Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Blood cell transcriptomic-based early biomarkers of adverse programming effects of gestational calorie restriction and their reversibility by leptin supplementation

Blood cell transcriptomic-based early biomarkers of adverse programming effects of gestational... OPEN Blood cell transcriptomic-based early biomarkers of adverse programming SUBJECT AREAS: GENE EXPRESSION effects of gestational calorie restriction OBESITY and their reversibility by leptin Received 25 September 2014 supplementation Accepted 19 February 2015 Jadwiga Konieczna*, Juana Sa´nchez*, Mariona Palou, Catalina Pico´ & Andreu Palou Published 13 March 2015 Laboratory of Molecular Biology, Nutrition and Biotechnology (Nutrigenomics), University of the Balearic Islands (UIB) and CIBER Fisiopatologı ´a de la Obesidad y Nutricion (CIBEROBN), Palma de Mallorca, Spain. Correspondence and requests for materials The challenge of preventing major chronic diseases requires reliable, early biomarkers. Gestational mild should be addressed to undernutrition in rats is enough to program the offspring to develop later pathologies; the intake of leptin, a breastmilk component, during lactation may reverse these programming effects. We used these models to C.P. ([email protected]) identify, in peripheral blood mononuclear cells (PBMCs), transcriptomic-based early biomarkers of programmed susceptibility to later disorders, and explored their response to neonatal leptin intake. Microarray analysis was performed in PBMCs from the offspring of control and 20% gestational * These authors calorie-restricted dams (CR), and CR-rats supplemented with physiological doses of leptin throughout contributed equally to lactation. Notably, leptin supplementation normalised 218 of the 224 mRNA-levels identified in PBMCs this work. associated to undernutrition during pregnancy. These markers may be useful for early identification and subsequent monitoring of individuals who are at risk of later diseases and would specifically benefit from the intake of appropriate amounts of leptin during lactation. revention is the new paradigm in personalized nutrition and medicine. This perspective may benefit the approach to major chronic diseases such as obesity and its related pathologies, because of their increased P worldwide prevalence and difficulty to treat. The development of effective preventive strategies requires reliable early biomarkers. The biomarkers that are conventionally used to predict the risk of obesity and its co- morbidities mainly involve body weight, BMI, blood pressure, lipid profile, and plasma glucose and insulin levels. Bearing in mind the complexity of the mechanisms contributing to obesity and its related pathologies, there is a 1–3 need for multiple novel biomarkers beyond the prediction of traditional metabolic risk factors . Application of early transcript-based metabolic markers might be more beneficial, providing more information regarding disease or physiological changes occurring in the body before phenotipic features become evidente, as well as 4,5 giving more time to intervene in the prevention of a future disease . Studies on molecular mechanisms revealing effects of diet on health usually imply invasive tissue biopsies . However, suitability of biomarkers for effective use requires that they can be easily accessed in humans. Peripheral blood mononuclear cells (PBMCs) provide an 5,7–9 attractive alternative, as they can be easily and repeatedly collected in sufficient quantities . These cells are able to respond to internal and external signals, and thereby have been proposed as a source of biomarkers of health and disease, as their gene expression profile may reflect the physiological and pathological state of the 8–12 organism . Identification of early biomarkers requires the use of suitable animal models with a different predisposition to subsequent diseases. Of particular interest are the models whose bias is acquired due to the influence of common environmental and nutritional factors. In this sense, there is an accumulating body of evidence showing that maternal nutrition during the perinatal period has significant effects on fetal growth and can exert powerful 13,14 influences upon long-term health and well-being . In this context, human and animal models associate maternal calorie-restriction during pregnancy with adverse health outcomes in adult offspring, mainly related, but not restricted, to the development of obesity, cardiovascular diseases and type II diabetes, particularly when SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 1 www.nature.com/scientificreports 15–18 exposed postnatally to obesogenic conditions . Although the fac- Results tors involved in the programming effects are not clearly known, the Anthropometric measurements and circulating parameters in the 19,20 role of the hormone leptin is receiving special attention . offspring. Description of the phenotype of pups at birth and after Leptin is mainly produced by the adipose tissue, but is also nat- 30 weaning has been previously published . Here we summarize data urally present in significant amounts in breast milk . In addition to related to body weight, body fat content and blood parameters the well established role of leptin in the regulation of energy home- (Table 1). Although mild maternal calorie restriction during 22,23 ostasis in adulthood , it has been shown to play a critical role gestation had no effects on the body weight of neonate rats, after during development by programming hypothalamic circuit forma- weaning CR pups weighed less and exhibited lower body fat content tion during a neonatal restricted window, which coincides with an than controls (p , 0.05; LSD post hoc one-way ANOVA test). 24,25 increase in plasma leptin levels, the so called leptin surge . In this Mentioned parameters were not influenced by oral leptin sense, our group and others have evidenced that maternal under- treatment throughout lactation (p , 0.05; LSD post hoc one-way nourishment during gestation in rodents, which is associated to a ANOVA test) . 15,26 disturbed neonatal leptin surge , perturbs hypothalamic structure As previously published , either maternal calorie restriction dur- 27–29 and function , and hence results in a greater propensity for obesity ing gestation or leptin treatment throughout lactation did not affect and insulin resistance development in adulthood. More recently, we circulating glucose and insulin levels at juvenile age (day 25); how- have also shown that daily administration of oral leptin at physiolo- ever, oral leptin treatment during the suckling period partially gic doses throughout lactation to the offspring of moderate calorie- reverted the decreased plasma leptin levels found in CR males (p restricted dams during gestation, was able to revert most of the , 0.05; LSD post hoc one-way ANOVA test). developmental malprogramming effects on hypothalamic structure and function . Similarly, daily subcutaneous injection of leptin into Gene expression in PBMCs of male animals at the age of 25 days neonatal rats born to undernourished mothers has been shown to based on whole-genome microarray analysis. Whole genome prevent the development of a programmed trend towards obesity 31,32 microarray analysis was performed in PBMCs of 25 day-old male and other metabolic alterations in later life . Positive effects of oral animals belonging to the 3 groups of animals (control, CR, and CR- leptin during lactation are not restricted to the offspring of calorie- Leptin). Of the 45,220 probes tested, 36,122 probes remained after restricted dams. We described for the first time that oral treatment background correction, normalization and merged replicated clones with physiological doses of leptin throughout lactation to the off- and were further taken into account. In all, 473 unique genes spring of ad libitum fed dams during gestation, protects againsts age- were found to be significantly different between control and related overweight and prevents metabolic alterations associated to 19,33,34 CR male animals (p # 0.010; limma t-test). Using available the intake of a high-fat diet . Other studies – which addressed databases (Genecards, KEGG, NCBI, Reactome, UniProt, USCN, the effects of early postnatal diet on healthy, lasting outcomes – WikiPathways), these genes were classified into several biological revealed that infants who are breastfed are less likely to become obese 35,36 processes according to their function. 249 genes were unknown than those who are exclusively formula fed , and a negative asso- and were not considered. From the remaining 224 known genes, ciation has been found between maternal milk leptin levels and body 58 exhibited down-regulation and 166 up-regulation (Figure 1). weight increase of infants , which has been confirmed by other 38,39 The processes with the highest number of differentially expressed groups . Thus, leptin may be considered as an essential factor genes were related to transcription/translation machinery, immune during lactation in the protection against subsequent overweight, system, signaling, cell turnover and metabolism of proteins and obesity and its co-morbidities in later life, and may also be worth polyamines. Other processes with a notable number of genes considering when searching for strategies to reverse programmed 40,41 whose expression was altered were related to transport, metabo- susceptibility to obesity acquired by fetal undernutrition . lism of lipids, cytoskeleton, sensory perception, nervous system Therefore, in the present study, we used whole genome transcrip- and neural signaling. The remaining genes were related to cell tome profiling of PBMCs of pups from calorie-restricted dams dur- ing gestation in order to identify early biomarkers of programmed communication, blood (including genes related to blood coagu- lation, or with specific functions of hemapoietic cells), metabo- susceptibility to obesity-related chronic diseases and to determine whether supplementation with physiological doses of leptin during lism of carbohydrates, epigenetic modification, metabolism of the suckling period is able to revert these markers of developmental nucleotides, metabolism of vitamins and minerals, and redox malprogramming. metabolism. Other biological processes such as fertilization, Table 1 | Offspring parameters: anthropometric measurements and circulating parameters in the offspring of rats with free access to standard chow diet (control), the offspring of 20% calorie restricted dams during the first 12 days of pregnancy (CR), and CR rats daily supplemented with physiological doses of leptin throughout lactation (CR-Leptin) Males Females Control CR CR-Leptin Control CR CR-Leptin Anthropometric measurements Body weight, day 1 (g) 6.57 6 0.18 6.37 6 0.11 6.45 6 0.12 6.38 6 0.08 6.15 6 0.13 6.18 6 0.12 Body weight, day 21 (g) 47.0 6 0.9 a 43.2 6 0.9 b 43.9 6 0.9 b 45.4 6 0.6 a 42.2 6 0.8 b 42.8 6 0.8 b Body weight, day 25 (g) 65.5 6 1.1 a 59.6 6 1.2 b 60.2 6 1.2 b 61.7 6 0.7 a 58.5 6 1.2 b 57.0 6 1.0 b Body fat, day 25 (%) 12.4 6 0.3 a 10.1 6 0.2 b 10.5 6 0.2 b 12.2 6 0.2 a 10.5 6 0.2 b 10.5 6 0.2 b Circulating parameters (day 25) Glucose (mg/dL) 148 6 4 145 6 2 138 6 4 149 6 4 148 6 5 142 6 4 Insulin (ng/L) 170 6 24 204 6 33 221 6 59 248 6 41 240 6 49 163 6 52 Leptin (ng/L) 2206 6 170 a 1798 6 121 b 2042 6 45 a,b 1689 6 241 1461 6 145 1414 6 129 Body weight was measured on postnatal days 1, 21 and 25. The other parameters were determined on day 25. Data are mean 6 S.E.M. For body weight at different days and body fat content, n 5 16–17; for circulating parameters, n 5 6–8. Each group is made up of animals coming from at least six different litters. Statistics: data not sharing a common letter are significantly different (a ? b) (p , 0.05; LSD post hoc one-way ANOVA test). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 2 www.nature.com/scientificreports Figure 1 | Microarray data classification into biological processes of the genes differentially expressed in PBMCs between male offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. Threshold of significance was set at p # 0.010 (limma t-test). The number of genes down- or up-regulated is indicated for each group of genes. detoxification, angiogenesis, and embryonic development, were pups as well as to verify whether the described changes were also grouped with the name ‘others’. occurring in females, expression levels of a selected set of genes 2 the Subsequently, we performed statistical analyses to compare 22 genes whose expression levels were completely normalized in leptin-treated CR male pups 2 were analysed by RT-qPCR. mRNA expression levels between CR and CR-Leptin groups and between CR-Leptin and control groups. Of the 224 known genes Among those genes, the expression levels were found to be differently expressed in CR pups vs controls (p # 0.010; limma t- quantifiable by RT-qPCR for: collapsin response mediator protein 1(Crmp1); digestive organ expansion factor homolog (zebrafish) test), 22 of these were found to be different between CR and CR- Leptin groups (p # 0.010; limma t-test) and simultaneously not (Diexf); fos-like antigen 1 (Fosl1); galactosidase, alpha (Gla); glutaminase (Gls); low density lipoprotein receptor-related protein statistically different between control and CR-Leptin pups; thus, we assumed that the expression levels of these genes were totally 11 (Lrp11); polyamine oxidase (exo-N4-amino) (Paox); ring finger reverted by oral leptin treatment throughout lactation. The detailed protein 10 (Rnf10); selenium binding protein 1 (Selenbp1); solute carrier family 7 (amino acid transporter light chain, L system), list of these genes is shown in Table 2. Transcript levels of the remain- ing 196 genes, which appeared to be affected by moderate maternal member 5 (Slc7a5); thymosin beta 4, X-linked (Tmsb4x); and calorie restriction during gestation, became partially reverted by lep- ubiquitin associated and SH3 domain containing, B (Ubash3b). The expression patterns of these genes in male and female animals tin treatment throughout lactation (Supplementary Table 1). These include the set of genes whose expression profile differed signifi- are shown in Figure 3. RT-qPCR analysis fully confirmed most of the microarray data in male pups, and gene expression profile was largely cantly in CR vs control males (p # 0.010; limma t-test) but did not differ significantly in CR-Leptin vs CR and CR-Leptin vs control similar in females. In detail, considering males and females, animals. Only 6 of the 224 genes whose expression levels were chan- gestational calorie restriction resulted in higher mRNA levels of Crmp1, Gla, Gls, Lrp11, Paox, Tmsb4x and Ubash3b; in turn, leptin ged due to gestational calorie restriction (CR vs control males, p # 0.010; limma t-test) were not reverted by leptin treatment through- treatment throughout lactation significantly diminished transcript out lactation, as their expression levels did not differ between CR and levels of these genes to the control values, reversing the effects observed in CR animals (p , 0.05; LSD post hoc two-way ANOVA CR-Leptin groups and were significantly different between control and CR-Leptin groups (p# 0.010; limma t test). These genes were the test). following: cardiomyopathy associated 5 (Cmya5); defensin, alpha, 24 Differences concerning Rnf10 and Selenbp1 expression levels iden- tified using the microarrays were partially confirmed by RT-qPCR (Defa24); desmoglein 2 (Dsg2); secretory leukocyte peptidase inhib- itor (Slpi); tryptophan hydroxylase 2 (Tph2); and tripartite motif- analysis. Gestational calorie restriction brought about down-regu- lation of mRNA levels of both genes in CR animals (p # 0.05; LSD containing 23 (Trim23). These are related to the immune system, cell turnover, neural signaling and metabolism of protein processes. post hoc two-way ANOVA). In turn, leptin supplementation The results from the array concerning the 224 genes differently throughout lactation partially normalized their levels to those observed in controls (p # 0.05; LSD post hoc two-way ANOVA). expressed between control and CR groups across individual samples are depicted in a heat map (Figure 2). This figure illustrates the RT-qPCR analysis revealed that mRNA levels of Diexf and Slc7a5 similarity between control and CR-Leptin groups concerning the showed different expression pattern between sexes (interaction between group and sex; p # 0.05; two-way ANOVA). Leptin treat- expression pattern of these genes. ment throughout lactation resulted in total reversion of increased Confirmation of microarray results in male animals by RT-qPCR Diexf mRNA expression levels in CR females (p # 0.05; LSD post hoc and verification in females. To confirm gene array findings in male one-way ANOVA), whereas no statistical differences were observed SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 3 www.nature.com/scientificreports Table 2 | Detailed list of genes whose expression in PBMC samples of male rats at the age of 25 days was affected by gestational calorie restriction and totally reverted by oral leptin supplementation throughout lactation CR vs Controls CR-Leptin vs CR Biological process Gene name Gene symbol Sequence ID P FC P FC Cell communication Small cell adhesion glycoprotein Smagp NM_182817 0.000 20.50 0.006 10.41 Cell turnover Digestive organ expansion factor Diexf NM_001013986 0.002 10.73 0.006 20.66 homolog (zebrafish) Fos-like antigen 1 Fosl1 NM_012953 0.003 20.64 0.009 10.60 Selenium binding protein 1 Selenbp1 NM_080892 0.001 20.93 0.007 10.81 Cytoskeleton Myosin IIIB Myo3b NM_001191901 0.007 20.42 0.010 10.43 Thymosin beta 4, X-linked Tmsb4x NM_031136 0.010 10.84 0.010 20.91 Metabolism (carbohydrates) Galactosidase, alpha Gla NM_001108820 0.004 10.88 0.004 20.96 Metabolism (lipids) Arachidonate lipoxygenase 3 Aloxe3 NM_001105793 0.009 20.54 0.005 10.63 Butyryl Coenzyme A synthetase 1 Bucs1 NM_001108502 0.004 20.47 0.004 10.51 Low density lipoprotein receptor-related Lrp11 NM_001106217 0.002 10.70 0.001 20.77 protein 11 Metabolism (proteins Glutaminase Gls NM_001109968 0.008 10.74 0.007 20.80 and polyamines) Polyamine oxidase (exo-N4-amino) Paox NM_001106311 0.008 10.62 0.010 20.64 Ubiquitin associated and SH3 domain Ubash3b NM_001191792 0.010 10.45 0.000 20.65 containing, B Neural signaling Cholinergic receptor, nicotinic, delta Chrnd NM_019298 0.006 20.56 0.004 10.62 Gamma-aminobutyric acid (GABA) A Gabra6 NM_021841 0.002 21.00 0.004 10.96 receptor, alpha 6 Glutamate receptor, metabotropic 6 Grm6 NM_022920 0.010 20.66 0.004 10.79 Nervous system Collapsin response mediator protein 1 Crmp1 NM_012932 0.004 10.82 0.008 20.78 Myelin transcription factor 1 Myt1 NM_001108615 0.007 20.57 0.005 10.64 Ring finger protein 10 Rnf10 NM_001011904 0.003 21.22 0.010 11.11 Signaling Calcium channel, voltage-dependent, Cacna1c ENSRNOT00000009343 0.006 20.65 0.009 10.66 L type, alpha 1C subunit Transport Fyve and coiled-coil domain containing 1 Fyco1 NM_001106870 0.003 10.57 0.010 20.51 Solute carrier family 7 (amino acid Slc7a5 NM_017353 0.007 20.87 0.000 11.20 transporter light chain), member 5 Controls: the offspring of rats with free access to standard chow diet; CR: the offspring of 20% calorie restricted dams during the first 12 days of pregnancy; CR-Leptin: CR rats daily supplemented with physiological doses of leptin throughout lactation. p-values (P ) of microarray data (limma t-test) and fold change (FC) values (calculated as the difference between Log2 means) of CR vs Controls and CR- Leptin vs CR comparisons are indicated; 1, indicates upregulation; 2, downregulation. Threshold of significance was set at p # 0.010. Expression levels of these genes were not significantly different between control and CR-Leptin groups. in males either due to gestational calorie restriction or due to leptin implement effective therapeutic and/or preventive strategies. A treatment throughout lactation. Regarding Slc7a5 mRNA levels, as growing number of studies exploring nutrigenomic-derived biomar- 4,8,9,42,43 confirmed with both techniques used, decreased expression levels of kers focus on blood cells as a surrogate tissue , since they can be this gene in CR animals were restored due to leptin treatment easily and repeatedly collected in humans, and hence may give a throughout lactation in males, but not in females (p # 0.05; LSD chance to apply results obtained from animal studies into humans. post hoc one-way ANOVA). On the other hand, regarding obesity prevention, neonatal leptin RT-qPCR analysis of Fosl1 did not fully confirm the expression treatment in rats has been found to prevent age- and high fat diet 19,33,34 pattern of this gene observed with the microarray analysis: although feeding-related overweight and other metabolic alterations . its expression levels were confirmed to be diminished in CR males vs Moreover, the intake of adecuate amounts of leptin during the suck- controls (p# 0.05; LSD post hoc one-way ANOVA), leptin treatment ling period has been proposed as one of the strategies for reversing throughout lactation did not restore its control levels (p # 0.05; the effects of metabolic disorders induced as a consequence of devel- LSD post hoc one-way ANOVA). Nevertheless, single comparison opmental programming . Therefore, in this study we undertook between groups revealed that CR-Leptin males exhibited a trend to these issues and attempted to identify early biomarkers that predict higher Fosl1 mRNA levels relative to their CR counterparts (p 5 programmed susceptibility to obesity-related chronic diseases 0.064; Student’s t test). Expression levels of Fosl1 in females were caused by moderate undernutrition during gestation and to monitor not different between groups. the response to neonatal leptin treatment using transcript-based biomarkers identified in PBMCs. The outcomes of maternal undernutrition during gestation on the Discussion offspring have been broadly discussed in scientific literature. This One of the major challenges in developed societies is to implement prenatal condition exerts adverse health effects on the offspring, therapeutic and, even more interestingly, preventive strategies, to leading to hyperphagia, hypertension and greater fat accumula- fight the increasing prevalence of obesity and its related metabolic 16,18 15 tion , impaired insulin and leptin sensitivity , alterations in the disorders. In this regard, there is an increased need for identification structure and expression of neuropeptides regulating feeding beha- of reliable, early biomarkers of propensity to these alterations . This 28,29 viour in hypothalamus as well as alterations in adipose tissue and could serve as a tool to improve the accuracy of disease diagnose and 44,45 stomach sympathetic innervations . Our study, for the first time, effectiveness of its prevention, as well as to monitor the efficacy of reveals, at transcriptional level, the whole of the detrimental pro- therapy used. Therefore, adding novel multimarkers beyond the tra- gramming sequelae induced by mild gestational calorie restriction, ditional risk factors for obesity development may substantially through whole-genome transcriptome profiling of PBMCs of male improve early identification of susceptible individuals in order to SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 4 www.nature.com/scientificreports Figure 2 | Heat map representing indicidual expression data of the genes differentially expressed in PBMCs between male offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. Rows represent the 224 genes differentially expressed between control and CR pups (p , 0.010, limma t-test), sorted by fold change. Columns represent the log2 value of the expression of each gene in each animal studied. SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 5 www.nature.com/scientificreports Figure 3 | Q-PCR substantiation of microarray data of genes affected by gestational calorie restriction and totally reverted by oral leptin supplementation throughout lactation. To confirm and verify consistency of array findings, RT-qPCR was performed in PBMCs samples of both male and female offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. mRNA levels were expressed as a percentage of the mean value of male controls. Data are mean 6 S.E.M (n 5 7–10 animals/group). Statistical analysis was performed by considering males and females as a whole (p # 0.05; two-way ANOVA), and separately for each sex (p # 0.05; one-way ANOVA). At any rate, data not sharing a common letter (a and b) are significantly different (a? b) (p , 0.05; LSD post hoc one-way and two-way ANOVA). Symbols: G, effect of group; GxS; interaction between the effect of group and the effect of sex (p , 0.05; two-way ANOVA); *,CR vs Controls (p , 0.05; Student’s t test); #, CR-Leptin vs CR (p , 0.05; Student’s t test); NS, not statistically significant. SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 6 www.nature.com/scientificreports pathways, and showed a significant association with some of the offspring. The rational for performing microarray analysis only in males results from previous findings indicating that the overall det- disease outcomes, although their specific function in PBMCs has not been generally explored. rimental effects of this prenatal condition were more marked in males than in females, particularly in terms of overweight and fat Herewith, we identified a comprehensive set of easily assessed 15,16,46 transcript-based biomarkers, with a particular emphasis for 7 of accumulation . Herein, we found that prenatal food restriction affected mRNA levels of 224 genes expressed in PBMCs. Induced them (Crmp1, Gla, Gls, Lrp11, Paox, Tmsb4x and Ubash3b), reflect- ing the reversion of a wide system of developmentally programmed changes in gene expression are mainly related to transcription and biological processes induced by relative fetal undernutrition. translation machinery, followed by genes related to immune system, Although the exact function of each of these genes in PBMCs which is not surprising as PBMCs are a subset of white blood cells. remains to be determined, identification of these markers, indicators Gestational calorie restriction also affected PBMCs expression of of efficacy of neonatal leptin treatment, supports evidence of the genes involved, among others, in signalling, cell turnover, metabol- positive effects of leptin intake during the suckling period on later ism, transport, cytoskeleton, sensory perception, nervous system and health programming. neural signaling. Hence, we identified a comprehensive set of easily Taken together, the results from this study show that leptin sup- assessed transcript-based biomarkers that reflect a wide system of plementation throughout lactation is able to revert the expression of biological processes and can improve prediction of the programmed most of the identified potential early biomarkers of programmed susceptibility to obesity and other pathologies induced by fetal obesity risk and other metabolic alterations associated to undernu- undernutrition. Although it is true that, nowadays, the phenomenon trition during pregnancy. These findings support the potential of prenatal maternal undernutrition does not seem to be responsible importance of leptin during lactation, a specific compound of mater- for the increasing prevalence of obesity in developed countries, it nal milk, which might be of relevance when considering strategies to might account for the increasing trends in the incidence of obesity- treat and/or prevent the programmed trend to diseases acquired by related pathologies in developing countries where maternal mal- inadequate fetal nutrition, particularly in susceptible subgroups. nutrition is still widespread . Moreover, fetal undernutrition may Moreover, the biomarkers identified in the present study, if validated also arise as a result of deficiency caused by maternal failure of in humans, may allow the identification and subsequent monitoring complete absorption of food components and differences in sea- of individuals at early ages who are at greater risk of developing sonal food availability . obesity and other pathologies, and whose alterations can be reverted Interestingly, we also show here the overall effects of leptin sup- by the intake of adequate amounts of leptin during lactation. plementation throughout the suckling period in reverting gene expression alterations in PBMCs induced by maternal undernutri- Methods tion during gestation. Neonatal leptin treatment normalized the Ethics statement. All experiments were performed in accordance with the approved expression of almost all of the genes whose expression was affected guidelines. The animal protocol was approved by the Bioethical Committee of the by calorie restriction during gestation in male offspring, with the University of the Balearic Islands (Resolution Number 8453. June, 2010). exception of 6 genes. Among the 218 genes whose expression was normalized, 196 genes reverted partially and 22 were totally reverted. Animals and Experimental Design. The animal protocol followed in this study has been previously described in detail . Briefly, male and female Wistar rat pups coming The results highlight the potential role of leptin during the suckling from 17 litters and belonging to 3 different groups (control, CR and CR-Leptin) were period, which might be worth considering when searching for strat- used, according to the schema presented in Figure 4. Animals were housed under egies to treat and/or prevent the programmed trend to obesity standard laboratory conditions (12 h dark and light cycle, 22uC) and allowed free acquired by inadequate fetal nutrition, particularly in susceptible access to water and a standard chow diet (3.3 kcal/g; Panlab, Barcelona, Spain), unless specified. subgroups. Microarray findings in PBMC samples from male ani- Virgin female rats were mated with male rats. After conception, the group of mals were substantiated by analyzing expression levels of a selection calorie-restricted dams (n 5 10 animals) was submitted to 20% calorie restriction diet of genes by RT-qPCR. We focused on the 22 genes whose expression during the first 12 days of gestation, while the group of control dams (n 5 7 animals) levels were completely normalized in leptin-treated CR male pups. was fed ad libitum. After delivery, male and female offspring of calorie-resticted dams was distributed into two groups: CR and CR-Leptin. The group of CR-Leptin pups mRNA expression levels of the same set of genes were also deter- was treated orally throughout lactation with a water solution of recombinant murine mined in PBMC samples of female animals to verify whether their leptin (PeproTech, London, UK). As established previously , the dosis of leptin was behaviour was similar to that of males. Among the 22 genes analyzed, at physiological level, progressively increased from 1 ng to 43.8 ng through this expression levels of several of these (Crmp1, Gla, Gls, Lrp11, Paox, period. CR pups and the offspring of control dams (controls) were treated orally with the vehicle (water). Tmsb4x and Ubash3b) emerged as particularly promising to be used At weaning (day 21), pups from control, CR and CR-Leptin groups (35, 34 and 33 as biomarkers because qPCR analyses fully confirmed microarray pups, respectively) were followed. They were housed (n 5 2 per cage) and fed on a data and showed similar behavior between males and females. In standard chow diet until their decapitation at the age of 25 days, under ad libitum addition to the aforementioned genes, other genes such as Rnf10, feeding conditions. After sacrifice, trunk blood was collected from neck for PBMCs isolation and gene expression analysis (n 5 10–11 animals per group), and for plasma Selenbp1, Diexf and Slc7a5 may also be of interest. qPCR analysis circulating parameters determination (n 5 6–8 per group). To obtain the plasma, of the expression of Rnf10 and Selenbp1 genes in both genders blood was collected in heparinized tubes and centrifuged at 1000 g for 10 min. showed similar patterns to those found for males with the microarray Animals used for analyses were from a minimum of six different litters. analysis, although decreased expression levels occurring in CR ani- PBMC isolation. Trunk blood samples of control, CR and CR-Leptin rats collected at mals vs their controls were only partially reverted by leptin treatment the age of 25 days under ad libitum feeding conditions, were used to isolate PBMCs. during lactation. Sexual dimorphism was found concerning the Peripheral blood samples were collected using EDTA (final concentration of 3– expression pattern of the Diexf and Slc7a5 genes in blood cells as 4 mM) as anticoagulant, and then diluted with an equal volume of buffered saline an effect of treatment. The increased expression levels of the Diexf (isosmotic). PBMCs were immediately isolated by OptiPrep density-gradient separation (Sigma Aldrich Quı mica SA, Madrid, Spain) according to the gene became totally reverted by leptin treatment, but only in the manufacturer’s instructions. group of females, and no changes were found in males. Con- cerning Slc7a5, decreased expression levels of this gene occurring Total RNA isolation. Total RNA was extracted from PBMCs of control, CR and CR- in CR animals were only normalized by leptin treatment during Leptin male and female animals by EZNA TOTAL RNA kit I (Omega Bio-Tek Inc., lactation in males, but not in females. Details regarding the proteins Norcross, GA, USA) following the manufacturer’s instructions. encoded by these genes and their potential functions are included as Microarray processing. For microarray analysis, RNA from PBMC samples obtained supplementary material (Supplementary Table 2). Besides the anno- from male offspring of controls, CR and CR-Leptin animals at the age of 25 days were tated basal function of proteins encoded by these genes, some of used (n 5 10–11/group). RNA samples were analyzed on Agilent 2100 Bioanalyzer them have been found to serve as a bridge for several key biological with RNA 6000 Nano chips (Agilent Technologies, Barcelona, Spain). To ensure the SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 7 www.nature.com/scientificreports Figure 4 | Schematic diagram of experimental design. After conception, the group of calorie-restricted dams was supplied with 20% calorie restriction diet from day 1 to day 12 of gestation, while the group of control dams was fed ad libitum. At birth, the offspring of control dams (control) was treated orally with vehicle throughout lactation, and the offspring of calorie restricted dams was divided into two groups: one group was also treated orally with vehicle (CR) and the other group was treated with a daily oral dose of leptin (CR-Leptin) throughout lactation. Daily oral dose of leptin was 5 times the average amount of daily leptin intake from maternal milk. Offspring was weaned at the age of 21 days and fed with normal fat diet until their sacrifice at the age of 25 days, when blood samples for plasma and PBMCs were obtained. high quality of RNA, only samples having a RIN number $ 8 were used for quantified, and the raw data were extracted using Feature Extraction Software version microarrays (n 5 8/group). Then, 80 ng of RNA from each sample was reverse 10.10.1.1 (Agilent Technologies). Background correction and normalization were transcribed to complementary DNA (cDNA) using the Agilent Low Input Quick performed within the Babelomics platform (http://www.babelomics.org), a suite of Amp Labeling kit (Agilent Technologies), according to the manufacturer’s protocol. web tools for microarray data analysis . Differential gene expression between groups Half of the cDNA sample (10 ml) was used for the linear amplification of RNA and of animals (CR vs controls, CR-Leptin vs CR, and CR-Leptin vs controls) was assessed labeling with cyanine-3 (Cy3) or Cy5. For these reactions, half of the amounts using the limma package from Bioconductor, implemented into Babelomics web 49 51 indicated by the manufacturer were used . Transcription and labeling were carried platform . The threshold of significance for the test was set at p # 0.010. out at 40uC for 2 h. Then, the labeled and amplified cRNA samples were purified Subsequently, a statistically generated list of genes was manually analyzed in regard to using Qiagen Rneasy MiniSpin columns (Qiagen, Madrid, Spain). The incorporation their biological information, obtained with the use of available databases (Genecards, of dyes and cRNA concentration was measured using the NanoDrop ND 1000 KEGG, NCBI, Reactome, UniProt, USCN, WikiPathways) based on key biological spectrophotometer (NanoDrop Techonologies, Ins., Wilmington, DE). Of the 24 domains, such as molecular function and biological process. Genes whose expression samples, 20 were used for microarray analysis. Four samples (2 samples in the CR and levels were significantly different between control and CR groups were plotted in a 2 samples in the CR-Leptin group) were excluded because of a low yield (,825 ng) heatmap using R (v 3.1.1, R Development Core Team). To control for false positives and low specific activity (,8.0 pmol Cy3 or Cy5 per mg of cRNA). Subsequently, each we performed the Benjamin-Hochberg false discovery rate (FDR) test; all the genes sample containing 825 ng of cRNA labeled with Cy5 and 825 ng of Cy3 pool were with a p , 0.01 had an adjusted p value , 0.42. Fold change (FC), defined here as a hybridized on 4 3 44 K G2519F rat whole genome Agilent microarrays (Agilent difference in log2 mean values between experimental groups, was also calculated Technologies) for 17 h at 65uC in hybridization chambers in an oven rotating at within the Babelomics platform. 10 rpm (Agilent Technologies). After hybridization, the arrays were washed using Gene Expression (GE) Wash Buffer Kit (Agilent Technologies). The arrays were Real-time quantitative RT-polymerase chain reaction (RT-qPCR) analysis. To rinsed in GE Wash Buffer 1 for 1 min, GE Wash Buffer 2 for 1 min, followed by validate microarray data, mRNA expression levels of selected genes: collapsin acetonitrile for 10 s, and finally with a Stabilization and Drying Solution for 30 s at response mediator protein 1 (Crmp1); digestive organ expansion factor homolog room temperature, according to the manufacturer’s protocol (Agilent Technologies). (zebrafish) (Diexf); fos-like antigen 1 (Fosl1); galactosidase, alpha (Gla); glutaminase (Gls); low density lipoprotein receptor-related protein 11 (Lrp11); polyamine oxidase Microarray data analysis. The arrays were scanned with an Agilent Microarray (exo-N4-amino) (Paox); ring finger protein 10 (Rnf10); selenium binding protein 1 Scanner (Agilent Technologies). Scanned images were examined for visible defects (Selenbp1); solute carrier family 7 (amino acid transporter light chain, L system), and proper grid alignment. The intensities of the signals from each spot were member 5 (Slc7a5); thymosin beta 4, X-linked (Tmsb4x); ubiquitin associated and Table 3 | Sequences of primers and amplicon size used for qRT-PCR Gene Forward primer (59 to 39) Reverse primer (59 to 39) Amplicon (bp) Crmp1 TGATTGTTCCTGGTGGAGTG GGATTTGGTGTCTGCTGCTT 248 Diexf TTCTACGACAGGGTTTCCAAG GCCATCTTCACCATTCATTTC 258 Fosl1 GCAGAAACCGAAGAAAGGAA CTGGAGAAAGGGAGATACAAGG 261 Gla CCCGAGAGGGATTCAAAG TACCCCAGTCAGCAAATGTC 199 Gls GGAGGGAAGGTTGCTGATTA AGGACTGAAGACAAAAGGGAAC 133 Lrp11 ACAGACGACCACGCCATT CCTGGGAAGCACAGTCACA 198 Paox TGGCTGTCCTGAATACCTTCTT TCAAAAACCATCACCTCCTTG 190 Psm6 TGGCTATGAGATTCCTGTGG CTGTCTGCTTCACTCCTGCT 206 Rnf10 GGGGGAAAAGAAACAAGTGG AAGGTGTCAGGGTCAGCAAA 124 Selenbp1 TGACCGCTTCCTCTACTTCA CTCGTTTTCCCTTGACCACT 194 Slc7a5 CCTGCCTCTGCGTGCTACT CCCTTGTCCTATGTCCTTTCC 155 Tmsb4x GCTCCTTCCAGCAACCAT GGGGCAGCACAGTCATTT 278 Ubash3b ACTTCATCGGGCTCTTTGTG TGTTCTGGGCGAGTTTCTCT 189 Abbreviations: Collapsin response mediator protein 1 (Crmp1); Digestive organ expansion factor homolog (zebrafish) (Diexf); Fos-like antigen 1 (Fosl1); Galactosidase, alpha (Gla); Glutaminase (Gls); Low density lipoprotein receptor-related protein 11 (Lrp11); Polyamine oxidase (exo-N4-amino) (Paox); Proteasome (prosome, macropain) subunit, alpha type 6 (Psm6); Ring finger protein 10 (Rnf10); Selenium binding protein 1 (Selenbp1); Solute carrier family 7 (amino acid transporter light chain, L system), member 5 (Slc7a5); Thymosin beta 4, X-linked (Tmsb4x); Ubiquitin associated and SH3 domain containing, B (Ubash3b). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 8 www.nature.com/scientificreports SH3 domain containing, B (Ubash3b) were measured by RT-qPCR in PBMC RNA 18. Vickers, M. H., Breier, B. H., Cutfield, W. S., Hofman, P. L. & Gluckman, P. D. samples of control, CR and CR-Leptin male animals. In addition, mRNA expression Fetal origins of hyperphagia, obesity, and hypertension and postnatal levels of the same set of genes were analyzed in PBMC samples of control, CR and CR- amplification by hypercaloric nutrition. Am. J. Physiol Endocrinol. Metab 279, Leptin female animals to verify the manner of their response to the treatments used. E83–E87 (2000). 19. Pico, C. et al. The intake of physiological doses of leptin during lactation in rats For RT-qPCR analysis, 0.05 mg of PBMC total RNA was used for reverse tran- TM scription by using iScript cDNA synthesis kit (Bio-Rad Laboratories, S.A., Madrid, prevents obesity in later life. Int J Obes (Lond) 31, 1199–1209 (2007). Spain) according to the manufacturer’s protocol. 20. Jones, R. Obesity: Leptin intake during the suckling period may protect against TM Real-time PCR was performed using the Applied Biosystems StepOnePlus Real- obesity and metabolic-related disorders. Nat Rev Gastroenterol Hepatol. 7,359 (2010). Time PCR Systems (Applied Biosystems, Madrid Spain) with Power SYBER Green PCR Master Mix (Applied Biosystems). Each PCR was performed from 1/5 dilution 21. Houseknecht, K. L., McGuire, M. K., Portocarrero, C. P., McGuire, M. A. & of the cDNA product and forward and reverse primers (5 mM each). The sequences of Beerman, K. Leptin is present in human milk and is related to maternal plasma primers purchased from Sigma Genosys (Sigma Aldrich Quı´ mica SA, Madrid, Spain) leptin concentration and adiposity. Biochem. Biophys. Res. Commun. 240, are described in Table 3. After an initial Taq activation at 95uC for 10 min, PCR was 742–747 (1997). performed using 40 two-temperature cycles with the following cycling conditions: 22. Schwartz, M. W., Woods, S. C., Porte, D., Jr., Seeley, R. J. & Baskin, D. G. Central 95uC for 15 s and 60uC for 1 min. The threshold cycle (Ct) values were calculated by nervous system control of food intake. Nature 404, 661–671 (2000). the StepOne Software v2.2.2, and the relative mRNA expression of each gene was 23. Arora, S. & Anubhuti. Role of neuropeptides in appetite regulationand obesity--a 2DDCt 52 expressed as a percentage of male control rats, using the 2 method . Proteasome review. Neuropeptides 40, 375–401 (2006). (prosome, macropain) subunit, alpha type 6 (Psm6) was chosen as reference gene 24. Bouret, S. G., Draper, S. J. & Simerly, R. B. Trophic Action of Leptin on because our microarray data showed equal expression of this gene across all groups. Hypothalamic Neurons That Regulate Feeding. Science 304, 108–110 (2004). 25. Bouret, S. G. & Simerly, R. B. Developmental programming of hypothalamic Statistical analysis. Data are expressed as mean 6 SEM. The statistical analysis of feeding circuits. Clin Genet. 70, 295–301 (2006). microarray data has been described in detail in the previous section (microarray data 26. Yura, S. et al. Role of premature leptin surge in obesity resulting from intrauterine analysis). Statistical significances were assessed by one-way (separately for each sex) undernutrition. Cell Metab 1, 371–378 (2005). and two-way ANOVA, and least significance difference (LSD) post hoc test. Student’s 27. Delahaye, F. et al. Maternal perinatal undernutrition drastically reduces postnatal t test was used to compare individual means. P , 0.05 was defined as the threshold of leptin surge and affects the development of arcuate nucleus proopiomelanocortin significance, unless stated. Statistics were computed with SPSS Statistics 19.0 (SPSS, neurons in neonatal male rat pups. Endocrinology 149, 470–475 (2008). Chicago, IL). 28. Ikenasio-Thorpe, B. A., Breier, B. H., Vickers, M. H. & Fraser, M. Prenatal influences on susceptibility to diet-induced obesity are mediated by altered neuroendocrine gene expression. J. Endocrinol. 193, 31–37 (2007). 1. Musaad, S. & Haynes, E. N. Biomarkers of Obesity and Subsequent 29. Garcia, A. P. et al. Moderate caloric restriction during gestation results in lower Cardiovascular Events. Epidemiologic Reviews 29, 98–114 (2007). arcuate nucleus NPY- and alphaMSH-neurons and impairs hypothalamic 2. Schneider, H. J. et al. Incremental effects of endocrine and metabolic biomarkers response to fed/fasting conditions in weaned rats. Diabetes Obes Metab 12, and abdominal obesity on cardiovascular mortality prediction. PLoS One 7, 403–413 (2010). e33084 (2012). 30. Konieczna, J. et al. Oral Leptin Treatment in Suckling Rats Ameliorates 3. Balagopal, P. B. et al. Nontraditional risk factors and biomarkers for Detrimental Effects in Hypothalamic Structure and Function Caused by Maternal cardiovascular disease: mechanistic, research, and clinical considerations for Caloric Restriction during Gestation. PLoS One 8, e81906 (2013). youth: a scientific statement from the American Heart Association. Circulation 31. Vickers, M. H. et al. Neonatal leptin treatment reverses developmental 123, 2749–2769 (2011). programming. Endocrinology 146, 4211–4216 (2005). 4. de Mello, V., Kolehmanien, M., Schwab, U., Pulkkinen, L. & Uusitupa, M. Gene 32. Vickers, M. H. et al. The effect of neonatal leptin treatment on postnatal weight expression of peripheral blood mononuclear cells as a tool in dietary intervention gain in male rats is dependent on maternal nutritional status during pregnancy. studies: What do we know so far? Mol Nutr Food Res 56, 1160–1172 (2012). Endocrinology 149, 1906–1913 (2008). 5. Konieczna, J. et al. Identification of early transcriptome-based biomarkers related 33. Sanchez, J. et al. Oral supplementation with physiological doses of leptin during to lipid metabolism in peripheral blood mononuclear cells of rats nutritionally lactation in rats improves insulin sensitivity and affects food preferences later in programmed for improved metabolic health. Genes Nutr 9, 366 (2014). life. Endocrinology 149, 733–740 (2008). 6. Viguerie, N. et al. Transcriptomics applied to obesity and caloric restriction. 34. Priego, T., Sanchez, J., Palou, A. & Pico, C. Leptin intake during the suckling Biochimie 87, 117–123 (2005). period improves the metabolic response of adipose tissue to a high-fat diet. Int J 7. de Mello, V. et al. Downregulation of genes involved in NFkappaB activation in Obes (Lond) 34, 809–819 (2010). peripheral blood mononuclear cells after weight loss is associated with the 35. von Kries, R. et al. Breast feeding and obesity: cross sectional study. BMJ 319, improvement of insulin sensitivity in individuals with the metabolic syndrome: 147–150 (1999). the GENOBIN study. Diabetologia 51, 2060–2067 (2008). 36. Armstrong, J. & Reilly, J. J. Breastfeeding and lowering the risk of childhood 8. Oliver, P., Reynes, B., Caimari, A. & Palou, A. Peripheral blood mononuclear cells: obesity. Lancet 359, 2003–2004 (2002). a potential source of homeostatic imbalance markers associated with obesity 37. Miralles, O., Sanchez, J., Palou, A. & Pico, C. A physiological role of breast milk development. Pflugers Arch 465, 459–68 (2013). leptin in body weight control in developing infants. Obesity. (Silver. Spring) 14, 9. Caimari, A., Oliver, P., Keijer, J. & Palou, A. Peripheral blood mononuclear cells as 1371–1377 (2006). a model to study the response of energy homeostasis-related genes to acute 38. Schuster, S., Hechler, C., Gebauer, C., Kiess, W. & Kratzsch, J. Leptin in maternal changes in feeding conditions. OMICS. 14, 129–141 (2010). serum and breast milk: association with infants’ body weight gain in a longitudinal 10. Bouwens, M., Afman, L. A. & Muller, M. Fasting induces changes in peripheral study over 6 months of lactation. Pediatr. Res 70, 633–637 (2011). blood mononuclear cell gene expression profiles related to increases in fatty acid 39. Doneray, H., Orbak, Z. & Yildiz, L. The relationship between breast milk leptin beta-oxidation: functional role of peroxisome proliferator activated receptor and neonatal weight gain. Acta Paediatr. 98, 643–647 (2009). alpha in human peripheral blood mononuclear cells. Am J Clin Nutr 86, 40. Pico, C., Jilkova, Z. M., Kus, V., Palou, A. & Kopecky, J. Perinatal programming of 1515–1523 (2007). body weight control by leptin: putative roles of AMP kinase and muscle 11. Manoel-Caetano, F. S. et al. Gene expression profiles displayed by peripheral thermogenesis. Am J Clin Nutr 94, 1830S–1837S (2011). blood mononuclear cells from patients with type 2 diabetes mellitus focusing on 41. Vickers, M. H. & Sloboda, D. M. Strategies for reversing the effects of metabolic biological processes implicated on the pathogenesis of the disease. Gene 511, disorders induced as a consequence of developmental programming. Front 151–160 (2012). Physiol 3, 242 (2012). 12. Burczynski, M. E. & Dorner, A. J. Transcriptional profiling of peripheral blood 42. Sanchez, J. et al. Blood cells as a source of transcriptional biomarkers of childhood cells in clinical pharmacogenomic studies. Pharmacogenomics. 7, 187–202 (2006). obesity and its related metabolic alterations: results of the IDEFICS study. J Clin 13. Sullivan, E. L. & Grove, K. L. Metabolic imprinting in obesity. Forum Nutr 63, Endocrinol Metab 97, E648–E652 (2012). 186–194 (2010). 43. Priego, T. et al. Influence of breastfeeding on blood-cell transcript-based 14. Pico, C., Palou, M., Priego, T., Sanchez, J. & Palou, A. Metabolic programming of biomarkers of health in children. Pediatr Obes 9, 463–470 (2014). obesity by energy restriction during the perinatal period: different outcomes 44. Garcia, A. P. et al. Moderate caloric restriction during gestation in rats alters depending on gender and period, type and severity of restriction. Front Physiol 3, adipose tissue sympathetic innervation and later adiposity in offspring. PLoS One 436 (2012). 6, e17313 (2011). 15. Palou, M. et al. Impaired insulin and leptin sensitivity in the offspring of moderate 45. Garcia, A. P. et al. Early alterations in plasma ghrelin levels in offspring of calorie- caloric-restricted dams during gestation is early programmed. J. Nutr. Biochem. restricted rats during gestation may be linked to lower sympathetic drive to the 23, 1627–1639 (2012). stomach. Peptides 39, 59–63 (2013). 16. Palou, M., Priego, T., Sanchez, J., Palou, A. & Pico, C. Sexual dimorphism in the 46. Jones, A. P. & Friedman, M. I. Obesity and adipocyte abnormalities in offspring of lasting effects of moderate caloric restriction during gestation on energy rats undernourished during pregnancy. Science 215, 1518–1519 (1982). homeostasis in rats is related with fetal programming of insulin and leptin 47. Rasmussen, K. M. The ‘‘fetal origins’’ hypothesis: challenges and opportunities for resistance. Nutr Metab (Lond) 7, 69 (2010). maternal and child nutrition. Annu Rev Nutr 21, 73–95 (2001). 17. Ravelli, G. P., Stein, Z. A. & Susser, M. W. Obesity in young men after famine 48. McArdle, H. J. & Ashworth, C. J. Micronutrients in fetal growth and development. exposure in utero and early infancy. N. Engl. J. Med. 295, 349–353 (1976). Br Med Bull. 55, 499–510 (1999). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 9 www.nature.com/scientificreports 49. van Schothorst, E. M., Pagmantidis, V., de Boer, V. C., Hesketh, J. & Keijer, J. tools: J.K., J.S. and M.P. Wrote the manuscript: J.K., C.P. and A.P. All authors revieved the Assessment of reducing RNA input for Agilent oligo microarrays. Anal Biochem final manuscript. 363, 315–317 (2007). 50. Medina, I. et al. Babelomics: an integrative platform for the analysis of Additional information transcriptomics, proteomics and genomic data with advanced functional Supplementary information accompanies this paper at http://www.nature.com/ profiling. Nucleic Acids Res 38, W210–W213 (2010). scientificreports 51. Smyth, G. K. Limma: linear models for microarray data. In: Bioinformatics and computational biology solutions using R and Bioconductor 23, 397–420 (2005). Competing financial interests: A.P., C.P. and J.S. are authors of a patent held by the 52. Pfaffl, M. W. A new mathematical model for relative quantification in real-time University of the Balearic Islands entitled ‘‘Use of leptin for the prevention of excess body RT-PCR. Nucleic Acids Res 29, e45 (2001). weight and composition containing leptin’’ (WO 2006089987 A1) (Priority data: 23 February 2005). A.P., C.P., J.K., J.S. and M.P. are authors of a patent application of the University of the Balearic Islands entitled ‘‘Method for the prediction and or prevention of overweight, obesity and/or its complications by gene expression analyses’’. (P201430428, Acknowledgments Spain) (Priority data: 26 March 2014). This study was supported by the Spanish Government (grant AGL2012-33692), the ´ ´ How to cite this article: Konieczna, J., Sanchez, J., Palou, M., Pico, C. & Palou, A. Blood cell European Union’s Seventh Framework Programme FP72007–2013 under grant agreement transcriptomic-based early biomarkers of adverse programming effects of gestational n. 244995 (BIOCLAIMS Project), and the Instituto de Salud Carlos III, Centro de calorie restriction and their reversibility by leptin supplementation. Sci. Rep. 5, 9088; Investigacio´ n Biome´ dica en Red Fisiopatologı´ a de la Obesidad y Nutricio´ n, CIBERobn. The DOI:10.1038/srep09088 (2015). Laboratory belongs to the Nutrigenomics-group, awarded as ‘‘Group of Excellence’’ of CAIB and supported by ‘‘Direccio´ General d’Universitats, Recerca i Transfere` ncia del This work is licensed under a Creative Commons Attribution 4.0 International Coneixement’’ of Regional Government (CAIB) and FEDER funds (EU Contract: n. License. The images or other third party material in this article are included in the FP6-506360). Jadwiga Konieczna is granted with a PhD fellowship entitled ‘‘beca para la article’s Creative Commons license, unless indicated otherwise in the credit line; if formacion de personal investigador, en el marco de un programa operativo cofinanciado the material is not included under the Creative Commons license, users will need por el Fondo Social Europeo’’. to obtain permission from the license holder in order to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ Author contributions Conceived and designed the experiments: A.P. and C.P. Performed the experiment: J.K., J.S. and M.P. Analyzed the data: J.K., J.S. and C.P. Contributed reagents/materials/analysis SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 10 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Scientific Reports Springer Journals

Blood cell transcriptomic-based early biomarkers of adverse programming effects of gestational calorie restriction and their reversibility by leptin supplementation

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/blood-cell-transcriptomic-based-early-biomarkers-of-adverse-pZ6Vf1gAkA

References (80)

Publisher
Springer Journals
Copyright
Copyright © 2015 by The Author(s)
Subject
Science, Humanities and Social Sciences, multidisciplinary; Science, Humanities and Social Sciences, multidisciplinary; Science, multidisciplinary
eISSN
2045-2322
DOI
10.1038/srep09088
Publisher site
See Article on Publisher Site

Abstract

OPEN Blood cell transcriptomic-based early biomarkers of adverse programming SUBJECT AREAS: GENE EXPRESSION effects of gestational calorie restriction OBESITY and their reversibility by leptin Received 25 September 2014 supplementation Accepted 19 February 2015 Jadwiga Konieczna*, Juana Sa´nchez*, Mariona Palou, Catalina Pico´ & Andreu Palou Published 13 March 2015 Laboratory of Molecular Biology, Nutrition and Biotechnology (Nutrigenomics), University of the Balearic Islands (UIB) and CIBER Fisiopatologı ´a de la Obesidad y Nutricion (CIBEROBN), Palma de Mallorca, Spain. Correspondence and requests for materials The challenge of preventing major chronic diseases requires reliable, early biomarkers. Gestational mild should be addressed to undernutrition in rats is enough to program the offspring to develop later pathologies; the intake of leptin, a breastmilk component, during lactation may reverse these programming effects. We used these models to C.P. ([email protected]) identify, in peripheral blood mononuclear cells (PBMCs), transcriptomic-based early biomarkers of programmed susceptibility to later disorders, and explored their response to neonatal leptin intake. Microarray analysis was performed in PBMCs from the offspring of control and 20% gestational * These authors calorie-restricted dams (CR), and CR-rats supplemented with physiological doses of leptin throughout contributed equally to lactation. Notably, leptin supplementation normalised 218 of the 224 mRNA-levels identified in PBMCs this work. associated to undernutrition during pregnancy. These markers may be useful for early identification and subsequent monitoring of individuals who are at risk of later diseases and would specifically benefit from the intake of appropriate amounts of leptin during lactation. revention is the new paradigm in personalized nutrition and medicine. This perspective may benefit the approach to major chronic diseases such as obesity and its related pathologies, because of their increased P worldwide prevalence and difficulty to treat. The development of effective preventive strategies requires reliable early biomarkers. The biomarkers that are conventionally used to predict the risk of obesity and its co- morbidities mainly involve body weight, BMI, blood pressure, lipid profile, and plasma glucose and insulin levels. Bearing in mind the complexity of the mechanisms contributing to obesity and its related pathologies, there is a 1–3 need for multiple novel biomarkers beyond the prediction of traditional metabolic risk factors . Application of early transcript-based metabolic markers might be more beneficial, providing more information regarding disease or physiological changes occurring in the body before phenotipic features become evidente, as well as 4,5 giving more time to intervene in the prevention of a future disease . Studies on molecular mechanisms revealing effects of diet on health usually imply invasive tissue biopsies . However, suitability of biomarkers for effective use requires that they can be easily accessed in humans. Peripheral blood mononuclear cells (PBMCs) provide an 5,7–9 attractive alternative, as they can be easily and repeatedly collected in sufficient quantities . These cells are able to respond to internal and external signals, and thereby have been proposed as a source of biomarkers of health and disease, as their gene expression profile may reflect the physiological and pathological state of the 8–12 organism . Identification of early biomarkers requires the use of suitable animal models with a different predisposition to subsequent diseases. Of particular interest are the models whose bias is acquired due to the influence of common environmental and nutritional factors. In this sense, there is an accumulating body of evidence showing that maternal nutrition during the perinatal period has significant effects on fetal growth and can exert powerful 13,14 influences upon long-term health and well-being . In this context, human and animal models associate maternal calorie-restriction during pregnancy with adverse health outcomes in adult offspring, mainly related, but not restricted, to the development of obesity, cardiovascular diseases and type II diabetes, particularly when SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 1 www.nature.com/scientificreports 15–18 exposed postnatally to obesogenic conditions . Although the fac- Results tors involved in the programming effects are not clearly known, the Anthropometric measurements and circulating parameters in the 19,20 role of the hormone leptin is receiving special attention . offspring. Description of the phenotype of pups at birth and after Leptin is mainly produced by the adipose tissue, but is also nat- 30 weaning has been previously published . Here we summarize data urally present in significant amounts in breast milk . In addition to related to body weight, body fat content and blood parameters the well established role of leptin in the regulation of energy home- (Table 1). Although mild maternal calorie restriction during 22,23 ostasis in adulthood , it has been shown to play a critical role gestation had no effects on the body weight of neonate rats, after during development by programming hypothalamic circuit forma- weaning CR pups weighed less and exhibited lower body fat content tion during a neonatal restricted window, which coincides with an than controls (p , 0.05; LSD post hoc one-way ANOVA test). 24,25 increase in plasma leptin levels, the so called leptin surge . In this Mentioned parameters were not influenced by oral leptin sense, our group and others have evidenced that maternal under- treatment throughout lactation (p , 0.05; LSD post hoc one-way nourishment during gestation in rodents, which is associated to a ANOVA test) . 15,26 disturbed neonatal leptin surge , perturbs hypothalamic structure As previously published , either maternal calorie restriction dur- 27–29 and function , and hence results in a greater propensity for obesity ing gestation or leptin treatment throughout lactation did not affect and insulin resistance development in adulthood. More recently, we circulating glucose and insulin levels at juvenile age (day 25); how- have also shown that daily administration of oral leptin at physiolo- ever, oral leptin treatment during the suckling period partially gic doses throughout lactation to the offspring of moderate calorie- reverted the decreased plasma leptin levels found in CR males (p restricted dams during gestation, was able to revert most of the , 0.05; LSD post hoc one-way ANOVA test). developmental malprogramming effects on hypothalamic structure and function . Similarly, daily subcutaneous injection of leptin into Gene expression in PBMCs of male animals at the age of 25 days neonatal rats born to undernourished mothers has been shown to based on whole-genome microarray analysis. Whole genome prevent the development of a programmed trend towards obesity 31,32 microarray analysis was performed in PBMCs of 25 day-old male and other metabolic alterations in later life . Positive effects of oral animals belonging to the 3 groups of animals (control, CR, and CR- leptin during lactation are not restricted to the offspring of calorie- Leptin). Of the 45,220 probes tested, 36,122 probes remained after restricted dams. We described for the first time that oral treatment background correction, normalization and merged replicated clones with physiological doses of leptin throughout lactation to the off- and were further taken into account. In all, 473 unique genes spring of ad libitum fed dams during gestation, protects againsts age- were found to be significantly different between control and related overweight and prevents metabolic alterations associated to 19,33,34 CR male animals (p # 0.010; limma t-test). Using available the intake of a high-fat diet . Other studies – which addressed databases (Genecards, KEGG, NCBI, Reactome, UniProt, USCN, the effects of early postnatal diet on healthy, lasting outcomes – WikiPathways), these genes were classified into several biological revealed that infants who are breastfed are less likely to become obese 35,36 processes according to their function. 249 genes were unknown than those who are exclusively formula fed , and a negative asso- and were not considered. From the remaining 224 known genes, ciation has been found between maternal milk leptin levels and body 58 exhibited down-regulation and 166 up-regulation (Figure 1). weight increase of infants , which has been confirmed by other 38,39 The processes with the highest number of differentially expressed groups . Thus, leptin may be considered as an essential factor genes were related to transcription/translation machinery, immune during lactation in the protection against subsequent overweight, system, signaling, cell turnover and metabolism of proteins and obesity and its co-morbidities in later life, and may also be worth polyamines. Other processes with a notable number of genes considering when searching for strategies to reverse programmed 40,41 whose expression was altered were related to transport, metabo- susceptibility to obesity acquired by fetal undernutrition . lism of lipids, cytoskeleton, sensory perception, nervous system Therefore, in the present study, we used whole genome transcrip- and neural signaling. The remaining genes were related to cell tome profiling of PBMCs of pups from calorie-restricted dams dur- ing gestation in order to identify early biomarkers of programmed communication, blood (including genes related to blood coagu- lation, or with specific functions of hemapoietic cells), metabo- susceptibility to obesity-related chronic diseases and to determine whether supplementation with physiological doses of leptin during lism of carbohydrates, epigenetic modification, metabolism of the suckling period is able to revert these markers of developmental nucleotides, metabolism of vitamins and minerals, and redox malprogramming. metabolism. Other biological processes such as fertilization, Table 1 | Offspring parameters: anthropometric measurements and circulating parameters in the offspring of rats with free access to standard chow diet (control), the offspring of 20% calorie restricted dams during the first 12 days of pregnancy (CR), and CR rats daily supplemented with physiological doses of leptin throughout lactation (CR-Leptin) Males Females Control CR CR-Leptin Control CR CR-Leptin Anthropometric measurements Body weight, day 1 (g) 6.57 6 0.18 6.37 6 0.11 6.45 6 0.12 6.38 6 0.08 6.15 6 0.13 6.18 6 0.12 Body weight, day 21 (g) 47.0 6 0.9 a 43.2 6 0.9 b 43.9 6 0.9 b 45.4 6 0.6 a 42.2 6 0.8 b 42.8 6 0.8 b Body weight, day 25 (g) 65.5 6 1.1 a 59.6 6 1.2 b 60.2 6 1.2 b 61.7 6 0.7 a 58.5 6 1.2 b 57.0 6 1.0 b Body fat, day 25 (%) 12.4 6 0.3 a 10.1 6 0.2 b 10.5 6 0.2 b 12.2 6 0.2 a 10.5 6 0.2 b 10.5 6 0.2 b Circulating parameters (day 25) Glucose (mg/dL) 148 6 4 145 6 2 138 6 4 149 6 4 148 6 5 142 6 4 Insulin (ng/L) 170 6 24 204 6 33 221 6 59 248 6 41 240 6 49 163 6 52 Leptin (ng/L) 2206 6 170 a 1798 6 121 b 2042 6 45 a,b 1689 6 241 1461 6 145 1414 6 129 Body weight was measured on postnatal days 1, 21 and 25. The other parameters were determined on day 25. Data are mean 6 S.E.M. For body weight at different days and body fat content, n 5 16–17; for circulating parameters, n 5 6–8. Each group is made up of animals coming from at least six different litters. Statistics: data not sharing a common letter are significantly different (a ? b) (p , 0.05; LSD post hoc one-way ANOVA test). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 2 www.nature.com/scientificreports Figure 1 | Microarray data classification into biological processes of the genes differentially expressed in PBMCs between male offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. Threshold of significance was set at p # 0.010 (limma t-test). The number of genes down- or up-regulated is indicated for each group of genes. detoxification, angiogenesis, and embryonic development, were pups as well as to verify whether the described changes were also grouped with the name ‘others’. occurring in females, expression levels of a selected set of genes 2 the Subsequently, we performed statistical analyses to compare 22 genes whose expression levels were completely normalized in leptin-treated CR male pups 2 were analysed by RT-qPCR. mRNA expression levels between CR and CR-Leptin groups and between CR-Leptin and control groups. Of the 224 known genes Among those genes, the expression levels were found to be differently expressed in CR pups vs controls (p # 0.010; limma t- quantifiable by RT-qPCR for: collapsin response mediator protein 1(Crmp1); digestive organ expansion factor homolog (zebrafish) test), 22 of these were found to be different between CR and CR- Leptin groups (p # 0.010; limma t-test) and simultaneously not (Diexf); fos-like antigen 1 (Fosl1); galactosidase, alpha (Gla); glutaminase (Gls); low density lipoprotein receptor-related protein statistically different between control and CR-Leptin pups; thus, we assumed that the expression levels of these genes were totally 11 (Lrp11); polyamine oxidase (exo-N4-amino) (Paox); ring finger reverted by oral leptin treatment throughout lactation. The detailed protein 10 (Rnf10); selenium binding protein 1 (Selenbp1); solute carrier family 7 (amino acid transporter light chain, L system), list of these genes is shown in Table 2. Transcript levels of the remain- ing 196 genes, which appeared to be affected by moderate maternal member 5 (Slc7a5); thymosin beta 4, X-linked (Tmsb4x); and calorie restriction during gestation, became partially reverted by lep- ubiquitin associated and SH3 domain containing, B (Ubash3b). The expression patterns of these genes in male and female animals tin treatment throughout lactation (Supplementary Table 1). These include the set of genes whose expression profile differed signifi- are shown in Figure 3. RT-qPCR analysis fully confirmed most of the microarray data in male pups, and gene expression profile was largely cantly in CR vs control males (p # 0.010; limma t-test) but did not differ significantly in CR-Leptin vs CR and CR-Leptin vs control similar in females. In detail, considering males and females, animals. Only 6 of the 224 genes whose expression levels were chan- gestational calorie restriction resulted in higher mRNA levels of Crmp1, Gla, Gls, Lrp11, Paox, Tmsb4x and Ubash3b; in turn, leptin ged due to gestational calorie restriction (CR vs control males, p # 0.010; limma t-test) were not reverted by leptin treatment through- treatment throughout lactation significantly diminished transcript out lactation, as their expression levels did not differ between CR and levels of these genes to the control values, reversing the effects observed in CR animals (p , 0.05; LSD post hoc two-way ANOVA CR-Leptin groups and were significantly different between control and CR-Leptin groups (p# 0.010; limma t test). These genes were the test). following: cardiomyopathy associated 5 (Cmya5); defensin, alpha, 24 Differences concerning Rnf10 and Selenbp1 expression levels iden- tified using the microarrays were partially confirmed by RT-qPCR (Defa24); desmoglein 2 (Dsg2); secretory leukocyte peptidase inhib- itor (Slpi); tryptophan hydroxylase 2 (Tph2); and tripartite motif- analysis. Gestational calorie restriction brought about down-regu- lation of mRNA levels of both genes in CR animals (p # 0.05; LSD containing 23 (Trim23). These are related to the immune system, cell turnover, neural signaling and metabolism of protein processes. post hoc two-way ANOVA). In turn, leptin supplementation The results from the array concerning the 224 genes differently throughout lactation partially normalized their levels to those observed in controls (p # 0.05; LSD post hoc two-way ANOVA). expressed between control and CR groups across individual samples are depicted in a heat map (Figure 2). This figure illustrates the RT-qPCR analysis revealed that mRNA levels of Diexf and Slc7a5 similarity between control and CR-Leptin groups concerning the showed different expression pattern between sexes (interaction between group and sex; p # 0.05; two-way ANOVA). Leptin treat- expression pattern of these genes. ment throughout lactation resulted in total reversion of increased Confirmation of microarray results in male animals by RT-qPCR Diexf mRNA expression levels in CR females (p # 0.05; LSD post hoc and verification in females. To confirm gene array findings in male one-way ANOVA), whereas no statistical differences were observed SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 3 www.nature.com/scientificreports Table 2 | Detailed list of genes whose expression in PBMC samples of male rats at the age of 25 days was affected by gestational calorie restriction and totally reverted by oral leptin supplementation throughout lactation CR vs Controls CR-Leptin vs CR Biological process Gene name Gene symbol Sequence ID P FC P FC Cell communication Small cell adhesion glycoprotein Smagp NM_182817 0.000 20.50 0.006 10.41 Cell turnover Digestive organ expansion factor Diexf NM_001013986 0.002 10.73 0.006 20.66 homolog (zebrafish) Fos-like antigen 1 Fosl1 NM_012953 0.003 20.64 0.009 10.60 Selenium binding protein 1 Selenbp1 NM_080892 0.001 20.93 0.007 10.81 Cytoskeleton Myosin IIIB Myo3b NM_001191901 0.007 20.42 0.010 10.43 Thymosin beta 4, X-linked Tmsb4x NM_031136 0.010 10.84 0.010 20.91 Metabolism (carbohydrates) Galactosidase, alpha Gla NM_001108820 0.004 10.88 0.004 20.96 Metabolism (lipids) Arachidonate lipoxygenase 3 Aloxe3 NM_001105793 0.009 20.54 0.005 10.63 Butyryl Coenzyme A synthetase 1 Bucs1 NM_001108502 0.004 20.47 0.004 10.51 Low density lipoprotein receptor-related Lrp11 NM_001106217 0.002 10.70 0.001 20.77 protein 11 Metabolism (proteins Glutaminase Gls NM_001109968 0.008 10.74 0.007 20.80 and polyamines) Polyamine oxidase (exo-N4-amino) Paox NM_001106311 0.008 10.62 0.010 20.64 Ubiquitin associated and SH3 domain Ubash3b NM_001191792 0.010 10.45 0.000 20.65 containing, B Neural signaling Cholinergic receptor, nicotinic, delta Chrnd NM_019298 0.006 20.56 0.004 10.62 Gamma-aminobutyric acid (GABA) A Gabra6 NM_021841 0.002 21.00 0.004 10.96 receptor, alpha 6 Glutamate receptor, metabotropic 6 Grm6 NM_022920 0.010 20.66 0.004 10.79 Nervous system Collapsin response mediator protein 1 Crmp1 NM_012932 0.004 10.82 0.008 20.78 Myelin transcription factor 1 Myt1 NM_001108615 0.007 20.57 0.005 10.64 Ring finger protein 10 Rnf10 NM_001011904 0.003 21.22 0.010 11.11 Signaling Calcium channel, voltage-dependent, Cacna1c ENSRNOT00000009343 0.006 20.65 0.009 10.66 L type, alpha 1C subunit Transport Fyve and coiled-coil domain containing 1 Fyco1 NM_001106870 0.003 10.57 0.010 20.51 Solute carrier family 7 (amino acid Slc7a5 NM_017353 0.007 20.87 0.000 11.20 transporter light chain), member 5 Controls: the offspring of rats with free access to standard chow diet; CR: the offspring of 20% calorie restricted dams during the first 12 days of pregnancy; CR-Leptin: CR rats daily supplemented with physiological doses of leptin throughout lactation. p-values (P ) of microarray data (limma t-test) and fold change (FC) values (calculated as the difference between Log2 means) of CR vs Controls and CR- Leptin vs CR comparisons are indicated; 1, indicates upregulation; 2, downregulation. Threshold of significance was set at p # 0.010. Expression levels of these genes were not significantly different between control and CR-Leptin groups. in males either due to gestational calorie restriction or due to leptin implement effective therapeutic and/or preventive strategies. A treatment throughout lactation. Regarding Slc7a5 mRNA levels, as growing number of studies exploring nutrigenomic-derived biomar- 4,8,9,42,43 confirmed with both techniques used, decreased expression levels of kers focus on blood cells as a surrogate tissue , since they can be this gene in CR animals were restored due to leptin treatment easily and repeatedly collected in humans, and hence may give a throughout lactation in males, but not in females (p # 0.05; LSD chance to apply results obtained from animal studies into humans. post hoc one-way ANOVA). On the other hand, regarding obesity prevention, neonatal leptin RT-qPCR analysis of Fosl1 did not fully confirm the expression treatment in rats has been found to prevent age- and high fat diet 19,33,34 pattern of this gene observed with the microarray analysis: although feeding-related overweight and other metabolic alterations . its expression levels were confirmed to be diminished in CR males vs Moreover, the intake of adecuate amounts of leptin during the suck- controls (p# 0.05; LSD post hoc one-way ANOVA), leptin treatment ling period has been proposed as one of the strategies for reversing throughout lactation did not restore its control levels (p # 0.05; the effects of metabolic disorders induced as a consequence of devel- LSD post hoc one-way ANOVA). Nevertheless, single comparison opmental programming . Therefore, in this study we undertook between groups revealed that CR-Leptin males exhibited a trend to these issues and attempted to identify early biomarkers that predict higher Fosl1 mRNA levels relative to their CR counterparts (p 5 programmed susceptibility to obesity-related chronic diseases 0.064; Student’s t test). Expression levels of Fosl1 in females were caused by moderate undernutrition during gestation and to monitor not different between groups. the response to neonatal leptin treatment using transcript-based biomarkers identified in PBMCs. The outcomes of maternal undernutrition during gestation on the Discussion offspring have been broadly discussed in scientific literature. This One of the major challenges in developed societies is to implement prenatal condition exerts adverse health effects on the offspring, therapeutic and, even more interestingly, preventive strategies, to leading to hyperphagia, hypertension and greater fat accumula- fight the increasing prevalence of obesity and its related metabolic 16,18 15 tion , impaired insulin and leptin sensitivity , alterations in the disorders. In this regard, there is an increased need for identification structure and expression of neuropeptides regulating feeding beha- of reliable, early biomarkers of propensity to these alterations . This 28,29 viour in hypothalamus as well as alterations in adipose tissue and could serve as a tool to improve the accuracy of disease diagnose and 44,45 stomach sympathetic innervations . Our study, for the first time, effectiveness of its prevention, as well as to monitor the efficacy of reveals, at transcriptional level, the whole of the detrimental pro- therapy used. Therefore, adding novel multimarkers beyond the tra- gramming sequelae induced by mild gestational calorie restriction, ditional risk factors for obesity development may substantially through whole-genome transcriptome profiling of PBMCs of male improve early identification of susceptible individuals in order to SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 4 www.nature.com/scientificreports Figure 2 | Heat map representing indicidual expression data of the genes differentially expressed in PBMCs between male offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. Rows represent the 224 genes differentially expressed between control and CR pups (p , 0.010, limma t-test), sorted by fold change. Columns represent the log2 value of the expression of each gene in each animal studied. SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 5 www.nature.com/scientificreports Figure 3 | Q-PCR substantiation of microarray data of genes affected by gestational calorie restriction and totally reverted by oral leptin supplementation throughout lactation. To confirm and verify consistency of array findings, RT-qPCR was performed in PBMCs samples of both male and female offspring of control and calorie-restricted dams during gestation (CR) at the age of 25 days. mRNA levels were expressed as a percentage of the mean value of male controls. Data are mean 6 S.E.M (n 5 7–10 animals/group). Statistical analysis was performed by considering males and females as a whole (p # 0.05; two-way ANOVA), and separately for each sex (p # 0.05; one-way ANOVA). At any rate, data not sharing a common letter (a and b) are significantly different (a? b) (p , 0.05; LSD post hoc one-way and two-way ANOVA). Symbols: G, effect of group; GxS; interaction between the effect of group and the effect of sex (p , 0.05; two-way ANOVA); *,CR vs Controls (p , 0.05; Student’s t test); #, CR-Leptin vs CR (p , 0.05; Student’s t test); NS, not statistically significant. SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 6 www.nature.com/scientificreports pathways, and showed a significant association with some of the offspring. The rational for performing microarray analysis only in males results from previous findings indicating that the overall det- disease outcomes, although their specific function in PBMCs has not been generally explored. rimental effects of this prenatal condition were more marked in males than in females, particularly in terms of overweight and fat Herewith, we identified a comprehensive set of easily assessed 15,16,46 transcript-based biomarkers, with a particular emphasis for 7 of accumulation . Herein, we found that prenatal food restriction affected mRNA levels of 224 genes expressed in PBMCs. Induced them (Crmp1, Gla, Gls, Lrp11, Paox, Tmsb4x and Ubash3b), reflect- ing the reversion of a wide system of developmentally programmed changes in gene expression are mainly related to transcription and biological processes induced by relative fetal undernutrition. translation machinery, followed by genes related to immune system, Although the exact function of each of these genes in PBMCs which is not surprising as PBMCs are a subset of white blood cells. remains to be determined, identification of these markers, indicators Gestational calorie restriction also affected PBMCs expression of of efficacy of neonatal leptin treatment, supports evidence of the genes involved, among others, in signalling, cell turnover, metabol- positive effects of leptin intake during the suckling period on later ism, transport, cytoskeleton, sensory perception, nervous system and health programming. neural signaling. Hence, we identified a comprehensive set of easily Taken together, the results from this study show that leptin sup- assessed transcript-based biomarkers that reflect a wide system of plementation throughout lactation is able to revert the expression of biological processes and can improve prediction of the programmed most of the identified potential early biomarkers of programmed susceptibility to obesity and other pathologies induced by fetal obesity risk and other metabolic alterations associated to undernu- undernutrition. Although it is true that, nowadays, the phenomenon trition during pregnancy. These findings support the potential of prenatal maternal undernutrition does not seem to be responsible importance of leptin during lactation, a specific compound of mater- for the increasing prevalence of obesity in developed countries, it nal milk, which might be of relevance when considering strategies to might account for the increasing trends in the incidence of obesity- treat and/or prevent the programmed trend to diseases acquired by related pathologies in developing countries where maternal mal- inadequate fetal nutrition, particularly in susceptible subgroups. nutrition is still widespread . Moreover, fetal undernutrition may Moreover, the biomarkers identified in the present study, if validated also arise as a result of deficiency caused by maternal failure of in humans, may allow the identification and subsequent monitoring complete absorption of food components and differences in sea- of individuals at early ages who are at greater risk of developing sonal food availability . obesity and other pathologies, and whose alterations can be reverted Interestingly, we also show here the overall effects of leptin sup- by the intake of adequate amounts of leptin during lactation. plementation throughout the suckling period in reverting gene expression alterations in PBMCs induced by maternal undernutri- Methods tion during gestation. Neonatal leptin treatment normalized the Ethics statement. All experiments were performed in accordance with the approved expression of almost all of the genes whose expression was affected guidelines. The animal protocol was approved by the Bioethical Committee of the by calorie restriction during gestation in male offspring, with the University of the Balearic Islands (Resolution Number 8453. June, 2010). exception of 6 genes. Among the 218 genes whose expression was normalized, 196 genes reverted partially and 22 were totally reverted. Animals and Experimental Design. The animal protocol followed in this study has been previously described in detail . Briefly, male and female Wistar rat pups coming The results highlight the potential role of leptin during the suckling from 17 litters and belonging to 3 different groups (control, CR and CR-Leptin) were period, which might be worth considering when searching for strat- used, according to the schema presented in Figure 4. Animals were housed under egies to treat and/or prevent the programmed trend to obesity standard laboratory conditions (12 h dark and light cycle, 22uC) and allowed free acquired by inadequate fetal nutrition, particularly in susceptible access to water and a standard chow diet (3.3 kcal/g; Panlab, Barcelona, Spain), unless specified. subgroups. Microarray findings in PBMC samples from male ani- Virgin female rats were mated with male rats. After conception, the group of mals were substantiated by analyzing expression levels of a selection calorie-restricted dams (n 5 10 animals) was submitted to 20% calorie restriction diet of genes by RT-qPCR. We focused on the 22 genes whose expression during the first 12 days of gestation, while the group of control dams (n 5 7 animals) levels were completely normalized in leptin-treated CR male pups. was fed ad libitum. After delivery, male and female offspring of calorie-resticted dams was distributed into two groups: CR and CR-Leptin. The group of CR-Leptin pups mRNA expression levels of the same set of genes were also deter- was treated orally throughout lactation with a water solution of recombinant murine mined in PBMC samples of female animals to verify whether their leptin (PeproTech, London, UK). As established previously , the dosis of leptin was behaviour was similar to that of males. Among the 22 genes analyzed, at physiological level, progressively increased from 1 ng to 43.8 ng through this expression levels of several of these (Crmp1, Gla, Gls, Lrp11, Paox, period. CR pups and the offspring of control dams (controls) were treated orally with the vehicle (water). Tmsb4x and Ubash3b) emerged as particularly promising to be used At weaning (day 21), pups from control, CR and CR-Leptin groups (35, 34 and 33 as biomarkers because qPCR analyses fully confirmed microarray pups, respectively) were followed. They were housed (n 5 2 per cage) and fed on a data and showed similar behavior between males and females. In standard chow diet until their decapitation at the age of 25 days, under ad libitum addition to the aforementioned genes, other genes such as Rnf10, feeding conditions. After sacrifice, trunk blood was collected from neck for PBMCs isolation and gene expression analysis (n 5 10–11 animals per group), and for plasma Selenbp1, Diexf and Slc7a5 may also be of interest. qPCR analysis circulating parameters determination (n 5 6–8 per group). To obtain the plasma, of the expression of Rnf10 and Selenbp1 genes in both genders blood was collected in heparinized tubes and centrifuged at 1000 g for 10 min. showed similar patterns to those found for males with the microarray Animals used for analyses were from a minimum of six different litters. analysis, although decreased expression levels occurring in CR ani- PBMC isolation. Trunk blood samples of control, CR and CR-Leptin rats collected at mals vs their controls were only partially reverted by leptin treatment the age of 25 days under ad libitum feeding conditions, were used to isolate PBMCs. during lactation. Sexual dimorphism was found concerning the Peripheral blood samples were collected using EDTA (final concentration of 3– expression pattern of the Diexf and Slc7a5 genes in blood cells as 4 mM) as anticoagulant, and then diluted with an equal volume of buffered saline an effect of treatment. The increased expression levels of the Diexf (isosmotic). PBMCs were immediately isolated by OptiPrep density-gradient separation (Sigma Aldrich Quı mica SA, Madrid, Spain) according to the gene became totally reverted by leptin treatment, but only in the manufacturer’s instructions. group of females, and no changes were found in males. Con- cerning Slc7a5, decreased expression levels of this gene occurring Total RNA isolation. Total RNA was extracted from PBMCs of control, CR and CR- in CR animals were only normalized by leptin treatment during Leptin male and female animals by EZNA TOTAL RNA kit I (Omega Bio-Tek Inc., lactation in males, but not in females. Details regarding the proteins Norcross, GA, USA) following the manufacturer’s instructions. encoded by these genes and their potential functions are included as Microarray processing. For microarray analysis, RNA from PBMC samples obtained supplementary material (Supplementary Table 2). Besides the anno- from male offspring of controls, CR and CR-Leptin animals at the age of 25 days were tated basal function of proteins encoded by these genes, some of used (n 5 10–11/group). RNA samples were analyzed on Agilent 2100 Bioanalyzer them have been found to serve as a bridge for several key biological with RNA 6000 Nano chips (Agilent Technologies, Barcelona, Spain). To ensure the SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 7 www.nature.com/scientificreports Figure 4 | Schematic diagram of experimental design. After conception, the group of calorie-restricted dams was supplied with 20% calorie restriction diet from day 1 to day 12 of gestation, while the group of control dams was fed ad libitum. At birth, the offspring of control dams (control) was treated orally with vehicle throughout lactation, and the offspring of calorie restricted dams was divided into two groups: one group was also treated orally with vehicle (CR) and the other group was treated with a daily oral dose of leptin (CR-Leptin) throughout lactation. Daily oral dose of leptin was 5 times the average amount of daily leptin intake from maternal milk. Offspring was weaned at the age of 21 days and fed with normal fat diet until their sacrifice at the age of 25 days, when blood samples for plasma and PBMCs were obtained. high quality of RNA, only samples having a RIN number $ 8 were used for quantified, and the raw data were extracted using Feature Extraction Software version microarrays (n 5 8/group). Then, 80 ng of RNA from each sample was reverse 10.10.1.1 (Agilent Technologies). Background correction and normalization were transcribed to complementary DNA (cDNA) using the Agilent Low Input Quick performed within the Babelomics platform (http://www.babelomics.org), a suite of Amp Labeling kit (Agilent Technologies), according to the manufacturer’s protocol. web tools for microarray data analysis . Differential gene expression between groups Half of the cDNA sample (10 ml) was used for the linear amplification of RNA and of animals (CR vs controls, CR-Leptin vs CR, and CR-Leptin vs controls) was assessed labeling with cyanine-3 (Cy3) or Cy5. For these reactions, half of the amounts using the limma package from Bioconductor, implemented into Babelomics web 49 51 indicated by the manufacturer were used . Transcription and labeling were carried platform . The threshold of significance for the test was set at p # 0.010. out at 40uC for 2 h. Then, the labeled and amplified cRNA samples were purified Subsequently, a statistically generated list of genes was manually analyzed in regard to using Qiagen Rneasy MiniSpin columns (Qiagen, Madrid, Spain). The incorporation their biological information, obtained with the use of available databases (Genecards, of dyes and cRNA concentration was measured using the NanoDrop ND 1000 KEGG, NCBI, Reactome, UniProt, USCN, WikiPathways) based on key biological spectrophotometer (NanoDrop Techonologies, Ins., Wilmington, DE). Of the 24 domains, such as molecular function and biological process. Genes whose expression samples, 20 were used for microarray analysis. Four samples (2 samples in the CR and levels were significantly different between control and CR groups were plotted in a 2 samples in the CR-Leptin group) were excluded because of a low yield (,825 ng) heatmap using R (v 3.1.1, R Development Core Team). To control for false positives and low specific activity (,8.0 pmol Cy3 or Cy5 per mg of cRNA). Subsequently, each we performed the Benjamin-Hochberg false discovery rate (FDR) test; all the genes sample containing 825 ng of cRNA labeled with Cy5 and 825 ng of Cy3 pool were with a p , 0.01 had an adjusted p value , 0.42. Fold change (FC), defined here as a hybridized on 4 3 44 K G2519F rat whole genome Agilent microarrays (Agilent difference in log2 mean values between experimental groups, was also calculated Technologies) for 17 h at 65uC in hybridization chambers in an oven rotating at within the Babelomics platform. 10 rpm (Agilent Technologies). After hybridization, the arrays were washed using Gene Expression (GE) Wash Buffer Kit (Agilent Technologies). The arrays were Real-time quantitative RT-polymerase chain reaction (RT-qPCR) analysis. To rinsed in GE Wash Buffer 1 for 1 min, GE Wash Buffer 2 for 1 min, followed by validate microarray data, mRNA expression levels of selected genes: collapsin acetonitrile for 10 s, and finally with a Stabilization and Drying Solution for 30 s at response mediator protein 1 (Crmp1); digestive organ expansion factor homolog room temperature, according to the manufacturer’s protocol (Agilent Technologies). (zebrafish) (Diexf); fos-like antigen 1 (Fosl1); galactosidase, alpha (Gla); glutaminase (Gls); low density lipoprotein receptor-related protein 11 (Lrp11); polyamine oxidase Microarray data analysis. The arrays were scanned with an Agilent Microarray (exo-N4-amino) (Paox); ring finger protein 10 (Rnf10); selenium binding protein 1 Scanner (Agilent Technologies). Scanned images were examined for visible defects (Selenbp1); solute carrier family 7 (amino acid transporter light chain, L system), and proper grid alignment. The intensities of the signals from each spot were member 5 (Slc7a5); thymosin beta 4, X-linked (Tmsb4x); ubiquitin associated and Table 3 | Sequences of primers and amplicon size used for qRT-PCR Gene Forward primer (59 to 39) Reverse primer (59 to 39) Amplicon (bp) Crmp1 TGATTGTTCCTGGTGGAGTG GGATTTGGTGTCTGCTGCTT 248 Diexf TTCTACGACAGGGTTTCCAAG GCCATCTTCACCATTCATTTC 258 Fosl1 GCAGAAACCGAAGAAAGGAA CTGGAGAAAGGGAGATACAAGG 261 Gla CCCGAGAGGGATTCAAAG TACCCCAGTCAGCAAATGTC 199 Gls GGAGGGAAGGTTGCTGATTA AGGACTGAAGACAAAAGGGAAC 133 Lrp11 ACAGACGACCACGCCATT CCTGGGAAGCACAGTCACA 198 Paox TGGCTGTCCTGAATACCTTCTT TCAAAAACCATCACCTCCTTG 190 Psm6 TGGCTATGAGATTCCTGTGG CTGTCTGCTTCACTCCTGCT 206 Rnf10 GGGGGAAAAGAAACAAGTGG AAGGTGTCAGGGTCAGCAAA 124 Selenbp1 TGACCGCTTCCTCTACTTCA CTCGTTTTCCCTTGACCACT 194 Slc7a5 CCTGCCTCTGCGTGCTACT CCCTTGTCCTATGTCCTTTCC 155 Tmsb4x GCTCCTTCCAGCAACCAT GGGGCAGCACAGTCATTT 278 Ubash3b ACTTCATCGGGCTCTTTGTG TGTTCTGGGCGAGTTTCTCT 189 Abbreviations: Collapsin response mediator protein 1 (Crmp1); Digestive organ expansion factor homolog (zebrafish) (Diexf); Fos-like antigen 1 (Fosl1); Galactosidase, alpha (Gla); Glutaminase (Gls); Low density lipoprotein receptor-related protein 11 (Lrp11); Polyamine oxidase (exo-N4-amino) (Paox); Proteasome (prosome, macropain) subunit, alpha type 6 (Psm6); Ring finger protein 10 (Rnf10); Selenium binding protein 1 (Selenbp1); Solute carrier family 7 (amino acid transporter light chain, L system), member 5 (Slc7a5); Thymosin beta 4, X-linked (Tmsb4x); Ubiquitin associated and SH3 domain containing, B (Ubash3b). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 8 www.nature.com/scientificreports SH3 domain containing, B (Ubash3b) were measured by RT-qPCR in PBMC RNA 18. Vickers, M. H., Breier, B. H., Cutfield, W. S., Hofman, P. L. & Gluckman, P. D. samples of control, CR and CR-Leptin male animals. In addition, mRNA expression Fetal origins of hyperphagia, obesity, and hypertension and postnatal levels of the same set of genes were analyzed in PBMC samples of control, CR and CR- amplification by hypercaloric nutrition. Am. J. Physiol Endocrinol. Metab 279, Leptin female animals to verify the manner of their response to the treatments used. E83–E87 (2000). 19. Pico, C. et al. The intake of physiological doses of leptin during lactation in rats For RT-qPCR analysis, 0.05 mg of PBMC total RNA was used for reverse tran- TM scription by using iScript cDNA synthesis kit (Bio-Rad Laboratories, S.A., Madrid, prevents obesity in later life. Int J Obes (Lond) 31, 1199–1209 (2007). Spain) according to the manufacturer’s protocol. 20. Jones, R. Obesity: Leptin intake during the suckling period may protect against TM Real-time PCR was performed using the Applied Biosystems StepOnePlus Real- obesity and metabolic-related disorders. Nat Rev Gastroenterol Hepatol. 7,359 (2010). Time PCR Systems (Applied Biosystems, Madrid Spain) with Power SYBER Green PCR Master Mix (Applied Biosystems). Each PCR was performed from 1/5 dilution 21. Houseknecht, K. L., McGuire, M. K., Portocarrero, C. P., McGuire, M. A. & of the cDNA product and forward and reverse primers (5 mM each). The sequences of Beerman, K. Leptin is present in human milk and is related to maternal plasma primers purchased from Sigma Genosys (Sigma Aldrich Quı´ mica SA, Madrid, Spain) leptin concentration and adiposity. Biochem. Biophys. Res. Commun. 240, are described in Table 3. After an initial Taq activation at 95uC for 10 min, PCR was 742–747 (1997). performed using 40 two-temperature cycles with the following cycling conditions: 22. Schwartz, M. W., Woods, S. C., Porte, D., Jr., Seeley, R. J. & Baskin, D. G. Central 95uC for 15 s and 60uC for 1 min. The threshold cycle (Ct) values were calculated by nervous system control of food intake. Nature 404, 661–671 (2000). the StepOne Software v2.2.2, and the relative mRNA expression of each gene was 23. Arora, S. & Anubhuti. Role of neuropeptides in appetite regulationand obesity--a 2DDCt 52 expressed as a percentage of male control rats, using the 2 method . Proteasome review. Neuropeptides 40, 375–401 (2006). (prosome, macropain) subunit, alpha type 6 (Psm6) was chosen as reference gene 24. Bouret, S. G., Draper, S. J. & Simerly, R. B. Trophic Action of Leptin on because our microarray data showed equal expression of this gene across all groups. Hypothalamic Neurons That Regulate Feeding. Science 304, 108–110 (2004). 25. Bouret, S. G. & Simerly, R. B. Developmental programming of hypothalamic Statistical analysis. Data are expressed as mean 6 SEM. The statistical analysis of feeding circuits. Clin Genet. 70, 295–301 (2006). microarray data has been described in detail in the previous section (microarray data 26. Yura, S. et al. Role of premature leptin surge in obesity resulting from intrauterine analysis). Statistical significances were assessed by one-way (separately for each sex) undernutrition. Cell Metab 1, 371–378 (2005). and two-way ANOVA, and least significance difference (LSD) post hoc test. Student’s 27. Delahaye, F. et al. Maternal perinatal undernutrition drastically reduces postnatal t test was used to compare individual means. P , 0.05 was defined as the threshold of leptin surge and affects the development of arcuate nucleus proopiomelanocortin significance, unless stated. Statistics were computed with SPSS Statistics 19.0 (SPSS, neurons in neonatal male rat pups. Endocrinology 149, 470–475 (2008). Chicago, IL). 28. Ikenasio-Thorpe, B. A., Breier, B. H., Vickers, M. H. & Fraser, M. Prenatal influences on susceptibility to diet-induced obesity are mediated by altered neuroendocrine gene expression. J. Endocrinol. 193, 31–37 (2007). 1. Musaad, S. & Haynes, E. N. Biomarkers of Obesity and Subsequent 29. Garcia, A. P. et al. Moderate caloric restriction during gestation results in lower Cardiovascular Events. Epidemiologic Reviews 29, 98–114 (2007). arcuate nucleus NPY- and alphaMSH-neurons and impairs hypothalamic 2. Schneider, H. J. et al. Incremental effects of endocrine and metabolic biomarkers response to fed/fasting conditions in weaned rats. Diabetes Obes Metab 12, and abdominal obesity on cardiovascular mortality prediction. PLoS One 7, 403–413 (2010). e33084 (2012). 30. Konieczna, J. et al. Oral Leptin Treatment in Suckling Rats Ameliorates 3. Balagopal, P. B. et al. Nontraditional risk factors and biomarkers for Detrimental Effects in Hypothalamic Structure and Function Caused by Maternal cardiovascular disease: mechanistic, research, and clinical considerations for Caloric Restriction during Gestation. PLoS One 8, e81906 (2013). youth: a scientific statement from the American Heart Association. Circulation 31. Vickers, M. H. et al. Neonatal leptin treatment reverses developmental 123, 2749–2769 (2011). programming. Endocrinology 146, 4211–4216 (2005). 4. de Mello, V., Kolehmanien, M., Schwab, U., Pulkkinen, L. & Uusitupa, M. Gene 32. Vickers, M. H. et al. The effect of neonatal leptin treatment on postnatal weight expression of peripheral blood mononuclear cells as a tool in dietary intervention gain in male rats is dependent on maternal nutritional status during pregnancy. studies: What do we know so far? Mol Nutr Food Res 56, 1160–1172 (2012). Endocrinology 149, 1906–1913 (2008). 5. Konieczna, J. et al. Identification of early transcriptome-based biomarkers related 33. Sanchez, J. et al. Oral supplementation with physiological doses of leptin during to lipid metabolism in peripheral blood mononuclear cells of rats nutritionally lactation in rats improves insulin sensitivity and affects food preferences later in programmed for improved metabolic health. Genes Nutr 9, 366 (2014). life. Endocrinology 149, 733–740 (2008). 6. Viguerie, N. et al. Transcriptomics applied to obesity and caloric restriction. 34. Priego, T., Sanchez, J., Palou, A. & Pico, C. Leptin intake during the suckling Biochimie 87, 117–123 (2005). period improves the metabolic response of adipose tissue to a high-fat diet. Int J 7. de Mello, V. et al. Downregulation of genes involved in NFkappaB activation in Obes (Lond) 34, 809–819 (2010). peripheral blood mononuclear cells after weight loss is associated with the 35. von Kries, R. et al. Breast feeding and obesity: cross sectional study. BMJ 319, improvement of insulin sensitivity in individuals with the metabolic syndrome: 147–150 (1999). the GENOBIN study. Diabetologia 51, 2060–2067 (2008). 36. Armstrong, J. & Reilly, J. J. Breastfeeding and lowering the risk of childhood 8. Oliver, P., Reynes, B., Caimari, A. & Palou, A. Peripheral blood mononuclear cells: obesity. Lancet 359, 2003–2004 (2002). a potential source of homeostatic imbalance markers associated with obesity 37. Miralles, O., Sanchez, J., Palou, A. & Pico, C. A physiological role of breast milk development. Pflugers Arch 465, 459–68 (2013). leptin in body weight control in developing infants. Obesity. (Silver. Spring) 14, 9. Caimari, A., Oliver, P., Keijer, J. & Palou, A. Peripheral blood mononuclear cells as 1371–1377 (2006). a model to study the response of energy homeostasis-related genes to acute 38. Schuster, S., Hechler, C., Gebauer, C., Kiess, W. & Kratzsch, J. Leptin in maternal changes in feeding conditions. OMICS. 14, 129–141 (2010). serum and breast milk: association with infants’ body weight gain in a longitudinal 10. Bouwens, M., Afman, L. A. & Muller, M. Fasting induces changes in peripheral study over 6 months of lactation. Pediatr. Res 70, 633–637 (2011). blood mononuclear cell gene expression profiles related to increases in fatty acid 39. Doneray, H., Orbak, Z. & Yildiz, L. The relationship between breast milk leptin beta-oxidation: functional role of peroxisome proliferator activated receptor and neonatal weight gain. Acta Paediatr. 98, 643–647 (2009). alpha in human peripheral blood mononuclear cells. Am J Clin Nutr 86, 40. Pico, C., Jilkova, Z. M., Kus, V., Palou, A. & Kopecky, J. Perinatal programming of 1515–1523 (2007). body weight control by leptin: putative roles of AMP kinase and muscle 11. Manoel-Caetano, F. S. et al. Gene expression profiles displayed by peripheral thermogenesis. Am J Clin Nutr 94, 1830S–1837S (2011). blood mononuclear cells from patients with type 2 diabetes mellitus focusing on 41. Vickers, M. H. & Sloboda, D. M. Strategies for reversing the effects of metabolic biological processes implicated on the pathogenesis of the disease. Gene 511, disorders induced as a consequence of developmental programming. Front 151–160 (2012). Physiol 3, 242 (2012). 12. Burczynski, M. E. & Dorner, A. J. Transcriptional profiling of peripheral blood 42. Sanchez, J. et al. Blood cells as a source of transcriptional biomarkers of childhood cells in clinical pharmacogenomic studies. Pharmacogenomics. 7, 187–202 (2006). obesity and its related metabolic alterations: results of the IDEFICS study. J Clin 13. Sullivan, E. L. & Grove, K. L. Metabolic imprinting in obesity. Forum Nutr 63, Endocrinol Metab 97, E648–E652 (2012). 186–194 (2010). 43. Priego, T. et al. Influence of breastfeeding on blood-cell transcript-based 14. Pico, C., Palou, M., Priego, T., Sanchez, J. & Palou, A. Metabolic programming of biomarkers of health in children. Pediatr Obes 9, 463–470 (2014). obesity by energy restriction during the perinatal period: different outcomes 44. Garcia, A. P. et al. Moderate caloric restriction during gestation in rats alters depending on gender and period, type and severity of restriction. Front Physiol 3, adipose tissue sympathetic innervation and later adiposity in offspring. PLoS One 436 (2012). 6, e17313 (2011). 15. Palou, M. et al. Impaired insulin and leptin sensitivity in the offspring of moderate 45. Garcia, A. P. et al. Early alterations in plasma ghrelin levels in offspring of calorie- caloric-restricted dams during gestation is early programmed. J. Nutr. Biochem. restricted rats during gestation may be linked to lower sympathetic drive to the 23, 1627–1639 (2012). stomach. Peptides 39, 59–63 (2013). 16. Palou, M., Priego, T., Sanchez, J., Palou, A. & Pico, C. Sexual dimorphism in the 46. Jones, A. P. & Friedman, M. I. Obesity and adipocyte abnormalities in offspring of lasting effects of moderate caloric restriction during gestation on energy rats undernourished during pregnancy. Science 215, 1518–1519 (1982). homeostasis in rats is related with fetal programming of insulin and leptin 47. Rasmussen, K. M. The ‘‘fetal origins’’ hypothesis: challenges and opportunities for resistance. Nutr Metab (Lond) 7, 69 (2010). maternal and child nutrition. Annu Rev Nutr 21, 73–95 (2001). 17. Ravelli, G. P., Stein, Z. A. & Susser, M. W. Obesity in young men after famine 48. McArdle, H. J. & Ashworth, C. J. Micronutrients in fetal growth and development. exposure in utero and early infancy. N. Engl. J. Med. 295, 349–353 (1976). Br Med Bull. 55, 499–510 (1999). SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 9 www.nature.com/scientificreports 49. van Schothorst, E. M., Pagmantidis, V., de Boer, V. C., Hesketh, J. & Keijer, J. tools: J.K., J.S. and M.P. Wrote the manuscript: J.K., C.P. and A.P. All authors revieved the Assessment of reducing RNA input for Agilent oligo microarrays. Anal Biochem final manuscript. 363, 315–317 (2007). 50. Medina, I. et al. Babelomics: an integrative platform for the analysis of Additional information transcriptomics, proteomics and genomic data with advanced functional Supplementary information accompanies this paper at http://www.nature.com/ profiling. Nucleic Acids Res 38, W210–W213 (2010). scientificreports 51. Smyth, G. K. Limma: linear models for microarray data. In: Bioinformatics and computational biology solutions using R and Bioconductor 23, 397–420 (2005). Competing financial interests: A.P., C.P. and J.S. are authors of a patent held by the 52. Pfaffl, M. W. A new mathematical model for relative quantification in real-time University of the Balearic Islands entitled ‘‘Use of leptin for the prevention of excess body RT-PCR. Nucleic Acids Res 29, e45 (2001). weight and composition containing leptin’’ (WO 2006089987 A1) (Priority data: 23 February 2005). A.P., C.P., J.K., J.S. and M.P. are authors of a patent application of the University of the Balearic Islands entitled ‘‘Method for the prediction and or prevention of overweight, obesity and/or its complications by gene expression analyses’’. (P201430428, Acknowledgments Spain) (Priority data: 26 March 2014). This study was supported by the Spanish Government (grant AGL2012-33692), the ´ ´ How to cite this article: Konieczna, J., Sanchez, J., Palou, M., Pico, C. & Palou, A. Blood cell European Union’s Seventh Framework Programme FP72007–2013 under grant agreement transcriptomic-based early biomarkers of adverse programming effects of gestational n. 244995 (BIOCLAIMS Project), and the Instituto de Salud Carlos III, Centro de calorie restriction and their reversibility by leptin supplementation. Sci. Rep. 5, 9088; Investigacio´ n Biome´ dica en Red Fisiopatologı´ a de la Obesidad y Nutricio´ n, CIBERobn. The DOI:10.1038/srep09088 (2015). Laboratory belongs to the Nutrigenomics-group, awarded as ‘‘Group of Excellence’’ of CAIB and supported by ‘‘Direccio´ General d’Universitats, Recerca i Transfere` ncia del This work is licensed under a Creative Commons Attribution 4.0 International Coneixement’’ of Regional Government (CAIB) and FEDER funds (EU Contract: n. License. The images or other third party material in this article are included in the FP6-506360). Jadwiga Konieczna is granted with a PhD fellowship entitled ‘‘beca para la article’s Creative Commons license, unless indicated otherwise in the credit line; if formacion de personal investigador, en el marco de un programa operativo cofinanciado the material is not included under the Creative Commons license, users will need por el Fondo Social Europeo’’. to obtain permission from the license holder in order to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ Author contributions Conceived and designed the experiments: A.P. and C.P. Performed the experiment: J.K., J.S. and M.P. Analyzed the data: J.K., J.S. and C.P. Contributed reagents/materials/analysis SCIENTIFIC REPORTS | 5 : 9088 | DOI: 10.1038/srep09088 10

Journal

Scientific Reports – Springer Journals

Published: Mar 13, 2015

There are no references for this article.