Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The Intrinsic DNA Helicase Activity of Methanobacterium thermoautotrophicum ΔH Minichromosome Maintenance Protein

The Intrinsic DNA Helicase Activity of Methanobacterium thermoautotrophicum ΔH Minichromosome... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 20, Issue of May 19, pp. 15049 –15059, 2000 © 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Intrinsic DNA Helicase Activity of Methanobacterium thermoautotrophicum DH Minichromosome Maintenance Protein* Received for publication, January 19, 2000, and in revised form, February 21, 2000 Published, JBC Papers in Press, March 9, 2000, DOI 10.1074/jbc.M000398200 David F. Shechter‡, Carol Y. Ying‡§, and Jean Gautier¶ From the Department of Genetics and Development, the Department of Dermatology, and the ‡Integrated Program in Cellular, Molecular and Biophysical Studies, Columbia University, New York, New York 10032 Minichromosome maintenance proteins (MCMs) form been identified in all eukaryotes studied (reviewed in Refs. 10 –12). In yeast, all six proteins are essential, and null muta- a family of conserved molecules that are essential for initiation of DNA replication. All eukaryotes contain six tions in any of the six genes result in cell cycle arrest prior to orthologous MCM proteins that function as heteromul- the onset of DNA replication (4, 6, 9, 13–19). MCM proteins are timeric complexes. The sequencing of the complete ge- a component of the prereplicative complex whose activation is nomes of several archaebacteria has shown that MCM a prerequisite to DNA replication initiation (20) and requires proteins are also present in archaea. The archaea Meth- the ordered assembly of the origin recognition complex, Cdc6, anobacterium thermoautotrophicum contains a single MCM, and Cdc45 proteins on the chromatin. Experiments in MCM-related sequence. Here we report on the expres- Xenopus cell-free extracts using specific immunodepletions of sion and purification of the recombinant M. thermoau- origin recognition complex, Cdc6, or MCM proteins have dem- totrophicum MCM protein (MtMCM) in both Escherichia onstrated the sequential nature of these assembly steps where coli and baculovirus-infected cells. We show that puri- Cdc6 assembles on origin recognition complex-bound chroma- fied MtMCM protein assembles in large macromolecular tin, then allowing the loading of MCM proteins (21–23). complexes consistent in size with being double hexam- Experiments in a variety of model systems have indicated ers. We demonstrate that MtMCM contains helicase ac- that all six MCM subunits are present in MCM complexes, tivity that preferentially uses dATP and DNA-dependent suggesting that MCMs might exist as heterohexameric com- dATPase and ATPase activities. The intrinsic helicase plexes in the cell in a 1:1 stoichiometry (reviewed in Ref. 12). activity of MtMCM is abolished when a conserved lysine However, biochemical purification and extraction procedures in the helicase domain I/nucleotide binding site is mu- have also revealed the existence of subcomplexes within this tated. MtMCM helicase unwinds DNA duplexes in a 3* 3 hexameric complex consisting of a tightly bound core complex 5* direction and can unwind up to 500 base pairs in vitro. (MCM4, -6, and -7) more loosely associated with MCM2 and a The kinetics, processivity, and directionality of MtMCM second complex composed of MCM3 and -5 (24 –29). These support its role as a replicative helicase in M. thermo- autotrophicum. This strongly suggests that this function observations have raised the possibility that several MCM is conserved for MCM proteins in eukaryotes where a complexes with potentially different functions might co-exist in replicative helicase has yet to be identified. the cell. MCM proteins share extensive similarities within a central core domain. All MCM proteins contain a putative ATPase Minichromosome maintenance proteins (MCMs) were first domain within this core, which resembles that found in DNA identified independently through two different genetic screens helicases. In particular, the highly conserved Walker A and designed to isolate mutants that either lose the ability to rep- Walker B domains, which have been implicated in ATP binding licate a plasmid containing a single origin of replication (mcm and ATP hydrolysis, respectively, are found in all MCM pro- mutants) (1) or cell cycle mutants (cdc) that arrest at the G /S 1 teins (30). Walker A and B domains correspond to the con- border (cdc mutants) (2). served regions I and II of the helicase superfamily (31). A large number of genetic and biochemical experiments in A variety of observations have suggested that MCM proteins yeast, Drosophila, Xenopus, and mammals have demonstrated could function as a replicative helicase either during DNA that MCM proteins are essential for initiation of DNA replica- replication initiation or for both the initiation and elongation tion in eukaryotes (3–9). Six orthologous MCM proteins have steps. 1) Helicases are DNA-dependent NTPases, using the energy of hydrolysis to transiently unwind DNA. The Walker * This work was supported in part by American Cancer Society Grant domains are therefore key features of helicases (31). 2) Loading RPG-99-040-01-CCG (to J. G.). The costs of publication of this article MCM proteins onto the chromatin requires the Cdc6 loading were defrayed in part by the payment of page charges. This article must factor, because the loading of the bacterial DnaB helicase re- therefore be hereby marked “advertisement” in accordance with 18 quires DnaC (reviewed in Ref. 32). 3) MCM protein complexes U.S.C. Section 1734 solely to indicate this fact. purified from Schizosaccharomyces pombe exhibited ring- § Supported by a Cancer Biology Training Grant predoctoral fellowship. shaped structures when observed by electron microscopy. Some To whom correspondence should be addressed: Dept. of Genetics of these structures seemed to display a ringlike 6-fold symme- and Development, Columbia University, VC15-1526, 630 W. 168th St., try reminiscent of that observed with some DNA helicases (24). New York, NY 10032. Tel.: 212-305-9586; Fax: 212-305-7391; E-mail: 4) Purified MCM complexes composed of MCM4, MCM6, and [email protected]. The abbreviations used are: MCM, minichromosome maintenance MCM7 contained weak helicase activity in vitro, restricted to protein; MtMCM, M. thermoautotrophicum MCM protein; ORF, open the unwinding of very short oligonucleotides (33, 34). On the reading frame; PCR, polymerase chain reaction; PAGE, polyacrylamide other hand, the hexameric MCM complex purified from S. gel electrophoresis; ssDNA, single-stranded DNA; dsDNA, double- pombe did not exhibit any helicase activity (24). In addition, the stranded DNA; ATPgS, adenosine 59-O-(thiotriphosphate); AMPPNP, 59-adenylyl-b,g-imidodiphosphate. MCM2 subunit has been reported to display inhibitory activity This paper is available on line at http://www.jbc.org 15049 This is an Open Access article under the CC BY license. 15050 Helicase Activity of the MCM Protein in vitro toward the helicase activity of the MCM4, -6, and -7 ing double hexamers. We demonstrate that MtMCM is a DNA complex (35). helicase that preferentially uses dATP and that nucleotide Studies on the localization of MCM proteins during the proc- binding is essential for activity. We also show that MtMCM is ess of replication have also provided conflicting data. Chroma- a DNA-dependent dATPase and ATPase. MtMCM works cata- lytically to unwind DNA duplexes in a 393 59 direction and can tin precipitation studies in budding yeast supported the idea that some MCM proteins move along the replication fork as unwind up to 500 base pairs in vitro. The kinetics, processivity, and directionality of the enzymatic activity all support the idea DNA replication proceeds, suggesting that if MCM proteins are that MtMCM can work as a replicative helicase. a helicase they could be involved in an initial unwinding step as well as during elongation (36, 37). Immunofluorescence studies EXPERIMENTAL PROCEDURES in other organisms, however, have indicated that MCM pro- Nucleotides, Oligonucleotides, and Other Reagents—[a- P]dATP teins do not colocalize with the sites of incorporation of nucle- (3000 Ci/mmol) and [g- P]ATP (6000 Ci/mmol) were purchased from otides during replication, suggesting that the role of MCM Amersham Pharmacia Biotech. dNTPs and ATP were from APBiotech, proteins might be restricted to an initiation event (38 – 40). while the other nucleotides were from Roche Molecular Biochemicals. Helicases are enzymes that unwind the nucleic acid duplex Oligonucleotides were purchased from Sigma Genosys. T4 polynucle- and are essential for many cellular processes such as replica- otide kinase was from New England Biolabs, and the Klenow enzyme was from Roche Molecular Biochemicals. tion, repair, or transcription. They can process the unwinding Cloning of M. thermoautotrophicum MCM—MtMCM was cloned of DNA with specific directionality and are referred as 39 3 59 from M. thermoautotrophicum genomic DNA (a generous gift of Dr. or 593 39 helicases. Helicases are generally oligomeric, usually Reeve). To facilitate purification of MtMCM protein, sequences encod- dimers or hexamers. It has been demonstrated that several of ing a 6-histidine tag were added to the C terminus of the MtMCM gene the helicases implicated in DNA replication such as SV40 or by PCR. The MtMCM gene was amplified by PCR using Vent DNA polyoma T antigen have a hexameric structure (41, 42). The polymerase (New England Biolabs) with CCCCTCTAGAAAACCTATA- AATCATATGATGAAAACCGTGGATAAGAGC as the 59 primer (the crystal structure of the replicative hexameric T7 DNA helicase engineered XbaI and NdeI restriction sites, respectively, are under- protein 4 was recently solved, suggesting that progression lined) and GGGGCTCGAGTTAGTGATGGTGATGGTGATGCAGACT- along the DNA leading to the unwinding of the duplex used a ATCTTAAGGTATCCC as the 39 primer (XhoI site is underlined). The corkscrew-like inchworm mechanism (43). The directionality of PCR product was subcloned into the XbaI and XhoI sites of the bacu- the helicase is not conferred by the dimeric or hexameric struc- lovirus expression vector pFASTBAC (Life Technologies, Inc.) and se- quenced using an Applied Biosystem Automated Sequencer. Subse- ture, since both specificities have been described with each type quently, MtMCM was subcloned into the NdeI and XhoI sites of the E. of structure (reviewed in Ref. 44). Despite the presence of a coli expression vector pET21b (Novagen). MtMCM recombinant bacu- large number of putative helicase sequences in the eukaryotic lovirus was generated based on the BAC-TO-BAC Baculovirus Expres- genome (134 putative helicase sequences have been identified sion System (Life Technologies, Inc.). in S. cerevisiae), no replicative helicase has yet been identified MtMCM was mutated at lysine 325 to alanine by PCR using Vent in eukaryotes (45). DNA polymerase (NEB) with GGGCGGCCCAGCAGGCCATAA as the 59 primer (the SfiI site is underlined) and GCGCGGTACCCTTACCG- The complete sequence of an archaebacterium genome CTGGTGTATATCCCCCTGGGGGCCAGCTTTGAGACGTACTTGAG- (Methanobacterium thermoautotrophicum) revealed that ar- CATCTGTGACGCACCGATACCGGGGTCCCC as the 39 primer (the chaea contained putative open reading frames sharing homol- KpnI site, the modified codon (lysine 3 alanine), and a silent mutation ogy with different components of the prereplicative complex, in the SmaI site are underlined, respectively). The PCR product was namely origin recognition complex, Cdc6, and MCM (46). Fur- subcloned back into the MtMCM-pET21b vector at the unique SfiI and thermore, putative origins of replication have been recently KpnI sites present in the MtMCM sequence. The mutation was detected by loss of the SmaI site and confirmed by sequencing. identified in archaea (47). In addition to the fact that archaea Expression and Purification of MtMCM Protein—For expression of possess homologues of most of the essential genes involved in MtMCM protein in E. coli, the pET21b vector containing the MtMCM DNA replication (48), this observation strengthened the idea gene was transformed into DE3(BL21)pLysS cells (Novagen) and grown that archaea possess features that are more closely related to from an overnight culture in 5.5 liters of LB medium containing 50 eukaryotic than prokaryotic DNA replication, supporting the mg/ml carbenicillin and 34 mg/ml chloramphenicol at 37 °C and 375 rpm. When the cells reached an A of 0.6, protein expression was hypothesis that the divergence between archaea and eu- induced by the addition of isopropyl-1-thio-b-D-galactopyranoside to 0.6 karyotes occurred later than the divergence between archaea mM. The cells were grown for an additional 3 h and harvested by and prokaryotes. The subsequent sequencing of other archaea centrifugation. The cells were resuspended in a small volume of 50 mM genomes confirmed these findings. Interestingly, two of the Tris-HCl, pH 7.5, 10% sucrose, and protease inhibitors (100 mg/ml archaea genomes sequenced (M. thermoautotrophicum and Ar- phenylmethylsulfonyl fluoride, 0.2 mg/ml aprotinin, 0.2 mg/ml leupep- chaeoglobus fulgidus) contained a single open reading frame tin) and frozen at 270 °C immediately. The cells were then thawed and sonicated on ice and spun in an SS34 rotor at 16,000 rpm for 15 min. related to MCM proteins (49), while Methanococcus jannaschii The supernatant was removed and precipitated with ammonium sul- contained four MCM-related sequences (50). Nothing is yet fate first at 20% and then at 45% saturation. The 45% pellet was known about the biochemical function of these MCM-related resuspended in and dialyzed overnight against 25 mM Tris-HCl, pH 7.8, proteins in archaea. In particular, it is not known whether they 50 mM NaCl, 10% glycerol, 5 mM imidazole, and protease inhibitors. might be involved in DNA replication. Following the increase of imidazole concentration to 50 mM, the protein As a step toward better understanding the biochemical role was loaded onto a pre-equilibrated 10-ml Ni -nitrilotriacetic acid- agarose (Qiagen) column and eluted with a 50 –300 mM imidazole gra- of MCM proteins and as an attempt to clarify some of the dient. The peak pool of protein was dialyzed overnight against 25 mM discrepancies regarding their possible biochemical function, we Tris-HCl, pH 7.8, 100 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 1 mM decided to take advantage of the presence of a single MCM EDTA, and protease inhibitors. This pool was then loaded onto a 10-ml protein in M. thermoautotrophicum, since it opened the possi- Source Q (APBiotech) column pre-equilibrated in the above buffer. The bility to test the biochemical function of this protein in a sim- column was washed with 3 volumes of buffer and then eluted with a 100-ml 100 – 450 mM NaCl gradient. The peak fractions were pooled, pler system where the potential inhibitory effect of other sub- and the protein concentration (2.0 mg/ml) was determined by an A units would not be relevant. measurement using the calculated extinction coefficient of 29,570 liters Here we report the expression and the purification of the M. 21 21 mol cm . thermoautotrophicum MCM-related ORF proteins from Esche- For eukaryotic expression of MtMCM protein, Sf9 insect cells (In- richia coli and baculovirus-infected cells. We show that the vitrogen) were infected with the recombinant baculovirus at a multi- purified protein multimerizes in complexes consistent with be- plicity of infection of 5 and harvested 96 h postinfection. The native Helicase Activity of the MCM Protein 15051 recombinant MtMCM protein in infected cell lysate was purified on a RESULTS Ni -nitrilotriacetic acid-agarose column and eluted with 350 mM im- M. thermoautotrophicum DH Contains a M Hepes-KOH, pH 7.4, 80 mM idazole and then dialyzed against 20 m Single MCM Homologue NaCl, 1 mM dithiothreitol. The protein concentration (0.5 mg/ml) was determined by the Bradford method (Bio-Rad) using bovine serum The complete sequence of M. thermoautotrophicum revealed albumin as a standard. the presence of one ORF (ORF 1770) that was similar to MCM For expression of K325A-MtMCM, the mutant vector was trans- protein sequences. When this ORF was compared with the formed and expressed in E. coli and purified as described for the wild entire protein data base using the BLAST software (51), it type, with the exception of the Source Q step. appeared that MtMCM was most closely related to the MCM4 Preparation of DNA Helicase Substrate—The substrate used in the branch of the MCM protein family (10, 12). Using the ClustalW standard DNA helicase reaction was prepared by annealing a 59-end- 1.8 alignment program (52), we have compared the MtMCM labeled 63-mer oligonucleotide (59-TGCCAAGCTTGCATGCCTGCAGG- protein sequence with the fission yeast Cdc21/MCM4 and Xe- TCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGT-39 (the nopus MCM4 sequences. This alignment is shown in Fig. 1. HincII site is underlined)) to M13mp18 single-stranded DNA (New MtMCM lacks the N-terminal region present in all the eukary- England Biochemicals). The oligonucleotide was labeled in a reaction (20 ml) containing 18 pmol of 63-mer, 13 polynucleotide kinase buffer otic proteins. MtMCM was found to be 35% identical with both mCi of [g- (New England Biochemicals), 20 P]ATP, and 15 units of T4 S. pombe and Xenopus laevis sequences over the aligned re- kinase for 30 min at 37 °C. The labeled oligonucleotide was separated gions lacking the N termini. Over the same region, the MtMCM from free nucleotide in a G-25 spin column (Roche Molecular Biochemi- protein was 49 and 48% similar to the S. pombe and X. laevis cals), and the specific activity of the labeled DNA was determined by sequences, respectively. The highest homology was found in the liquid scintillation counting (usually 1500 cpm/fmol). The helicase tem- core region of the proteins encompassing the putative nucleo- plate was prepared by annealing the oligonucleotide to M13 in the tide binding regions and ATPase motifs. Interestingly, the N- ml reaction volume containing 2 pmol of M13 following conditions: a 32- terminal region of eukaryotic MCM4 proteins contains putative DNA and 4 pmol of labeled oligonucleotide, 100 mM NaCl, 25 mM Tris-HCl, pH 7.8, and 15 mM MgCl consensus sites for phosphorylation by cyclin-dependent kinase . The reaction was layered with mineral oil, placed in a heat block at 100 °C, and then slowly cooled to (see Fig. 1) (12). These sites are absent from the MtMCM room temperature. The annealed substrate was separated from unan- protein. We have underlined the Walker A and Walker B do- nealed oligonucleotide via gel filtration through a 5-ml Biogel A-15M mains of the protein sequences, which also correspond to the M Tris-HCl, pH 7.8, and (Bio-Rad) column in a buffer containing 25 m conserved domains I and II (31) found in all known helicases 100 mM NaCl. Six-drop fractions were collected, and the peak fractions (Fig. 1). in the void volume were pooled. The yield of template was calculated using the specific activity of the oligonucleotide. Purification of MtMCM The template used to determine directionality was prepared by di- gesting the standard template with HincII, resulting in a linear, blunt- In order to determine the role of MtMCM, we isolated the ended template with a 38-nucleotide oligonucleotide annealed to the cDNA encoding for MtMCM from M. thermoautotrophicum 39-end of the M13 molecule and a 25-nucleotide P-labeled oligonucleo- genomic DNA (a generous gift from Dr. J. Reeve) and inserted tide annealed to the 59-end. Subsequently, the 39-end of the 38-mer was it into two different expression vectors as fusion proteins con- extended 2 nucleotides with the Klenow enzyme and [a- P]dATP, taining a C-terminal His tag (see “Experimental Procedures”). resulting in a linear template with short radiolabeled double-stranded The protein was expressed in E. coli and in insect cells using a regions at each end. baculovirus expression system. In both cases, the protein was ml) con- Helicase Assay—The standard helicase assay reaction (20 soluble and was purified under native conditions. Following a tained 25 mM Tris-HCl, pH 7.8, 2.5 mM dATP, 5 mM MgCl ,1mM three-step purification procedure (see “Experimental Proce- dithiothreitol, 200 mg/ml bovine serum albumin, and either 5 or 10 fmol dures”), the protein synthesized in E. coli migrated as a single of helicase substrate. For incubations at 60 °C, the reaction was incu- bated in a heated-top PCR machine (PE9600) in order to prevent evap- band with an apparent molecular mass of 75 kDa, consistent oration. The time course reactions were incubated layered with mineral with its predicted molecular mass of 76.5 kDa (Fig. 2A, left oil in a heat block. The reactions were incubated for 30 min and stopped panel). The identity of the protein was further confirmed by by the addition of 5 mlofa53 stop solution (final concentrations: 0.5% Western blotting detection using an anti-His tag antibody M EDTA, 0.5 mg/ml proteinase K, 20% Ficoll, and 0.01% SDS, 40 m (data not shown and Fig. 3B). We also expressed MtMCM in E. bromphenol blue) and then run on a 10% polyacrylamide TBE gel coli in which the conserved lysine within the Walker A domain containing 0.1% SDS at a constant voltage of 150 V, soaked in 20% was replaced by an alanine, referred to as K325A-MtMCM (see trichloroacetic acid, and exposed to a PhosphorImager screen (Molecu- “Experimental Procedures” and Fig. 1). The Coomassie stain of lar Dynamics). The reaction products were quantitated, and any free the SDS-PAGE of the three proteins is shown in Fig. 2A.No oligo in the absence of enzyme was subtracted. ml) con- other bands were detected on the gels. MtMCM protein ex- dATPase/ATPase Assay—The standard assay reaction (10 tained 25 mM Tris-HCl, pH 7.8, 100 mM dATP, 5 nM [a- P]dATP, 5 mM pressed from insect cells migrated as a doublet in which both MgCl, 1 mM dithiothreitol, and 200 mg/ml bovine serum albumin. Incu- polypeptides contained the His tag, since they were both rec- bations were performed as described for the helicase assay and stopped ognized by an anti-His tag antibody (data not shown). mlof0.5 M EDTA. The reaction products (NTP, NDP, by the addition of 1 P ) were separated by running 1 ml of the reaction on a polyethylenei- MtMCM Protein Contains Intrinsic Helicase Activity That M acetic acid and 0.8 mine-cellulose TLC plate (Selecto Scientific) in 0.8 Requires an Intact Nucleotide-binding Domain M lithium chloride. The plate was air-dried and exposed to a Phospho- a- MCM proteins have been proposed to function as helicases rImager for imaging and quantification. Any background [ P]dADP released in the absence of enzyme was subtracted. The molar values during DNA replication. However, whether the helicase activ- ml of the reaction spotted on the were calculated by quantification of 1 ity was intrinsic to the MCM proteins in eukaryotes has been TLC plate after the run. somewhat controversial. In order to demonstrate unequivocally Gel Filtration/Size Analysis—A Superose 6 (APBiotech) column was that the MtMCM protein has an intrinsic helicase activity and equilibrated and run on an FPLC system in 25 mM Tris-HCl, pH 7.8, that this activity is not due to a contaminating activity, we 10% glycerol and the indicated salt or EDTA concentration. The column assayed the protein purified from both prokaryotic and eukary- was run at 0.4 ml/min at 4 °C. Injections were made in a volume of 200 otic expression systems. By assaying for helicase activity in ml. Fractions (14 drops, about 385– 400 ml) were collected after 7 ml had both baculovirus and E. coli expressed MtMCM, we ruled out flowed through the column after injection of the sample. Gel filtration the argument that the helicase activity is due to a contaminat- markers (Bio-Rad), when indicated, were run in the same buffer condi- tions as the experiment. ing activity that copurifies with the protein. Furthermore, we 15052 Helicase Activity of the MCM Protein FIG.1. Multiple sequence alignment of MtMCM, SpMCM4, and XlMCM4 proteins. M. thermoautotrophicum DH ORF 1770 was translated and named MtMCM. A ClustalW 1.8 alignment was made with S. pombe Cdc21/MCM4 (SpMCM4) and with X. laevis MCM4 (XlMCM4). Black boxes, amino acid identities; gray boxes, amino acid similarities. The Walker A and Walker B domains of the nucleotide binding region are underlined in black. The position of the lysine that was mutated to an alanine (K325A) is indicated above the MtMCM sequence. Asterisks indicate the positions of cyclin-dependent kinase putative phosphorylation sites in the yeast and Xenopus sequences. MtMCM Proteins Assemble into Large Complexes That introduced a lysine to alanine point mutation in the MtMCM protein within the Walker A domain (K325A-MtMCM). All Contain the Helicase Activity Walker A domains contain a conserved lysine shown to be Eukaryotic MCM proteins have been shown to assemble into essential for nucleotide binding. large multimeric complexes. In order to assess the size of the We then assayed the three different purified proteins shown MtMCM proteins purified under native conditions, we used in Fig. 2A for DNA helicase activity. In this assay, a radiola- nondenaturing gradient gel electrophoresis (Fig. 3A), a method beled 63-mer oligonucleotide was annealed to single-stranded that proved to be very valuable to resolve MCM protein com- M13 DNA, and the helicase activity was measured by the plexes (53, 54), or gel filtration followed by SDS-PAGE (Fig. ability to melt or unwind the labeled oligonucleotide from M13 3C). With either method, all of the purified MtMCM was de- circular DNA (see “Experimental Procedures”). Both wild-type termined to exist as a large complex (Fig. 3). The estimated MtMCM proteins, expressed in either E. coli or in baculovirus- molecular mass of this complex was determined to be 900 –950 infected cells, displayed DNA helicase activity, while no heli- kDa following nondenaturing gel electrophoresis or gel filtra- case activity was detected in the K325A-MtMCM protein (Fig. tion. This size is consistent with MtMCM forming a dodecamer 2B). This demonstrates unambiguously that the helicase activ- that would have a predicted mass of 918 kDa. Both the bacu- ity was indeed intrinsic to MtMCM protein and not due to a lovirus and E. coli expressed MtMCM protein assembled into contaminating protein co-purifying with MtMCM. Further- more, these data indicate that this is a Walker A type helicase, complexes of similar size (Fig. 3B). The K325A-MtMCM protein requiring a nucleotide triphosphate for activity. also assembled into complexes of similar size (Fig. 3, C and F). Helicase Activity of the MCM Protein 15053 stimulated dATPase (Fig. 4C) activities (see “Experimental procedures”). The peak of helicase and dATPase activities pri- marily coincided with the protein elution profile of the MtMCM protein complex, in fractions 10 –18. In this experiment, we analyzed the ability of MtMCM to displace a P-labeled 63- mer labeled oligonucleotide from an M13 ssDNA circle. DNA- stimulated ATPase activity also coincided with the protein profile of MtMCM (data not shown). Biochemical Properties of the MtMCM Helicase Nucleotide Requirements—All helicases contain a conserved nucleotide-binding motif. Helicase-mediated DNA unwinding might require both nucleotide binding and hydrolysis. We tested the helicase activity of the MtMCM protein in the pres- ence of a variety of nucleotides and nucleotide analogues. As shown in Fig. 5, only ATP and dATP were able to efficiently support DNA helicase activity catalyzed by MtMCM. All other nucleotides and deoxynucleotides tested were not efficient co- factors. Interestingly, the MtMCM DNA helicase activity was abolished in the presence of AMPPNP and was greatly dimin- ished but not completely abolished in the presence of ATPgS, suggesting that both ATP binding and hydrolysis are required for the unwinding reaction. We found that dATP worked more efficiently than ATP in our helicase assays (Fig. 5); therefore, most of the experiments presented were carried out using dATP. No ATPase activity was detected in K325A-MtMCM (data not shown), which also lacked detectable helicase activity. Enzyme Titration and Kinetics—We then determined the minimal concentration of enzyme sufficient for unwinding ac- tivity by titrating down the amount of MtMCM protein at given concentrations of dATP (2.5 mM) and oligonucleotide substrate (0.25 nM). The helicase activity was found to be mostly linear over the range of 0.5–35 nM (Fig. 6, A and B). Since M. thermoautotrophicum is a thermophilic microorgan- ism with an optimal growth temperature of 65 °C (55), we examined the kinetics of helicase activity at different temper- atures. Using a 63-mer oligonucleotide annealed to M13, we FIG.2. MtMCM protein purification and helicase activity. Mt- determined the kinetics of DNA unwinding at 21, 37, and 60 °C MCM protein was overexpressed in and purified from both E. coli and for a given amount of enzyme (26.5 nM). We used 60 °C as the baculovirus-infected insect cells. The K325A-MtMCM was overex- pressed in and purified from E. coli, as described under “Experimental highest temperature for helicase assays to circumvent possible Procedures.” A, Coomassie-stained SDS-PAGE gels showing the puri- thermal melting of the oligonucleotide at higher temperatures. fied proteins as indicated. B, the MtMCM proteins (40 ng each, 26.5 nM As seen in Fig. 6, C and D, a dramatic temperature effect was monomer) were assayed for helicase activity, as described under “Ex- observed with no melting occurring at 21 °C and a 7-fold lower perimental Procedures.” Helicase activity was measured by the ability of 40 ng of each protein (26.5 nM monomer) to melt a 63-mer oligonu- helicase activity seen at 37 °C compared with 60 °C. Interest- cleotide from single-stranded M13 (10 fmol (0.5 nM) template) in the ingly, a lag period with no unwinding was consistently ob- presence of 2.5 mM dATP and 5 mM MgCl for 30 min at 60 °C. served during the first minutes of the assay. DNA Requirements for NTPase—Our data show that Mt- The stability of this large complex was tested by flowing the MCM helicase activity requires nucleotide binding and hydrol- wild-type protein expressed in E. coli through a Superose 6 ysis that is DNA-dependent. We analyzed the DNA require- column in the presence of 125 mM NaCl, 750 mM NaCl, or 15 ment for this nucleotide hydrolysis. The data for dATPase mM EDTA. In all three conditions, the vast majority of the activity are shown in Fig. 7. Similar data were obtained for protein eluted as a complex of about 900 kDa, and no mono- ATP hydrolysis (data not shown). The quantification of dATP meric form of MtMCM was observed. In the presence of either released in the presence or in the absence of DNA was deter- 750 mM NaCl or 15 mM EDTA, we observed a slight shift toward mined. Although some weak dATPase activity was observed at the lower molecular mass that could be consistent with a frac- high MtMCM protein concentration in the absence of DNA tion of the dodecameric form dissociating into single hexamers (Fig. 7D), a 7-fold increase in dATPase was observed in the (Fig. 3, D and E). In these conditions, we did not observe the presence of either ssDNA or dsDNA (Fig. 7D). At low molarity dissociation of the complexes into monomeric MtMCM. Also, of enzyme (25 nM), in the linear range of activity, this difference these studies demonstrated that the absence of helicase activ- was even more dramatic (Fig. 7B). Both ssDNA and dsDNA ity in the K325A-MtMCM protein (Fig. 2B) was not due to the were found to be equally effective at stimulating the dATPase inability of the protein to form large molecular weight com- activity when assayed for its kinetics or in a titration assay. plexes, since K325A-MtMCM protein was found to exist exclu- Directionality—Two classes of DNA helicase have been de- sively as a complex of ;900 kDa (Fig. 3F). scribed that translocate either in the 59 3 39 direction, such as We next tested the fractions across the Superose-6 purifica- DnaB (56), or that translocate in the 39 3 59 direction, such as tion profile (Fig. 4A) for both helicase (Fig. 4B) and DNA- the hexameric SV40 large T antigen helicase (57). We deter- 15054 Helicase Activity of the MCM Protein FIG.3. MtMCM protein forms a stable high molecular weight complex. MtMCM protein was run on a native gradient polyacrylamide gel and through a Superose 6 gel filtration column in order to analyze its native conformation. A, the wild type protein was run through a native gradient (4 –29% polyacrylamide) gel in parallel with markers (thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), lactase dehydro- genase (140 kDa), and albumin (67 kDa)) and stained with Coomassie Blue. A semilog plot of the migration distance of the markers allowed for calculation of an approximate molecular mass for the complex of 900 –950 kDa. B, the wild type protein produced in E. coli and in insect cells was run through a native gradient gel and immunoblotted with an anti-His antibody. C, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 125 mM NaCl. Aliquots (20 ml) of the collected fractions were run on an SDS-PAGE gel and stained with Coomassie Blue, revealing a single peak of protein elution. Markers (thyroglobulin (670 kDa), g-globulin (158 kDa), ovalbumin (44 kDa), myoglobin (17 kDa), and vitamin B (1.35 kDa)) were run through the column in the same buffer conditions. A semilog plot of the elution peak of the markers based on the A profile allowed for calculation of an approximate molecular mass for the complex of 900 –950 kDa. D, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 750 mM NaCl. E, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 15 mM EDTA. F, 150 mg of K325A-MtMCM protein was injected onto a Superose 6 column equilibrated with 125 mM NaCl. C–F, the peak elution positions of the markers are noted with arrows above the gels. mined the directionality of the MtMCM helicase by using above, we have used synthetic oligonucleotides of various asymmetrical templates. In this experiment, a 59-labeled 63- lengths, up to 63-mer, that were efficiently melted by the Mt- mer oligonucleotide containing a blunt-end restriction site was MCM helicase. In order to estimate the maximum oligonucleo- annealed to M13. The annealed template was digested and tide length that could be processed by the enzyme, we prepared then labeled at its 39-end, giving rise to an asymmetrical tem- templates of variable length in which the labeled nucleotide plate containing both a 39-labeled and a 59-labeled oligonucleo- was extended by Klenow DNA polymerase. Our results showed tide of 40 and 25 nucleotides in length, respectively (see Fig. 8A that using 40 ng of enzyme, oligonucleotides of at least 500 base and “Experimental Procedures”). Fig. 8B shows that only the pairs were melted (Fig. 8C). This high processivity is compat- oligonucleotide labeled at its 59-end was melted, establishing ible with MtMCM being a replicative helicase. that the enzyme was moving in the 39 3 59 direction on the DISCUSSION translocating strand, assuming that MtMCM loads on the ssDNA side. In this report, we show that the single MCM protein from a Processivity—In a previous study using purified eukaryotic thermophilic microorganism has intrinsic helicase and DNA- MCM proteins, helicase activity was described as having very dependent NTPase activities and that the enzymatic activities low processivity and only unwinding oligonucleotides of 20-mer reside in a large multimeric complex. in length (33). We felt it was very important to establish the Sequence analysis of several archaea genomes has shown processivity of the MtMCM helicase to assess whether it could that they contain different numbers of MCM-related sequences act as a replicative helicase. In the experiments described (10, 12), with at least two species, M. thermoautotrophicum and Helicase Activity of the MCM Protein 15055 FIG.5. Properties of MtMCM helicase: nucleotide effects. The bar graph shows nucleotide energy requirements for MtMCM helicase activity. Each reaction contained 5 fmol of helicase substrate, 26.5 nM MCM monomer, and a 2.5 mM concentration of the indicated NTP. The activity is represented as the total amount of oligonucleotide melted from M13. The experiments using dATP and ATP were performed in triplicate. a prokaryotic or a eukaryotic expression system displayed he- licase activity that co-purified with the protein. In addition, we establish unambiguously that the helicase activity is intrinsic to the MtMCM protein by showing that a single amino acid mutation in the Walker A domain of the MtMCM protein com- pletely abolishes the MtMCM-associated helicase activity. This is in agreement with previous findings that MCM pro- teins, purified from mammalian cells, have associated helicase FIG.4. Co-elution of helicase and NTPase activity with the activity (33). However, the helicase activity of mammalian high molecular weight MtMCM complex on a Superose 6 col- MCM proteins exhibited properties different from the MtMCM umn. 150 mg of MtMCM protein was loaded onto a Superose-6 sizing helicase. Mammalian MCM proteins have been reported to column as described for Fig. 2C. A, every third fraction was run on an melt only short oligonucleotides (less than 30-mer), while we SDS-PAGE gel (20 ml aliquot) and stained with Coomassie. The Load lane contained 4 mg of MtMCM protein. The peak stained fractions show that MtMCM protein can melt oligonucleotides of at least coincided with the peak on the recorded A reading (not shown). B, 280 500 nucleotides in length. Additionally, MtMCM is able to every third fraction (1 ml) was subjected to a helicase assay (5 fmol of displace a 63-mer oligonucleotide when present at equimolar template), as described under “Experimental Procedures.” The Sub- ratio with the oligonucleotide (considering that MtMCM forms strate lane contained 5 fmol of the template without any added protein, incubated in the same conditions as the rest of the fractions. The Boiled hexamers or double hexamers), while the recombinant hexam- lane contained 5 fmol of template heated to 100 °C for 5 min. C, quan- eric MCM proteins from mammals were reported to melt a tification of the helicase (solid line) and dATPase (dotted line) assays 17-mer oligonucleotide only when present in a 40-fold molar shown along with the position of the peak elution of the molecular excess of hexamers to the oligonucleotide (34). weight markers, as determined by the A profile. We find that MtMCM helicase unwinds the DNA in the 39 3 59 direction, similarly to the mammalian MCM proteins. This is A. fulgidus, containing a single MCM ORF. In both cases this the directionality of SV40 large T antigen and polyoma PyV putative MCM protein is most closely related to the eukaryotic large T antigen, two viral hexameric DNA replicative helicases MCM4 protein (see Fig. 1 and data not shown). MCM4 is a (42, 57, 59). target for multiple cell cycle-regulated phosphorylation (53, The data presented in this report strongly support the idea 58), and all eukaryotic MCM4s contain multiple putative cyclin- that MtMCM could function as a replicative helicase because of dependent kinase phosphorylation sites clustered in the N- its high processivity and its catalytic properties. Two recent terminal region of the protein (Fig. 1 and data not shown). reports on the characterization of the MtMCM-associated he- Interestingly, none of the archaea sequences that we have licase activity (60, 61) describe observations that are generally analyzed (M. thermoautotrophicum, A. fulgidus, M. jannaschii, similar to those reported here (see below). In particular, our Aeropyrum pernix, and Sulfolobus solfataricus) contain cyclin- observation that MCM helicase can unwind up to 500 base dependent kinase phosphorylation sites. One interpretation of pairs is entirely consistent with it being a replicative helicase these observations is that during evolution MCM-dependent requiring such high processivity. DNA replication appeared before cell cycle regulation by cyclin- The fact that a single amino acid mutation in the conserved dependent kinases, since archaea do not contain cyclin-depend- lysine within the Walker A domain completely abolishes heli- ent kinases. case activity strongly suggests that nucleotide binding is es- MtMCM as a Replicative Helicase—The most important find- sential for helicase activity. The Walker A domain of the NT- ing in this report is that a single MCM protein contains intrin- Pase region has been shown to be important for nucleotide sic DNA helicase activity. This was demonstrated by showing binding in several enzymes (62– 65), while the B domain was that highly purified MtMCM protein overexpressed from either shown to be important for nucleotide hydrolysis by site-di- 15056 Helicase Activity of the MCM Protein FIG.6. Titration of MtMCM protein in the helicase assay and temperature effect upon the kinetics of MtMCM helicase activity. MtMCM protein was titrated in the helicase assay by serially diluting the protein in 3-fold steps from 167 ng/ml (110 nM) to 0.4 ng/ml (0.5 nM). 1 ml of each dilution was assayed for helicase activity in a volume of 20 ml with 10 fmol (0.25 nM) of the standard substrate for 30 min. A, helicase activity of the titrated protein. B, quantification of the helicase activity, performed in duplicate, plotted versus the concentration of the MtMCM monomer. C and D, the kinetics of MtMCM helicase activity was examined at three temperatures: 21, 37, and 60 °C. In each case, 85 fmol of helicase template (0.5 nM) and 344 ng of MtMCM (26.5 nM) were incubated in the standard reaction buffer in a volume of 170 ml. At the indicated times, a 20-ml sample was removed into 5 ml of the stop solution. C, the time course at the various temperatures, showing the melting of the oligonucleotide from the M13 ssDNA. The Substrate lane contained 10 fmol of template without any added enzyme incubated in the same conditions as the rest of the points. The Boiled lane contained 10 fmol of template heated to 100 °C for 5 min, fully denaturing the template. D, quantification of the helicase assays at 21 °C (l), 37 °C (ƒ), and 60 °C (f). rected mutagenesis or through structural studies (63– 65). In- also observe that MtMCM uses both ATP and dATP, with a terestingly, our analysis of nucleotide requirements for Mt- significant preference for dATP. Another helicase from calf MCM helicase activity suggests that nucleotide binding and thymus has also been shown to use dATP preferentially over nucleotide hydrolysis might play distinct functions. Indeed, the other nucleotides (66). helicase activity of the wild-type MtMCM protein was com- Mutation in the conserved Lysine residue in the Walker A pletely abolished in the presence of AMPPNP, a nonbinding domain of mouse MCM6 (34) resulted in a MCM complex with ATP analogue, while some low helicase activity was observed in residual helicase activity. In order to detect any possible resid- the presence of ATPgS, an ATP analogue that can bind but is ual helicase activity in K325A-MtMCM, we tested very high not hydrolyzed. This concurs with the previously proposed concentrations of protein (up to 300 nM) but never observed mechanism of helicase activity in which nucleotide binding helicase activity (data not shown). This difference might be due promotes first a conformational change followed by a subse- to the fact that in the mouse MCM complex both MCM4 and quent change associated with nucleotide hydrolysis (43). We MCM7 had intact Walker A domains that could account for the Helicase Activity of the MCM Protein 15057 FIG.7. DNA dependence of MtMCM dATPase activity. MtMCM protein was titrated in the dATPase assay by serially diluting the protein in 3-fold steps from 167 ng/ml (220 nM) to 0.4 ng/ml (1 nM). Each concentration was assayed in the presence of various DNAs: single-stranded M13mp18, double-stranded plasmid DNA, and a 63-mer oligonucleotide. A, dATPase activity of the titrated protein (1 ml) incubated in a 10-ml reaction volume in the presence of 31.25 ng of M13mp18, 5 ng of 63-mer, 31.25 ng of plasmid, or no DNA. B, quantification of the molar quantity of hydrolyzed dATP in the presence of M13 (l), 63-mer (f), plasmid (ƒ), or no DNA (L). C, time course of MtMCM dATPase activity. 120 ng of MtMCM protein (20 nM) was incubated in an 80-ml reaction volume, as described under “Experimental Procedures,” in the presence of 250 ng of M13mp18, 10 ng of 63-mer, 250 ng of plasmid, or no DNA. At the times indicated, 10-ml aliquots were removed to 1 ml of 0.5 M EDTA to stop the reaction. D, quantification of the molar quantity of hydrolyzed dATP in the presence of M13 (l), 63-mer (f), plasmid (ƒ), or no DNA (L). residual helicase activity. subset of the MCM proteins (33) display helicase activity in Our data strengthen the previous hypothesis that MCM pro- vitro (MCM4, -6, and -7), while MCM2 is inhibitory (35). In this teins are a helicase and could be a replicative helicase. The context, the essential in vitro function of MCM3 and MCM5 has current data on mammalian MCM proteins indicate that only a yet to be determined. 15058 Helicase Activity of the MCM Protein FIG.8. Directionality and processivity of the MtMCM helicase activity. MtMCM protein was assayed for directionality by the use of a modified template and for processivity by using an extended template. A, the directionality template was prepared as shown and as described under “Experimental Procedures.” B, the directionality template (5 fmol) was incubated at 60 °C in the absence of added protein (Substrate lane) and with the addition of 40 ng of MtMCM (26.5 nM monomer). The positions of the two possible melted products are indicated on the right. C, the standard template was extended with Klenow in the presence of all four dNTPs for the times indicated. Those progressively longer templates were used to assay MtMCM activity. The lanes labeled Substrate pool and Boiled were pools of these extended templates from the same experiment, incubated without protein and heated to 100 °C, respectively. MtMCM Complex Formation and Assembly—Another impor- template melted by the helicase (data not shown). tant observation is that all of the MtMCM protein assembles We have also observed by gel shift assay that MtMCM can into large oligomeric complexes. We did not observe the pres- directly bind to a 63-mer oligonucleotide when present in a ence of monomeric MtMCM following purification of the over- 3– 8-fold excess of the double hexameric form over the oligonu- expressed protein in insect cells or in bacteria. Additionally, cleotide (data not shown), suggesting that the interaction be- K325A-MtMCM was also found entirely in a complex. This tween the MtMCM complex and the DNA is a stable one, in differs from the work by Kelman et al. (60), who observed agreement with previous work showing the DNA binding abil- monomeric MtMCM. This discrepancy could be due to the po- ity of MCM proteins (33, 60). The assembly of the complex on sition of the His tag, which we positioned at the C terminus of the DNA is probably an essential step for the unwinding of the the protein as opposed to the N-terminal His tag used by DNA, since in addition to bringing the enzyme in contact with Kelman et al. (60). The other difference is that they purified the its substrate, the NTPase activity of the enzyme is stimulated. protein following its denaturation by urea, while we purified This stimulation might correspond to some conformational the native protein. changes in the complex. We show that both ssDNA and dsDNA Our observations of the molecular mass of the MtMCM com- equally stimulate the NTPase activity. Whether the stimula- plex in low salt conditions, using two different methods, show tion by dsDNA is due to single strand regions in the duplex that the protein is present in a dodecameric form, consistent arising at 60 °C or true stimulation by dsDNA remains to be with being double hexamers. These hexamers appear very sta- clarified. ble, since they do not dissociate in NaCl up to 750 mM NaCl. In Acknowledgment—We thank Dr. G. Freyer for helpful discussions addition, the stability of this oligomeric complex does not re- and comments on the manuscript. quire divalent cations, since it is stable in the presence of REFERENCES EDTA. However, we observe a slight broadening of the elution 1. Maine, G. T., Sinha, P., and Tye, B. K. (1984) Genetics 106, 365–385 peak of the complex in the presence of EDTA or high salt that 2. Hennessy, K. M., Lee, A., Chen, E., and Botstein, D. (1991) Genes Dev. 5, could reflect the transition of a fraction of the protein from a 958 –969 3. Chong, J. P., Mahbubani, H. M., Khoo, C. Y., and Blow, J. J. (1995) Nature 375, dodecameric or double hexamer form to a hexameric form. The 418 – 421 structure of the hexameric T7 helicase was recently solved, 4. Dalton, S., and Whitbread, L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, showing that the monomers arrange into a helical filament 2514 –2518 5. Feger, G., Vaessin, H., Su, T. T., Wolff, E., Jan, L. Y., and Jan, Y. N. (1995) resembling a ringlike structure when viewed along the axis of EMBO J. 14, 5387–5398 the filament (43). Although there is no information about the 6. Forsburg, S. L., and Nurse, P. (1994) J. Cell Sci. 107, 2779 –2788 7. Fujita, M., Kiyono, T., Hayashi, Y., and Ishibashi, M. (1996) Biochem. Biophys. possible structure of the MtMCM helicase, if it were such a Res. Commun. 219, 604 – 607 helical oligomeric filament, it is easy to imagine that it could 8. Madine, M. A., Khoo, C. Y., Mills, A. D., and Laskey, R. A. (1995) Nature 375, exist either as a single or a double hexamer moving along the 421– 424 9. Takahashi, K., Yamada, H., and Yanagida, M. (1994) Mol. Biol. Cell 5, DNA. 1145–1158 Several observations suggest that assembly and multimer- 10. Tye, B. K. (1999) Methods 18, 329 –334 11. Thommes, P., and Blow, J. J. (1997) Cancer Surv. 29, 75–90 ization of MtMCM are essential steps for activity. In time 12. Kearsey, S. E., and Labib, K. (1998) Biochim. Biophys. Acta 1398, 113–136 course experiments, we always observe a lag phase between the 13. Forsburg, S. L., Sherman, D. A., Ottilie, S., Yasuda, J. R., and Hodson, J. A. onset of the reaction and the actual detection of helicase activ- (1997) Genetics 147, 1025–1041 14. Gibson, S. I., Surosky, R. T., and Tye, B. K. (1990) Mol. Cell. Biol. 10, ity (Figs. 6D and 7D). This could reflect the necessity for dis- 5707–5720 assembly of a preformed complex and its reassembly around 15. Liang, D. T., Hodson, J. A., and Forsburg, S. L. (1999) J. Cell Sci. 112, 559 –567 16. Maiorano, D., Van Assendelft, G. B., and Kearsey, S. E. (1996) EMBO J. 15, the DNA. Additional support for this idea comes from compe- 861– 872 tition experiments in which we added unlabeled template along 17. Okishio, N., Adachi, Y., and Yanagida, M. (1996) J. Cell Sci. 109, 319 –326 with the labeled template either at the start of the helicase 18. Sherman, D. A., and Forsburg, S. L. (1998) Nucleic Acids Res. 26, 3955–3960 19. Yan, H., Gibson, S., and Tye, B. K. (1991) Genes Dev. 5, 944 –957 assay or 5 or 10 min following initiation of the assay. While 20. Diffley, J. F., Cocker, J. H., Dowell, S. J., and Rowley, A. (1994) Cell 78, adding an excess of unlabeled competitor template at 10 min 303–316 21. Carpenter, P. B., Mueller, P. R., and Dunphy, W. G. (1996) Nature 379, had little effect on the amount of labeled template melted by 357–360 the helicase, adding the competitor template at 5 or 0 min 22. Coleman, T. R., Carpenter, P. B., and Dunphy, W. G. (1996) Cell 87, 53– 63 resulted in up to an 80% reduction of the amount of labeled 23. Romanowski, P., Madine, M. A., Rowles, A., Blow, J. J., and Laskey, R. A. Helicase Activity of the MCM Protein 15059 (1996) Curr. Biol. 6, 1416 –1425 Bush, D., Reeve, J. N., et al. (1997) J. Bacteriol. 179, 7135–7155 24. Adachi, Y., Usukura, J., and Yanagida, M. (1997) Genes Cells 2, 467– 479 47. Lopez, P., Philippe, H., Myllykallio, H., and Forterre, P. (1999) Mol. Microbiol. 25. Kimura, H., Ohtomo, T., Yamaguchi, M., Ishii, A., and Sugimoto, K. (1996) 32, 883– 886 Genes Cells 1, 977–993 48. Edgell, D. R., and Doolittle, W. F. (1997) Cell 89, 995–998 26. Kubota, Y., Mimura, S., Nishimoto, S., Masuda, T., Nojima, H., and Takisawa, 49. Klenk, H. P., Clayton, R. A., Tomb, J. F., White, O., Nelson, K. E., Ketchum, H. (1997) EMBO J. 16, 3320 –3331 K. A., Dodson, R. J., Gwinn, M., Hickey, E. K., Peterson, J. D., Richardson, 27. Pasion, S. G., and Forsburg, S. L. (1999) Mol. Biol. Cell 10, 4043– 4057 D. L., Kerlavage, A. R., Graham, D. E., Kyrpides, N. C., Fleischmann, R. D., 28. Schulte, D., Richter, A., Burkhart, R., Musahl, C., and Knippers, R. (1996) Eur. Quackenbush, J., Lee, N. H., Sutton, G. G., Gill, S., Kirkness, E. F., Dough- J. Biochem. 235, 144 –151 erty, B. A., McKenney, K., Adams, M. D., Loftus, B., Venter, J. C., et al. 29. Thommes, P., Kubota, Y., Takisawa, H., and Blow, J. J. (1997) EMBO J. 16, (1997) Nature 390, 364 –370 3312–3319 50. Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., 30. Koonin, E. V. (1993) Nucleic Acids Res. 21, 2541–2547 Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, 31. Gorbalenya, A. E., and Koonin, E. V. (1993) Curr. Opin. Struct. Biol. 3, A. R., Dougherty, B. A., Tomb, J. F., Adams, M. D., Reich, C. I., Overbeek, 419 – 429 R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A., Scott, J. L., 32. Baker, T. A., and Bell, S. P. (1998) Cell 92, 295–305 Geoghagen, N. S. M., and Venter, J. C. (1996) Science 273, 1058 –1073 33. Ishimi, Y. (1997) J. Biol. Chem. 272, 24508 –24513 51. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. 34. You, Z., Komamura, Y., and Ishimi, Y. (1999) Mol. Cell. Biol. 19, 8003– 8015 Mol. Biol. 215, 403– 410 35. Ishimi, Y., Komamura, Y., You, Z., and Kimura, H. (1998) J. Biol. Chem. 273, 52. Higgins, D. G., Bleasby, A. J., and Fuchs, R. (1992) Comput. Appl. Biosci. 8, 8369 – 8375 189 –191 36. Aparicio, O. M., Weinstein, D. M., and Bell, S. P. (1997) Cell 91, 59–69 53. Hendrickson, M., Madine, M., Dalton, S., and Gautier, J. (1996) Proc. Natl. 37. Tanaka, T., Knapp, D., and Nasmyth, K. (1997) Cell 90, 649 – 660 Acad. Sci. U. S. A. 93, 12223–12228 38. Todorov, I. T., Attaran, A., and Kearsey, S. E. (1995) J. Cell Biol. 129, 54. Sible, J. C., Erikson, E., Hendrickson, M., Maller, J. L., and Gautier, J. (1998) 1433–1445 Curr. Biol. 8, 347–350 39. Romanowski, P., Madine, M. A., and Laskey, R. A. (1996) Proc. Natl. Acad. Sci. 55. Zeikus, J. G., and Wolfe, R. S. (1972) J. Bacteriol. 109, 707–715 U. S. A. 93, 10189 –10194 56. Lee, M. S., and Marians, K. J. (1989) J. Biol. Chem. 264, 14531–14542 40. Kimura, H., Nozaki, N., and Sugimoto, K. (1994) EMBO J. 13, 4311– 4320 57. Wang, E. H., and Prives, C. (1991) J. Biol. Chem. 266, 12668 –12675 41. Wang, E. H., and Prives, C. (1991) Virology 184, 399 – 403 58. Coue, M., Kearsey, S. E., and Mechali, M. (1996) EMBO J. 15, 1085–1097 42. Dean, F. B., Borowiec, J. A., Eki, T., and Hurwitz, J. (1992) J. Biol. Chem. 267, 59. Stahl, H., Droge, P., and Knippers, R. (1986) EMBO J. 5, 1939 –1944 14129 –14137 60. Kelman, Z., Lee, J. K., and Hurwitz, J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 43. Sawaya, M. R., Guo, S., Tabor, S., Richardson, C. C., and Ellenberger, T. (1999) 14783–14788 Cell 99, 167–177 61. Chong, J. P., Hayashi, M. K., Simon, M. N., Xum R. M., Stillman, B. (2000) 44. Bird, L. E., Subramanya, H. S., and Wigley, D. B. (1998) Curr. Opin. Struct. Proc. Natl. Acad. Sci. U. S. A. 97, 1530 –1535 Biol. 8, 14 –18 62. Haber, L. T., and Walker, G. C. (1991) EMBO J. 10, 2707–2715 45. Shiratori, A., Shibata, T., Arisawa, M., Hanaoka, F., Murakami, Y., and Eki, T. 63. Fry, D. C., Kuby, S. A., and Mildvan, A. S. (1986) Proc. Natl. Acad. Sci. U. S. A. (1999) Yeast 15, 219 –253 83, 907–911 46. Smith, D. R., Doucette-Stamm, L. A., Deloughery, C., Lee, H., Dubois, J., 64. Pause, A., and Sonenberg, N. (1992) EMBO J. 11, 2643–2654 Aldredge, T., Bashirzadeh, R., Blakely, D., Cook, R., Gilbert, K., Harrison, 65. Story, R. M., and Steitz, T. A. (1992) Nature 355, 374 –376 D., Hoang, L., Keagle, P., Lumm, W., Pothier, B., Qiu, D., Spadafora, R., 66. Siegal, G., Turchi, J. J., Jessee, C. B., Myers, T. W., and Bambara, R. A. (1992) Vicaire, R., Wang, Y., Wierzbowski, J., Gibson, R., Jiwani, N., Caruso, A., J. Biol. Chem. 267, 13629 –13635 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

The Intrinsic DNA Helicase Activity of Methanobacterium thermoautotrophicum ΔH Minichromosome Maintenance Protein

Shechter, David F.; Ying, Carol Y.; Gautier, Jean
Journal of Biological Chemistry – May 1, 2000
Download PDF
11 pages

Loading next page...
 
/lp/unpaywall/the-intrinsic-dna-helicase-activity-of-methanobacterium-rUg8gYbX5h

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m000398200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 20, Issue of May 19, pp. 15049 –15059, 2000 © 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Intrinsic DNA Helicase Activity of Methanobacterium thermoautotrophicum DH Minichromosome Maintenance Protein* Received for publication, January 19, 2000, and in revised form, February 21, 2000 Published, JBC Papers in Press, March 9, 2000, DOI 10.1074/jbc.M000398200 David F. Shechter‡, Carol Y. Ying‡§, and Jean Gautier¶ From the Department of Genetics and Development, the Department of Dermatology, and the ‡Integrated Program in Cellular, Molecular and Biophysical Studies, Columbia University, New York, New York 10032 Minichromosome maintenance proteins (MCMs) form been identified in all eukaryotes studied (reviewed in Refs. 10 –12). In yeast, all six proteins are essential, and null muta- a family of conserved molecules that are essential for initiation of DNA replication. All eukaryotes contain six tions in any of the six genes result in cell cycle arrest prior to orthologous MCM proteins that function as heteromul- the onset of DNA replication (4, 6, 9, 13–19). MCM proteins are timeric complexes. The sequencing of the complete ge- a component of the prereplicative complex whose activation is nomes of several archaebacteria has shown that MCM a prerequisite to DNA replication initiation (20) and requires proteins are also present in archaea. The archaea Meth- the ordered assembly of the origin recognition complex, Cdc6, anobacterium thermoautotrophicum contains a single MCM, and Cdc45 proteins on the chromatin. Experiments in MCM-related sequence. Here we report on the expres- Xenopus cell-free extracts using specific immunodepletions of sion and purification of the recombinant M. thermoau- origin recognition complex, Cdc6, or MCM proteins have dem- totrophicum MCM protein (MtMCM) in both Escherichia onstrated the sequential nature of these assembly steps where coli and baculovirus-infected cells. We show that puri- Cdc6 assembles on origin recognition complex-bound chroma- fied MtMCM protein assembles in large macromolecular tin, then allowing the loading of MCM proteins (21–23). complexes consistent in size with being double hexam- Experiments in a variety of model systems have indicated ers. We demonstrate that MtMCM contains helicase ac- that all six MCM subunits are present in MCM complexes, tivity that preferentially uses dATP and DNA-dependent suggesting that MCMs might exist as heterohexameric com- dATPase and ATPase activities. The intrinsic helicase plexes in the cell in a 1:1 stoichiometry (reviewed in Ref. 12). activity of MtMCM is abolished when a conserved lysine However, biochemical purification and extraction procedures in the helicase domain I/nucleotide binding site is mu- have also revealed the existence of subcomplexes within this tated. MtMCM helicase unwinds DNA duplexes in a 3* 3 hexameric complex consisting of a tightly bound core complex 5* direction and can unwind up to 500 base pairs in vitro. (MCM4, -6, and -7) more loosely associated with MCM2 and a The kinetics, processivity, and directionality of MtMCM second complex composed of MCM3 and -5 (24 –29). These support its role as a replicative helicase in M. thermo- autotrophicum. This strongly suggests that this function observations have raised the possibility that several MCM is conserved for MCM proteins in eukaryotes where a complexes with potentially different functions might co-exist in replicative helicase has yet to be identified. the cell. MCM proteins share extensive similarities within a central core domain. All MCM proteins contain a putative ATPase Minichromosome maintenance proteins (MCMs) were first domain within this core, which resembles that found in DNA identified independently through two different genetic screens helicases. In particular, the highly conserved Walker A and designed to isolate mutants that either lose the ability to rep- Walker B domains, which have been implicated in ATP binding licate a plasmid containing a single origin of replication (mcm and ATP hydrolysis, respectively, are found in all MCM pro- mutants) (1) or cell cycle mutants (cdc) that arrest at the G /S 1 teins (30). Walker A and B domains correspond to the con- border (cdc mutants) (2). served regions I and II of the helicase superfamily (31). A large number of genetic and biochemical experiments in A variety of observations have suggested that MCM proteins yeast, Drosophila, Xenopus, and mammals have demonstrated could function as a replicative helicase either during DNA that MCM proteins are essential for initiation of DNA replica- replication initiation or for both the initiation and elongation tion in eukaryotes (3–9). Six orthologous MCM proteins have steps. 1) Helicases are DNA-dependent NTPases, using the energy of hydrolysis to transiently unwind DNA. The Walker * This work was supported in part by American Cancer Society Grant domains are therefore key features of helicases (31). 2) Loading RPG-99-040-01-CCG (to J. G.). The costs of publication of this article MCM proteins onto the chromatin requires the Cdc6 loading were defrayed in part by the payment of page charges. This article must factor, because the loading of the bacterial DnaB helicase re- therefore be hereby marked “advertisement” in accordance with 18 quires DnaC (reviewed in Ref. 32). 3) MCM protein complexes U.S.C. Section 1734 solely to indicate this fact. purified from Schizosaccharomyces pombe exhibited ring- § Supported by a Cancer Biology Training Grant predoctoral fellowship. shaped structures when observed by electron microscopy. Some To whom correspondence should be addressed: Dept. of Genetics of these structures seemed to display a ringlike 6-fold symme- and Development, Columbia University, VC15-1526, 630 W. 168th St., try reminiscent of that observed with some DNA helicases (24). New York, NY 10032. Tel.: 212-305-9586; Fax: 212-305-7391; E-mail: 4) Purified MCM complexes composed of MCM4, MCM6, and [email protected]. The abbreviations used are: MCM, minichromosome maintenance MCM7 contained weak helicase activity in vitro, restricted to protein; MtMCM, M. thermoautotrophicum MCM protein; ORF, open the unwinding of very short oligonucleotides (33, 34). On the reading frame; PCR, polymerase chain reaction; PAGE, polyacrylamide other hand, the hexameric MCM complex purified from S. gel electrophoresis; ssDNA, single-stranded DNA; dsDNA, double- pombe did not exhibit any helicase activity (24). In addition, the stranded DNA; ATPgS, adenosine 59-O-(thiotriphosphate); AMPPNP, 59-adenylyl-b,g-imidodiphosphate. MCM2 subunit has been reported to display inhibitory activity This paper is available on line at http://www.jbc.org 15049 This is an Open Access article under the CC BY license. 15050 Helicase Activity of the MCM Protein in vitro toward the helicase activity of the MCM4, -6, and -7 ing double hexamers. We demonstrate that MtMCM is a DNA complex (35). helicase that preferentially uses dATP and that nucleotide Studies on the localization of MCM proteins during the proc- binding is essential for activity. We also show that MtMCM is ess of replication have also provided conflicting data. Chroma- a DNA-dependent dATPase and ATPase. MtMCM works cata- lytically to unwind DNA duplexes in a 393 59 direction and can tin precipitation studies in budding yeast supported the idea that some MCM proteins move along the replication fork as unwind up to 500 base pairs in vitro. The kinetics, processivity, and directionality of the enzymatic activity all support the idea DNA replication proceeds, suggesting that if MCM proteins are that MtMCM can work as a replicative helicase. a helicase they could be involved in an initial unwinding step as well as during elongation (36, 37). Immunofluorescence studies EXPERIMENTAL PROCEDURES in other organisms, however, have indicated that MCM pro- Nucleotides, Oligonucleotides, and Other Reagents—[a- P]dATP teins do not colocalize with the sites of incorporation of nucle- (3000 Ci/mmol) and [g- P]ATP (6000 Ci/mmol) were purchased from otides during replication, suggesting that the role of MCM Amersham Pharmacia Biotech. dNTPs and ATP were from APBiotech, proteins might be restricted to an initiation event (38 – 40). while the other nucleotides were from Roche Molecular Biochemicals. Helicases are enzymes that unwind the nucleic acid duplex Oligonucleotides were purchased from Sigma Genosys. T4 polynucle- and are essential for many cellular processes such as replica- otide kinase was from New England Biolabs, and the Klenow enzyme was from Roche Molecular Biochemicals. tion, repair, or transcription. They can process the unwinding Cloning of M. thermoautotrophicum MCM—MtMCM was cloned of DNA with specific directionality and are referred as 39 3 59 from M. thermoautotrophicum genomic DNA (a generous gift of Dr. or 593 39 helicases. Helicases are generally oligomeric, usually Reeve). To facilitate purification of MtMCM protein, sequences encod- dimers or hexamers. It has been demonstrated that several of ing a 6-histidine tag were added to the C terminus of the MtMCM gene the helicases implicated in DNA replication such as SV40 or by PCR. The MtMCM gene was amplified by PCR using Vent DNA polyoma T antigen have a hexameric structure (41, 42). The polymerase (New England Biolabs) with CCCCTCTAGAAAACCTATA- AATCATATGATGAAAACCGTGGATAAGAGC as the 59 primer (the crystal structure of the replicative hexameric T7 DNA helicase engineered XbaI and NdeI restriction sites, respectively, are under- protein 4 was recently solved, suggesting that progression lined) and GGGGCTCGAGTTAGTGATGGTGATGGTGATGCAGACT- along the DNA leading to the unwinding of the duplex used a ATCTTAAGGTATCCC as the 39 primer (XhoI site is underlined). The corkscrew-like inchworm mechanism (43). The directionality of PCR product was subcloned into the XbaI and XhoI sites of the bacu- the helicase is not conferred by the dimeric or hexameric struc- lovirus expression vector pFASTBAC (Life Technologies, Inc.) and se- quenced using an Applied Biosystem Automated Sequencer. Subse- ture, since both specificities have been described with each type quently, MtMCM was subcloned into the NdeI and XhoI sites of the E. of structure (reviewed in Ref. 44). Despite the presence of a coli expression vector pET21b (Novagen). MtMCM recombinant bacu- large number of putative helicase sequences in the eukaryotic lovirus was generated based on the BAC-TO-BAC Baculovirus Expres- genome (134 putative helicase sequences have been identified sion System (Life Technologies, Inc.). in S. cerevisiae), no replicative helicase has yet been identified MtMCM was mutated at lysine 325 to alanine by PCR using Vent in eukaryotes (45). DNA polymerase (NEB) with GGGCGGCCCAGCAGGCCATAA as the 59 primer (the SfiI site is underlined) and GCGCGGTACCCTTACCG- The complete sequence of an archaebacterium genome CTGGTGTATATCCCCCTGGGGGCCAGCTTTGAGACGTACTTGAG- (Methanobacterium thermoautotrophicum) revealed that ar- CATCTGTGACGCACCGATACCGGGGTCCCC as the 39 primer (the chaea contained putative open reading frames sharing homol- KpnI site, the modified codon (lysine 3 alanine), and a silent mutation ogy with different components of the prereplicative complex, in the SmaI site are underlined, respectively). The PCR product was namely origin recognition complex, Cdc6, and MCM (46). Fur- subcloned back into the MtMCM-pET21b vector at the unique SfiI and thermore, putative origins of replication have been recently KpnI sites present in the MtMCM sequence. The mutation was detected by loss of the SmaI site and confirmed by sequencing. identified in archaea (47). In addition to the fact that archaea Expression and Purification of MtMCM Protein—For expression of possess homologues of most of the essential genes involved in MtMCM protein in E. coli, the pET21b vector containing the MtMCM DNA replication (48), this observation strengthened the idea gene was transformed into DE3(BL21)pLysS cells (Novagen) and grown that archaea possess features that are more closely related to from an overnight culture in 5.5 liters of LB medium containing 50 eukaryotic than prokaryotic DNA replication, supporting the mg/ml carbenicillin and 34 mg/ml chloramphenicol at 37 °C and 375 rpm. When the cells reached an A of 0.6, protein expression was hypothesis that the divergence between archaea and eu- induced by the addition of isopropyl-1-thio-b-D-galactopyranoside to 0.6 karyotes occurred later than the divergence between archaea mM. The cells were grown for an additional 3 h and harvested by and prokaryotes. The subsequent sequencing of other archaea centrifugation. The cells were resuspended in a small volume of 50 mM genomes confirmed these findings. Interestingly, two of the Tris-HCl, pH 7.5, 10% sucrose, and protease inhibitors (100 mg/ml archaea genomes sequenced (M. thermoautotrophicum and Ar- phenylmethylsulfonyl fluoride, 0.2 mg/ml aprotinin, 0.2 mg/ml leupep- chaeoglobus fulgidus) contained a single open reading frame tin) and frozen at 270 °C immediately. The cells were then thawed and sonicated on ice and spun in an SS34 rotor at 16,000 rpm for 15 min. related to MCM proteins (49), while Methanococcus jannaschii The supernatant was removed and precipitated with ammonium sul- contained four MCM-related sequences (50). Nothing is yet fate first at 20% and then at 45% saturation. The 45% pellet was known about the biochemical function of these MCM-related resuspended in and dialyzed overnight against 25 mM Tris-HCl, pH 7.8, proteins in archaea. In particular, it is not known whether they 50 mM NaCl, 10% glycerol, 5 mM imidazole, and protease inhibitors. might be involved in DNA replication. Following the increase of imidazole concentration to 50 mM, the protein As a step toward better understanding the biochemical role was loaded onto a pre-equilibrated 10-ml Ni -nitrilotriacetic acid- agarose (Qiagen) column and eluted with a 50 –300 mM imidazole gra- of MCM proteins and as an attempt to clarify some of the dient. The peak pool of protein was dialyzed overnight against 25 mM discrepancies regarding their possible biochemical function, we Tris-HCl, pH 7.8, 100 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 1 mM decided to take advantage of the presence of a single MCM EDTA, and protease inhibitors. This pool was then loaded onto a 10-ml protein in M. thermoautotrophicum, since it opened the possi- Source Q (APBiotech) column pre-equilibrated in the above buffer. The bility to test the biochemical function of this protein in a sim- column was washed with 3 volumes of buffer and then eluted with a 100-ml 100 – 450 mM NaCl gradient. The peak fractions were pooled, pler system where the potential inhibitory effect of other sub- and the protein concentration (2.0 mg/ml) was determined by an A units would not be relevant. measurement using the calculated extinction coefficient of 29,570 liters Here we report the expression and the purification of the M. 21 21 mol cm . thermoautotrophicum MCM-related ORF proteins from Esche- For eukaryotic expression of MtMCM protein, Sf9 insect cells (In- richia coli and baculovirus-infected cells. We show that the vitrogen) were infected with the recombinant baculovirus at a multi- purified protein multimerizes in complexes consistent with be- plicity of infection of 5 and harvested 96 h postinfection. The native Helicase Activity of the MCM Protein 15051 recombinant MtMCM protein in infected cell lysate was purified on a RESULTS Ni -nitrilotriacetic acid-agarose column and eluted with 350 mM im- M. thermoautotrophicum DH Contains a M Hepes-KOH, pH 7.4, 80 mM idazole and then dialyzed against 20 m Single MCM Homologue NaCl, 1 mM dithiothreitol. The protein concentration (0.5 mg/ml) was determined by the Bradford method (Bio-Rad) using bovine serum The complete sequence of M. thermoautotrophicum revealed albumin as a standard. the presence of one ORF (ORF 1770) that was similar to MCM For expression of K325A-MtMCM, the mutant vector was trans- protein sequences. When this ORF was compared with the formed and expressed in E. coli and purified as described for the wild entire protein data base using the BLAST software (51), it type, with the exception of the Source Q step. appeared that MtMCM was most closely related to the MCM4 Preparation of DNA Helicase Substrate—The substrate used in the branch of the MCM protein family (10, 12). Using the ClustalW standard DNA helicase reaction was prepared by annealing a 59-end- 1.8 alignment program (52), we have compared the MtMCM labeled 63-mer oligonucleotide (59-TGCCAAGCTTGCATGCCTGCAGG- protein sequence with the fission yeast Cdc21/MCM4 and Xe- TCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGT-39 (the nopus MCM4 sequences. This alignment is shown in Fig. 1. HincII site is underlined)) to M13mp18 single-stranded DNA (New MtMCM lacks the N-terminal region present in all the eukary- England Biochemicals). The oligonucleotide was labeled in a reaction (20 ml) containing 18 pmol of 63-mer, 13 polynucleotide kinase buffer otic proteins. MtMCM was found to be 35% identical with both mCi of [g- (New England Biochemicals), 20 P]ATP, and 15 units of T4 S. pombe and Xenopus laevis sequences over the aligned re- kinase for 30 min at 37 °C. The labeled oligonucleotide was separated gions lacking the N termini. Over the same region, the MtMCM from free nucleotide in a G-25 spin column (Roche Molecular Biochemi- protein was 49 and 48% similar to the S. pombe and X. laevis cals), and the specific activity of the labeled DNA was determined by sequences, respectively. The highest homology was found in the liquid scintillation counting (usually 1500 cpm/fmol). The helicase tem- core region of the proteins encompassing the putative nucleo- plate was prepared by annealing the oligonucleotide to M13 in the tide binding regions and ATPase motifs. Interestingly, the N- ml reaction volume containing 2 pmol of M13 following conditions: a 32- terminal region of eukaryotic MCM4 proteins contains putative DNA and 4 pmol of labeled oligonucleotide, 100 mM NaCl, 25 mM Tris-HCl, pH 7.8, and 15 mM MgCl consensus sites for phosphorylation by cyclin-dependent kinase . The reaction was layered with mineral oil, placed in a heat block at 100 °C, and then slowly cooled to (see Fig. 1) (12). These sites are absent from the MtMCM room temperature. The annealed substrate was separated from unan- protein. We have underlined the Walker A and Walker B do- nealed oligonucleotide via gel filtration through a 5-ml Biogel A-15M mains of the protein sequences, which also correspond to the M Tris-HCl, pH 7.8, and (Bio-Rad) column in a buffer containing 25 m conserved domains I and II (31) found in all known helicases 100 mM NaCl. Six-drop fractions were collected, and the peak fractions (Fig. 1). in the void volume were pooled. The yield of template was calculated using the specific activity of the oligonucleotide. Purification of MtMCM The template used to determine directionality was prepared by di- gesting the standard template with HincII, resulting in a linear, blunt- In order to determine the role of MtMCM, we isolated the ended template with a 38-nucleotide oligonucleotide annealed to the cDNA encoding for MtMCM from M. thermoautotrophicum 39-end of the M13 molecule and a 25-nucleotide P-labeled oligonucleo- genomic DNA (a generous gift from Dr. J. Reeve) and inserted tide annealed to the 59-end. Subsequently, the 39-end of the 38-mer was it into two different expression vectors as fusion proteins con- extended 2 nucleotides with the Klenow enzyme and [a- P]dATP, taining a C-terminal His tag (see “Experimental Procedures”). resulting in a linear template with short radiolabeled double-stranded The protein was expressed in E. coli and in insect cells using a regions at each end. baculovirus expression system. In both cases, the protein was ml) con- Helicase Assay—The standard helicase assay reaction (20 soluble and was purified under native conditions. Following a tained 25 mM Tris-HCl, pH 7.8, 2.5 mM dATP, 5 mM MgCl ,1mM three-step purification procedure (see “Experimental Proce- dithiothreitol, 200 mg/ml bovine serum albumin, and either 5 or 10 fmol dures”), the protein synthesized in E. coli migrated as a single of helicase substrate. For incubations at 60 °C, the reaction was incu- bated in a heated-top PCR machine (PE9600) in order to prevent evap- band with an apparent molecular mass of 75 kDa, consistent oration. The time course reactions were incubated layered with mineral with its predicted molecular mass of 76.5 kDa (Fig. 2A, left oil in a heat block. The reactions were incubated for 30 min and stopped panel). The identity of the protein was further confirmed by by the addition of 5 mlofa53 stop solution (final concentrations: 0.5% Western blotting detection using an anti-His tag antibody M EDTA, 0.5 mg/ml proteinase K, 20% Ficoll, and 0.01% SDS, 40 m (data not shown and Fig. 3B). We also expressed MtMCM in E. bromphenol blue) and then run on a 10% polyacrylamide TBE gel coli in which the conserved lysine within the Walker A domain containing 0.1% SDS at a constant voltage of 150 V, soaked in 20% was replaced by an alanine, referred to as K325A-MtMCM (see trichloroacetic acid, and exposed to a PhosphorImager screen (Molecu- “Experimental Procedures” and Fig. 1). The Coomassie stain of lar Dynamics). The reaction products were quantitated, and any free the SDS-PAGE of the three proteins is shown in Fig. 2A.No oligo in the absence of enzyme was subtracted. ml) con- other bands were detected on the gels. MtMCM protein ex- dATPase/ATPase Assay—The standard assay reaction (10 tained 25 mM Tris-HCl, pH 7.8, 100 mM dATP, 5 nM [a- P]dATP, 5 mM pressed from insect cells migrated as a doublet in which both MgCl, 1 mM dithiothreitol, and 200 mg/ml bovine serum albumin. Incu- polypeptides contained the His tag, since they were both rec- bations were performed as described for the helicase assay and stopped ognized by an anti-His tag antibody (data not shown). mlof0.5 M EDTA. The reaction products (NTP, NDP, by the addition of 1 P ) were separated by running 1 ml of the reaction on a polyethylenei- MtMCM Protein Contains Intrinsic Helicase Activity That M acetic acid and 0.8 mine-cellulose TLC plate (Selecto Scientific) in 0.8 Requires an Intact Nucleotide-binding Domain M lithium chloride. The plate was air-dried and exposed to a Phospho- a- MCM proteins have been proposed to function as helicases rImager for imaging and quantification. Any background [ P]dADP released in the absence of enzyme was subtracted. The molar values during DNA replication. However, whether the helicase activ- ml of the reaction spotted on the were calculated by quantification of 1 ity was intrinsic to the MCM proteins in eukaryotes has been TLC plate after the run. somewhat controversial. In order to demonstrate unequivocally Gel Filtration/Size Analysis—A Superose 6 (APBiotech) column was that the MtMCM protein has an intrinsic helicase activity and equilibrated and run on an FPLC system in 25 mM Tris-HCl, pH 7.8, that this activity is not due to a contaminating activity, we 10% glycerol and the indicated salt or EDTA concentration. The column assayed the protein purified from both prokaryotic and eukary- was run at 0.4 ml/min at 4 °C. Injections were made in a volume of 200 otic expression systems. By assaying for helicase activity in ml. Fractions (14 drops, about 385– 400 ml) were collected after 7 ml had both baculovirus and E. coli expressed MtMCM, we ruled out flowed through the column after injection of the sample. Gel filtration the argument that the helicase activity is due to a contaminat- markers (Bio-Rad), when indicated, were run in the same buffer condi- tions as the experiment. ing activity that copurifies with the protein. Furthermore, we 15052 Helicase Activity of the MCM Protein FIG.1. Multiple sequence alignment of MtMCM, SpMCM4, and XlMCM4 proteins. M. thermoautotrophicum DH ORF 1770 was translated and named MtMCM. A ClustalW 1.8 alignment was made with S. pombe Cdc21/MCM4 (SpMCM4) and with X. laevis MCM4 (XlMCM4). Black boxes, amino acid identities; gray boxes, amino acid similarities. The Walker A and Walker B domains of the nucleotide binding region are underlined in black. The position of the lysine that was mutated to an alanine (K325A) is indicated above the MtMCM sequence. Asterisks indicate the positions of cyclin-dependent kinase putative phosphorylation sites in the yeast and Xenopus sequences. MtMCM Proteins Assemble into Large Complexes That introduced a lysine to alanine point mutation in the MtMCM protein within the Walker A domain (K325A-MtMCM). All Contain the Helicase Activity Walker A domains contain a conserved lysine shown to be Eukaryotic MCM proteins have been shown to assemble into essential for nucleotide binding. large multimeric complexes. In order to assess the size of the We then assayed the three different purified proteins shown MtMCM proteins purified under native conditions, we used in Fig. 2A for DNA helicase activity. In this assay, a radiola- nondenaturing gradient gel electrophoresis (Fig. 3A), a method beled 63-mer oligonucleotide was annealed to single-stranded that proved to be very valuable to resolve MCM protein com- M13 DNA, and the helicase activity was measured by the plexes (53, 54), or gel filtration followed by SDS-PAGE (Fig. ability to melt or unwind the labeled oligonucleotide from M13 3C). With either method, all of the purified MtMCM was de- circular DNA (see “Experimental Procedures”). Both wild-type termined to exist as a large complex (Fig. 3). The estimated MtMCM proteins, expressed in either E. coli or in baculovirus- molecular mass of this complex was determined to be 900 –950 infected cells, displayed DNA helicase activity, while no heli- kDa following nondenaturing gel electrophoresis or gel filtra- case activity was detected in the K325A-MtMCM protein (Fig. tion. This size is consistent with MtMCM forming a dodecamer 2B). This demonstrates unambiguously that the helicase activ- that would have a predicted mass of 918 kDa. Both the bacu- ity was indeed intrinsic to MtMCM protein and not due to a lovirus and E. coli expressed MtMCM protein assembled into contaminating protein co-purifying with MtMCM. Further- more, these data indicate that this is a Walker A type helicase, complexes of similar size (Fig. 3B). The K325A-MtMCM protein requiring a nucleotide triphosphate for activity. also assembled into complexes of similar size (Fig. 3, C and F). Helicase Activity of the MCM Protein 15053 stimulated dATPase (Fig. 4C) activities (see “Experimental procedures”). The peak of helicase and dATPase activities pri- marily coincided with the protein elution profile of the MtMCM protein complex, in fractions 10 –18. In this experiment, we analyzed the ability of MtMCM to displace a P-labeled 63- mer labeled oligonucleotide from an M13 ssDNA circle. DNA- stimulated ATPase activity also coincided with the protein profile of MtMCM (data not shown). Biochemical Properties of the MtMCM Helicase Nucleotide Requirements—All helicases contain a conserved nucleotide-binding motif. Helicase-mediated DNA unwinding might require both nucleotide binding and hydrolysis. We tested the helicase activity of the MtMCM protein in the pres- ence of a variety of nucleotides and nucleotide analogues. As shown in Fig. 5, only ATP and dATP were able to efficiently support DNA helicase activity catalyzed by MtMCM. All other nucleotides and deoxynucleotides tested were not efficient co- factors. Interestingly, the MtMCM DNA helicase activity was abolished in the presence of AMPPNP and was greatly dimin- ished but not completely abolished in the presence of ATPgS, suggesting that both ATP binding and hydrolysis are required for the unwinding reaction. We found that dATP worked more efficiently than ATP in our helicase assays (Fig. 5); therefore, most of the experiments presented were carried out using dATP. No ATPase activity was detected in K325A-MtMCM (data not shown), which also lacked detectable helicase activity. Enzyme Titration and Kinetics—We then determined the minimal concentration of enzyme sufficient for unwinding ac- tivity by titrating down the amount of MtMCM protein at given concentrations of dATP (2.5 mM) and oligonucleotide substrate (0.25 nM). The helicase activity was found to be mostly linear over the range of 0.5–35 nM (Fig. 6, A and B). Since M. thermoautotrophicum is a thermophilic microorgan- ism with an optimal growth temperature of 65 °C (55), we examined the kinetics of helicase activity at different temper- atures. Using a 63-mer oligonucleotide annealed to M13, we FIG.2. MtMCM protein purification and helicase activity. Mt- determined the kinetics of DNA unwinding at 21, 37, and 60 °C MCM protein was overexpressed in and purified from both E. coli and for a given amount of enzyme (26.5 nM). We used 60 °C as the baculovirus-infected insect cells. The K325A-MtMCM was overex- pressed in and purified from E. coli, as described under “Experimental highest temperature for helicase assays to circumvent possible Procedures.” A, Coomassie-stained SDS-PAGE gels showing the puri- thermal melting of the oligonucleotide at higher temperatures. fied proteins as indicated. B, the MtMCM proteins (40 ng each, 26.5 nM As seen in Fig. 6, C and D, a dramatic temperature effect was monomer) were assayed for helicase activity, as described under “Ex- observed with no melting occurring at 21 °C and a 7-fold lower perimental Procedures.” Helicase activity was measured by the ability of 40 ng of each protein (26.5 nM monomer) to melt a 63-mer oligonu- helicase activity seen at 37 °C compared with 60 °C. Interest- cleotide from single-stranded M13 (10 fmol (0.5 nM) template) in the ingly, a lag period with no unwinding was consistently ob- presence of 2.5 mM dATP and 5 mM MgCl for 30 min at 60 °C. served during the first minutes of the assay. DNA Requirements for NTPase—Our data show that Mt- The stability of this large complex was tested by flowing the MCM helicase activity requires nucleotide binding and hydrol- wild-type protein expressed in E. coli through a Superose 6 ysis that is DNA-dependent. We analyzed the DNA require- column in the presence of 125 mM NaCl, 750 mM NaCl, or 15 ment for this nucleotide hydrolysis. The data for dATPase mM EDTA. In all three conditions, the vast majority of the activity are shown in Fig. 7. Similar data were obtained for protein eluted as a complex of about 900 kDa, and no mono- ATP hydrolysis (data not shown). The quantification of dATP meric form of MtMCM was observed. In the presence of either released in the presence or in the absence of DNA was deter- 750 mM NaCl or 15 mM EDTA, we observed a slight shift toward mined. Although some weak dATPase activity was observed at the lower molecular mass that could be consistent with a frac- high MtMCM protein concentration in the absence of DNA tion of the dodecameric form dissociating into single hexamers (Fig. 7D), a 7-fold increase in dATPase was observed in the (Fig. 3, D and E). In these conditions, we did not observe the presence of either ssDNA or dsDNA (Fig. 7D). At low molarity dissociation of the complexes into monomeric MtMCM. Also, of enzyme (25 nM), in the linear range of activity, this difference these studies demonstrated that the absence of helicase activ- was even more dramatic (Fig. 7B). Both ssDNA and dsDNA ity in the K325A-MtMCM protein (Fig. 2B) was not due to the were found to be equally effective at stimulating the dATPase inability of the protein to form large molecular weight com- activity when assayed for its kinetics or in a titration assay. plexes, since K325A-MtMCM protein was found to exist exclu- Directionality—Two classes of DNA helicase have been de- sively as a complex of ;900 kDa (Fig. 3F). scribed that translocate either in the 59 3 39 direction, such as We next tested the fractions across the Superose-6 purifica- DnaB (56), or that translocate in the 39 3 59 direction, such as tion profile (Fig. 4A) for both helicase (Fig. 4B) and DNA- the hexameric SV40 large T antigen helicase (57). We deter- 15054 Helicase Activity of the MCM Protein FIG.3. MtMCM protein forms a stable high molecular weight complex. MtMCM protein was run on a native gradient polyacrylamide gel and through a Superose 6 gel filtration column in order to analyze its native conformation. A, the wild type protein was run through a native gradient (4 –29% polyacrylamide) gel in parallel with markers (thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), lactase dehydro- genase (140 kDa), and albumin (67 kDa)) and stained with Coomassie Blue. A semilog plot of the migration distance of the markers allowed for calculation of an approximate molecular mass for the complex of 900 –950 kDa. B, the wild type protein produced in E. coli and in insect cells was run through a native gradient gel and immunoblotted with an anti-His antibody. C, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 125 mM NaCl. Aliquots (20 ml) of the collected fractions were run on an SDS-PAGE gel and stained with Coomassie Blue, revealing a single peak of protein elution. Markers (thyroglobulin (670 kDa), g-globulin (158 kDa), ovalbumin (44 kDa), myoglobin (17 kDa), and vitamin B (1.35 kDa)) were run through the column in the same buffer conditions. A semilog plot of the elution peak of the markers based on the A profile allowed for calculation of an approximate molecular mass for the complex of 900 –950 kDa. D, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 750 mM NaCl. E, 150 mg of wild type MtMCM protein was injected onto a Superose 6 column equilibrated with 15 mM EDTA. F, 150 mg of K325A-MtMCM protein was injected onto a Superose 6 column equilibrated with 125 mM NaCl. C–F, the peak elution positions of the markers are noted with arrows above the gels. mined the directionality of the MtMCM helicase by using above, we have used synthetic oligonucleotides of various asymmetrical templates. In this experiment, a 59-labeled 63- lengths, up to 63-mer, that were efficiently melted by the Mt- mer oligonucleotide containing a blunt-end restriction site was MCM helicase. In order to estimate the maximum oligonucleo- annealed to M13. The annealed template was digested and tide length that could be processed by the enzyme, we prepared then labeled at its 39-end, giving rise to an asymmetrical tem- templates of variable length in which the labeled nucleotide plate containing both a 39-labeled and a 59-labeled oligonucleo- was extended by Klenow DNA polymerase. Our results showed tide of 40 and 25 nucleotides in length, respectively (see Fig. 8A that using 40 ng of enzyme, oligonucleotides of at least 500 base and “Experimental Procedures”). Fig. 8B shows that only the pairs were melted (Fig. 8C). This high processivity is compat- oligonucleotide labeled at its 59-end was melted, establishing ible with MtMCM being a replicative helicase. that the enzyme was moving in the 39 3 59 direction on the DISCUSSION translocating strand, assuming that MtMCM loads on the ssDNA side. In this report, we show that the single MCM protein from a Processivity—In a previous study using purified eukaryotic thermophilic microorganism has intrinsic helicase and DNA- MCM proteins, helicase activity was described as having very dependent NTPase activities and that the enzymatic activities low processivity and only unwinding oligonucleotides of 20-mer reside in a large multimeric complex. in length (33). We felt it was very important to establish the Sequence analysis of several archaea genomes has shown processivity of the MtMCM helicase to assess whether it could that they contain different numbers of MCM-related sequences act as a replicative helicase. In the experiments described (10, 12), with at least two species, M. thermoautotrophicum and Helicase Activity of the MCM Protein 15055 FIG.5. Properties of MtMCM helicase: nucleotide effects. The bar graph shows nucleotide energy requirements for MtMCM helicase activity. Each reaction contained 5 fmol of helicase substrate, 26.5 nM MCM monomer, and a 2.5 mM concentration of the indicated NTP. The activity is represented as the total amount of oligonucleotide melted from M13. The experiments using dATP and ATP were performed in triplicate. a prokaryotic or a eukaryotic expression system displayed he- licase activity that co-purified with the protein. In addition, we establish unambiguously that the helicase activity is intrinsic to the MtMCM protein by showing that a single amino acid mutation in the Walker A domain of the MtMCM protein com- pletely abolishes the MtMCM-associated helicase activity. This is in agreement with previous findings that MCM pro- teins, purified from mammalian cells, have associated helicase FIG.4. Co-elution of helicase and NTPase activity with the activity (33). However, the helicase activity of mammalian high molecular weight MtMCM complex on a Superose 6 col- MCM proteins exhibited properties different from the MtMCM umn. 150 mg of MtMCM protein was loaded onto a Superose-6 sizing helicase. Mammalian MCM proteins have been reported to column as described for Fig. 2C. A, every third fraction was run on an melt only short oligonucleotides (less than 30-mer), while we SDS-PAGE gel (20 ml aliquot) and stained with Coomassie. The Load lane contained 4 mg of MtMCM protein. The peak stained fractions show that MtMCM protein can melt oligonucleotides of at least coincided with the peak on the recorded A reading (not shown). B, 280 500 nucleotides in length. Additionally, MtMCM is able to every third fraction (1 ml) was subjected to a helicase assay (5 fmol of displace a 63-mer oligonucleotide when present at equimolar template), as described under “Experimental Procedures.” The Sub- ratio with the oligonucleotide (considering that MtMCM forms strate lane contained 5 fmol of the template without any added protein, incubated in the same conditions as the rest of the fractions. The Boiled hexamers or double hexamers), while the recombinant hexam- lane contained 5 fmol of template heated to 100 °C for 5 min. C, quan- eric MCM proteins from mammals were reported to melt a tification of the helicase (solid line) and dATPase (dotted line) assays 17-mer oligonucleotide only when present in a 40-fold molar shown along with the position of the peak elution of the molecular excess of hexamers to the oligonucleotide (34). weight markers, as determined by the A profile. We find that MtMCM helicase unwinds the DNA in the 39 3 59 direction, similarly to the mammalian MCM proteins. This is A. fulgidus, containing a single MCM ORF. In both cases this the directionality of SV40 large T antigen and polyoma PyV putative MCM protein is most closely related to the eukaryotic large T antigen, two viral hexameric DNA replicative helicases MCM4 protein (see Fig. 1 and data not shown). MCM4 is a (42, 57, 59). target for multiple cell cycle-regulated phosphorylation (53, The data presented in this report strongly support the idea 58), and all eukaryotic MCM4s contain multiple putative cyclin- that MtMCM could function as a replicative helicase because of dependent kinase phosphorylation sites clustered in the N- its high processivity and its catalytic properties. Two recent terminal region of the protein (Fig. 1 and data not shown). reports on the characterization of the MtMCM-associated he- Interestingly, none of the archaea sequences that we have licase activity (60, 61) describe observations that are generally analyzed (M. thermoautotrophicum, A. fulgidus, M. jannaschii, similar to those reported here (see below). In particular, our Aeropyrum pernix, and Sulfolobus solfataricus) contain cyclin- observation that MCM helicase can unwind up to 500 base dependent kinase phosphorylation sites. One interpretation of pairs is entirely consistent with it being a replicative helicase these observations is that during evolution MCM-dependent requiring such high processivity. DNA replication appeared before cell cycle regulation by cyclin- The fact that a single amino acid mutation in the conserved dependent kinases, since archaea do not contain cyclin-depend- lysine within the Walker A domain completely abolishes heli- ent kinases. case activity strongly suggests that nucleotide binding is es- MtMCM as a Replicative Helicase—The most important find- sential for helicase activity. The Walker A domain of the NT- ing in this report is that a single MCM protein contains intrin- Pase region has been shown to be important for nucleotide sic DNA helicase activity. This was demonstrated by showing binding in several enzymes (62– 65), while the B domain was that highly purified MtMCM protein overexpressed from either shown to be important for nucleotide hydrolysis by site-di- 15056 Helicase Activity of the MCM Protein FIG.6. Titration of MtMCM protein in the helicase assay and temperature effect upon the kinetics of MtMCM helicase activity. MtMCM protein was titrated in the helicase assay by serially diluting the protein in 3-fold steps from 167 ng/ml (110 nM) to 0.4 ng/ml (0.5 nM). 1 ml of each dilution was assayed for helicase activity in a volume of 20 ml with 10 fmol (0.25 nM) of the standard substrate for 30 min. A, helicase activity of the titrated protein. B, quantification of the helicase activity, performed in duplicate, plotted versus the concentration of the MtMCM monomer. C and D, the kinetics of MtMCM helicase activity was examined at three temperatures: 21, 37, and 60 °C. In each case, 85 fmol of helicase template (0.5 nM) and 344 ng of MtMCM (26.5 nM) were incubated in the standard reaction buffer in a volume of 170 ml. At the indicated times, a 20-ml sample was removed into 5 ml of the stop solution. C, the time course at the various temperatures, showing the melting of the oligonucleotide from the M13 ssDNA. The Substrate lane contained 10 fmol of template without any added enzyme incubated in the same conditions as the rest of the points. The Boiled lane contained 10 fmol of template heated to 100 °C for 5 min, fully denaturing the template. D, quantification of the helicase assays at 21 °C (l), 37 °C (ƒ), and 60 °C (f). rected mutagenesis or through structural studies (63– 65). In- also observe that MtMCM uses both ATP and dATP, with a terestingly, our analysis of nucleotide requirements for Mt- significant preference for dATP. Another helicase from calf MCM helicase activity suggests that nucleotide binding and thymus has also been shown to use dATP preferentially over nucleotide hydrolysis might play distinct functions. Indeed, the other nucleotides (66). helicase activity of the wild-type MtMCM protein was com- Mutation in the conserved Lysine residue in the Walker A pletely abolished in the presence of AMPPNP, a nonbinding domain of mouse MCM6 (34) resulted in a MCM complex with ATP analogue, while some low helicase activity was observed in residual helicase activity. In order to detect any possible resid- the presence of ATPgS, an ATP analogue that can bind but is ual helicase activity in K325A-MtMCM, we tested very high not hydrolyzed. This concurs with the previously proposed concentrations of protein (up to 300 nM) but never observed mechanism of helicase activity in which nucleotide binding helicase activity (data not shown). This difference might be due promotes first a conformational change followed by a subse- to the fact that in the mouse MCM complex both MCM4 and quent change associated with nucleotide hydrolysis (43). We MCM7 had intact Walker A domains that could account for the Helicase Activity of the MCM Protein 15057 FIG.7. DNA dependence of MtMCM dATPase activity. MtMCM protein was titrated in the dATPase assay by serially diluting the protein in 3-fold steps from 167 ng/ml (220 nM) to 0.4 ng/ml (1 nM). Each concentration was assayed in the presence of various DNAs: single-stranded M13mp18, double-stranded plasmid DNA, and a 63-mer oligonucleotide. A, dATPase activity of the titrated protein (1 ml) incubated in a 10-ml reaction volume in the presence of 31.25 ng of M13mp18, 5 ng of 63-mer, 31.25 ng of plasmid, or no DNA. B, quantification of the molar quantity of hydrolyzed dATP in the presence of M13 (l), 63-mer (f), plasmid (ƒ), or no DNA (L). C, time course of MtMCM dATPase activity. 120 ng of MtMCM protein (20 nM) was incubated in an 80-ml reaction volume, as described under “Experimental Procedures,” in the presence of 250 ng of M13mp18, 10 ng of 63-mer, 250 ng of plasmid, or no DNA. At the times indicated, 10-ml aliquots were removed to 1 ml of 0.5 M EDTA to stop the reaction. D, quantification of the molar quantity of hydrolyzed dATP in the presence of M13 (l), 63-mer (f), plasmid (ƒ), or no DNA (L). residual helicase activity. subset of the MCM proteins (33) display helicase activity in Our data strengthen the previous hypothesis that MCM pro- vitro (MCM4, -6, and -7), while MCM2 is inhibitory (35). In this teins are a helicase and could be a replicative helicase. The context, the essential in vitro function of MCM3 and MCM5 has current data on mammalian MCM proteins indicate that only a yet to be determined. 15058 Helicase Activity of the MCM Protein FIG.8. Directionality and processivity of the MtMCM helicase activity. MtMCM protein was assayed for directionality by the use of a modified template and for processivity by using an extended template. A, the directionality template was prepared as shown and as described under “Experimental Procedures.” B, the directionality template (5 fmol) was incubated at 60 °C in the absence of added protein (Substrate lane) and with the addition of 40 ng of MtMCM (26.5 nM monomer). The positions of the two possible melted products are indicated on the right. C, the standard template was extended with Klenow in the presence of all four dNTPs for the times indicated. Those progressively longer templates were used to assay MtMCM activity. The lanes labeled Substrate pool and Boiled were pools of these extended templates from the same experiment, incubated without protein and heated to 100 °C, respectively. MtMCM Complex Formation and Assembly—Another impor- template melted by the helicase (data not shown). tant observation is that all of the MtMCM protein assembles We have also observed by gel shift assay that MtMCM can into large oligomeric complexes. We did not observe the pres- directly bind to a 63-mer oligonucleotide when present in a ence of monomeric MtMCM following purification of the over- 3– 8-fold excess of the double hexameric form over the oligonu- expressed protein in insect cells or in bacteria. Additionally, cleotide (data not shown), suggesting that the interaction be- K325A-MtMCM was also found entirely in a complex. This tween the MtMCM complex and the DNA is a stable one, in differs from the work by Kelman et al. (60), who observed agreement with previous work showing the DNA binding abil- monomeric MtMCM. This discrepancy could be due to the po- ity of MCM proteins (33, 60). The assembly of the complex on sition of the His tag, which we positioned at the C terminus of the DNA is probably an essential step for the unwinding of the the protein as opposed to the N-terminal His tag used by DNA, since in addition to bringing the enzyme in contact with Kelman et al. (60). The other difference is that they purified the its substrate, the NTPase activity of the enzyme is stimulated. protein following its denaturation by urea, while we purified This stimulation might correspond to some conformational the native protein. changes in the complex. We show that both ssDNA and dsDNA Our observations of the molecular mass of the MtMCM com- equally stimulate the NTPase activity. Whether the stimula- plex in low salt conditions, using two different methods, show tion by dsDNA is due to single strand regions in the duplex that the protein is present in a dodecameric form, consistent arising at 60 °C or true stimulation by dsDNA remains to be with being double hexamers. These hexamers appear very sta- clarified. ble, since they do not dissociate in NaCl up to 750 mM NaCl. In Acknowledgment—We thank Dr. G. Freyer for helpful discussions addition, the stability of this oligomeric complex does not re- and comments on the manuscript. quire divalent cations, since it is stable in the presence of REFERENCES EDTA. However, we observe a slight broadening of the elution 1. Maine, G. T., Sinha, P., and Tye, B. K. (1984) Genetics 106, 365–385 peak of the complex in the presence of EDTA or high salt that 2. Hennessy, K. M., Lee, A., Chen, E., and Botstein, D. (1991) Genes Dev. 5, could reflect the transition of a fraction of the protein from a 958 –969 3. Chong, J. P., Mahbubani, H. M., Khoo, C. Y., and Blow, J. J. (1995) Nature 375, dodecameric or double hexamer form to a hexameric form. The 418 – 421 structure of the hexameric T7 helicase was recently solved, 4. Dalton, S., and Whitbread, L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, showing that the monomers arrange into a helical filament 2514 –2518 5. Feger, G., Vaessin, H., Su, T. T., Wolff, E., Jan, L. Y., and Jan, Y. N. (1995) resembling a ringlike structure when viewed along the axis of EMBO J. 14, 5387–5398 the filament (43). Although there is no information about the 6. Forsburg, S. L., and Nurse, P. (1994) J. Cell Sci. 107, 2779 –2788 7. Fujita, M., Kiyono, T., Hayashi, Y., and Ishibashi, M. (1996) Biochem. Biophys. possible structure of the MtMCM helicase, if it were such a Res. Commun. 219, 604 – 607 helical oligomeric filament, it is easy to imagine that it could 8. Madine, M. A., Khoo, C. Y., Mills, A. D., and Laskey, R. A. (1995) Nature 375, exist either as a single or a double hexamer moving along the 421– 424 9. Takahashi, K., Yamada, H., and Yanagida, M. (1994) Mol. Biol. Cell 5, DNA. 1145–1158 Several observations suggest that assembly and multimer- 10. Tye, B. K. (1999) Methods 18, 329 –334 11. Thommes, P., and Blow, J. J. (1997) Cancer Surv. 29, 75–90 ization of MtMCM are essential steps for activity. In time 12. Kearsey, S. E., and Labib, K. (1998) Biochim. Biophys. Acta 1398, 113–136 course experiments, we always observe a lag phase between the 13. Forsburg, S. L., Sherman, D. A., Ottilie, S., Yasuda, J. R., and Hodson, J. A. onset of the reaction and the actual detection of helicase activ- (1997) Genetics 147, 1025–1041 14. Gibson, S. I., Surosky, R. T., and Tye, B. K. (1990) Mol. Cell. Biol. 10, ity (Figs. 6D and 7D). This could reflect the necessity for dis- 5707–5720 assembly of a preformed complex and its reassembly around 15. Liang, D. T., Hodson, J. A., and Forsburg, S. L. (1999) J. Cell Sci. 112, 559 –567 16. Maiorano, D., Van Assendelft, G. B., and Kearsey, S. E. (1996) EMBO J. 15, the DNA. Additional support for this idea comes from compe- 861– 872 tition experiments in which we added unlabeled template along 17. Okishio, N., Adachi, Y., and Yanagida, M. (1996) J. Cell Sci. 109, 319 –326 with the labeled template either at the start of the helicase 18. Sherman, D. A., and Forsburg, S. L. (1998) Nucleic Acids Res. 26, 3955–3960 19. Yan, H., Gibson, S., and Tye, B. K. (1991) Genes Dev. 5, 944 –957 assay or 5 or 10 min following initiation of the assay. While 20. Diffley, J. F., Cocker, J. H., Dowell, S. J., and Rowley, A. (1994) Cell 78, adding an excess of unlabeled competitor template at 10 min 303–316 21. Carpenter, P. B., Mueller, P. R., and Dunphy, W. G. (1996) Nature 379, had little effect on the amount of labeled template melted by 357–360 the helicase, adding the competitor template at 5 or 0 min 22. Coleman, T. R., Carpenter, P. B., and Dunphy, W. G. (1996) Cell 87, 53– 63 resulted in up to an 80% reduction of the amount of labeled 23. Romanowski, P., Madine, M. A., Rowles, A., Blow, J. J., and Laskey, R. A. Helicase Activity of the MCM Protein 15059 (1996) Curr. Biol. 6, 1416 –1425 Bush, D., Reeve, J. N., et al. (1997) J. Bacteriol. 179, 7135–7155 24. Adachi, Y., Usukura, J., and Yanagida, M. (1997) Genes Cells 2, 467– 479 47. Lopez, P., Philippe, H., Myllykallio, H., and Forterre, P. (1999) Mol. Microbiol. 25. Kimura, H., Ohtomo, T., Yamaguchi, M., Ishii, A., and Sugimoto, K. (1996) 32, 883– 886 Genes Cells 1, 977–993 48. Edgell, D. R., and Doolittle, W. F. (1997) Cell 89, 995–998 26. Kubota, Y., Mimura, S., Nishimoto, S., Masuda, T., Nojima, H., and Takisawa, 49. Klenk, H. P., Clayton, R. A., Tomb, J. F., White, O., Nelson, K. E., Ketchum, H. (1997) EMBO J. 16, 3320 –3331 K. A., Dodson, R. J., Gwinn, M., Hickey, E. K., Peterson, J. D., Richardson, 27. Pasion, S. G., and Forsburg, S. L. (1999) Mol. Biol. Cell 10, 4043– 4057 D. L., Kerlavage, A. R., Graham, D. E., Kyrpides, N. C., Fleischmann, R. D., 28. Schulte, D., Richter, A., Burkhart, R., Musahl, C., and Knippers, R. (1996) Eur. Quackenbush, J., Lee, N. H., Sutton, G. G., Gill, S., Kirkness, E. F., Dough- J. Biochem. 235, 144 –151 erty, B. A., McKenney, K., Adams, M. D., Loftus, B., Venter, J. C., et al. 29. Thommes, P., Kubota, Y., Takisawa, H., and Blow, J. J. (1997) EMBO J. 16, (1997) Nature 390, 364 –370 3312–3319 50. Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., 30. Koonin, E. V. (1993) Nucleic Acids Res. 21, 2541–2547 Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, 31. Gorbalenya, A. E., and Koonin, E. V. (1993) Curr. Opin. Struct. Biol. 3, A. R., Dougherty, B. A., Tomb, J. F., Adams, M. D., Reich, C. I., Overbeek, 419 – 429 R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A., Scott, J. L., 32. Baker, T. A., and Bell, S. P. (1998) Cell 92, 295–305 Geoghagen, N. S. M., and Venter, J. C. (1996) Science 273, 1058 –1073 33. Ishimi, Y. (1997) J. Biol. Chem. 272, 24508 –24513 51. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. 34. You, Z., Komamura, Y., and Ishimi, Y. (1999) Mol. Cell. Biol. 19, 8003– 8015 Mol. Biol. 215, 403– 410 35. Ishimi, Y., Komamura, Y., You, Z., and Kimura, H. (1998) J. Biol. Chem. 273, 52. Higgins, D. G., Bleasby, A. J., and Fuchs, R. (1992) Comput. Appl. Biosci. 8, 8369 – 8375 189 –191 36. Aparicio, O. M., Weinstein, D. M., and Bell, S. P. (1997) Cell 91, 59–69 53. Hendrickson, M., Madine, M., Dalton, S., and Gautier, J. (1996) Proc. Natl. 37. Tanaka, T., Knapp, D., and Nasmyth, K. (1997) Cell 90, 649 – 660 Acad. Sci. U. S. A. 93, 12223–12228 38. Todorov, I. T., Attaran, A., and Kearsey, S. E. (1995) J. Cell Biol. 129, 54. Sible, J. C., Erikson, E., Hendrickson, M., Maller, J. L., and Gautier, J. (1998) 1433–1445 Curr. Biol. 8, 347–350 39. Romanowski, P., Madine, M. A., and Laskey, R. A. (1996) Proc. Natl. Acad. Sci. 55. Zeikus, J. G., and Wolfe, R. S. (1972) J. Bacteriol. 109, 707–715 U. S. A. 93, 10189 –10194 56. Lee, M. S., and Marians, K. J. (1989) J. Biol. Chem. 264, 14531–14542 40. Kimura, H., Nozaki, N., and Sugimoto, K. (1994) EMBO J. 13, 4311– 4320 57. Wang, E. H., and Prives, C. (1991) J. Biol. Chem. 266, 12668 –12675 41. Wang, E. H., and Prives, C. (1991) Virology 184, 399 – 403 58. Coue, M., Kearsey, S. E., and Mechali, M. (1996) EMBO J. 15, 1085–1097 42. Dean, F. B., Borowiec, J. A., Eki, T., and Hurwitz, J. (1992) J. Biol. Chem. 267, 59. Stahl, H., Droge, P., and Knippers, R. (1986) EMBO J. 5, 1939 –1944 14129 –14137 60. Kelman, Z., Lee, J. K., and Hurwitz, J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 43. Sawaya, M. R., Guo, S., Tabor, S., Richardson, C. C., and Ellenberger, T. (1999) 14783–14788 Cell 99, 167–177 61. Chong, J. P., Hayashi, M. K., Simon, M. N., Xum R. M., Stillman, B. (2000) 44. Bird, L. E., Subramanya, H. S., and Wigley, D. B. (1998) Curr. Opin. Struct. Proc. Natl. Acad. Sci. U. S. A. 97, 1530 –1535 Biol. 8, 14 –18 62. Haber, L. T., and Walker, G. C. (1991) EMBO J. 10, 2707–2715 45. Shiratori, A., Shibata, T., Arisawa, M., Hanaoka, F., Murakami, Y., and Eki, T. 63. Fry, D. C., Kuby, S. A., and Mildvan, A. S. (1986) Proc. Natl. Acad. Sci. U. S. A. (1999) Yeast 15, 219 –253 83, 907–911 46. Smith, D. R., Doucette-Stamm, L. A., Deloughery, C., Lee, H., Dubois, J., 64. Pause, A., and Sonenberg, N. (1992) EMBO J. 11, 2643–2654 Aldredge, T., Bashirzadeh, R., Blakely, D., Cook, R., Gilbert, K., Harrison, 65. Story, R. M., and Steitz, T. A. (1992) Nature 355, 374 –376 D., Hoang, L., Keagle, P., Lumm, W., Pothier, B., Qiu, D., Spadafora, R., 66. Siegal, G., Turchi, J. J., Jessee, C. B., Myers, T. W., and Bambara, R. A. (1992) Vicaire, R., Wang, Y., Wierzbowski, J., Gibson, R., Jiwani, N., Caruso, A., J. Biol. Chem. 267, 13629 –13635

Journal

Journal of Biological Chemistry – Unpaywall

Published: May 1, 2000

There are no references for this article.