Transcription from the Survivin three-fold lower number of human genes in the genome. locus gives rise to alternatively spliced transcripts identi- Alternative splicing generates a multitude of isoforms that fied in both human and mice [6-8]. To date, three alterna- have overlapping but distinct functions during embryonic tively spliced isoforms have been described in humans [6- development and that also contribute to maintaining 8]. Survivin-2B is generated by the insertion of an alterna- homeostasis in adult differentiated tissues (reviewed in tive exon, exon 2B; Survivin-∆ Ex3 arises from the removal [1]). Alternative splice forms of key proteins in cancer, of exon 3 resulting in a frameshift and translation of part TP53, MDM2 [2] and c-MYC [3], have been shown to play of the 3'UTR generating a unique carboxy-terminus; Sur- a role in oncogenesis. vivin-3B results from the introduction of a novel exon 3B Page 1 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Structural Figure 1 analysis of survivin 2α compared with the other human survivin isoforms Structural analysis of survivin 2α compared with the other human survivin isoforms. A: The survivin pre-mRNA generates at least five mature mRNA transcripts. Boxes represent exons, with the sizes indicated below. The size of the additional nucle- otide sequences for survivin 3B and survivin 2α are shown. In survivin 2α, 197nt of intron 2 are added, of which 195nt are non- coding. Protein domains and motifs are indicated above the diagrams. The black arrow indicates the stop codon; the coiled-coil domain is shown by the dotted line; and the double lines represent the BIR domain. B: Survivin 2α transcript and predicted protein sequence. The sequence for the survivin 2α transcript was obtained by sequencing the insert contained within the IMAGE clone. C: Predicted 3D structural modeling of survivin 2α and survivin. The amino acid sequence of survivin 2α was used with SWISS-MODEL to predict a 3D structure by homology modeling. The resulting PDB file was visualized and manipu- lated using Swiss PBD-Viewer for the view presented. The 3D structure for survivin was obtained from Swiss-PROT database (PDB entry 1F3H). The yellow arrows indicate regions of differences between survivin 2α and survivin. The red arrows repre- rd sent the first 2 alpha helices of the BIR domain, and the pink arrow represents the 3 helix, that is absent in survivin 2α. The green arrow points to the C-terminal coiled-coil domain. D: Protein Analysis of survivin 2α. Total HeLa cell lysate was loaded on a 18% SDS-PAGE and transferred into nitrocellulose membrane. The proteins were detected by immunoprobing with a pol- yclonal survivin antibody. A protein of approximate molecular weight 8.5 kDa, corresponding to the predicted size of survivin 2α is detected in HeLa cell lysates. resulting in a frameshift and premature termination of the In this report we identify and characterize a novel isoform protein (Figure 1A). of survivin, survivin 2α. We show that survivin 2α is expressed at high levels in malignant cells, co-localizes Survivin has 2 main functions; one as a chromosomal pas- with survivin and has the potential to attenuate the anti- senger protein [9] and the other as an inhibitor of apop- apoptotic effect of survivin. tosis [10]. Survivin 2B has been shown to be a pro- apoptotic protein that sensitizes resistant leukemia cells to Results and Discussion chemotherapy in a p53-dependent fashion [11]. Survivin- Structural Characteristics of Survivin 2α ∆ Ex3 functions as an anti-apoptotic protein and is upreg- In this work, we characterized a novel isoform of the sur- ulated in malignancies (Mahotka et al., 1999). No func- vivin locus. We surveyed the aligned survivin EST tion has yet been described for survivin-3B. sequences available in the UCSC Human Genome Page 2 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Table 1: Table of the predicted localization and structural Table 2: Survivin 2α expression (relative to normal tissue). features of survivin and the novel isoform survivin 2α. Cell Type Relative Increase Localization Survivin Survivin 2α Normal Cerebellum 1.00 Cytoplasm 56.5% 39.1% Normal Breast (MCF10A) 0.97 Nucleus 17.4% 34.8% Breast Carcinoma (MCF7) 8.17 Cytoskeleton 0% 4.3% Osteosarcoma (U2OS) 39.06 Golgi Apparatus 0% 0% Lung (A549) 3.03 Plasma membrane 4.3% 0% ALL (Jurkat) 1.84 ER 4.3% 4.3% Soft Tissue Sarcoma (RH28) 94.90 Peroxysome 0% 0% Cervical Carcinoma (HeLa) 58.22 Mitochondria 13.0% 13.0% Medulloblastoma (Daoy) 34.23 Lysosomes 4.3% 4.3% Primary Tumors Features Medulloblastoma #1 4.68 BIR 1 Partial Medulloblastoma #2 154.55 Coiled-Coil 1 0 Medulloblastoma #3 93.24 Protein Size 142 aa 74 aa Medulloblastoma #4 5.69 Predicted Molecular Weight 16.4 kDa 8.5 kDa Medulloblastoma #5 8.54 Medulloblastoma #6 9.81 Medulloblastoma#7 75.10 Browser and identified an EST from a human breast tumor cDNA library (I.M.A.G.E. clone 1631662). We sequenced the entire cDNA and designated it Survivin 2α. The com- plete cDNA sequence is shown in Figure 1B. The protein contains the coding sequences from exon 1 and exon 2, shown to accelerate PCD (Programmed Cell Death) in and one additional amino acid before termination (Figure vitro. Similarly, mutations in Cytosine 84 (C84) enhance 1B). This 74 amino acid protein, with a predicted molec- PCD, as a result of displacement of the wild type Survivin ular weight of 8.5 kDa, contains a truncated BIR domain protein [13]. The Survivin 2α protein, truncated at amino and lacks the carboxy-terminal coiled-coil domain in its acid 74, lacks both of these amino acid residues. Addition- entirety (Figure 1A). There are no defined localization sig- ally, Survivin 2α lacks the third alpha helix in the BIR nals in the protein, and PSORTII predicts localization domain. As the anti-apoptotic function of Survivin is within the nucleus and the cytoplasm (Table 1). Align- mediated both by the BIR domain and by the interaction ment with the known human survivin isoforms shows of its C-terminal coiled coil domain with microtubules of that the sequence of Survivin 2α is identical to exons 1 the mitotic spindle [10,14,15], it would be predicted that and 2 of the other survivin splice variants, with the excep- Survivin 2α might not have anti-apoptotic properties. tion of the last amino acid. Alignment of Survivin 2α with Survivin 2α is highly expressed in tumor cells the three mouse survivin isoforms also reveals some sim- ilarity with survivin40, a 40-amino acid mouse splice var- Survivin is critical for global normal embryonic develop- iant (not shown). The 3D predicted structure of Survivin ment, as demonstrated by the early embryonic lethality of 2α shows the absence of the alpha-helical coiled-coil mice with homozygous deletions in the survivin gene domain, present in survivin (Figure 1C). It also shows locus [16]. Survivin proteins are virtually absent from minor predicted rearrangements in the structure that may most normal differentiated tissues, however these pro- occur to stabilize the protein (Figure 1C, yellow arrows). teins are expressed in certain highly proliferative areas These re-arrangements occur within the BIR domain, and within normal tissues [17-19]. In contrast, survivin is could have functional implications for the role of Survivin highly expressed in the majority of human malignancies, 2α in apoptosis. derived from different cell origins. We evaluated the expression of survivin 2α in 7 different cancer cell lines, 2 The BIR domain has been shown to be important for non-transformed tissues and 7 primary medulloblastoma homodimerization and coordination of the zinc atom co- tumors by quantitative PCR. We designed primers that factor [12]. In the survivin protein, Histidine 80 (H80) is will specifically amplify Survivin 2α after selection of required for zinc atom coordination and homodimeriza- polyadenylated RNA. Survivin 2α expression in tumor tion. Expression constructs containing mutations at this cells and primary medulloblastoma tumors varied from residue within the Survivin protein have previously been 2–100 fold above non transformed cells (Table 2). The Page 3 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Table 3: Expression of survivin splice variants in medulloblastoma (relative to survivin) Tissue Survivin 2B Survivin ∆Ex3 Survivin 2α Medulloblastoma #3 37.63 0.46 0.36 Medulloblastoma #4 43.82 0.18 0.18 Medulloblastoma (Daoy) 1290.16 35.10 0.66 Survivin 2α alters the subcellular localization of survivin levels of Survivin 2α transcripts are comparable to those of Survivin ∆Exon3 (Table 3). Like Survivin, Survivin 2α is To characterize the subcellular localization of survivin 2α expressed at increased levels in transformed cells com- we performed direct fluorescence assays in HeLa cells pared to non-transformed cells, and therefore it suggests transfected with a GFP- survivin 2α construct. Survivin 2α that it could have a role in tumorigenesis. Additionally, localized to the nucleus and the cytoplasm in interphase we detected expression of endogenous Survivin 2α pro- cells (Figure 3A). In cells undergoing mitosis, survivin 2α tein in HeLa cells, suggesting that the transcript is trans- was confined to the cytoplasmic compartment (Figure lated (Figure 1D). 3B). Interestingly, when co-expressed with survivin, sur- vivin 2α co-localized with survivin to the centromeres of Functional Properties of Survivin 2α the chromosomes in prometaphase (Figure 3C) and To characterize a function for Survivin 2α, we transfected metaphase (Figure 3D), and at the midbody during late Daoy cells with Survivin 2α and a combination of Sur- telophase/cytokinesis (Figure 3E). Moreover, the normal vivin 2α and Survivin. To induce apoptosis in the Daoy cytoplasmic localization of survivin shifted to the nucleus cells, we treated them with 2 µM of the chemotherapeutic in interphase cells. This data suggests a direct interaction agent vincristine. Vincristine is a vinca alkaloid that binds between the two proteins, as well as a potential to tubulin, inhibiting microtubule polymerization. It kills mechanism for the attenuation of survivin's anti-apop- Daoy cells in culture by PCD. We analyzed early apoptotic totic activity by survivin 2α. events in vincristine-treated transfected cells by Annexin V staining. Survivin 2α antagonized the anti-apoptotic effect Survivin 2α physically interacts with survivin of Survivin in co-transfection assays with or without a cell To further investigate the possibility that survivin 2α inter- death stimulus (not shown and Figure 2A). As inhibition acts with survivin we performed co-immunoprecipitation of apoptosis by Survivin involves activation of the caspase experiments. We co-transfected HeLa cells with constructs pathway [20], we assayed Survivin 2α transfected cells for encoding a Flag-survivin fusion protein and a myc-sur- caspase 3 activation. Caspase-3 was strongly activated in vivin 2α fusion protein. We used a Flag antibody to pre- vector control and Survivin 2α transfected cells in the cipitate protein complexes, and a myc antibody to detect presence of vincristine. Much lower levels of caspase-3 myc-tagged survivin 2α. We detected survivin 2α-myc in activation were observed in Survivin-transfected cells (Fig- the complexes precipitated with the Flag antibody, sub- ure 2B). In the absence of an apoptotic stimulus we stantiating a physical interaction of survivin with survivin observed a 35% increase of caspase-3 activity in Survivin 2α (Figure 4). 2α cells, as well as a 46% increase in early apoptosis, as assessed by Annexin V staining. We also performed elec- Conclusion tron microscopy analysis of Survivin 2α transfected and We characterized a novel survivin splice variant that we non-transfected cells. We sorted transfected cells from designated survivin 2α. We hypothesize that survivin 2α non-transfected cells by FACS based on GFP fluorescence, can alter the anti-apoptotic functions of survivin in malig- and processed each population for EM analysis (Figure nant cells. Thus, survivin 2α may be useful as a 2C). Overall, there was a 43% increase in incidence of therapeutic tool in sensitizing chemoresistant tumor cells apoptosis in Survivin 2α-expressing cells versus non- to chemotherapy. expressing cells. Our results suggest that Survivin 2α can attenuate survivin's anti-apoptotic activity and sensitize Methods tumor cells to chemotherapy. These findings have Patient samples important therapeutic implications in the treatment of Seven fresh frozen primary medulloblastoma tumor sam- chemoresistant tumors. ples were obtained from the Cooperative Human Tumor Network (CHTN), after approval through the Columbus Children's Hospital IRB. Page 4 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 3.5 2.5 1.5 Control 0.5 Vector Survivin Survivin 2α Survivin Survivin 2α 5.E+05 5.E+05 4.E+05 4.E+05 3.E+05 3.E+05 2.E+05 Survivin 2αααα 2.E+05 1.E+05 5.E+04 0.E+00 Vector Survivin 2α Survivin + + VCR VCR VCR E Figure 2 arly apoptosis in tumor cells transfected with survivin and survivin 2α Early apoptosis in tumor cells transfected with survivin and survivin 2α. A: Daoy cells were transiently transfected with control vector, survivin, survivin 2α, or a combination of survivin and survivin 2α. Apoptosis was measured using Annexin V/PI staining 24 hours after transfection, in the absence of a cell death stimulus. The results are shown relative to empty vector control. Error bars represent standard deviations from triplicate experiments. Results were adjusted for transfection efficiency based on parallel transfection with a GFP-expressing plasmid. B: Daoy cells were transiently transfected with control, survivin or sur- vivin 2α. Apoptosis was measured by Caspase-3 activity following treatment with vincristine. C: HeLa cells were transiently transfected with control or GFP-tagged survivin 2α. Electron Microscopy analysis of transfected cells shows a representative cell undergoing apoptosis as induced by survivin 2α. Images were taken 12,000× magnification and scale bars are shown. Sequencing fusion with the C-terminal GFP tag. The start codon in IMAGE clone 1631662 (Invitrogen) was sequenced using both constructs corresponds to the naturally occurring primers that flanked the multiple-cloning-site. start codon in the cDNA transcript. The resulting clones were confirmed by sequencing. Plasmids and Cloning Cell Culture and Transfection The cDNA for survivin 2α was amplified from the EST clone (Invitrogen) and cloned into the KpnI-BamHI sites HeLa (cervical adenocarcinoma), Daoy (medulloblast- of pcDNA4/TO/myc-HisB (Invitrogen) generating an in- oma), Jurkat (acute lymphoblastic leukemia) and MCF-7 frame fusion with the C-terminal myc-tag, or into the (breast adenocarcinoma) cells (ATCC) were grown in KpnI-BamHI sites of pEGFP-N3 generating an in-frame DMEM supplemented with 10% FBS at 37°C, 5% CO ; Page 5 of 9 (page number not for citation purposes) Apoptosis relative to Vector control RLU/10 seconds/2,000 cells Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 GFP-Survivin 2αα + αα + + + + + HcRed-Survivin - - + ++ + AB C D E F A1 B1 C1 D1 E1 F1 A2 B2 C2 D2 E2 F2 C3 D3 E3 F3 Figure 3 Confocal microscopy analysis of survivin 2α sub-cellular localization Confocal microscopy analysis of survivin 2α sub-cellular localization. HeLa cells were transfected with GFP-survivin 2α or HcRed survivin, as detailed on the top of the figure. Green pixels correspond to GFP expression, red pixels correspond to HcRed expression and blue pixels represent DNA labeled with Hoechst dye. When co-localization of GFP and HcRed occurs the pixels are yellow. A: Expression of survivin 2α at interphase localizes to nuclear and cytoplasmic structures. B: During M- phase survivin 2α is excluded from the condensed/dividing chromosomes and is localized in the cytoplasm of the dividing cell. C, D, E, F: When co-expressed with survivin, survivin 2α localization does not change at interphase. During M-phase survivin 2α co-localizes with survivin to the centromeres of the dividing chromosomes (D and E), and in the midbody region at cytoki- nesis (F). Scale bar = 5 µm U2OS osteosarcoma cells (kindly donated by Dr. Greg with 100 ng/ml cholera toxin (Sigma Aldrich) at 37°C, Otterson) were grown in McCoy's 5A medium 5% CO . supplemented with 10% FBS at 37°C, 5% CO ; RH28 (alveolar rhabdomyosarcoma, kindly donated by Dr. Transient transfections were performed using Effectene Steve Qualman) and A549 (lung carcinoma) (ATCC) were transfection reagent (Qiagen) at a DNA: Effectene ratio of grown in RPMI1640 supplemented with 10% FBS at 1:10. 37°C, 5% CO . MCF10-A, a non-transformed breast cell line (ATCC) was grown in MEGM, Mammary Epithelial Drug Treatment Growth Medium, Serum-free, (Clonetics) supplemented Induction of apoptosis by vincristine was done by treat- ment of cells with complete growth medium supple- Page 6 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Survivin 2α ++ Flag-survivin ++ Survivin 2α-myc Anti-Flag M2 - + Co-immunoprecipita Figure 4 tion of survivin-survivin 2α Co-immunoprecipitation of survivin-survivin 2α. HeLa cells were transfected with constructs encoding tagged forms of survivin (Flag) and survivin 2α (myc). Lysates from transfected cells were subjected to immunoprecipitation with an antibody against the Flag epitope. The resulting immunoprecipitated complexes were resolved by SDS-PAGE and subjected to Western blotting. The membrane was immunoprobed with an antibody against the myc epitope tag. Survivin 2α-myc is clearly visualized in lysates precipitated with a Flag antibody. mented with vincristine sulfate at a final concentration of 6FAM AGATTTGAGTTGCAAAGACACTTAGTAT- 2 µM. GGGAGGG TAMRA RNA isolation and Real Time PCR Apoptosis Assays RNA was isolated from 10 proliferating cells or frozen Two apoptosis assays were performed: Caspase-3 assay tumor tissue using TriZol reagent (Invitrogen) as recom- and Annexin-V FLUOS. For caspase assays 2,000 cells mended by the supplier. Poly(A) RNA was purified using from each experimental condition were subjected to the Oligotex dT kit (Qiagen). 100 ng of poly(A) purified RNA caspase-3 assay, Caspase 3/7 GLO (Promega) and ana- was used as a template in a reverse transcription reaction lyzed on a Victor3 plate reader (Applied Biosystems). using random hexamers and Omniscript Reverse tran- Experiments were performed in triplicate. scriptase (Qiagen) and performed according to manufac- turer's instructions. Quantitative real-time PCR reactions Annexin V/propidium iodide staining was carried out using Taqman probes (FAM/TAMRA) were run in tripli- using the Roche Annexin-V-Fluos Staining Kit following cate on an ABI Prism 7700 Real-time PCR machine the manufacturer's instructions. Fluorescein and propid- (Applied Biosystems). Control GAPDH reactions ium iodide fluorescence measured with a Coulter EPICS (Applied Biosystems) were run to normalize ∆Ct values. XL flow cytometer. Experiments were performed in Relative change was calculated by the comparative C triplicate. (-∆∆Ct) method, 2 . The survivin 2α specific primers consist of: Forward 5'GCTTTGTTTTGAACTGAGTTGTCAA; Reverse 5'GCAATGAGGGTGGAAAGCA; and Probe: Page 7 of 9 (page number not for citation purposes) Control IP Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Microscopy Authors' contributions Proliferating HeLa cells, grown on glass coverslips, were HC performed bioinformatic analysis, subcellular locali- transiently transfected with a GFP-tagged survivin 2α zation, functional studies, co-immunoprecipitation and expression construct or co-transfected with GFP-tagged drafted the manuscript. LH performed quantitative real survivin 2α and HcRed-tagged survivin. 24 hours post- time PCR in cell lines and primary tumors. RA conceived transfection the cells were fixed in 4% paraformaldehyde the study and participated in its design and coordination, and stained with 50 µg/ml Hoechst dye. Cells were ana- and was responsible for overseeing the final version of the lyzed on a Zeiss LSM510 META confocal microscope, manuscript. All authors have read and approved the final using a 63x PlanApochromat objective. For electron manuscript. microscopy analysis, proliferating HeLa cells were trans- fected with GFP-tagged survivin 2α construct for 12 hours. Acknowledgements We would like to thank M. Holloway and J. Fangusaro for general technical The cells were aseptically sorted by FACS based on green assistance, C. McAllister for assistance with FACS and EM and G. Otterson fluorescence from GFP-survivin 2α for positive and nega- and S. Qualman for kindly donating cell lines. We are grateful to Dr tive populations. This was done in order to separate an Heithem El-Hodiri for critically reviewing this manuscript. This work was enriched population that consisted of >90% GFP express- supported by the Elsa U. Pardee Foundation and by the Hope Street Kids ing cells. 10 cells for each condition were fixed in 2.5% Foundation. gluteraldehyde for 24 hours and processed for EM. For cell analysis, 10 to 12 fields containing 8–10 cells per field at References a magnification of 3500× were used. At least 100 cells 1. Wagner KD, Wagner N, Schedl A: The complex life of WT1. J Cell Sci 2003, 116:1653-1658. were counted for each experimental condition and 2. Fridman JS, Hernando E, Hemann MT, de Stanchina E, Cordon-Cardo assigned to categories of healthy or dying based on their C, Lowe SW: Tumor promotion by Mdm2 splice variants una- morphological appearance, including nuclear integrity. ble to bind p53. Cancer Res 2003, 63:5703-5706. 3. Bodescot M, Brison O: Characterization of new human c-myc Image collection was performed on a Hitachi H-600 trans- mRNA species produced by alternative splicing. Gene 1996, mission electron microscope equipped with a GATAN 174:115-120. 4. Ambrosini G, Adida C, Altieri DC: A novel anti-apoptosis gene, image acquisition system. survivin, expressed in cancer and lymphoma. Nat Med 1997, 3:917-921. Co-Immunoprecipitation 5. LaCasse EC, Baird S, Korneluk RG, MacKenzie AE: The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Onco- HeLa cells transfected with Flag-survivin and survivin-2α gene 1998, 17:3247-3259. myc were collected in Cell Lysis Buffer (100 mM Tris-HCl 6. Badran A, Yoshida A, Ishikawa K, Goi T, Yamaguchi A, Ueda T, Inu- zuka M: Identification of a novel splice variant of the human pH8.0, 100 mM NaCl, 0.5% Triton X-100, 0.2 µM PMSF) anti-apoptopsis gene survivin. Biochem Biophys Res Commun 2004, and incubated at 4°C for 30 min. The cell lysate was clar- 314:902-907. ified by centrifugation and the clarified supernatant dis- 7. Mahotka C, Wenzel M, Springer E, Gabbert HE, Gerharz CD: Sur- vivin-deltaEx3 and survivin-2B: two novel splice variants of solved 1:5 in Co-IP buffer (50 mM Tris-HCl pH7.5, 15 the apoptosis inhibitor survivin with different antiapoptotic mM EGTA, 100 mM NaCl, 0.1% Triton X-100, 1x protease properties. Cancer Res 1999, 59:6097-6102. inhibitors cocktail, 1 mM DTT, 1 mM PMSF). The equiva- 8. Conway EM, Pollefeyt S, Cornelissen J, DeBaere I, Steiner-Mosonyi M, Ong K, Baens M, Collen D, Schuh AC: Three differentially lent of 400 µg of lysate total protein was incubated with 2 expressed survivin cDNA variants encode proteins with dis- µg of anti-Flag M2 antibody at 4°C for 1 h with constant tinct antiapoptotic functions. Blood 2000, 95:1435-1442. 9. Carvalho A, Carmena M, Sambade C, Earnshaw WC, Wheatley SP: rotation. As a control the same amount of lysate protein Survivin is required for stable checkpoint activation in taxol- was incubated in the absence of antibody. Fifty microliters treated HeLa cells. J Cell Sci 2003, 116:2987-2998. of agarose-conjugated protein A (Invitrogen) were added 10. Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC: Anti-apoptosis gene, survivin, and prognosis of and the mixture incubated for a further hour in the same neuroblastoma. Lancet 1998, 351:882-883. conditions. The protein-antibody-protein A complexes 11. Zhu N, Gu L, Findley HW, Li F, Zhou M: An alternatively spliced survivin variant is positively regulated by p53 and sensitizes were pulled down by centrifugation and subjected to 3 leukemia cells to chemotherapy. Oncogene 2004, 23:7545-7551. washes with co-IP buffer. The proteins were analyzed 12. Muchmore SW, Chen J, Jakob C, Zakula D, Matayoshi ED, Wu W, through electrophoretic separation in a 20% SDS-PAGE, Zhang H, Li F, Ng SC, Altieri DC: Crystal structure and muta- genic analysis of the inhibitor-of-apoptosis protein survivin. electroblotted onto nitrocellulose and immunoprobed Mol Cell 2000, 6:173-182. with an antibody against myc-tag. Detection was per- 13. Skoufias DA, Mollinari C, Lacroix FB, Margolis RL: Human survivin formed using the ECL kit (Amersham). Protein standards is a kinetochore-associated passenger protein. J Cell Biol 2000, 151:1575-1582. were used for size determination. 14. Ambrosini G, Adida C, Sirugo G, Altieri DC: Induction of apopto- sis and inhibition of cell proliferation by survivin gene Bioinformatics targeting. J Biol Chem 1998, 273:11177-11182. 15. Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J, Altieri DC: Subcellular localization predicted by PSORTII program. Developmentally regulated expression of the novel cancer Coiled-Coil domain predicted by Coils and PairCoil anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol 1998, 152:43-49. programs 16. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL, Choo KH: Survivin and the inner centromere protein Page 8 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 INCENP show similar cell-cycle localization and gene knock- out phenotype. Curr Biol 2000, 10:1319-1328. 17. Conway EM, Pollefeyt S, Steiner-Mosonyi M, Luo W, Devriese A, Lupu F, Bono F, Leducq N, Dol F, Schaeffer P, Collen D, Herbert JM: Deficiency of survivin in transgenic mice exacerbates Fas- induced apoptosis via mitochondrial pathways. Gastroenterol- ogy 2002, 123:619-631. 18. Fukuda S, Foster RG, Porter SB, Pelus LM: The antiapoptosis pro- tein survivin is associated with cell cycle entry of normal cord blood CD34(+) cells and modulates cell cycle and pro- liferation of mouse hematopoietic progenitor cells. Blood 2002, 100:2463-2471. 19. Altura RA, Olshefski RS, Jiang Y, Boue DR: Nuclear expression of Survivin in paediatric ependymomas and choroid plexus tumours correlates with morphologic tumour grade. Br J Cancer 2003, 89:1743-1749. 20. Dohi T, Beltrami E, Wall NR, Plescia J, Altieri DC: Mitochondrial survivin inhibits apoptosis and promotes tumorigenesis. J Clin Invest 2004, 114:1117-1127. Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 9 of 9 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Molecular Cancer Springer Journals

Survivin 2α: a novel Survivin splice variant expressed in human malignancies

Caldas, Hugo; Honsey, Laura; Altura, Rachel
Molecular Cancer , Volume 4 (1) – Mar 2, 2005
Download PDF
9 pages

Loading next page...
 
/lp/springer-journals/survivin-2-a-novel-survivin-splice-variant-expressed-in-human-rtAdNquCRf

References (25)

Publisher
Springer Journals
Copyright
Copyright © 2005 by Caldas et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Cancer Research; Oncology
eISSN
1476-4598
DOI
10.1186/1476-4598-4-11
pmid
15743529
Publisher site
See Article on Publisher Site

Abstract

Background: Survivin and its alternative splice forms are involved in critical cellular processes, including cell division and programmed cell death. Survivin is expressed in the majority of human cancers, but minimally in differentiated normal tissues. Expression levels correlate with tumor aggressiveness and resistance to therapy. Results: In the present study, we identify and characterize a novel survivin isoform that we designate survivin 2α. Structurally, the transcript consists of 2 exons: exon 1 and exon 2, as well as a 3' 197 bp region of intron 2. Acquisition of a new in-frame stop codon within intron 2 results in an open reading frame of 225 nucleotides, predicting a truncated 74 amino acid protein. Survivin 2α is expressed at high levels in several malignant cell lines and primary tumors. Functional assays show that survivin 2α attenuates the anti-apoptotic activity of survivin. Subcellular localization and immunoprecipitation of survivin 2α suggests a physical interaction with survivin. Conclusion: We characterized a novel survivin splice variant that we designated survivin 2α. We hypothesize that survivin 2α can alter the anti-apoptotic functions of survivin in malignant cells. Thus survivin 2α may be useful as a therapeutic tool in sensitizing chemoresistant tumor cells to chemotherapy. Survivin was originally identified by structural homology Background Alternative splicing is estimated to occur in 40–60% of all to IAPs in human B-cell lymphoma [4]. It is composed of human genes, accounting for some of the discrepancies a single BIR domain and an extended carboxy-terminal between the large number of known proteins and the coiled coil domain [5]. Transcription from the Survivin three-fold lower number of human genes in the genome. locus gives rise to alternatively spliced transcripts identi- Alternative splicing generates a multitude of isoforms that fied in both human and mice [6-8]. To date, three alterna- have overlapping but distinct functions during embryonic tively spliced isoforms have been described in humans [6- development and that also contribute to maintaining 8]. Survivin-2B is generated by the insertion of an alterna- homeostasis in adult differentiated tissues (reviewed in tive exon, exon 2B; Survivin-∆ Ex3 arises from the removal [1]). Alternative splice forms of key proteins in cancer, of exon 3 resulting in a frameshift and translation of part TP53, MDM2 [2] and c-MYC [3], have been shown to play of the 3'UTR generating a unique carboxy-terminus; Sur- a role in oncogenesis. vivin-3B results from the introduction of a novel exon 3B Page 1 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Structural Figure 1 analysis of survivin 2α compared with the other human survivin isoforms Structural analysis of survivin 2α compared with the other human survivin isoforms. A: The survivin pre-mRNA generates at least five mature mRNA transcripts. Boxes represent exons, with the sizes indicated below. The size of the additional nucle- otide sequences for survivin 3B and survivin 2α are shown. In survivin 2α, 197nt of intron 2 are added, of which 195nt are non- coding. Protein domains and motifs are indicated above the diagrams. The black arrow indicates the stop codon; the coiled-coil domain is shown by the dotted line; and the double lines represent the BIR domain. B: Survivin 2α transcript and predicted protein sequence. The sequence for the survivin 2α transcript was obtained by sequencing the insert contained within the IMAGE clone. C: Predicted 3D structural modeling of survivin 2α and survivin. The amino acid sequence of survivin 2α was used with SWISS-MODEL to predict a 3D structure by homology modeling. The resulting PDB file was visualized and manipu- lated using Swiss PBD-Viewer for the view presented. The 3D structure for survivin was obtained from Swiss-PROT database (PDB entry 1F3H). The yellow arrows indicate regions of differences between survivin 2α and survivin. The red arrows repre- rd sent the first 2 alpha helices of the BIR domain, and the pink arrow represents the 3 helix, that is absent in survivin 2α. The green arrow points to the C-terminal coiled-coil domain. D: Protein Analysis of survivin 2α. Total HeLa cell lysate was loaded on a 18% SDS-PAGE and transferred into nitrocellulose membrane. The proteins were detected by immunoprobing with a pol- yclonal survivin antibody. A protein of approximate molecular weight 8.5 kDa, corresponding to the predicted size of survivin 2α is detected in HeLa cell lysates. resulting in a frameshift and premature termination of the In this report we identify and characterize a novel isoform protein (Figure 1A). of survivin, survivin 2α. We show that survivin 2α is expressed at high levels in malignant cells, co-localizes Survivin has 2 main functions; one as a chromosomal pas- with survivin and has the potential to attenuate the anti- senger protein [9] and the other as an inhibitor of apop- apoptotic effect of survivin. tosis [10]. Survivin 2B has been shown to be a pro- apoptotic protein that sensitizes resistant leukemia cells to Results and Discussion chemotherapy in a p53-dependent fashion [11]. Survivin- Structural Characteristics of Survivin 2α ∆ Ex3 functions as an anti-apoptotic protein and is upreg- In this work, we characterized a novel isoform of the sur- ulated in malignancies (Mahotka et al., 1999). No func- vivin locus. We surveyed the aligned survivin EST tion has yet been described for survivin-3B. sequences available in the UCSC Human Genome Page 2 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Table 1: Table of the predicted localization and structural Table 2: Survivin 2α expression (relative to normal tissue). features of survivin and the novel isoform survivin 2α. Cell Type Relative Increase Localization Survivin Survivin 2α Normal Cerebellum 1.00 Cytoplasm 56.5% 39.1% Normal Breast (MCF10A) 0.97 Nucleus 17.4% 34.8% Breast Carcinoma (MCF7) 8.17 Cytoskeleton 0% 4.3% Osteosarcoma (U2OS) 39.06 Golgi Apparatus 0% 0% Lung (A549) 3.03 Plasma membrane 4.3% 0% ALL (Jurkat) 1.84 ER 4.3% 4.3% Soft Tissue Sarcoma (RH28) 94.90 Peroxysome 0% 0% Cervical Carcinoma (HeLa) 58.22 Mitochondria 13.0% 13.0% Medulloblastoma (Daoy) 34.23 Lysosomes 4.3% 4.3% Primary Tumors Features Medulloblastoma #1 4.68 BIR 1 Partial Medulloblastoma #2 154.55 Coiled-Coil 1 0 Medulloblastoma #3 93.24 Protein Size 142 aa 74 aa Medulloblastoma #4 5.69 Predicted Molecular Weight 16.4 kDa 8.5 kDa Medulloblastoma #5 8.54 Medulloblastoma #6 9.81 Medulloblastoma#7 75.10 Browser and identified an EST from a human breast tumor cDNA library (I.M.A.G.E. clone 1631662). We sequenced the entire cDNA and designated it Survivin 2α. The com- plete cDNA sequence is shown in Figure 1B. The protein contains the coding sequences from exon 1 and exon 2, shown to accelerate PCD (Programmed Cell Death) in and one additional amino acid before termination (Figure vitro. Similarly, mutations in Cytosine 84 (C84) enhance 1B). This 74 amino acid protein, with a predicted molec- PCD, as a result of displacement of the wild type Survivin ular weight of 8.5 kDa, contains a truncated BIR domain protein [13]. The Survivin 2α protein, truncated at amino and lacks the carboxy-terminal coiled-coil domain in its acid 74, lacks both of these amino acid residues. Addition- entirety (Figure 1A). There are no defined localization sig- ally, Survivin 2α lacks the third alpha helix in the BIR nals in the protein, and PSORTII predicts localization domain. As the anti-apoptotic function of Survivin is within the nucleus and the cytoplasm (Table 1). Align- mediated both by the BIR domain and by the interaction ment with the known human survivin isoforms shows of its C-terminal coiled coil domain with microtubules of that the sequence of Survivin 2α is identical to exons 1 the mitotic spindle [10,14,15], it would be predicted that and 2 of the other survivin splice variants, with the excep- Survivin 2α might not have anti-apoptotic properties. tion of the last amino acid. Alignment of Survivin 2α with Survivin 2α is highly expressed in tumor cells the three mouse survivin isoforms also reveals some sim- ilarity with survivin40, a 40-amino acid mouse splice var- Survivin is critical for global normal embryonic develop- iant (not shown). The 3D predicted structure of Survivin ment, as demonstrated by the early embryonic lethality of 2α shows the absence of the alpha-helical coiled-coil mice with homozygous deletions in the survivin gene domain, present in survivin (Figure 1C). It also shows locus [16]. Survivin proteins are virtually absent from minor predicted rearrangements in the structure that may most normal differentiated tissues, however these pro- occur to stabilize the protein (Figure 1C, yellow arrows). teins are expressed in certain highly proliferative areas These re-arrangements occur within the BIR domain, and within normal tissues [17-19]. In contrast, survivin is could have functional implications for the role of Survivin highly expressed in the majority of human malignancies, 2α in apoptosis. derived from different cell origins. We evaluated the expression of survivin 2α in 7 different cancer cell lines, 2 The BIR domain has been shown to be important for non-transformed tissues and 7 primary medulloblastoma homodimerization and coordination of the zinc atom co- tumors by quantitative PCR. We designed primers that factor [12]. In the survivin protein, Histidine 80 (H80) is will specifically amplify Survivin 2α after selection of required for zinc atom coordination and homodimeriza- polyadenylated RNA. Survivin 2α expression in tumor tion. Expression constructs containing mutations at this cells and primary medulloblastoma tumors varied from residue within the Survivin protein have previously been 2–100 fold above non transformed cells (Table 2). The Page 3 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Table 3: Expression of survivin splice variants in medulloblastoma (relative to survivin) Tissue Survivin 2B Survivin ∆Ex3 Survivin 2α Medulloblastoma #3 37.63 0.46 0.36 Medulloblastoma #4 43.82 0.18 0.18 Medulloblastoma (Daoy) 1290.16 35.10 0.66 Survivin 2α alters the subcellular localization of survivin levels of Survivin 2α transcripts are comparable to those of Survivin ∆Exon3 (Table 3). Like Survivin, Survivin 2α is To characterize the subcellular localization of survivin 2α expressed at increased levels in transformed cells com- we performed direct fluorescence assays in HeLa cells pared to non-transformed cells, and therefore it suggests transfected with a GFP- survivin 2α construct. Survivin 2α that it could have a role in tumorigenesis. Additionally, localized to the nucleus and the cytoplasm in interphase we detected expression of endogenous Survivin 2α pro- cells (Figure 3A). In cells undergoing mitosis, survivin 2α tein in HeLa cells, suggesting that the transcript is trans- was confined to the cytoplasmic compartment (Figure lated (Figure 1D). 3B). Interestingly, when co-expressed with survivin, sur- vivin 2α co-localized with survivin to the centromeres of Functional Properties of Survivin 2α the chromosomes in prometaphase (Figure 3C) and To characterize a function for Survivin 2α, we transfected metaphase (Figure 3D), and at the midbody during late Daoy cells with Survivin 2α and a combination of Sur- telophase/cytokinesis (Figure 3E). Moreover, the normal vivin 2α and Survivin. To induce apoptosis in the Daoy cytoplasmic localization of survivin shifted to the nucleus cells, we treated them with 2 µM of the chemotherapeutic in interphase cells. This data suggests a direct interaction agent vincristine. Vincristine is a vinca alkaloid that binds between the two proteins, as well as a potential to tubulin, inhibiting microtubule polymerization. It kills mechanism for the attenuation of survivin's anti-apop- Daoy cells in culture by PCD. We analyzed early apoptotic totic activity by survivin 2α. events in vincristine-treated transfected cells by Annexin V staining. Survivin 2α antagonized the anti-apoptotic effect Survivin 2α physically interacts with survivin of Survivin in co-transfection assays with or without a cell To further investigate the possibility that survivin 2α inter- death stimulus (not shown and Figure 2A). As inhibition acts with survivin we performed co-immunoprecipitation of apoptosis by Survivin involves activation of the caspase experiments. We co-transfected HeLa cells with constructs pathway [20], we assayed Survivin 2α transfected cells for encoding a Flag-survivin fusion protein and a myc-sur- caspase 3 activation. Caspase-3 was strongly activated in vivin 2α fusion protein. We used a Flag antibody to pre- vector control and Survivin 2α transfected cells in the cipitate protein complexes, and a myc antibody to detect presence of vincristine. Much lower levels of caspase-3 myc-tagged survivin 2α. We detected survivin 2α-myc in activation were observed in Survivin-transfected cells (Fig- the complexes precipitated with the Flag antibody, sub- ure 2B). In the absence of an apoptotic stimulus we stantiating a physical interaction of survivin with survivin observed a 35% increase of caspase-3 activity in Survivin 2α (Figure 4). 2α cells, as well as a 46% increase in early apoptosis, as assessed by Annexin V staining. We also performed elec- Conclusion tron microscopy analysis of Survivin 2α transfected and We characterized a novel survivin splice variant that we non-transfected cells. We sorted transfected cells from designated survivin 2α. We hypothesize that survivin 2α non-transfected cells by FACS based on GFP fluorescence, can alter the anti-apoptotic functions of survivin in malig- and processed each population for EM analysis (Figure nant cells. Thus, survivin 2α may be useful as a 2C). Overall, there was a 43% increase in incidence of therapeutic tool in sensitizing chemoresistant tumor cells apoptosis in Survivin 2α-expressing cells versus non- to chemotherapy. expressing cells. Our results suggest that Survivin 2α can attenuate survivin's anti-apoptotic activity and sensitize Methods tumor cells to chemotherapy. These findings have Patient samples important therapeutic implications in the treatment of Seven fresh frozen primary medulloblastoma tumor sam- chemoresistant tumors. ples were obtained from the Cooperative Human Tumor Network (CHTN), after approval through the Columbus Children's Hospital IRB. Page 4 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 3.5 2.5 1.5 Control 0.5 Vector Survivin Survivin 2α Survivin Survivin 2α 5.E+05 5.E+05 4.E+05 4.E+05 3.E+05 3.E+05 2.E+05 Survivin 2αααα 2.E+05 1.E+05 5.E+04 0.E+00 Vector Survivin 2α Survivin + + VCR VCR VCR E Figure 2 arly apoptosis in tumor cells transfected with survivin and survivin 2α Early apoptosis in tumor cells transfected with survivin and survivin 2α. A: Daoy cells were transiently transfected with control vector, survivin, survivin 2α, or a combination of survivin and survivin 2α. Apoptosis was measured using Annexin V/PI staining 24 hours after transfection, in the absence of a cell death stimulus. The results are shown relative to empty vector control. Error bars represent standard deviations from triplicate experiments. Results were adjusted for transfection efficiency based on parallel transfection with a GFP-expressing plasmid. B: Daoy cells were transiently transfected with control, survivin or sur- vivin 2α. Apoptosis was measured by Caspase-3 activity following treatment with vincristine. C: HeLa cells were transiently transfected with control or GFP-tagged survivin 2α. Electron Microscopy analysis of transfected cells shows a representative cell undergoing apoptosis as induced by survivin 2α. Images were taken 12,000× magnification and scale bars are shown. Sequencing fusion with the C-terminal GFP tag. The start codon in IMAGE clone 1631662 (Invitrogen) was sequenced using both constructs corresponds to the naturally occurring primers that flanked the multiple-cloning-site. start codon in the cDNA transcript. The resulting clones were confirmed by sequencing. Plasmids and Cloning Cell Culture and Transfection The cDNA for survivin 2α was amplified from the EST clone (Invitrogen) and cloned into the KpnI-BamHI sites HeLa (cervical adenocarcinoma), Daoy (medulloblast- of pcDNA4/TO/myc-HisB (Invitrogen) generating an in- oma), Jurkat (acute lymphoblastic leukemia) and MCF-7 frame fusion with the C-terminal myc-tag, or into the (breast adenocarcinoma) cells (ATCC) were grown in KpnI-BamHI sites of pEGFP-N3 generating an in-frame DMEM supplemented with 10% FBS at 37°C, 5% CO ; Page 5 of 9 (page number not for citation purposes) Apoptosis relative to Vector control RLU/10 seconds/2,000 cells Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 GFP-Survivin 2αα + αα + + + + + HcRed-Survivin - - + ++ + AB C D E F A1 B1 C1 D1 E1 F1 A2 B2 C2 D2 E2 F2 C3 D3 E3 F3 Figure 3 Confocal microscopy analysis of survivin 2α sub-cellular localization Confocal microscopy analysis of survivin 2α sub-cellular localization. HeLa cells were transfected with GFP-survivin 2α or HcRed survivin, as detailed on the top of the figure. Green pixels correspond to GFP expression, red pixels correspond to HcRed expression and blue pixels represent DNA labeled with Hoechst dye. When co-localization of GFP and HcRed occurs the pixels are yellow. A: Expression of survivin 2α at interphase localizes to nuclear and cytoplasmic structures. B: During M- phase survivin 2α is excluded from the condensed/dividing chromosomes and is localized in the cytoplasm of the dividing cell. C, D, E, F: When co-expressed with survivin, survivin 2α localization does not change at interphase. During M-phase survivin 2α co-localizes with survivin to the centromeres of the dividing chromosomes (D and E), and in the midbody region at cytoki- nesis (F). Scale bar = 5 µm U2OS osteosarcoma cells (kindly donated by Dr. Greg with 100 ng/ml cholera toxin (Sigma Aldrich) at 37°C, Otterson) were grown in McCoy's 5A medium 5% CO . supplemented with 10% FBS at 37°C, 5% CO ; RH28 (alveolar rhabdomyosarcoma, kindly donated by Dr. Transient transfections were performed using Effectene Steve Qualman) and A549 (lung carcinoma) (ATCC) were transfection reagent (Qiagen) at a DNA: Effectene ratio of grown in RPMI1640 supplemented with 10% FBS at 1:10. 37°C, 5% CO . MCF10-A, a non-transformed breast cell line (ATCC) was grown in MEGM, Mammary Epithelial Drug Treatment Growth Medium, Serum-free, (Clonetics) supplemented Induction of apoptosis by vincristine was done by treat- ment of cells with complete growth medium supple- Page 6 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Survivin 2α ++ Flag-survivin ++ Survivin 2α-myc Anti-Flag M2 - + Co-immunoprecipita Figure 4 tion of survivin-survivin 2α Co-immunoprecipitation of survivin-survivin 2α. HeLa cells were transfected with constructs encoding tagged forms of survivin (Flag) and survivin 2α (myc). Lysates from transfected cells were subjected to immunoprecipitation with an antibody against the Flag epitope. The resulting immunoprecipitated complexes were resolved by SDS-PAGE and subjected to Western blotting. The membrane was immunoprobed with an antibody against the myc epitope tag. Survivin 2α-myc is clearly visualized in lysates precipitated with a Flag antibody. mented with vincristine sulfate at a final concentration of 6FAM AGATTTGAGTTGCAAAGACACTTAGTAT- 2 µM. GGGAGGG TAMRA RNA isolation and Real Time PCR Apoptosis Assays RNA was isolated from 10 proliferating cells or frozen Two apoptosis assays were performed: Caspase-3 assay tumor tissue using TriZol reagent (Invitrogen) as recom- and Annexin-V FLUOS. For caspase assays 2,000 cells mended by the supplier. Poly(A) RNA was purified using from each experimental condition were subjected to the Oligotex dT kit (Qiagen). 100 ng of poly(A) purified RNA caspase-3 assay, Caspase 3/7 GLO (Promega) and ana- was used as a template in a reverse transcription reaction lyzed on a Victor3 plate reader (Applied Biosystems). using random hexamers and Omniscript Reverse tran- Experiments were performed in triplicate. scriptase (Qiagen) and performed according to manufac- turer's instructions. Quantitative real-time PCR reactions Annexin V/propidium iodide staining was carried out using Taqman probes (FAM/TAMRA) were run in tripli- using the Roche Annexin-V-Fluos Staining Kit following cate on an ABI Prism 7700 Real-time PCR machine the manufacturer's instructions. Fluorescein and propid- (Applied Biosystems). Control GAPDH reactions ium iodide fluorescence measured with a Coulter EPICS (Applied Biosystems) were run to normalize ∆Ct values. XL flow cytometer. Experiments were performed in Relative change was calculated by the comparative C triplicate. (-∆∆Ct) method, 2 . The survivin 2α specific primers consist of: Forward 5'GCTTTGTTTTGAACTGAGTTGTCAA; Reverse 5'GCAATGAGGGTGGAAAGCA; and Probe: Page 7 of 9 (page number not for citation purposes) Control IP Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 Microscopy Authors' contributions Proliferating HeLa cells, grown on glass coverslips, were HC performed bioinformatic analysis, subcellular locali- transiently transfected with a GFP-tagged survivin 2α zation, functional studies, co-immunoprecipitation and expression construct or co-transfected with GFP-tagged drafted the manuscript. LH performed quantitative real survivin 2α and HcRed-tagged survivin. 24 hours post- time PCR in cell lines and primary tumors. RA conceived transfection the cells were fixed in 4% paraformaldehyde the study and participated in its design and coordination, and stained with 50 µg/ml Hoechst dye. Cells were ana- and was responsible for overseeing the final version of the lyzed on a Zeiss LSM510 META confocal microscope, manuscript. All authors have read and approved the final using a 63x PlanApochromat objective. For electron manuscript. microscopy analysis, proliferating HeLa cells were trans- fected with GFP-tagged survivin 2α construct for 12 hours. Acknowledgements We would like to thank M. Holloway and J. Fangusaro for general technical The cells were aseptically sorted by FACS based on green assistance, C. McAllister for assistance with FACS and EM and G. Otterson fluorescence from GFP-survivin 2α for positive and nega- and S. Qualman for kindly donating cell lines. We are grateful to Dr tive populations. This was done in order to separate an Heithem El-Hodiri for critically reviewing this manuscript. This work was enriched population that consisted of >90% GFP express- supported by the Elsa U. Pardee Foundation and by the Hope Street Kids ing cells. 10 cells for each condition were fixed in 2.5% Foundation. gluteraldehyde for 24 hours and processed for EM. For cell analysis, 10 to 12 fields containing 8–10 cells per field at References a magnification of 3500× were used. At least 100 cells 1. Wagner KD, Wagner N, Schedl A: The complex life of WT1. J Cell Sci 2003, 116:1653-1658. were counted for each experimental condition and 2. Fridman JS, Hernando E, Hemann MT, de Stanchina E, Cordon-Cardo assigned to categories of healthy or dying based on their C, Lowe SW: Tumor promotion by Mdm2 splice variants una- morphological appearance, including nuclear integrity. ble to bind p53. Cancer Res 2003, 63:5703-5706. 3. Bodescot M, Brison O: Characterization of new human c-myc Image collection was performed on a Hitachi H-600 trans- mRNA species produced by alternative splicing. Gene 1996, mission electron microscope equipped with a GATAN 174:115-120. 4. Ambrosini G, Adida C, Altieri DC: A novel anti-apoptosis gene, image acquisition system. survivin, expressed in cancer and lymphoma. Nat Med 1997, 3:917-921. Co-Immunoprecipitation 5. LaCasse EC, Baird S, Korneluk RG, MacKenzie AE: The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Onco- HeLa cells transfected with Flag-survivin and survivin-2α gene 1998, 17:3247-3259. myc were collected in Cell Lysis Buffer (100 mM Tris-HCl 6. Badran A, Yoshida A, Ishikawa K, Goi T, Yamaguchi A, Ueda T, Inu- zuka M: Identification of a novel splice variant of the human pH8.0, 100 mM NaCl, 0.5% Triton X-100, 0.2 µM PMSF) anti-apoptopsis gene survivin. Biochem Biophys Res Commun 2004, and incubated at 4°C for 30 min. The cell lysate was clar- 314:902-907. ified by centrifugation and the clarified supernatant dis- 7. Mahotka C, Wenzel M, Springer E, Gabbert HE, Gerharz CD: Sur- vivin-deltaEx3 and survivin-2B: two novel splice variants of solved 1:5 in Co-IP buffer (50 mM Tris-HCl pH7.5, 15 the apoptosis inhibitor survivin with different antiapoptotic mM EGTA, 100 mM NaCl, 0.1% Triton X-100, 1x protease properties. Cancer Res 1999, 59:6097-6102. inhibitors cocktail, 1 mM DTT, 1 mM PMSF). The equiva- 8. Conway EM, Pollefeyt S, Cornelissen J, DeBaere I, Steiner-Mosonyi M, Ong K, Baens M, Collen D, Schuh AC: Three differentially lent of 400 µg of lysate total protein was incubated with 2 expressed survivin cDNA variants encode proteins with dis- µg of anti-Flag M2 antibody at 4°C for 1 h with constant tinct antiapoptotic functions. Blood 2000, 95:1435-1442. 9. Carvalho A, Carmena M, Sambade C, Earnshaw WC, Wheatley SP: rotation. As a control the same amount of lysate protein Survivin is required for stable checkpoint activation in taxol- was incubated in the absence of antibody. Fifty microliters treated HeLa cells. J Cell Sci 2003, 116:2987-2998. of agarose-conjugated protein A (Invitrogen) were added 10. Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC: Anti-apoptosis gene, survivin, and prognosis of and the mixture incubated for a further hour in the same neuroblastoma. Lancet 1998, 351:882-883. conditions. The protein-antibody-protein A complexes 11. Zhu N, Gu L, Findley HW, Li F, Zhou M: An alternatively spliced survivin variant is positively regulated by p53 and sensitizes were pulled down by centrifugation and subjected to 3 leukemia cells to chemotherapy. Oncogene 2004, 23:7545-7551. washes with co-IP buffer. The proteins were analyzed 12. Muchmore SW, Chen J, Jakob C, Zakula D, Matayoshi ED, Wu W, through electrophoretic separation in a 20% SDS-PAGE, Zhang H, Li F, Ng SC, Altieri DC: Crystal structure and muta- genic analysis of the inhibitor-of-apoptosis protein survivin. electroblotted onto nitrocellulose and immunoprobed Mol Cell 2000, 6:173-182. with an antibody against myc-tag. Detection was per- 13. Skoufias DA, Mollinari C, Lacroix FB, Margolis RL: Human survivin formed using the ECL kit (Amersham). Protein standards is a kinetochore-associated passenger protein. J Cell Biol 2000, 151:1575-1582. were used for size determination. 14. Ambrosini G, Adida C, Sirugo G, Altieri DC: Induction of apopto- sis and inhibition of cell proliferation by survivin gene Bioinformatics targeting. J Biol Chem 1998, 273:11177-11182. 15. Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J, Altieri DC: Subcellular localization predicted by PSORTII program. Developmentally regulated expression of the novel cancer Coiled-Coil domain predicted by Coils and PairCoil anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol 1998, 152:43-49. programs 16. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL, Choo KH: Survivin and the inner centromere protein Page 8 of 9 (page number not for citation purposes) Molecular Cancer 2005, 4:11 http://www.molecular-cancer.com/content/4/1/11 INCENP show similar cell-cycle localization and gene knock- out phenotype. Curr Biol 2000, 10:1319-1328. 17. Conway EM, Pollefeyt S, Steiner-Mosonyi M, Luo W, Devriese A, Lupu F, Bono F, Leducq N, Dol F, Schaeffer P, Collen D, Herbert JM: Deficiency of survivin in transgenic mice exacerbates Fas- induced apoptosis via mitochondrial pathways. Gastroenterol- ogy 2002, 123:619-631. 18. Fukuda S, Foster RG, Porter SB, Pelus LM: The antiapoptosis pro- tein survivin is associated with cell cycle entry of normal cord blood CD34(+) cells and modulates cell cycle and pro- liferation of mouse hematopoietic progenitor cells. Blood 2002, 100:2463-2471. 19. Altura RA, Olshefski RS, Jiang Y, Boue DR: Nuclear expression of Survivin in paediatric ependymomas and choroid plexus tumours correlates with morphologic tumour grade. Br J Cancer 2003, 89:1743-1749. 20. Dohi T, Beltrami E, Wall NR, Plescia J, Altieri DC: Mitochondrial survivin inhibits apoptosis and promotes tumorigenesis. J Clin Invest 2004, 114:1117-1127. Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 9 of 9 (page number not for citation purposes)

Journal

Molecular Cancer – Springer Journals

Published: Mar 2, 2005

There are no references for this article.