Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene

Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 2 © 1990 Oxford University Press 261 Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene Glenn A.Bauer and Peter M.J.Burgers* Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St Louis, MO 63110, USA Received October 11, 1989; Accepted December 11, 1989 ABSTRACT MATERIALS AND METHODS The budding yeast Saccharomyces cerevisiae is Strains and Media. The E. coli strain was DHL Yeast strains proving to be an useful and accurate model for were prototrophic diploids NCYC239 and SKI (12), as well as eukaryotic DNA replication. It contains both DNA PY2/YM599 (a/a ura3-52/ura3-52 trplA/trplA Ieu2-3,112/+ polymerase a (I) and 8 (III). Recently, proliferating cell +/ade2-101 +/lys2-801 canl/+). All rich and minimal media nuclear antigen (PCNA), which in mammalian cells is were as described (13). an auxiliary subunit of DNA polymerase 8 and is essential for in vitro leading strand SV40 DNA Isolation of the gene for yPCNA. Fifty ng of y PCNA, Fraction replication, was purified from yeast. We have now V m (14) was purified by electrophoresis on a preparative 12% cloned the gene for yeast PCNA (POL30). The gene SDS-polyacrylamide gel. The protein was transferred codes for an essential protein of 29 kDa, which shows electrophoretically to a polyvinylidene difluoride membrane (15). 35% homology with human PCNA. Cell cycle Half of the appropriate membrane was directly subjected to expression studies, using synchronized cells, show sequencing on an automated Applied Biosystems sequenator. The that expression of both the PCNA (POL30) and the DNA other half was treated with trypsin, peptides released from the polymerase 8 (POL3, or CDC2) genes of yeast are membrane were separated by reverse phase HPLC and some of regulated in an identical fashion to that of the DNA these sequenced as well. A 41 aminoterminal sequence was polymerase a (POL1) gene. Thus, steady state mRNA obtained from the intact protein. And an octapeptide sequence, levels increase 10-100-fold in late G1 phase, peak in which was later shown to map near the carboxy terminus, was early S-phase, and decrease to low levels in late S- obtained from a tryptic fragment (Figure 2). Using yeast codon phase. In addition, in meiosis mRNA levels increase usage data, a sense strand 64-fold degenerate 44-mer prior to initiation of premeiotic DNA synthesis. oligonucleotide was made to amino acid residues 1 — 14 2/3 and an antisense strand 32-fold degenerate 42-mer oligonucleotide to residues 40-27 (16). These oligonucleotides, at 1 pM nucleotide each, were used as primers in a 25 cycle polymerase INTRODUCTION chain reaction (PCR) with total yeast DNA at 20 /*g/ml as template (17). A 120 bp fragment was detected and purified by Evidence for the model that, in mammalian cells, DNA 10% PAGE and used as a probe for the isolation of the full length polymerase 8 is responsible for leading strand DNA replication gene from a library of 10-20 kb genomic DNA HindSl (1) derives from studies of the proliferating cell nuclear antigen fragments ligated into the centromere vector yCp50. Subcloning (PCNA, or cyclin), which is a known cofactor of DNA using the 120 bp PCR fragment as a probe located the gene to polymerase 8 (2-4 ) in in vitro replication of SV40 DNA (5,6). a 1.1 kb Mlul-Xba\ fragment, which was sequenced using The high degree of structural and functional conservation of sequenase (United States Biochemicals) and the dideoxy components of the DNA replication apparatus between methodology. Both strands were completely sequenced from mammalian cells and yeast (7) gives relevance to genetic deletions generated with restriction enzyme cutting or by the use information obtained in yeast for understanding eukaryotic DNA of appropriate synthetic oligonucleotide primers. replication in general. Recently, we (8), and others (9), have shown that the polymerase subunit of DNA polymerase HI (10), the yeast analog of mammalian Pol5, is encoded by the CDC2 Plasmids. The 2.1 kb Mlul fragment containing the yPCNA gene gene (11), indicating an essential function for this enzyme during was ligated into the Sail site of pUC19 after both the Mlul and the S phase of the yeast cell cycle. Here, we describe the cloning, Sail sites were filled in with DNA polymerase I, Klenow primary structure and cell cycle regulated expression of the yeast fragment, and dNTP's (pBL203). The orientation of the insert PCNA (yPCNA) gene, and show that it is an essential gene as in pBL203 was such that a 1.0 kb Xbal fragment could be deleted well. by cutting and religating using the Xbal site in the polylinker * To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 262 Nucleic Acids Research of pUC19 and a single Xbal site in the insert, resulting in plasmid fragment from plasmid yEp24 which contained the URA3 gene pBL205 containing the full length yPCNA gene on the remaining (18) was made blunt-end with DNA polymerase I, Klenow 1.1 kb Mlul-Xbal fragment (Figure 1A). A 1.2 kb Hindm fragment, and dNTP's and ligated into the EcoRV sites of plasmid pBL203. This replaced the 160 bp EcoRV fragment internal to the yPCNA gene by the URA3 gene (pBL206, Figure IB). A. Plasmid pBL205 was cut with EcoRV and Styl and religated after R2 RI RS l l l filling in the Styl site, thus deleting a 360 bp fragment internal -ORF - to the yPCNA gene (pBL207). The URA3 gene was inserted in 1,0 kb this plasmid into the HindlE site present in the polylinker region (pBL208, Figure 1C). Plasmid pBL203 was cut with BamHl and B. Hindm, which cut at sites in the pUC19 polylinker region such (RS) (R2) that the fragment contained the 2.1 kb Mlul insert. The resulting fragment was ligated into the BamHl-HindYR site of centromere 2.0 kb 1.0 1.5 vector yCp50 (pBL211). H M (S/R2) c. URA-3 Expression studies of the POL30 (yPCNA) gene. Strain NCYC239 was synchronized by the feed-starve method (12,19). Synchronous entry into meiosis for strain SKI was affected Figure 1. Restriction maps of the yeast PCNA gene region and deletion derivatives. through a shift to potassium acetate containing media (12,20). All fragments are inserted into pUC19 in a counter clockwise direction as described At appropriate times cells were collected by centriguation and in Materials and Methods. A, The Mlul-Xbal wild-type fragment in pBL205; frozen in dry ice. Total RNA was isolated by the glass- B, The disruption construction in pBL206 used for insertional mutagenesis; C, bead method (21), separated by agarose gel electrophoresis The deletion construction in pBL.208 used for making a chromosomal deletion. Abbreviations are: M, Mlul; S, Styl; RV, EcoRV; RI, EcoRl; X, Xbal; H, Hindm. and transferred to Gene-screen (DuPont) according to 1 ACGCGTAACrrjmTTTTTGGATTTCAACTGATAGTTTTCGTAC 4 6 TTTGCTTCCTCTGGTACATAAMTTATATATAAGAMCACTrTTGCTTTAGCCTTCCTTTCTTTCCACTTGCACC T T 121 TTTCACTTTCGCCGTCCTTTTTCACTCACAGCAACAAGCAGCAAGCACTAAGTACGCAGTCAAAAGAGAGAAAAA 196 ATGTTAGMGCAAMTTTGAAGAAGCATCCCTTTTCAAGAGAATAATTGATGGTTTCAAAGATTGTGTCCAGTTG 1 HetLeuGluAlaLysPheGluGluAlaSerLeuPheLysArgllelleAspGlyPheLysAspCysValGlnLeu 271 GTCAATTTCCAATGTAAAG AAG ATGGTATCATTGCACAAGCTGTCG ATG ACTCAAGAGTTCTATTGGTCTCCTTG 26 ValAsnPheGlnCysLysGluAspGlyllellcAlaGlnAlaValAspAspSerArgValLeuLeuValSerLeu 346 GAAATAGGTGTCGAAGCCTTCCAAGAATATAGATGTGACCATCCTGTTACGTTAGGTATGGATCTAACCTCACTA 51 GluIleGlyValGluAlaPheGlnGluTyrArgCysAspHisProValThrLeuGlyMetAspLeuThrSerLeu 421 AGTAAAATCCTACGTTGTGGTAACAACACCGATACATTAACACTAATTGCTGACAACACACCGGATTCCATCATC 76 SerLysIleLeuArgCysGlyAsnAsnThrAspThrLeuThrLeuIleAlaAspAsnThrProAspSerllelle 496 TTATTATTTGAGGATACCAAGAAAGACCGTATAGCCGAATACTCTCTGAAATTGATGGATATCGATGCTGATTTC 101 LeuLeuPheGluAspThrLysLysAspArglleAlaGluTyrSerLeuLysLeuMetAspIleAspAlaAspPhe 571 TTAAAGATTGMGMTTACAGTACGACTCCACCCTGTCATTGCCATCrTCCGAATTCTCTAAAATTGTTCGTGAC 126 LeuLysIleGluGluLeuGlnTyrAspSerThrLeuSerLeuProSerSerGluPheSerLysIleValArgAsp 646 TTGTCCCAATTGAGTGATTCTATTAATATCATGATCACCAAAGAAACAATAAAGTTTGTAGCTGACGGTGATATC 151 LeuSerGlnLeuSerAspSerlleAsnllGMetlleThrLysGluThrlleLysPheValAlaAspGlyAspIle 721 GG ATCAGGTTCAGTCATAATAAAACCATTCGTGGATATGG AACATCCTGAAACAAGCATCAAACTTGAAATGGAT 176 GlySerGlySerValllelleLysProPheValAspMetGluHisProGluThrSerlleLysLeuGluMetAsp 796 CMCCTGTCGACTTGACGTTCGGAGCTAMTATTTATTGGACATCATTMGGGCTCCTCCCTTTCTGATAGAGTT 201 GlnProValAspLeuThrPheGlyAlaLysTyrLeuLeuAspIlelleLysGlySerSerLeuSerAspArgVal 871 GGTATC AGGCTCTCCAGCG AAGCTCCTGCTTrATTCCAATTrGATTTGAAGAGTGGGTTCCTACAGTTTTTCTTG 226 GlylleArgLeuSerSerGluAlaProAlaLeuPheGlnPheAspLeuLysSerGlyPheLcuGlnPhePheLeu 946 GCTCCTAAATTTAATGACGAAGAATAAATGTAAATTATCTATATAGTTGTATACTAAAAATAATAAACAAAAAAA 251 AlaProLysPheAsnAspGluGlu 1021 AAACAGTAAAGTTTGTTTTAAATGAAAATAAATAACAAAGAAAATAAAGACTAAGTAGTCAGTTAATATCAGCAT 1096 TTTTGTGTGACTTATACAGTATTTATGACATATCTTACATTAATCTAGA Figure 2. DNA sequence of the Mlul-Xbal fragment and deduced protein sequence of yPCNA. The POL30 sequence data will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Databases under the accession number X16676. The underlined amino acid residues correspond to those obtained from protein sequencing of the intact protein (residues 1-41), or a tryptic fragment thereof (residues 231 -240) . Arrows indicate RNA start sites as mapped by primer extension analysis (34). Both stan sites are used with approximately equal efficiency. The underlined DNA sequence is identical with a sequence upstream of the POL3 gene. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research 263 or a smaller derivative (pBL205) (see Materials and Methods). Further mapping and sequencing defined the gene to a Mlul-Xbal ACT1 fragment (Figure 1A). The DNA sequence of the 1.1 kb Mlul- Xbal fragment and the deduced amino acid sequence of yPCNA P0L 1 are given in Fig. 2. An open reading frame for a 28,916 dalton protein was found. This is larger than the M of purified POL 3 yPCNA as observed by SDS-PAGE (26-27 kDa), suggesting that the purified yPCNA may be a proteolytic fragment. POL 30 However, amino acid sequence data from a tryptic fragment obtained from pure yPCNA yielded sequence data near the carboxy terminus (residues 231-240), indicating that our purified yPCNA could at most be missing the 18 carboxy terminal residues. In addition, we have recently expressed yPCNA in E. 2 80 coli using an appropriate expression system, and the resulting rr E 70 purified protein has exactly the same SDS-PAGE size and enzymatic properties as the protein purified from yeast (Burgers | 60 et al., unpublished results). | 50 A null mutant of yPCNA was created in vitro by deleting the internal EcoRV fragment (160 bp) and inserting a 1.1 kb HindHl = 30 fragment from YEp24 containing the URA3 gene (Fig. IB). The resulting modified POL30 gene was removed from the plasmid by digestion with Mlul and transformed into diploid strain PY2/YM599 (see Materials and Methods) to disrupt one of the 0 two copies of the gene by a double crossover event (26). Tetrad 30 60 90 120 150 180 210 240 analysis of the sporulated diploid showed that the POL30 gene Time (hours) is essential for spore viability. Of 18 tetrads analyzed, 10 produced two viable spores and 8 produced one viable spore. Figure 3. Cell cycle regulated expression in mitotic cells. NCYC239 cells, All viable spores were Ura~. Sporulation of the control diploid synchronized by the feed-starve method were shifted to rich media. Samples were strain gave (of 10 tetrads dissected) 6 tetrads with 4 viable spores, removed at intervals and total RNA extracted for Northern blot analysis. A, The 3 tetrads with 3 viable spores, and 1 tetrad with 2 viable spores, blot was probed with radioactively labelled fragments of the ACT1, POL1, POL3 indicating that the low spore viability of the parental strain was and POL30 genes. B, Densitometric scanning of the autoradiogram obtained from the cause of the relatively high number of tetrads with 1 viable probing of the blot with the POL30 gene. The bar in the graph identifies the period of DNA synthesis (from ref. 12,20). spore in the disruption strain. These results show that the POL30 gene is essential for growth. A large chromosomal deletion of the yPCNA gene was generated by transforming the PY2/YM599 the manufacturer's directions. The blots were probed with diploid to Ura+ with the integrating plasmid pBL208 (Figure 32P-labelled probes to the coding sequences of the ACT1, 1C). Cells which had then excised the plasmid by intramolecular POL1, POL3 and POL30 genes (8,22,23). Probes were prepared recombination leaving the deleted copy of the gene in the using the random primer method (24). chromosome were selected by plating on 5-fluoroorotic acid containing plates and subsequently screened by Southern blot RESULTS analysis (27,28). Sporulation and tetrad analysis showed that this deletion was also lethal. The deletion mutant, however, was The sequence of the amino-terminal 41 residues of yPCNA was complemented by a plasmid containing the POL30 gene on a 2.1 determined on an automated sequenator from the protein bound kb Mlul fragment inserted into centromere vector yCp50 to a polyvinylidene difluoride membrane (15). Using this (pBL211, see Materials and Methods) when the heterozygous information, we made two oppositely-oriented degenerate diploid was transformed with this plasmid prior to sporulation. oligonucleotides (see Materials and Methods) and subjected them to the polymerase chain reaction (PCR) with genomic yeast 190 bp upstream from the initiation codon is a Mlul (ACGCGT) DNA (17). The resulting amplified 120 bp DNA fragment was site which is also present in one or more copies upstream from used as a probe to /flnJUI-digested yeast genomic DNA in a a large number of genes involved in DNA metabolism that are Southern blot analysis. Hybridization was to a single 17 kb band. periodically expressed during the cell cycle (23). This sequence Accordingly, a yeast genomic library of 10—20 kb HindXR is also present upstream from the start site of the POL3 (CDC2) fragments was made in the centromere vector YCp50. Three gene (8). Even more strikingly, a 14 bp stretch at the Mlul site identical clones were obtained by screening this library with the (ACGCGTAACTTTTT) is identical for the P0L3 (CDC2) and 120 bp fragment. POL30 (yPCNA) genes (Ref. 8, Fig. 2), suggesting that both genes may be similarly regulated. Cell cycle dependent expression The yPCNA gene is designated POL30 because PCNA is a of the P0L3 and POL30 genes was measured after subunit of DNA polymerase 8 (III) and the gene designation for synchronization of NCYC239 cells by the feed-starve method the catalytic polypeptide (formerly designated CDC2) should be (12,19). This type of synchronization gave results identical to considered as POL3 (8,9). The POL30 gene was mapped to the elutriation or a-Factor synchronization when cell-cycle dependent left arm of chromosome n (25) (results not shown). After expression of the POL1 and CDC9 genes was studied (12,20). restriction mapping, a 2.1 kb Mlul fragment was subcloned into The timing of POL3 and POL30 expression was indistinguishable pUC19 in such a way that the Mlul sites were regenerated and from each other and from that of the POL1 gene, with steady- all further manipulations were done with this plasmid (pBL203) Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 264 Nucleic Acids Research state mRNA levels of all three genes rising sharply in late G1 , continuing through S, and decreasing again in the late S phase (Figure 3). As a control, expression of the actin gene (ACT!) was cell-cycle independent. The poor signal obtained with the 90 POL 30 POL3 probe was due to the low levels of POL3 mRNA (Figure 3). Quantitative dot blot analysis of steady state mRNA levels 2 80 in asynchronously growing cells showed that the abundance of tr POL30 mRNA is 2-3 fold higher than POLI, and 10-fold higher E 70 than POL3 mRNA (data not shown). The POL30 and POLI mRNA levels also rose coordinately £ 60 when the diploid strain SK-l was induced to sporulate in a | 50 synchronous fashion (Figure 4). In these blots, however, the POLS (CDC2) mRNA could not be detected above background < 40 noise. Again, increase in the mRNA levels precedes meiotic DNA CD replication. ~ 30 I 20 DISCUSSION The use of amino acid sequence derived oppositely oriented 0 degenerate oligonucleotides as primers for a polymerase chain 0 1 2 3 4 6 reaction with total nuclear DNA proved to be a facile way to generate a probe for isolation of the full-length gene (29). Only Time (hours) one fragment of the expected size (120 bp) was produced. The coding region of the POL30 gene is preceded by a 190 bp regulatory region which contains a consensus TATA box, the ACT1 RNA start site(s) and a ACGCGT sequence (a MM site) presumed to be required for cell cycle regulated gene expression POL1 (23). This 190 bp upstream region was sufficient to allow complementation of a POL30 deletion mutant by the wild-type gene on a centromere plasmid. Whether the entire region is 5 6 2 3 4 required for proper expression has not yet been determined. Time (hours) The putative amino acid sequence of yPCNA shows ca. 35% homology to that of the human PCNA (30) (Fig. 2). While Figure 4. Regulation of mRNA levels during meiosis. Late-log phase SK-l cells yPCNA can fully stimulate calf thymus DNA polymerase 6 by were transferred to sporulation medium and samples taken and processed as described in Materials and Methods and in the Legend to Figure 3. The same increasing its processivity of action, it cannot substitute for human RNA samples were used for different blots in A and B. A. The blot was probed PCNA in the in vitro SV40 DNA replication system (14). This with the POL30 gene and the autoradiogram scanned with a densitometer. The low homology at the amino acid level can also explain why human bar indicates the region of premeiotic DNA synthesis (from ref. 12,20). B. The polyclonal antisera from lupus patients, which react with blot was probed with the ACT1 and POLI genes. HUMAN 1 SIP EAR LVQQS I LKK VLEA L KOLINEACWDISS S QSM D SSHVStVQli TLR S EQF DT YEAST 1 §j L| FEEASL F QAV D K|R I I DQ FKDCVQLVNFQCKE D DSRVL LVS L E I QV AFQE AcMNPV 1 llF H E iFKTQA V LKR LVET F KOLLPHATFDCDN R SMQVMD KK TSHVALVSLQLH A EGF HUMAN 6 1 IC O R N L AM Q V N L TfBjMjSK J LK CAQNED I I TLRL E 0 N A P T L A L V JE A P NQ E K V SD IEMKLUD YEAST 6 1 RCOHPVTLGMDLTS L SK I LR CQNNTDTLT L l| NTPO S I I LL jEDTKKD R I A E SLlKLUD 6 1 ICORNVPLNV S I NS L AcMNPV VK CjVNERSSVLMK(AjEDQQ(DjVMAFVgJNN - -DN R I C SK I TLIKLUC L(5|VEOC|GfT HUMAN 12 1 PEQESISCVVKMP AR I CR LS H I QDAVV I SCApKlDQVK flS A 3NQ N I YEAST 1 2 1 IKII EELO|DSTLSLP DADF F S K I V R LSQLSDSINIMI T |V A £>L ET IK flSGSV AcMNPV 1 1 9 PDSDVDCVVHM I FAQVC K DVEHl TQFDHDIIVSC S KGL OiR A 6SAD V HUMAN 18 1 KLSQTSNVDKEEEAVTIEMNE PffilQ L DVPLVVEY K YEAST 18 1 I I KPFVDMEHPET S I KLEMDQP^JD EAPALFQF D AcMNPV 17 9 QMSA - - -DNENFS V - LKAKQ ITVT PFKLEY C HUMAN 24 1 YY E - - OS LARK DE I YEAST 2 4 1 L K S - tiQ F F F - - ND Ei LAPK AcMNPV 2 3 4 I K D V 9jV L A C F I VNN D I F LAP * EE Figure 5. Protein comparison of human, yeast, and AcMNPV PCNA sequences. Protein sequence homology was determined using the Wilbur/Lipman PRTALN alignment program (35). Boxed residues indicate identity between all three PCNA sequences. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research 265 21 . Elder, R.T., Loh, E.Y. & Davis, R.W. (1983) Proc. Natl. Acad. Sci. USA mammalian PCNA, do not react with yPCNA (14). Recently it 80, 2432-2435. has been reported that the baculovirus Autographa californica 22. Galwitz, D. & Sures, I. (1980) Proc. Natl. Acad. Sci. USA 77, 2546-2550. nuclear polyhedrosis virus (AcMNPV) has a gene that encodes 23. Pizzagalli, A., Valsasnini, P., Plevani, P. & Lucchini, G. (1988) Proc. Natl. a protein, ETL, that has significant homology to rat PCNA (31), Acad. Sci. USA 85, 3772-3776. which in turn is virtually identical to the human PCNA. The 24. Feinberg, A.P. & Fogelstein, B. (1983) Anal. Biochem. 132, 6-13 . 25. Carle, G.F. & Olson, M.V. (1985) Proc. Natl. Acad. Sci. USA 82, possibility that ETL functions similarly to yeast and calf thymus 3756-3760 (1985). PCNA is further supported by the finding that the AcMNPV also 26. Rothstein, R.J. (1983) Methods Enzymol. 101, 202-211. encodes a DNA polymerase with 5-like properties, i.e. aphidicolin 27. Scherer, S. & Davis, R.W. (1979) Proc. Natl. Acad. Sci. USA 76, sensitivity, and a 3' —5 ' exonuclease activity (32). This AcMNPV 4951-4954. ETL protein is 34% homologous to yeast PCNA (Fig. 5). When 28. Boeke, J.D., LaCroute, F. & Fink, G.R. (1984) Mol. Gen. Genet. 797, 345-346 . all three PCNA sequences are analyzed together (human, yeast, 29. Gould, S.J., Subramani, S. & Scheffler, I.E. (1989) Proc. Natl. Acad. Sci. and AcMNPV), there are definite domains of homology which USA 86, 1934-1938. might be important for protein-protein interaction with the 5 30. Almendral, J.M., Huebsch, D., Blundell, P.A., Macdonald-Brown, H. & polymerase (33). Bravo, R. (1987) Proc. Natl. Acad. Sci. USA 84, 1575-1579. 31. O'Reilly, D.R., Crawford, A.M. & Miller, L.K. (1989) Nature 337, 606. These results indicate that yPCNA plays a necessary role in 32. Mikhailov, V.J., Marlyev, K.A., Ataeva, J.O., Kullyev, P.K. & Atrazhev, yeast, presumably in its interaction with DNA polymerase 8 A.M. (1986) Nucleic Acids Res. 14, 3841-3857. during DNA replication. This interaction appears to be conserved 33. Bauer, G.A. & Burgers, P.M.J. (1988) Biochim. Biophys. Acta 951, through evolution, since yeast PCNA can sustitute for calf thymus 274-279 . PCNA in vitro. Also, domains of homology between human, 34. Krainer, A.R., Maniatis, T., Ruskin, B. & Green, M.R. (1984) Cell 36, 993-1005. yeast and AcMNPV PCNA suggest a functional conservation 35. Wilbur, W.J. & Lipman, D.J. (1983) Proc. Natl. Acad. Sci. USA 80, between these three very diverse organisms. 736-740 . ACKNOWLEDGEMENTS We thank Kim Percival for excellent technical assistance, John Majors for helpful suggestions, and Jim Dutchik and Maynard Olson for physical mapping of the POL30 gene. Protein sequence analysis and oligonucleotide synthesis was carried out in the Protein Chemistry Laboratory of Washington University School of Medicine. Supported by a grant from the National Institutes of Health. P.M.J.B. is an established investigator of the American Heart Association. REFERENCES 1. So, A.G. & Downey, K.M. (1988) Biochemistry 27, 4591-4595. 2. Tan, C.K., Castillo, C , So, A.G. & Downey, K.M. (1986) J. Biol. Chem. 261, 12310-12316. 3. Bravo, R., Frank, R., Blundell, P.A. & MacDonald-Bravo, H. (1987) Nature 326, 515-517. 4. Prelich, G., Tan, C.K., Kostura, M., Mathews, M.B., Sa, A.G., Downey, K.M. & Stillman, B. (1987) Nature 362, 517-520. 5. Prelich, G., Kostura, M., Marshak, D.R., Mathews, M.B. & Stillman, B. (1987) Nature 326, 471-475. 6. Prelich, G. & Stillman, B. (1988) Cell 53, 117-126. 7. Burgers, P.M.J., (1989) Progr. Nucleic Acids Res. Mol. Biol. 37, 235-280. 8. Boulet, A., Simon, M., Faye, G., Bauer, G.A. & Burgers, P.M.J., (1989) EMBO J. 8, 1849-1854. 9. Sitney, K.C., Budd, M.E. & Campbell, J.L. (1989) Cell 56, 599-605. 10. Bauer, G.A., Heller, H.M. & Burgers, P.M.J. (1988) J. Biol. Chem. 263, 917-924 . 11. Pringle, J.R. & Hartwell, L.H. (1981) In: The Molecular Biology of the yeast Saccharomyces (Strathern, J., Jones, E.W., and Broachs, J., Eds.), CSHL Press, Cold Spring Harbor, NY, Vol. I, pp. 97-142. 12. White, J.H.M., Barker, D.G., Nurse, P. & Johnston, L.H. (1986) EMBO J. 5, 1705-1709. 13. Sherman, F., Fink, G.R. & Hicks, J.B. (1986) Methods in Yeast Genetics, CSHL, Cold Spring Harbor, NY. 14. Bauer, G.A. & Burgers, P.M.J. (1988) Proc. Natl. Acad. Sci. USA 85, 7506-7510. 15. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038. 16. Bennetzen, J.L. & Hall, B.D. (1982) J. Biol. Chem. 257, 3026-3031. 17. Saike, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. & Erlich, H.A. (1986) Science 239, 487-491. 18. Broach, J.R. (1983) Methods in Enzymol. 101, 307-325. 19. Williamson, D.H. & Scopes, A.W. (1962) Nature 193, 256-257. 20. Johnston, L.H., White, J.H.M., Johnson, A.L., Lucchini, G. & Plevani, P. (1987) Nucleic Acids Res. 15, 5017-5030. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene

Bauer, Glenn, A.; Burgers, M., J.
Nucleic Acids Research , Volume 18 (2) – Jan 25, 1990
Download PDF
6 pages

Loading next page...
 
/lp/oxford-university-press/molecular-cloning-structure-and-expression-of-the-yeast-proliferating-rK5K0yvM7f

References (2)

Publisher
Oxford University Press
Copyright
© Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/18.2.261
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 2 © 1990 Oxford University Press 261 Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene Glenn A.Bauer and Peter M.J.Burgers* Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St Louis, MO 63110, USA Received October 11, 1989; Accepted December 11, 1989 ABSTRACT MATERIALS AND METHODS The budding yeast Saccharomyces cerevisiae is Strains and Media. The E. coli strain was DHL Yeast strains proving to be an useful and accurate model for were prototrophic diploids NCYC239 and SKI (12), as well as eukaryotic DNA replication. It contains both DNA PY2/YM599 (a/a ura3-52/ura3-52 trplA/trplA Ieu2-3,112/+ polymerase a (I) and 8 (III). Recently, proliferating cell +/ade2-101 +/lys2-801 canl/+). All rich and minimal media nuclear antigen (PCNA), which in mammalian cells is were as described (13). an auxiliary subunit of DNA polymerase 8 and is essential for in vitro leading strand SV40 DNA Isolation of the gene for yPCNA. Fifty ng of y PCNA, Fraction replication, was purified from yeast. We have now V m (14) was purified by electrophoresis on a preparative 12% cloned the gene for yeast PCNA (POL30). The gene SDS-polyacrylamide gel. The protein was transferred codes for an essential protein of 29 kDa, which shows electrophoretically to a polyvinylidene difluoride membrane (15). 35% homology with human PCNA. Cell cycle Half of the appropriate membrane was directly subjected to expression studies, using synchronized cells, show sequencing on an automated Applied Biosystems sequenator. The that expression of both the PCNA (POL30) and the DNA other half was treated with trypsin, peptides released from the polymerase 8 (POL3, or CDC2) genes of yeast are membrane were separated by reverse phase HPLC and some of regulated in an identical fashion to that of the DNA these sequenced as well. A 41 aminoterminal sequence was polymerase a (POL1) gene. Thus, steady state mRNA obtained from the intact protein. And an octapeptide sequence, levels increase 10-100-fold in late G1 phase, peak in which was later shown to map near the carboxy terminus, was early S-phase, and decrease to low levels in late S- obtained from a tryptic fragment (Figure 2). Using yeast codon phase. In addition, in meiosis mRNA levels increase usage data, a sense strand 64-fold degenerate 44-mer prior to initiation of premeiotic DNA synthesis. oligonucleotide was made to amino acid residues 1 — 14 2/3 and an antisense strand 32-fold degenerate 42-mer oligonucleotide to residues 40-27 (16). These oligonucleotides, at 1 pM nucleotide each, were used as primers in a 25 cycle polymerase INTRODUCTION chain reaction (PCR) with total yeast DNA at 20 /*g/ml as template (17). A 120 bp fragment was detected and purified by Evidence for the model that, in mammalian cells, DNA 10% PAGE and used as a probe for the isolation of the full length polymerase 8 is responsible for leading strand DNA replication gene from a library of 10-20 kb genomic DNA HindSl (1) derives from studies of the proliferating cell nuclear antigen fragments ligated into the centromere vector yCp50. Subcloning (PCNA, or cyclin), which is a known cofactor of DNA using the 120 bp PCR fragment as a probe located the gene to polymerase 8 (2-4 ) in in vitro replication of SV40 DNA (5,6). a 1.1 kb Mlul-Xba\ fragment, which was sequenced using The high degree of structural and functional conservation of sequenase (United States Biochemicals) and the dideoxy components of the DNA replication apparatus between methodology. Both strands were completely sequenced from mammalian cells and yeast (7) gives relevance to genetic deletions generated with restriction enzyme cutting or by the use information obtained in yeast for understanding eukaryotic DNA of appropriate synthetic oligonucleotide primers. replication in general. Recently, we (8), and others (9), have shown that the polymerase subunit of DNA polymerase HI (10), the yeast analog of mammalian Pol5, is encoded by the CDC2 Plasmids. The 2.1 kb Mlul fragment containing the yPCNA gene gene (11), indicating an essential function for this enzyme during was ligated into the Sail site of pUC19 after both the Mlul and the S phase of the yeast cell cycle. Here, we describe the cloning, Sail sites were filled in with DNA polymerase I, Klenow primary structure and cell cycle regulated expression of the yeast fragment, and dNTP's (pBL203). The orientation of the insert PCNA (yPCNA) gene, and show that it is an essential gene as in pBL203 was such that a 1.0 kb Xbal fragment could be deleted well. by cutting and religating using the Xbal site in the polylinker * To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 262 Nucleic Acids Research of pUC19 and a single Xbal site in the insert, resulting in plasmid fragment from plasmid yEp24 which contained the URA3 gene pBL205 containing the full length yPCNA gene on the remaining (18) was made blunt-end with DNA polymerase I, Klenow 1.1 kb Mlul-Xbal fragment (Figure 1A). A 1.2 kb Hindm fragment, and dNTP's and ligated into the EcoRV sites of plasmid pBL203. This replaced the 160 bp EcoRV fragment internal to the yPCNA gene by the URA3 gene (pBL206, Figure IB). A. Plasmid pBL205 was cut with EcoRV and Styl and religated after R2 RI RS l l l filling in the Styl site, thus deleting a 360 bp fragment internal -ORF - to the yPCNA gene (pBL207). The URA3 gene was inserted in 1,0 kb this plasmid into the HindlE site present in the polylinker region (pBL208, Figure 1C). Plasmid pBL203 was cut with BamHl and B. Hindm, which cut at sites in the pUC19 polylinker region such (RS) (R2) that the fragment contained the 2.1 kb Mlul insert. The resulting fragment was ligated into the BamHl-HindYR site of centromere 2.0 kb 1.0 1.5 vector yCp50 (pBL211). H M (S/R2) c. URA-3 Expression studies of the POL30 (yPCNA) gene. Strain NCYC239 was synchronized by the feed-starve method (12,19). Synchronous entry into meiosis for strain SKI was affected Figure 1. Restriction maps of the yeast PCNA gene region and deletion derivatives. through a shift to potassium acetate containing media (12,20). All fragments are inserted into pUC19 in a counter clockwise direction as described At appropriate times cells were collected by centriguation and in Materials and Methods. A, The Mlul-Xbal wild-type fragment in pBL205; frozen in dry ice. Total RNA was isolated by the glass- B, The disruption construction in pBL206 used for insertional mutagenesis; C, bead method (21), separated by agarose gel electrophoresis The deletion construction in pBL.208 used for making a chromosomal deletion. Abbreviations are: M, Mlul; S, Styl; RV, EcoRV; RI, EcoRl; X, Xbal; H, Hindm. and transferred to Gene-screen (DuPont) according to 1 ACGCGTAACrrjmTTTTTGGATTTCAACTGATAGTTTTCGTAC 4 6 TTTGCTTCCTCTGGTACATAAMTTATATATAAGAMCACTrTTGCTTTAGCCTTCCTTTCTTTCCACTTGCACC T T 121 TTTCACTTTCGCCGTCCTTTTTCACTCACAGCAACAAGCAGCAAGCACTAAGTACGCAGTCAAAAGAGAGAAAAA 196 ATGTTAGMGCAAMTTTGAAGAAGCATCCCTTTTCAAGAGAATAATTGATGGTTTCAAAGATTGTGTCCAGTTG 1 HetLeuGluAlaLysPheGluGluAlaSerLeuPheLysArgllelleAspGlyPheLysAspCysValGlnLeu 271 GTCAATTTCCAATGTAAAG AAG ATGGTATCATTGCACAAGCTGTCG ATG ACTCAAGAGTTCTATTGGTCTCCTTG 26 ValAsnPheGlnCysLysGluAspGlyllellcAlaGlnAlaValAspAspSerArgValLeuLeuValSerLeu 346 GAAATAGGTGTCGAAGCCTTCCAAGAATATAGATGTGACCATCCTGTTACGTTAGGTATGGATCTAACCTCACTA 51 GluIleGlyValGluAlaPheGlnGluTyrArgCysAspHisProValThrLeuGlyMetAspLeuThrSerLeu 421 AGTAAAATCCTACGTTGTGGTAACAACACCGATACATTAACACTAATTGCTGACAACACACCGGATTCCATCATC 76 SerLysIleLeuArgCysGlyAsnAsnThrAspThrLeuThrLeuIleAlaAspAsnThrProAspSerllelle 496 TTATTATTTGAGGATACCAAGAAAGACCGTATAGCCGAATACTCTCTGAAATTGATGGATATCGATGCTGATTTC 101 LeuLeuPheGluAspThrLysLysAspArglleAlaGluTyrSerLeuLysLeuMetAspIleAspAlaAspPhe 571 TTAAAGATTGMGMTTACAGTACGACTCCACCCTGTCATTGCCATCrTCCGAATTCTCTAAAATTGTTCGTGAC 126 LeuLysIleGluGluLeuGlnTyrAspSerThrLeuSerLeuProSerSerGluPheSerLysIleValArgAsp 646 TTGTCCCAATTGAGTGATTCTATTAATATCATGATCACCAAAGAAACAATAAAGTTTGTAGCTGACGGTGATATC 151 LeuSerGlnLeuSerAspSerlleAsnllGMetlleThrLysGluThrlleLysPheValAlaAspGlyAspIle 721 GG ATCAGGTTCAGTCATAATAAAACCATTCGTGGATATGG AACATCCTGAAACAAGCATCAAACTTGAAATGGAT 176 GlySerGlySerValllelleLysProPheValAspMetGluHisProGluThrSerlleLysLeuGluMetAsp 796 CMCCTGTCGACTTGACGTTCGGAGCTAMTATTTATTGGACATCATTMGGGCTCCTCCCTTTCTGATAGAGTT 201 GlnProValAspLeuThrPheGlyAlaLysTyrLeuLeuAspIlelleLysGlySerSerLeuSerAspArgVal 871 GGTATC AGGCTCTCCAGCG AAGCTCCTGCTTrATTCCAATTrGATTTGAAGAGTGGGTTCCTACAGTTTTTCTTG 226 GlylleArgLeuSerSerGluAlaProAlaLeuPheGlnPheAspLeuLysSerGlyPheLcuGlnPhePheLeu 946 GCTCCTAAATTTAATGACGAAGAATAAATGTAAATTATCTATATAGTTGTATACTAAAAATAATAAACAAAAAAA 251 AlaProLysPheAsnAspGluGlu 1021 AAACAGTAAAGTTTGTTTTAAATGAAAATAAATAACAAAGAAAATAAAGACTAAGTAGTCAGTTAATATCAGCAT 1096 TTTTGTGTGACTTATACAGTATTTATGACATATCTTACATTAATCTAGA Figure 2. DNA sequence of the Mlul-Xbal fragment and deduced protein sequence of yPCNA. The POL30 sequence data will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Databases under the accession number X16676. The underlined amino acid residues correspond to those obtained from protein sequencing of the intact protein (residues 1-41), or a tryptic fragment thereof (residues 231 -240) . Arrows indicate RNA start sites as mapped by primer extension analysis (34). Both stan sites are used with approximately equal efficiency. The underlined DNA sequence is identical with a sequence upstream of the POL3 gene. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research 263 or a smaller derivative (pBL205) (see Materials and Methods). Further mapping and sequencing defined the gene to a Mlul-Xbal ACT1 fragment (Figure 1A). The DNA sequence of the 1.1 kb Mlul- Xbal fragment and the deduced amino acid sequence of yPCNA P0L 1 are given in Fig. 2. An open reading frame for a 28,916 dalton protein was found. This is larger than the M of purified POL 3 yPCNA as observed by SDS-PAGE (26-27 kDa), suggesting that the purified yPCNA may be a proteolytic fragment. POL 30 However, amino acid sequence data from a tryptic fragment obtained from pure yPCNA yielded sequence data near the carboxy terminus (residues 231-240), indicating that our purified yPCNA could at most be missing the 18 carboxy terminal residues. In addition, we have recently expressed yPCNA in E. 2 80 coli using an appropriate expression system, and the resulting rr E 70 purified protein has exactly the same SDS-PAGE size and enzymatic properties as the protein purified from yeast (Burgers | 60 et al., unpublished results). | 50 A null mutant of yPCNA was created in vitro by deleting the internal EcoRV fragment (160 bp) and inserting a 1.1 kb HindHl = 30 fragment from YEp24 containing the URA3 gene (Fig. IB). The resulting modified POL30 gene was removed from the plasmid by digestion with Mlul and transformed into diploid strain PY2/YM599 (see Materials and Methods) to disrupt one of the 0 two copies of the gene by a double crossover event (26). Tetrad 30 60 90 120 150 180 210 240 analysis of the sporulated diploid showed that the POL30 gene Time (hours) is essential for spore viability. Of 18 tetrads analyzed, 10 produced two viable spores and 8 produced one viable spore. Figure 3. Cell cycle regulated expression in mitotic cells. NCYC239 cells, All viable spores were Ura~. Sporulation of the control diploid synchronized by the feed-starve method were shifted to rich media. Samples were strain gave (of 10 tetrads dissected) 6 tetrads with 4 viable spores, removed at intervals and total RNA extracted for Northern blot analysis. A, The 3 tetrads with 3 viable spores, and 1 tetrad with 2 viable spores, blot was probed with radioactively labelled fragments of the ACT1, POL1, POL3 indicating that the low spore viability of the parental strain was and POL30 genes. B, Densitometric scanning of the autoradiogram obtained from the cause of the relatively high number of tetrads with 1 viable probing of the blot with the POL30 gene. The bar in the graph identifies the period of DNA synthesis (from ref. 12,20). spore in the disruption strain. These results show that the POL30 gene is essential for growth. A large chromosomal deletion of the yPCNA gene was generated by transforming the PY2/YM599 the manufacturer's directions. The blots were probed with diploid to Ura+ with the integrating plasmid pBL208 (Figure 32P-labelled probes to the coding sequences of the ACT1, 1C). Cells which had then excised the plasmid by intramolecular POL1, POL3 and POL30 genes (8,22,23). Probes were prepared recombination leaving the deleted copy of the gene in the using the random primer method (24). chromosome were selected by plating on 5-fluoroorotic acid containing plates and subsequently screened by Southern blot RESULTS analysis (27,28). Sporulation and tetrad analysis showed that this deletion was also lethal. The deletion mutant, however, was The sequence of the amino-terminal 41 residues of yPCNA was complemented by a plasmid containing the POL30 gene on a 2.1 determined on an automated sequenator from the protein bound kb Mlul fragment inserted into centromere vector yCp50 to a polyvinylidene difluoride membrane (15). Using this (pBL211, see Materials and Methods) when the heterozygous information, we made two oppositely-oriented degenerate diploid was transformed with this plasmid prior to sporulation. oligonucleotides (see Materials and Methods) and subjected them to the polymerase chain reaction (PCR) with genomic yeast 190 bp upstream from the initiation codon is a Mlul (ACGCGT) DNA (17). The resulting amplified 120 bp DNA fragment was site which is also present in one or more copies upstream from used as a probe to /flnJUI-digested yeast genomic DNA in a a large number of genes involved in DNA metabolism that are Southern blot analysis. Hybridization was to a single 17 kb band. periodically expressed during the cell cycle (23). This sequence Accordingly, a yeast genomic library of 10—20 kb HindXR is also present upstream from the start site of the POL3 (CDC2) fragments was made in the centromere vector YCp50. Three gene (8). Even more strikingly, a 14 bp stretch at the Mlul site identical clones were obtained by screening this library with the (ACGCGTAACTTTTT) is identical for the P0L3 (CDC2) and 120 bp fragment. POL30 (yPCNA) genes (Ref. 8, Fig. 2), suggesting that both genes may be similarly regulated. Cell cycle dependent expression The yPCNA gene is designated POL30 because PCNA is a of the P0L3 and POL30 genes was measured after subunit of DNA polymerase 8 (III) and the gene designation for synchronization of NCYC239 cells by the feed-starve method the catalytic polypeptide (formerly designated CDC2) should be (12,19). This type of synchronization gave results identical to considered as POL3 (8,9). The POL30 gene was mapped to the elutriation or a-Factor synchronization when cell-cycle dependent left arm of chromosome n (25) (results not shown). After expression of the POL1 and CDC9 genes was studied (12,20). restriction mapping, a 2.1 kb Mlul fragment was subcloned into The timing of POL3 and POL30 expression was indistinguishable pUC19 in such a way that the Mlul sites were regenerated and from each other and from that of the POL1 gene, with steady- all further manipulations were done with this plasmid (pBL203) Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 264 Nucleic Acids Research state mRNA levels of all three genes rising sharply in late G1 , continuing through S, and decreasing again in the late S phase (Figure 3). As a control, expression of the actin gene (ACT!) was cell-cycle independent. The poor signal obtained with the 90 POL 30 POL3 probe was due to the low levels of POL3 mRNA (Figure 3). Quantitative dot blot analysis of steady state mRNA levels 2 80 in asynchronously growing cells showed that the abundance of tr POL30 mRNA is 2-3 fold higher than POLI, and 10-fold higher E 70 than POL3 mRNA (data not shown). The POL30 and POLI mRNA levels also rose coordinately £ 60 when the diploid strain SK-l was induced to sporulate in a | 50 synchronous fashion (Figure 4). In these blots, however, the POLS (CDC2) mRNA could not be detected above background < 40 noise. Again, increase in the mRNA levels precedes meiotic DNA CD replication. ~ 30 I 20 DISCUSSION The use of amino acid sequence derived oppositely oriented 0 degenerate oligonucleotides as primers for a polymerase chain 0 1 2 3 4 6 reaction with total nuclear DNA proved to be a facile way to generate a probe for isolation of the full-length gene (29). Only Time (hours) one fragment of the expected size (120 bp) was produced. The coding region of the POL30 gene is preceded by a 190 bp regulatory region which contains a consensus TATA box, the ACT1 RNA start site(s) and a ACGCGT sequence (a MM site) presumed to be required for cell cycle regulated gene expression POL1 (23). This 190 bp upstream region was sufficient to allow complementation of a POL30 deletion mutant by the wild-type gene on a centromere plasmid. Whether the entire region is 5 6 2 3 4 required for proper expression has not yet been determined. Time (hours) The putative amino acid sequence of yPCNA shows ca. 35% homology to that of the human PCNA (30) (Fig. 2). While Figure 4. Regulation of mRNA levels during meiosis. Late-log phase SK-l cells yPCNA can fully stimulate calf thymus DNA polymerase 6 by were transferred to sporulation medium and samples taken and processed as described in Materials and Methods and in the Legend to Figure 3. The same increasing its processivity of action, it cannot substitute for human RNA samples were used for different blots in A and B. A. The blot was probed PCNA in the in vitro SV40 DNA replication system (14). This with the POL30 gene and the autoradiogram scanned with a densitometer. The low homology at the amino acid level can also explain why human bar indicates the region of premeiotic DNA synthesis (from ref. 12,20). B. The polyclonal antisera from lupus patients, which react with blot was probed with the ACT1 and POLI genes. HUMAN 1 SIP EAR LVQQS I LKK VLEA L KOLINEACWDISS S QSM D SSHVStVQli TLR S EQF DT YEAST 1 §j L| FEEASL F QAV D K|R I I DQ FKDCVQLVNFQCKE D DSRVL LVS L E I QV AFQE AcMNPV 1 llF H E iFKTQA V LKR LVET F KOLLPHATFDCDN R SMQVMD KK TSHVALVSLQLH A EGF HUMAN 6 1 IC O R N L AM Q V N L TfBjMjSK J LK CAQNED I I TLRL E 0 N A P T L A L V JE A P NQ E K V SD IEMKLUD YEAST 6 1 RCOHPVTLGMDLTS L SK I LR CQNNTDTLT L l| NTPO S I I LL jEDTKKD R I A E SLlKLUD 6 1 ICORNVPLNV S I NS L AcMNPV VK CjVNERSSVLMK(AjEDQQ(DjVMAFVgJNN - -DN R I C SK I TLIKLUC L(5|VEOC|GfT HUMAN 12 1 PEQESISCVVKMP AR I CR LS H I QDAVV I SCApKlDQVK flS A 3NQ N I YEAST 1 2 1 IKII EELO|DSTLSLP DADF F S K I V R LSQLSDSINIMI T |V A £>L ET IK flSGSV AcMNPV 1 1 9 PDSDVDCVVHM I FAQVC K DVEHl TQFDHDIIVSC S KGL OiR A 6SAD V HUMAN 18 1 KLSQTSNVDKEEEAVTIEMNE PffilQ L DVPLVVEY K YEAST 18 1 I I KPFVDMEHPET S I KLEMDQP^JD EAPALFQF D AcMNPV 17 9 QMSA - - -DNENFS V - LKAKQ ITVT PFKLEY C HUMAN 24 1 YY E - - OS LARK DE I YEAST 2 4 1 L K S - tiQ F F F - - ND Ei LAPK AcMNPV 2 3 4 I K D V 9jV L A C F I VNN D I F LAP * EE Figure 5. Protein comparison of human, yeast, and AcMNPV PCNA sequences. Protein sequence homology was determined using the Wilbur/Lipman PRTALN alignment program (35). Boxed residues indicate identity between all three PCNA sequences. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020 Nucleic Acids Research 265 21 . Elder, R.T., Loh, E.Y. & Davis, R.W. (1983) Proc. Natl. Acad. Sci. USA mammalian PCNA, do not react with yPCNA (14). Recently it 80, 2432-2435. has been reported that the baculovirus Autographa californica 22. Galwitz, D. & Sures, I. (1980) Proc. Natl. Acad. Sci. USA 77, 2546-2550. nuclear polyhedrosis virus (AcMNPV) has a gene that encodes 23. Pizzagalli, A., Valsasnini, P., Plevani, P. & Lucchini, G. (1988) Proc. Natl. a protein, ETL, that has significant homology to rat PCNA (31), Acad. Sci. USA 85, 3772-3776. which in turn is virtually identical to the human PCNA. The 24. Feinberg, A.P. & Fogelstein, B. (1983) Anal. Biochem. 132, 6-13 . 25. Carle, G.F. & Olson, M.V. (1985) Proc. Natl. Acad. Sci. USA 82, possibility that ETL functions similarly to yeast and calf thymus 3756-3760 (1985). PCNA is further supported by the finding that the AcMNPV also 26. Rothstein, R.J. (1983) Methods Enzymol. 101, 202-211. encodes a DNA polymerase with 5-like properties, i.e. aphidicolin 27. Scherer, S. & Davis, R.W. (1979) Proc. Natl. Acad. Sci. USA 76, sensitivity, and a 3' —5 ' exonuclease activity (32). This AcMNPV 4951-4954. ETL protein is 34% homologous to yeast PCNA (Fig. 5). When 28. Boeke, J.D., LaCroute, F. & Fink, G.R. (1984) Mol. Gen. Genet. 797, 345-346 . all three PCNA sequences are analyzed together (human, yeast, 29. Gould, S.J., Subramani, S. & Scheffler, I.E. (1989) Proc. Natl. Acad. Sci. and AcMNPV), there are definite domains of homology which USA 86, 1934-1938. might be important for protein-protein interaction with the 5 30. Almendral, J.M., Huebsch, D., Blundell, P.A., Macdonald-Brown, H. & polymerase (33). Bravo, R. (1987) Proc. Natl. Acad. Sci. USA 84, 1575-1579. 31. O'Reilly, D.R., Crawford, A.M. & Miller, L.K. (1989) Nature 337, 606. These results indicate that yPCNA plays a necessary role in 32. Mikhailov, V.J., Marlyev, K.A., Ataeva, J.O., Kullyev, P.K. & Atrazhev, yeast, presumably in its interaction with DNA polymerase 8 A.M. (1986) Nucleic Acids Res. 14, 3841-3857. during DNA replication. This interaction appears to be conserved 33. Bauer, G.A. & Burgers, P.M.J. (1988) Biochim. Biophys. Acta 951, through evolution, since yeast PCNA can sustitute for calf thymus 274-279 . PCNA in vitro. Also, domains of homology between human, 34. Krainer, A.R., Maniatis, T., Ruskin, B. & Green, M.R. (1984) Cell 36, 993-1005. yeast and AcMNPV PCNA suggest a functional conservation 35. Wilbur, W.J. & Lipman, D.J. (1983) Proc. Natl. Acad. Sci. USA 80, between these three very diverse organisms. 736-740 . ACKNOWLEDGEMENTS We thank Kim Percival for excellent technical assistance, John Majors for helpful suggestions, and Jim Dutchik and Maynard Olson for physical mapping of the POL30 gene. Protein sequence analysis and oligonucleotide synthesis was carried out in the Protein Chemistry Laboratory of Washington University School of Medicine. Supported by a grant from the National Institutes of Health. P.M.J.B. is an established investigator of the American Heart Association. REFERENCES 1. So, A.G. & Downey, K.M. (1988) Biochemistry 27, 4591-4595. 2. Tan, C.K., Castillo, C , So, A.G. & Downey, K.M. (1986) J. Biol. Chem. 261, 12310-12316. 3. Bravo, R., Frank, R., Blundell, P.A. & MacDonald-Bravo, H. (1987) Nature 326, 515-517. 4. Prelich, G., Tan, C.K., Kostura, M., Mathews, M.B., Sa, A.G., Downey, K.M. & Stillman, B. (1987) Nature 362, 517-520. 5. Prelich, G., Kostura, M., Marshak, D.R., Mathews, M.B. & Stillman, B. (1987) Nature 326, 471-475. 6. Prelich, G. & Stillman, B. (1988) Cell 53, 117-126. 7. Burgers, P.M.J., (1989) Progr. Nucleic Acids Res. Mol. Biol. 37, 235-280. 8. Boulet, A., Simon, M., Faye, G., Bauer, G.A. & Burgers, P.M.J., (1989) EMBO J. 8, 1849-1854. 9. Sitney, K.C., Budd, M.E. & Campbell, J.L. (1989) Cell 56, 599-605. 10. Bauer, G.A., Heller, H.M. & Burgers, P.M.J. (1988) J. Biol. Chem. 263, 917-924 . 11. Pringle, J.R. & Hartwell, L.H. (1981) In: The Molecular Biology of the yeast Saccharomyces (Strathern, J., Jones, E.W., and Broachs, J., Eds.), CSHL Press, Cold Spring Harbor, NY, Vol. I, pp. 97-142. 12. White, J.H.M., Barker, D.G., Nurse, P. & Johnston, L.H. (1986) EMBO J. 5, 1705-1709. 13. Sherman, F., Fink, G.R. & Hicks, J.B. (1986) Methods in Yeast Genetics, CSHL, Cold Spring Harbor, NY. 14. Bauer, G.A. & Burgers, P.M.J. (1988) Proc. Natl. Acad. Sci. USA 85, 7506-7510. 15. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038. 16. Bennetzen, J.L. & Hall, B.D. (1982) J. Biol. Chem. 257, 3026-3031. 17. Saike, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. & Erlich, H.A. (1986) Science 239, 487-491. 18. Broach, J.R. (1983) Methods in Enzymol. 101, 307-325. 19. Williamson, D.H. & Scopes, A.W. (1962) Nature 193, 256-257. 20. Johnston, L.H., White, J.H.M., Johnson, A.L., Lucchini, G. & Plevani, P. (1987) Nucleic Acids Res. 15, 5017-5030. Downloaded from https://academic.oup.com/nar/article/18/2/261/5490705 by DeepDyve user on 14 August 2020

Journal

Nucleic Acids Research – Oxford University Press

Published: Jan 25, 1990

There are no references for this article.