Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

Wei Wang; Xiaohui Lin; Tao Jiang; Zixin Peng; Jin Xu; Lingxian Yi; Fengqin Li; Séamus Fanning; Zulqarnain Baloch

doi:10.3389/fmicb.2018.01123

Wang, Wei;Lin, Xiaohui;Jiang, Tao;Peng, Zixin;Xu, Jin;Yi, Lingxian;Li, Fengqin;Fanning, Séamus;Baloch, Zulqarnain;

2018-06-22 00:00:00

ORIGINAL RESEARCH published: 22 June 2018 doi: 10.3389/fmicb.2018.01123 Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China 1† 2† 1 1 1 3 1 Wei Wang , Xiaohui Lin , Tao Jiang , Zixin Peng , Jin Xu , Lingxian Yi , Fengqin Li *, 1,4,5 3 Séamus Fanning * and Zulqarnain Baloch * Key Laboratory of Food Safety Risk Assessment, Ministry of Health, China National Center for Food Safety Risk Assessment, Beijing, China, Physics and Chemical Department, Tianjin Center for Disease Control and Prevention, Tianjin, 3 4 China, College of Veterinary Medicine, South China Agricultural University, Guangzhou, China, UCD-Centre for Food Safety, School of Public Health, Physiotherapy and Sports Science, University College Dublin, Dublin, Ireland, School of Biological Sciences, Institute for Global Food Security, Queen’s University Belfast, Belfast, United Kingdom The colonization of dairy herds and subsequent contamination of raw milk by Edited by: Staphylococcus aureus (S. aureus), especially those expressing a multi-drug resistance Maria Schirone, Università di Teramo, Italy (MDR), bioﬁlm and toxins producing ability, remains an important issue for both the dairy Reviewed by: producer and public health. In this study, we investigated the prevalence, antimicrobial Pierluigi Di Ciccio, resistance, virulence, and genetic diversity of S. aureus in raw milk taken from 2 dairy Università degli Studi di Parma, Italy Jesús Santos, farms in Beijing, China. Ninety (46.2%, 90/195) samples were positive for S. aureus. Universidad de León, Spain Resistant to penicillin (PEN) (31.3%), ciproﬂoxacin (18.8%) and enroﬂoxacin (15.6%) *Correspondence: were the most often observed. Isolates cultured from farm B showed signiﬁcantly higher Fengqin Li resistance to penicillin (73.9%), ciproﬂoxacin (34.8%), enroﬂoxacin (34.8%), tilmicosin [email protected] Séamus Fanning (17.4%), and erythromycin (17.4%) than those from farm A (p < 0.05). Totally, 94.8% [email protected] S. aureus harbored at least one virulence gene and the pvl (93.8%), sec (65.6%), and Zulqarnain Baloch [email protected] sea (60.4%) genes were the most frequently detected. The pvl and sec genes were more often detected in isolates from farm A (97.3% and 84.9% respectively) than those from These authors have contributed equally to this work and co-ﬁrst farm B (p < 0.05). Of all 77 staphylococcus enterotoxin (SE)-positive isolates, more than authors 90% could produce enterotoxins and 70.1% could produce two types. Bioﬁlm related genes (icaA/D, clf/B, can, and fnbA) were detected in all96 isolates. All 96 isolates could Specialty section: This article was submitted to produce bioﬁlm with 8.3, 70.8, and 18.8% of the isolates demonstrating weak, moderate Food Microbiology, and strong bioﬁlm formation, respectively. A total of 5 STs, 7 spa types (1 novel spa type a section of the journal t17182), 3agr types (no agrII), and 14 SmaI-pulso-types were found in this study. PFGE Frontiers in Microbiology cluster II-CC1-ST1-t127-agr III was the most prevalent clone (56.3%). Isolates of agr Received: 07 March 2018 Accepted: 14 May 2018 III (PFGE Cluster I/II-CC1-ST1-t127/2279) had higher detection of virulence genes than Published: 22 June 2018 those of agr I and agr IV. TheMSSA-ST398-t1456-agr I clone expressed the greatest Citation: MDRbut with no virulence genes and weakly bioﬁlm formation. Our ﬁnding indicated a Wang W, Lin X, Jiang T, Peng Z, Xu J, Yi L, Li F, Fanning S and Baloch Z relatively high prevalence of S. aureus with less antimicrobial resistance but often positive (2018) Prevalence and for enterotoxigenicity and bioﬁlm formation. This study could help identify predominant Characterization of Staphylococcus clones and provide surveillance measures to eliminate and decrease the contamination aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in of S. aureus in raw milk of dairy cows with mastitis. Beijing, China. Front. Microbiol. 9:1123. Keywords: Staphylococcus aureus, raw milk, mastitis, antimicrobial susceptible test, virulence factors, doi: 10.3389/fmicb.2018.01123 enterotoxin production, bioﬁlm, molecular typing Frontiers in Microbiology | www.frontiersin.org 1 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus INTRODUCTION particular clonal lineages may be prevalent geographically, and have speciﬁc antimicrobial resistance and virulence Staphylococcus aureus (S. aureus) is one of the leading sources patterns (Hata et al., 2010). This study aimed to estimate of intra-mammary infections in dairy cows (Dufour et al., the prevalence of S. aureus among raw milk from dairy 2012; Zecconi and Scali, 2013). It is reported that 10–40% cows with clinical mastitis from two dairy farms during of the mastitis cases are caused by S. aureus in China and August to December in 2016 in Beijing, China, and to other countries (Kateete et al., 2013; Basanisi et al., 2017; Liu describe the characteristics of the isolates, in order to provide et al., 2017). Mastitis is a global challenge that it can result in groundwork for further studies on the control and prevention ﬁnancial losses for the dairy industry and the economy due to of contamination of S. aureus in raw milk of dairy cows with the substandard quality of milk, treatment costs, and causing mastitis. subsequent new infection of other cows (Schroeder, 2012). Contaminated raw milk at farm level, may lead to subsequent MATERIALS AND METHODS problems further along the food chain giving rise to S. Aureus associated food contamination (Jakobsen et al., 2011; Rola et al., Sampling and Isolation of S. aureus 2016). Recruitment of cows into this study was done in consultation S. aureus associated food poisoning in humans and similarly with veterinarians and sampling process was carried on with the mastitis in animal is caused by those isolates possessing virulence agreement of the dairy farms’ owners. Raw milk samples were factors (Hennekinne et al., 2012). This bacterium produces collected from cows presenting with clinical mastitis consistent wide range of factors, for example toxic shock syndrome with poor milk yield, color change and udders inﬂammation. toxin-1 (TSST-1), staphylococcus enterotoxin (SE), and Panton- Milk collection process was performed after cleaning the teats, Valentine leukocidin (PVL). SEs is regarded as the major cause initial streams of milk discarded and teat tips scrubbed with of S. aureus associated food poisoning (Bergdoll et al., 1981; cotton balls moistened with 75% alcohol. Teat-cleaning before Hennekinne et al., 2012). It is reported that more than 90% of milking and treatment with antibiotics at dry-oﬀ were not S. aureus-associated food poisoning outbreaks were attributed to performed. In total, one milk sample from each cow was collected the classical SEs (denoted as SEA to SEE) encoded by sea to see and 195 individual milk samples of 195 cows were obtained genes (Tarekgne et al., 2016). The TSST-1 toxin could result in from 2 dairy farms during August to December in 2016 in toxic shock syndrome by reducing the host immune response, Beijing, China. These two dairy farms belong to one of the while PVL could destruct host leukocyte and cause tissue necrosis largest dairy production companies in China, which mainly (Schlievert et al., 1981). supply consumers in Beijing and other regions in China, and Antimicrobial therapy is an important strategy for mastitis also export internationally. Both farms were managed with an control as well as human infections (Gomes and Henriques, intensive breeding system, with the herd size of about 500 2016). However, S. aureus often exhibit resistance to multiple locating cows. classes of antimicrobial agents as a response to the selective The S. aureus contamination was detected in raw milk samples pressure of antimicrobials, which will narrow the treatment according to National Food Safety Standards of China document options for clinicians and veterinarians (Gomes and Henriques, GB 4789.10-2016. Brieﬂy, a 25-ml milk sample was taken and 2016). It is reported that many S. aureus-associated food mixed thoroughly, and then transferred into 225 mL 10% (w/v%) poisoning outbreaks were due to multi-drug resistant (MDR) saline solution (Land Bridge, Beijing, China) and homogenize S. aureus including methicillin-resistant S. aureus (MRSA) it and solutions were incubated at 37 C for 24 h. A loopful (Johler et al., 2015; Jans et al., 2017). Furthermore, formation of the incubated culture were streaked onto Baird-Parker Agar of bioﬁlms, highly organized multicellular complexes, is often supplemented with 5% egg yolk and tellurite, and Blood Agar associated with both epithelial adhesion and evasion of host with sterile deﬁbrinated sheep blood (Land Bridge, Beijing, immune defenses (Melchior et al., 2009). Bioﬁlm associated China), respectively, then incubated at 37 C for 24–48 h. Putative protein (Bap) plays an important role in primary attachment S. aureus isolates were tested for coagulase activity, and were and recruitment of S. aureus (Khoramian et al., 2015; Felipe further conﬁrmed using API STAPH test strips (bio-Mérieux, et al., 2017). The icaA and icaD genes that form part of the Marcyl’Etoile, France). Finally, all isolates were subjected the icaABCD gene cluster (intracellular adhesion locus) are essential detection of 16SrRNA and nuc genes by PCR (Table 1; Murakami for bioﬁlm formation (Khoramian et al., 2015; Felipe et al., 2017). et al., 1991). All conﬁrmed S. aureus isolates were stored in BHI Additionally, the collagen binding proteins (Cna), clumping with 40% [v/v%] glycerol (Land Bridge, Beijing, China) at−80 C. factors (ClfA and ClfB) and ﬁbronectin binding proteins (FnbA No more than2 isolates of each sample were chose for subsequent and FnbB) also have associations with bioﬁlm production studies. according to previous studies (Khoramian et al., 2015; Pereyra et al., 2016). Antimicrobial Susceptibility Testing (AST) Molecular epidemiology-based methods are essential tools In this study, broth dilution method was applied to estimate for the study of clonal relatedness, genetic diversity, and the antimicrobial susceptibility of all tested isolates using the also tracking the dissemination of S. aureus infections. It Biofosun Gram-positive panel (Fosun Diagnostics, Shanghai, was reported that certain S. aureus lineages were speciﬁcally China) and interpreted by the Clinical and Laboratory Standards associated with milk, such as CC97 (Clonal complex), and Institute (CLSI) (CLSI, 2015). The antimicrobial agents Frontiers in Microbiology | www.frontiersin.org 2 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus TABLE 1 | Primers used in this study. ′ ′ Gene Oligonucleotide sequence (5 −3 ) Size of product Annealing temperature References nuc-F GCGATTGATGGTGATACGGTT 798 55 Murakami et al., 1991 nuc-R AGCCAAGCCTTGACGAACTAAAGC 16S rRNA-F AGAGTTTGATCATGGCTCAG 270 55 16S rRNA-R GGACTACCAGGGTATCTAAT mecA-F AAAATCGATGGTAAAGGTTGGC 533 55 mecA-R AGTTCTGCAGTACCGGATTTGC sea-F ACGATCAATTTTTACAGC 544 44.5 Rosec and Gigaud, 2002 sea-R TGCATGTTTTCAGAGTTAATC seb-F ATTCTATTAAGGACACTAAGTTAGGGGA 404 44.5 Jarraud et al., 2002 seb-R ATCCCGTTTCATAAGGCGAGT sec-F GACATAAAAGCTAGGAATTT 257 46.2 Rosec and Gigaud, 2002 sec-R AAATCGGATTAACATTATCCA sed-F CAAATATATTGATATAATGA 330 44.5 Khoramrooz et al., 2016 sed-R AGTAAAAAAGAGTAATGCAA see-F CAAAGAAATGCTTTAAGCAATCTTAGGC 482 44.5 Jarraud et al., 2002 see-R CACCTTACCGCCAAAGCTG tst-F ACCCCTGTTCCCTTATCATC 326 54 Khoramrooz et al., 2016 tst-R TTTTCAGTATTTGTAACGCC lukS/F-F ATCATTAGGTAAAATGTCTGGACATGATCCA 433 55 McClure et al., 2006 lukS/F-R GCATCAAGTGTATTGGATAGCAAAAGC pan-agr ATGCACATGGTGCACATGC – 55 Shopsin et al., 2003 agrI GTCACAAGTACTATAAGCTGCGAT 440 55 agrII GTATTACTAATTGAAAAGTGCCATAGC 573 55 agrIII CTGTTGAAAAAGTCAACTAAAAGCTC 406 55 agrIV CGATAATGCCGTAATAC CCG 588 55 fnbA-F GATACAAACCCAGGTGGTGG 191 52 Zmantar et al., 2008 fnbA-R TGTGCTTGACCATGCTCTTC fnbB-F ACGCTCAAGGCGACGGCAAAG 197 62 Pereyra et al., 2016 fnbB-R ACCTTCTGCATGACCTTCTGCACCT clfA-F CCGGATCCGTAGCTGCAGATGCACC 1000 60 Zmantar et al., 2008 clfA-R GCTCTAGATCACTCATCAGGTTGTTCAGG clfB-F TGCAAGTGCAGATTCCGAAAAAAAC 194 62 Klein et al., 2012 clfB-R CCGTCGGTTGAGGTGTTTCATTTG cna-F AAAGCGTTGCCTAGTGGAGAC 192 54 Zmantar et al., 2008 cna-R AGTGCCTTCCCAAACCTTTT bap-F CCCTATATCGAAGGTGTAGAATTG 971 60 Darwish and Asfour, 2013 bap-R GCTGTTGAAGTTAATACTGTACCTGC icaA-F CCTAACTAACGAAAGGTAG 1351 49 icaA-R AAGATATAGCGATAAGTGC icaD-F AAACGTAAGAGAGGTGG 381 49 Pereyra et al., 2016 icaD-R GGCAATATGATCAAGATAC included Ceftiofur (EFT) (0.25–64μg/mL), Chloramphenicol Detection of MRSA, Virulence and Bioﬁlm (CHL) (0.5–128μg/mL), Ciproﬂoxacin (CIP) (0.125– Related Genes 16μg/mL), Daptomycin (DAP) (0.06–16μg/mL), Enroﬂoxacin ◦ Frozen isolates were cultured overnight at 37 C in BHI (Land (ENO) (0.125–32μg/mL), Erythromycin (ERY) (0.125– Bridge, Beijing, China). The genomic DNA was then extracted 16μg/mL), Fosfomycin (FOS) (0.5–256μg/mL), Gentamycin with TIANamp Bacterial DNA extraction kit (TianGenDNA Kit (GEN) (0.5–64μg/mL), Penicillin (PEN) (0.06–32μg/mL), DP302, Beijing, China), and the quality of DNA was evaluated by Tetracycline (TET) (0.25–64μg/mL), Tilmicosin (TIL) (0.5– a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientiﬁc, 64μg/mL), and Vancomycin (VAN) (0.06–128μg/mL). NH, USA). Sterile deionized water was used to dilute the TM S. aureus ATCC 29213 was used as the reference strain for extracted DNA to 50 mg/L, which was suitable for real-time the AST. PCR assays. The genes encoding the methicillin resistance gene Frontiers in Microbiology | www.frontiersin.org 3 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus (mecA), SEs (sea to see), toxic-shock syndrome toxin (tst), spa Typing Panton-Valentine leukocidin (lukF), bioﬁlm related genes (bap, The spa typing for all S. aureus isolates was performed as icaA, and icaD), and adhesion related genes (fnbA, fnbB, clfA, described previously (Harmsen et al., 2003). The spa repeats and clfB, and can) were detected by PCR. The primers were supplied types were assigned by the Bio Numerics software v.7.5 (Applied by Thermo Fisher Scientiﬁc (Waltham, MA, USA; Table 1). Math, Belgium). If a spa repeat did not match any spa types, the Positive and negative controls were included in all PCRs. sequence of this spa was then upload to the Ridom Spa Server database (http://spa.ridom.de) to assign a new type. Detection of SEs Production agr Genotyping SEs (SEA to SEE)production was detected by immuno-colloidal The agr type of all S. aureus isolates was determined using the agr- gold chromatographic test strips (Longrunbio, Beijing, China). group speciﬁc primers (agr allele types I–V) and agr multiplex In brief, the supernatant of 24 h cultures of S. aureus (1 × 10 PCR as described previously (Table 1). CFU/mL) positive with SEs genes grown at 37 C in a shake- tube (Xuzhou Yanjia Glass Products, Xuzhou, China) containing Pulsed-Field Gel Electrophoresis (PFGE) 5 mL BHI (Land Bridge, Beijing, China) was separated from The genetic relationships of all S. aureus isolates were established cells by centrifugation at 8,000 × g for 20 min. The supernatant ◦ by PFGE (Murchan et al., 2003; Ribot et al., 2006). In brief, was heated at 100 C for 10 min. Then 200 μL of the heated the tested isolates were cultured and plugs were prepared. supernatant were tested for the presence of the SEs by the strip Chromosomal DNA was digested with the endonuclease SmaI test assay. The samples 100 ng/mL of SEA to SEE were used as (20 units/μL, New England Biolabs) at 30 C for 3 h. The a positive control and phosphate buﬀer was used as negative electrophoresis was performed in 1% agarose SeaKem Gold gel control. in the CHEF DR III apparatus (Bio-Rad, Hercules, California z) at 14 C for 19 h. Macro restriction patterns were interpreted Bioﬁlm Formation by Bio Numerics software v.7.5 (Applied Math, Belgium) by Bioﬁlm production was assessed by a 96-well microtiter plate the un weighted pair group method with arithmetic averages assay using minimal medium M9 (6 g/l Na HPO , 3 g/l KH PO , 2 4 2 4 (UPGMA). Salmonella Braenderup H9812 was used as a standard 0.5 g/l NaCl, 1 g/l NH Cl, 2 mM MgSO , 0.1% glucose, and 4 4 size marker. 0.1 mM CaCl ; Müsken et al., 2010). After overnight growth in tryptone soy broth medium (TSB; Oxoid Ltd., Basingstoke, Simpson’s Index of Diversity Calculation UK), 200 μL of cell suspension diluted to 1:100 was transferred The Simpson’s index of diversity (diversity index, DI) was used into each microtiter plate well, and the later was incubated at to evaluate the genetic diversity and discriminatory ability of 37 C for 72 h. After three brief washes with 200 μL phosphate- diﬀerent typing methods. The formula is as follows: buﬀered saline (PBS) solution and a 20-min ﬁxation step with 200 μL methanol, all plates were stained with 200 μL 0.4% (wt/vol) crystal violet (CV) for 15 min and washed with 200 DI = 1 − n (n − 1) (1) j j [N(N − 1)] μL PBS for another 15 min. The formed bioﬁlm was then j−1 dissolved with 200 μL 33% (wt/vol) acetic acid for 30 min. The bioﬁlm formation was measured at 570 nm optical density (OD) n is the number of isolates belonging to the jth type, and N is the in a micro-titer plate reader (Tecan, Mannedorf, Switzerland). total number of tested isolates. Salmonella Typhimurium ATCC14028, a strong bioﬁlm-forming strain, was selected as the positive control and sterile TSB was Statistical Analysis used as negative control for the bioﬁlm production assays (Yan The Chi-square test was calculated using SPSS 20.0 (SPSS, et al., 2015). These bioﬁlm assays were performed in triplicate Chicago, USA), in order to analyze the diﬀerences in that included biological duplicates. An OD value of 0.6 570nm the prevalent rates, the proportion of isolates resistant to was applied as the cutoﬀ point to distinguish between bioﬁlm antimicrobial agents, and the distribution of virulence genes, producer from non-bioﬁlm producer [cut-oﬀ (ODc) = average bioﬁlm related genes, enterotoxin production, and bioﬁlm OD plus 3 standard deviation (SD) of negative control]. The production ability between two farms. Values of p < 0.05 were bioﬁlm formation was classiﬁed as strong+++ (OD > 1.8), considered statistically signiﬁcant. 570nm moderate++ (1.8 > OD >1.2), weak+ (1.2 > OD > 570nm 570nm 0.6), and negative − (OD < 0.6). 570nm RESULTS Multilocus Sequence Typing (MLST) Isolation and Identiﬁcation of S. aureus All S. aureus isolates were examined by MLST, based on Of the 195 raw milk samples, 90 (46.2%, 90/195) were conﬁrmed the sequencing of 7 housekeeping genes described previously with S. aureus, and in all 96 isolates were obtained in this study (Enright et al., 2000). Alleles and the sequence type (ST) were (Table 2). Twelve isolates cultured from six samples (2 isolates assigned according to the S. aureus MLST database (http://www. were cultured per samples), respectively, were included in this mlst.net/). The STs were then clustered in to clonal complexes study, as both strains of each sample were subsequently found to (CC) by eBURST v.3 software (http://eburst.mlst.net; Feil et al., have diﬀerent genetic patterns and/or phenotypes (Table 3 and 2004). Figure 1). Of the 90 S. aureus-positive samples, 71 of 147 (48.2%) Frontiers in Microbiology | www.frontiersin.org 4 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus TABLE 2 | Prevalence of S. aureus in raw milk in Beijing. Farm No. of No. (%) of samples No. of S. aureus No. (%) of MRSA samples with conﬁrmed isolates isolates S. aureus A 147 71 (48.2%) 73 1 (1.4%) B 48 19 (39.6%) 23 ND* Total 195 90 (46.2%) 96 1 (1%) *ND means no detection. and 19 of 48 (39.6%) raw milk samples collected from farm A and farm B respectively, were positive for S. aureus. Meanwhile, 73 and 23 S. aureus isolates were obtained from samples collected from farm A and farm B, respectively. Additionally, one S. aureus isolate (1%, 1/96) cultured from farm A was then identiﬁed to harbor the mecA gene, thereby classifying it as a MRSA isolate (Table 2 and Figure 1). Antimicrobial Susceptibility Table 4 shows the antimicrobial susceptibility results for the tested isolates. Of the 96 S. aureus isolates tested, resistance was most frequently observed to penicillin (31.3%, 30/96), followed by ciproﬂoxacin (18.8%, 18/96) and enroﬂoxacin (15.6%, 15/96), and to a lesser extent tilmicosin (6.3%, 6/96), erythromycin (5.2%, 5/96), gentamycin (1.0%, 1/96), chloramphenicol (1.0%, 1/96), and tetracycline (1.0%, 1/96). Isolates from farm B showed signiﬁcantly higher resistance to penicillin (73.9%), ciproﬂoxacin (34.8%), enroﬂoxacin (34.8%), tilmicosin (17.4%), and erythromycin (17.4%) than those from farm A (p< 0.05; Table 4). All S. aureus isolates were susceptible to ceftiofur, daptomycin, and vancomycin. Notably, 52 (54.2%, 52/96) and seven (7.3%, 7/96) isolates, all of which were cultured from farm A, expressed an intermediate phenotype to ciproﬂoxacin and enroﬂoxacin, respectively. Meanwhile, for the top three resistant phenotypes to penicillin, ciproﬂoxacin, enroﬂoxacin, the MIC and MIC were measured at 0.06- and 8-μg/mL, 50 90 2- and 8-μg/mL, 0.5 and 4-μg/mL, respectively. Additionally, thirty-seven isolates (38.5%, 37/96) showed resistant to at least one antimicrobial and 6 isolates (6.3%, 6/96) showed resistant to ≥3 classes (MDR) (Tables 4, 5 and Figure 1). Totally, nine resistance patterns were identiﬁed, wherein PEN (16.7%, 16/96), PEN-CIP-ENO-ERY-TIL (5.2%, 5/96) and PEN-CIP-ENO (5.2%, 5/96) were the top three frequently identiﬁed patterns. Greater diversity among the resistance patterns from farm A (8 patterns) than those from farm B (3 patterns), were noted (Table 5 and Figure 1). PEN-CIP-ENO-ERY-TIL, and PEN were more frequently detected from farm B than from farm A (p < 0.05), while PEN-CHL-GEN-TIL, PEN-CIP-ENO, PEN-CIP, CIP, ENO, and TET were only identiﬁed in farm A and CIP-ENO only in farm B. Presence of Virulence and Bioﬁlm Related Genes Of the 96 S. aureus isolates tested, 91 (94.8%) were detected to have one or more virulence genes, and 6 virulence genes (tst, pvl, Frontiers in Microbiology | www.frontiersin.org 5 June 2018 | Volume 9 | Article 1123 TABLE 3 | Characteristics of isolates cultured from the same samples . Sample ID Isolates Genotype patterns Virulence genes Bioﬁlm related genes Antimicrobial resistance Enterotoxin Bioﬁlm Farms production formation M11 M11-1 PFGE cluster II-CC1-ST1-t127-agr III sea-sec icaA-icaD-clfA-clfB-can-fnbA-fnbB - SEA-SEC ++ A M11-2 PFGE cluster II-CC1-ST1-t127-agr III pvl-sea-sec icaA-icaD-clfA-clfB-can-fnbA-fnbB - SEA-SEC ++ A M17 M17-1 PFGE cluster II-CC1-ST1-t127-agr III pvl-sea-sec icaA-icaD-clfA-clfB-can-fnbA-fnbB - SEA-SEC + + + A M17-2 PFGE cluster II-CC1-ST1-t127-agr III pvl-sea-sec icaA-icaD-clfA-clfB-can-fnbA - SEA-SEC ++ A M23 M23-1 PFGE cluster V-CC50-ST50-t518-agr IV pvl icaA-icaD-clfA-clfB-can-fnbA-fnbB - - + + + A M23-2 PFGE cluster V-CC50-ST50-t518-agr IV pvl-sea-sec icaA-icaD-clfA-clfB-can-fnbA-fnbB TET SEC ++ A M34 M34-1 PFGE cluster II-CC1-ST1-t127-agr III pvl-sea-sec icaA-icaD-clfA-clfB-can-fnbA-fnbB - SEA-SEC ++ A M34-2 PFGE cluster III-CC97-ST97-t730-agr I pvl-sec-sed icaA-icaD-clfA-clfB-can-fnbA-fnbB PEN-CIP-ENO SEC-SED ++ A M87 M87-1 PFGE cluster I-CC1-ST1-t2279-agr III pvl-seb icaA-icaD-clfA-clfB-can-fnbA-fnbB PEN SEB + + + B M87-2 PFGE cluster I-CC1-ST1-t2279-agr III pvl icaA-icaD-clfA-clfB-can-fnbA-fnbB PEN - ++ B M91 M91-1 PFGE cluster I-CC1-ST1-t2279-agr III pvl-seb icaA-icaD-clfA-clfB-can-fnbA-fnbB PEN SEB ++ B M91-2 PFGE cluster VI-CC398-ST398-t14156-agr I - icaA-icaD-clfA-clfB-can-fnbA-fnbB PEN-CIP-ENO-ERY-TIL - + B “-”means that isolates did not have this genotype or phenotype. Wang et al. Prevalence and Characterization of Staphylococcus aureus FIGURE 1 | Dendrogram of PFGE patterns and antimicrobial susceptibility testing (AST), virulence genes, enterotoxin production, bioﬁlm and adhesion related genes, mecA gene, and molecular characterization of 96 S. aureus isolates cultured from raw milk in Beijing China. Ninety-six isolates were grouped into 6 clusters (cluster I-VI) by PFGE patterns and all had more than 92% similarity. The results of AST were showed in different colors according to the MIC values of isolates to different antimicrobial agents. Green squares indicate susceptibility; yellow squares indicate intermediate; and red squares indicate resistance. The detection of virulence genes, enterotoxin production, bioﬁlm and adhesion related genes, and mecA gene were summarized by a heat map. Black squares denote that the studied genes were detected in those isolates, or those isolates could produce those types of enterotoxins. White squares denote that those isolates lack these studied genes or could not produce those types of enterotoxins. BPA represents bioﬁlm production ability. ST/CC represents sequence type of MLST and the clone complex (CC) of this ST. agr represents agr types. Antimicrobial compounds used are abbreviated as follows: TIO, Ceftiofur; CHL, chloramphenicol; CIP, ciproﬂoxacin; DAP, daptomycin; ENO, enroﬂoxacin; ERY, erythromycin; FOS, fosfomycin; GEN, gentamycin; PEN, penicillin; TET, tetracycline; TIM, tilmicosin; VAN, vancomycin. The same symbols beside farm number of , N, F, H, ⋆, and represent isolates cultured from M11, M17, M23, M34, M87, and M91, respectively. Frontiers in Microbiology | www.frontiersin.org 6 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus TABLE 4 | Antimicrobial susceptibility of the study isolates to eight of the 12 antimicrobial agents tested. Antimicrobials MIC MIC Range Resistant, no. of isolates (%) Intermediate, no. of isolates (%) Susceptible, no. of isolates (%) 50 90 Farm A Farm B Total Farm A Farm B Total Farm A Farm B Total Penicillin 0.06 8 0.06—32 13(17.8) 17(73.9)* 30(31.3) 0(0) 0(0) 0(0) 60(82.2) 6(26.1) 66(68.8) Ciproﬂoxacin 2 8 0.125—16 10(13.7) 8(34.8)* 18(18.8) 52(71.2) 0(0) 52(54.2) 11(15.1) 15(65.2) 26(27.1) Enroﬂoxacin 0.5 4 0.125—32 7(9.6) 8(34.8)* 15(15.6) 7(9.6) 0(0) 7(7.3) 59(80.1) 15(65.2) 74(77.1) Tilmicosin 2 2 0.5—64 2(2.7) 4(17.4)* 6(6.3) 0(0) 0(0) 0(0) 71(97.3) 19(82.6) 90(93.8) Erythromycin 0.25 0.25 0.125—16 1(1.4) 4(17.4)* 5(5.2) 2(2.7) 0(0) 2(2.1) 70(95.9) 19(82.6) 89(92.7) Gentamycin 1 1 0.5—64 1(1.4) 0(0) 1(1) 0(0) 0(0) 0(0) 72(98.6) 23(100) 95(99) Chloramphenicol 8 8 0.5—128 1(1.4) 0(0) 1(1) 1(1.4) 1(4.3) 2(2.1) 71(97.3) 22(95.7) 93(96.9) Tetracycline 0.5 0.5 0.25—64 1(1.4) 0(0) 1(1) 1(1.4) 0(0) 1(1) 71(97.3) 23(100) 94(97.9) Fosfomycin 32 64 0.5—256 0(0) 0(0) 0(0) 1(1.4) 0(0) 1(1) 72(98.6) 23(100) 95(99) Ceftiofur 0.5 2 0.25—64 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 73(100) 23(100) 96(100) Daptomycin 0.5 1 0.06—16 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 73(100) 23(100) 96(100) Vancomycin 0.5 1 0.06—128 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 73(100) 23(100) 96(100) *p < 0.05. sea to sed) were identiﬁed with no see genes ampliﬁed, by PCR in The microtiter plate assay showed that all 96 S. aureus from this study (Table 5 and Figure 1). The 4 SEs genes were detected the two farms could produce bioﬁlm, although at diﬀerent in 80.2% (77/96) of all 96 isolates. The three most frequently intensities (Table 5 and Figure 1). Eight isolates (8.3%, 8/96), detected virulence genes were pvl (93.8%, 70/96), sec (65.6%, including 4 from farm A and farm B, were able to produce bioﬁlm 63/96), and sea (60.4%, 58/96), followed by seb (14.6%, 14/96), weakly; 68 strains (70.8%, 68/96), including 53 isolates from farm sed (5.2%, 6/96), and tst (2.1%, 2/96). Prevalence rates of the A and 17 isolates from farm B respectively, showed moderate pvl and sec genes from farm A (97.3% and 84.9% respectively) bioﬁlm formation; 18 strains (18.8%, 18/96), including 16 isolates were higher than those from farm B (82.6 and 4.3% respectively) from farm A and 2 isolates from farm B respectively, showed (p < 0.05). While, the tst and sea genes were only identiﬁed strong bioﬁlm formation. in farm A, and the seb gene was only identiﬁed in farm B MLST (Table 5). In total, eight diﬀerent virulence gene patterns were observed. Among all patterns, the pvl-sea-sec (59.4%, 57/96) was All 96 isolates were typed by MLST as shown in Table 5 and Figures 1–3. A total of 5 sequence types (STs) were identiﬁed common, followed by pvl (14.6%, 14/96), pvl-seb (13.5%, 13/96). The pvl-sec-sed and tst-pvl-sec-sed patterns were found in 2.1% (ST1, ST7, ST50, ST97, and ST398), which were further grouped into 5 CCs. In this study, CC1 was represented by ST1 (CC1- (2/96 each) of all 96 isolates, respectively, while pvl-sec, sea-sec, ST1) alone, being found as the most predominate sequence and pvl-seb-sed were found in 1% (1/96 each) of all 96 isolates, type (71.9%, 69/96) in both two farms, followed by CC50- respectively (Table 5). ST50 (13.5%, 13/96), CC398-ST398 (6.3%, 6/96), and CC7-ST7 Table 5 lists the bioﬁlm and adhesion related genes of the 96 and CC398-ST398 (4.2%, 4/96 each). The clonal lineages of S. aureus isolates recovered from farm A and farm B. The results S. aureus isolates were further analyzed based on the sampling show that the icaA, icaD, clfA, clfB, can, and fnbA genes were detected in all of the 96 isolates, while 7 isolates (5 from farm A farms. As shown in Table 5 and Figure 1, four clonal lineages were identiﬁed from farm A, including CC1-ST1, CC50-ST50, and 2 from farm B) did not carry the fnbB gene and the bap gene was only detected in one isolate from farm B. CC97-ST97, and CC398-ST398. In contrast, three clonal lineages were identiﬁed from farm B, including CC1-ST1, CC7-ST7, and CC398-ST398. Determination of Enterotoxin Production, and Bioﬁlm Production Ability spa Typing In total, 77 isolates were detected by PCR to have enterotoxin A total of 7 spa types were obtained in all 96 S. aureus, with 1 genes, while 53 (55.2%, 53/96), 14 (14.6%, 14/96), 59(61.5%, novel spa type (t17182) identiﬁed (Table 5 and Figure 1). The 59/96), and 5 (5.2%, 5/96) could produce SEA, SEB, SEC, and most prevalent spa type was t127 (56.3%, 54/96) and this was SED, respectively (Table 5). More than 90% of the SEs genes associated with isolates cultured from farm A. In addition to t127, harboring S. aureus isolates could produce enterotoxins. four other spa types were also found in isolates from farm A (t518, Additionally, 54 (70.1%, 54/77) isolates simultaneously t730, t034, and t14156). Meanwhile, Isolates from farm B were produced two types of enterotoxins (Table 5 and Figure 1). deﬁned by 3 spa types, including t2279, t14156, and t17182. Based Moreover, the MRSA isolates harboring sea and sec genes on MLST, isolates of the sequence types ST7, ST50, and ST97 had also have the ability to producing both enterotoxins, SEA their own identical spa types (ST50-t518, ST97-t730, and ST7- and SEC. t17182) (Table 5 and Figures 1, 3). However, there were some Frontiers in Microbiology | www.frontiersin.org 7 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus TABLE 5 | Phenotypes and genotypes of 96 S. aureus isolates tested in this study. Phenotypes or genotypes tested in this study No. of isolates (%) Farm A Farm B Total Antimicrobial resistance patterns PEN 3(4.1) 13(56.5)* 16(16.7) CIP 1(1.4) 0(0) 1(1) ENO 1(1.4) 0(0) 1(1) TET 1(1.4) 0(0) 1(1) PEN-CIP 3(4.1) 0(0) 3(3.1) CIP-ENO 0(0) 4(17.4) 4(4.2) PEN-CIP-ENO 5(6.8) 0(0) 5(5.2) PEN-CHL-GEN-TIL 1(1.4) 0(0) 1(1) PEN-CIP-ENO-ERY-TIL 1(1.4) 4(17.4)* 5(5.2) ND 57(78.1) 2(8.7) 59(61.5) Virulence genes tst 2(2.7) 0(0) 2(2.1) pvl 71(97.3)* 19(82.6) 90(93.8) sea 58(79.5) 0(0) 58(60.4) seb 0(0) 14(60.9) 14(14.6) sec 62(84.9)* 1(4.3) 63(65.6) sed 4(5.5) 1(4.3) 5(5.2) see 0(0) 0(0) 0(0) ND 1(1.4) 4(17.4) 5(5.2) Virulence gene patterns pvl 10(13.7) 4(17.4) 14(14.6) pvl-seb 0(0) 13(56.5) 13(13.5) pvl-sec 0(0) 1(4.3) 1(1) sea-sec 1(1.4) 0(0) 1(1) pvl-sea-sec 57(78.1) 0(0) 57(59.4) pvl-seb-sed 0(0) 1(4.3) 1(1) pvl-sec-sed 2(2.7) 0(0) 2(2.1) tst-pvl-sec-sed 2(2.7) 0(0) 2(2.1) ND 1(1.4) 4(17.4) 5(5.2) Enterotoxin production SEA 53(72.6) 0(0) 53(55.2) SEB 0(0) 14(60.9) 14(14.6) SEC 58(79.5)* 1(4.3) 59(61.5) SED 4(5.5) 1(4.3) 5(5.2) SEE 0(0) 0(0) 0(0) ND 11(15.1) 8(34.8) 19(19.8) Enterotoxin production patterns SEA 4(5.5) 0(0) 4(4.2) SEB 0(0) 13(56.5) 13(13.5) SEC 5(6.8) 1(4.3) 6(6.3) SEA-SEC 49(67.1) 0(0) 49(51) SEB-SED 0(0) 1(4.3) 1(1) SEC-SED 4(5.5) 0(0) 4(4.2) ND 11(15.1) 8(34.8) 19(19.8) Bioﬁlm related genes icaA-icaD-clfA-clfB-can-fnbA 5(6.8) 2(8.6) 7(7.3) icaA-icaD-clfA-clfB-can-fnbA-fnbB 68(93.2) 20(86.9) 88(91.7) bap-icaA-icaD-clfA-clfB-can-fnbA-fnbB 0(0) 1(4.3) 1(1) (Continued) Frontiers in Microbiology | www.frontiersin.org 8 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus TABLE 5 | Continued Phenotypes or genotypes tested in this study No. of isolates (%) Farm A Farm B Total Bioﬁlm production ability + (range of OD: 0.913-1.196) 4(5.5) 4(17.39) 8(8.3) ++ (range of OD: 1.246-1.797) 53(72.6) 17(73.9) 70(72.9) + + + (range of OD: 1.807-2.156) 16(21.9) 2(8.7) 18(18.8) agr types I 6(8.2) 8(34.8) 14(14.6) II 0(0) 0(0) 0(0) III 54(74) 15(65.2) 69(71.9) IV 13(17.8) 0(0) 13(13.5) MLST CC1-ST1 54(74) 15(65.2) 69(71.9) CC7-ST7 0(0) 4(17.4) 4(4.2) CC50-ST50 13(17.8) 0(0) 13(13.5) CC97-ST97 4(5.5) 0(0) 4(4.2) CC398-ST398 2(2.7) 4(17.4) 6(6.3) spa typing t034 1(1.4) 0(0) 1(1) t127 54(74) 0(0) 54(56.3) t518 13(17.8) 0(0) 13(13.5) t730 4(5.5) 0(0) 4(4.2) t2279 0(0) 15(65.2) 15(15.6) t14156 1(1.4) 4(17.4) 5(5.2) t17182 0(0) 4(17.4) 4(4.2) Genotype patterns PFGE cluster I-CC1-ST1-t2279-agr III 0(0) 15(65.2) 15(15.6) PFGE cluster II-CC1-ST1-t127-agr III 54(74) 0(0) 54(56.3) PFGE cluster III-CC97-ST97-t730-agr I 4(5.5) 0(0) 4(4.2) PFGE cluster IV-CC7-ST7-t17182-agr I 0(0) 4(17.4) 4(4.2) PFGE cluster V-CC50-ST50-t518-agr IV 13(17.8) 0(0) 13(13.5) PFGE cluster VI-CC398-ST398-t034-agr I 1(1.4) 0(0) 1(1) PFGE cluster VI-CC398-ST398-t14156-agr I 1(1.4) 4(17.4) 5(5.2) Quantiﬁcation of bioﬁlm formation by optical density (OD) determination: (+ + +): strong bioﬁlm producers (OD570 > 1.8), (++): moderate bioﬁlm producers (1.8 > OD570 > 1.2), (+): weak bioﬁlm producers (1.2 > OD570 > 0.6); *p < 0.05. exceptions that several isolates owned the identical sequence PFGE Sub-typing and Identiﬁcation of type but diﬀerent spa types (ST1-t127/t2279, ST398-t034/t1456) Major Clones (Table 5 and Figures 1, 3). Among 96 isolates subtyped by PFGE, six isolates (belonging to ST398) could not be typed by this method (Table 5 and Figure 1). The other 90 isolates were distinguished into 14 pulso agr Genotyping types and then gathered into ﬁve PFGE clusters (Cluster I–V) The distribution of agr alleles among the 96 isolates is provided based on more than 92% genetic similarity. The predominant in Table 5. Using a multiplex-based PCR, agr alleles were PFGE cluster was cluster II and included 54 isolates all cultured successfully identiﬁed in 96 isolates. The agr III genotype was from farm A, and which were diﬀerentiated into 4 pulso types. predominant, representing 71.9% (69/96) of the isolates and Fifty of these 54 isolates were found to sharing the same PFGE was the prevailing agr type regardless of the sampling farms of banding patterns. All isolates in cluster II were characterized S. aureus isolates, followed by agr I (14.6%, 14/96) and agr VI as PFGE cluster II-CC1-ST1-t127-agr III. Cluster I included 15 (13.5%, 13/96). No agr II type was detected among all 96 isolates. isolates with 5 pulso types and included PFGE Cluster I-CC1- Furthermore, all 14 isolates with agr I were discriminated into ST1-t2279-agr III. All 15 isolates in cluster-I were cultured from three STs and four spa types (ST7-t17182, ST97-t730, ST398- farm B. Four isolates from farm A were characterized as PFGE t034, and ST398-t1456). All 69 isolates with agr III with the Cluster III-CC97-ST97-t730-agr I, while another 4 isolates from same sequence type were discriminated into two spa types (ST1- farm A were included in PFGE Cluster III-CC97-ST97-t730-agr I t2279 and ST1-t127). However, all 13 isolates with agr IV had the characterized as PFGE Cluster IV-CC7-ST7-t17182-agr I. Cluster identical sequence type and spa type (ST50-t518) (Table 5 and V included 13 isolates with 3 pulso types that were designated Figure 1). Frontiers in Microbiology | www.frontiersin.org 9 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus FIGURE 2 | Population snapshot analyses by eBURST on 5779 S. aureus strains that belonged to 2766 STs in S. aureus MLST database. Pink circles labeled with red arrows and the ST names in black font are used for sequence types identiﬁed in this study. Relationship Between Phenotypes and Genotypes The relationship between antimicrobial resistance, virulence, bioﬁlm and molecular subtypes is shown in Figure 1. Each clonal complex had speciﬁc antimicrobial resistance, virulence, and bioﬁlm characteristics. Isolates identiﬁed as CC1-ST1 clones and contained within PFGE cluster I-t2279-agr III were found to be resistance only to PEN with two isolates susceptible to all tested antimicrobial agents tested, followed by three virulence gene patterns denoted as aspvl-seb(13/15), pvl(1/15), and pvl- seb-sed (1/15). Isolates within PFGE cluster II-CC1-ST1-t127- agr III exhibited more resistant diversity including PEN-CIP (3/54), PEN-CIP-ENO (1/54), PEN (1/54), CIP (1/54), ENO (1/54),followed by two virulence gene patterns denoted as pvl- sea-sec (53/54) and sea-sec (1/54). All isolates in this cluster were un-susceptible to CIP. All isolates within PFGE cluster III-CC97-ST97-t730-agr I expressed resistance to PEN, CIP, and ENO, followed by two virulence gene patterns, tst-pvl-sec- FIGURE 3 | Minimum Spanning Tree of 96 S. aureus isolates based on the sed(2/4) and pvl-sec-sed(2/4). The isolates identiﬁed as PFGE MLST data. Colors indicate ST of each node. The spa types of 96 S. aureus cluster IV-CC7-ST7-t17182-agr I showed resistant to CIP and isolates were also showed within each node. Novel spa type identiﬁed in this ENO, followed by two virulence gene patterns, pvl(3/4) and pvl- study was t17182. sec (1/4). Only three isolates (3/13) with PFGE cluster V-CC50- ST50-t518-agr IV exhibited a resistance phenotype (2 resistant to PEN and 1 resistance to TET) and all 13 isolates in this as Cluster V-CC50-ST50-t518-agr IV. Moreover, 6 ST398 isolates cluster harbored the pvl gene, with three isolates also carrying that could not be digested with SmaI, were grouped as PFGE the sea and sec genes. In contrast, isolates identiﬁed as CC398- cluster VI in this study (Cluster VI-CC398-ST398-t034/t1456- ST398 expressed the greatest MDR in this study (5 patterns agr I). The DI values of PFGE, spa typing, MLST, and agr of PEN-CIP-ENO-ERY-TIL and 1 patterns of PEN-CHL-GEN- typing of all 96 isolates were 0.701, 0.641, 0.463, and 0.448, TIL). Moreover, the only MRSA isolate with CC398-ST398- respectively. t034-agr I harbored three virulence genes of pvl, sea and sec, Frontiers in Microbiology | www.frontiersin.org 10 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus whereas another 5 CC398-ST398 isolates identiﬁed as t1456- lower than two previous reports in Chinese (87% and 72.2%, agr I were found to carry none of the tested virulence genes. respectively) and those in India (95%) (Li et al., 2015; Rola Bioﬁlm formation assay showed that this CC398-ST398-t1456- et al., 2015; Mistry et al., 2016; Giacinti et al., 2017; Liu et al., agr I clone was only able to produce bioﬁlm weakly in this 2017). Moreover, only 6 isolates (6.3%) showed MDR that was study. lower than reports in other regions in China (Li et al., 2015; Liu et al., 2017). According to previous studies, penicillin- resistant S. aureus are the most prevalence isolates among raw milk and ranged from less than 10% to over 80% (Li et al., DISCUSSION 2015; Rola et al., 2015; Liu et al., 2017). In this study, 31.3% S. aureus has been considered as an important cause of zoonotic of S. aureus were resistant to this antimicrobial agent. It was disease and the potential transmission of MRSA between notable that ciproﬂoxacin- and enroﬂoxacin-resistant S. aureus livestock and humans through close contact, handling and/or were found to be the next most frequently detected resistance consumption of S. aureus infected food of animal origin (Kateete types in addition to penicillin. Both are ﬂuoroquinolones, et al., 2013; Song et al., 2015; Pereyra et al., 2016). The wherein ciproﬂoxacin a third generation ﬂuoroquinolone is infection of dairy herds and contamination of raw milk by used at clinical level while enroﬂoxacin is specially used for S. aureus, especially those expressing a MDR phenotype and veterinary applications in China (Hoang et al., 2017; Li J. possessing the ability for produce bioﬁlm and toxins including et al., 2017). Once human and/or animals become infected enterotoxin, TSST-1 and PVL, remains an important public with these resistant isolates, treatment failure using these two health issue (Cavicchioli et al., 2015; Wang et al., 2016). The antimicrobials, is inevitable. Additionally, 54.2 and 7.3% of the public health signiﬁcance caused by this bacterium is manifested isolates from farm A expressed an intermediate phenotype to by food-borne poisoning outbreaks caused by dairy products ciproﬂoxacin and enroﬂoxacin, respectively. Meanwhile, isolates contaminated by S. aureus, including one of the largest food- from farm B exhibited signiﬁcantly higher resistance to a panel borne outbreaks on record involving 13,420 infected individuals of antimicrobial compounds including penicillin, ciproﬂoxacin, in Japan (Asao et al., 2003; Hennekinne et al., 2012). Of note, enroﬂoxacin, tilmicosin, and erythromycin when compared to food-borne infections attributed to S. aureus contaminated dairy those from farm A (p < 0.05). Moreover, the resistance patterns foods are also frequently reported in China (Rong et al., 2017). were diﬀerent between two farms in that PEN-CIP-ENO-ERY- Additionally, the economic cost burden to the dairy farms is TIL and PEN were more frequently detected from farm B considerable; mastitis in dairy cow can result in reductions compared with farm A (p < 0.05). These results suggested that in milk yield, treatment expense and/or culling in sometimes the isolates from both farms may have their own resistance (Hennekinne et al., 2012). This study investigated the prevalence, characteristics and the resistance patterns from farm A were genetic diversity, antimicrobial resistance phenotypes, carriage of more diverse than those from farm B (p < 0.05). Furthermore, staphylococcal virulence factors along with testing the capacity of it has been reported that rational management and appropriate these isolates to produce bioﬁlm and the 5 classical enterotoxins usage of antimicrobial compounds in food-producing livestock (SEA to SEE). All of these S. aureus were isolated from raw milk is very important to control and prevent the spread of drug- samples taken in 2 dairy farms in Beijing, China. Acquisition of resistant isolates (Jessen et al., 2017). All isolates in this study the prevalence and characteristics of S. aureus isolated from raw exhibited low-level resistance to other antimicrobial agents tested milk would be helpful to obtain the antimicrobial resistance and and similarly the MIC and MIC values were relatively low, a 50 90 virulence markers as well as predominant clones which can help situation that is much diﬀerent to previous reports in China and prevent and control the S. aureus contamination in dairy herd other countries (Li et al., 2015; Mistry et al., 2016; Liu et al., 2017). and protect the end consumer. The relatively low rate of resistance and MDR isolates observed In the present study, 46.2% (90/195) of raw milk samples in this study could be due to the extensive farming systems and taken from dairy cows with mastitis were positive for S. aureus. the strict management of the use of antimicrobial agents by the This prevalence is similar to a recent report in China and other company. reports in Brazil and Italy (Cavicchioli et al., 2015; Li et al., 2015; MRSA is considered as major cause of hospital-acquired Giacinti et al., 2017). However, another recent study reported and community-acquired infections (Gopal and Divya, 2017). that the prevalence of S. aureus in raw milk of health cows in Additionally, the contaminated animal and associated products Beijing was 22.0% (Liu et al., 2017). Overall, our data indicate have been supposed to be a potential source of community- that S. aureus is common and frequently detected in the raw milk acquired MRSA (Gopal and Divya, 2017). Recently, the isolation of dairy cows with mastitis in Beijing, China. Further research is of MRSA from raw milk and dairy products has been reported needed to explore methods of controlling S. aureus occurrence in worldwide (Rola et al., 2016; Tarekgne et al., 2016; Basanisi raw milk. et al., 2017). In this study, one S. aureus isolate (1.4%, 1/96) In recent years, the emergence of MDR S. aureus, particularly was identiﬁed as MRSA being conﬁrmed by amplifying the mecA MRSA, leading to animal and human infections, has become a gene. The current study’s prevalence reported for MRSA is lower growing public health concern (Li et al., 2015). In the current than those reported previously in China or India (4.8–48.7%) (Li study, few resistances were detected among all 96 S. aureus et al., 2015; Mistry et al., 2016; Liu et al., 2017). However, the (38.5% resistant to at least one antimicrobial), which were potential MRSA transmission risk via the food chain, particularly similar to those in Italy (39.4%) and Poland (23%), but much by insuﬃcient pasteurization milk, cannot be ignored. Frontiers in Microbiology | www.frontiersin.org 11 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus With regard to the risk of pathogenicity, the presence of persist in this environment. The ability to form bioﬁlms helps virulence genes among all 96 isolates was also assessed in this S. aureus to persist in infections and subclinical and clinical study. The classic enterotoxin SE determinants, of S. aureus are cases of bovine mastitis (Dhanawade et al., 2010). In the known to cause sporadic food-poisoning incidents or even food- present study all 96 S. aureus isolates could form bioﬁlms as borne outbreaks. It is reported that 89.7% isolates from cow milk determined by the microtiter plate assay described above, and related to mastitis carried one or more SEs genes (Song et al., these ﬁndings agree with a previous report from Argentina 2015). In the current study, 80.2% of the isolates were positive but being higher in number than reported in a similar study for SE encoding genes and the sec (65.6%) and sea (60.4%) genes from Brazil (Lee et al., 2014; Pereyra et al., 2016). The high were the most frequently detected. This ﬁnding is similar to incidence of bioﬁlm-producing S. aureus isolates in this study those in previous reports from China and Australia, whereas suggests the necessary for dairy farms to improve the quality the sed gene was mainly detected among isolates from raw milk assurance systems, in order to decrease and eliminate these samples in Poland (Rola et al., 2015; Song et al., 2015; McMillan isolates. et al., 2016; Liu et al., 2017). Meanwhile, another Chinese study Our data also highlighted the diverse genetic backgrounds reported that the seb gene was the most commonly detected of the S. aureus from raw milk by MLST, spa typing, agr (Cheng et al., 2016). Additionally, the prevalence rates of the typing and PFGE sub-typing. Since the MLST genotyping sec gene from farm A (84.9%) was higher than from farm B for S. aureus was ﬁrst reported, it has been widely used in (4.3%) (p < 0.05). While, the sea gene was only found in farm epidemiological analysis of S. aureus infection and associated A, and the seb gene was only found in farm B. Therefore, the food poisoning outbreaks (Enright et al., 2000). In this study, diﬀerent prevalence rates observed among all SE genes could be ﬁve sequence types were obtained by MLST and each was due to the fact that these isolates originated in geographically further grouped into a clonal complexes. CC1-ST1 was the diverse locations. According to previous reports, the see gene predominant clone (71.9%, 69/96), followed by CC50-ST50, was rarely present in raw milk or even retail food in China, and CC398-ST398, CC7-ST7, and CC398-ST398, all of which have similarly, this marker was not detected in this study. Notably, been reported in raw milk in China, previously (Song et al., the pvl-encoding gene showed a very high prevalence (93.8%) 2015). Moreover, the ST1 and ST97 lineages were also detected in the tested isolates, which was similar to previous reports frequently from bovine milk worldwide, while ST398, the most (Esposito et al., 2013; Aires-de-Sousa, 2017). It was reported that common livestock-associated MRSA type, has been already the pvl-encoding gene were present at a high prevalence among found in both food-producing animal and human species methicillin-sensitive isolates and the Livestock-associated MRSA (Mistry et al., 2016; Gopal and Divya, 2017). Six isolates (LA-MRSA) isolates positive with PVL mostly originated from were identiﬁed as ST398 including the only one detected as a humans (Price et al., 2012; Wardyn et al., 2012). Two isolates MRSA strain in this study. It was reported that MRSA ST398 in this study were identiﬁed to have the tst gene, which could is the most prevalent clone in Europe and North America, cause severe clinical diseases (Xie et al., 2011). Our data highlight whereas methicillin-susceptible S. aureus (MSSA) ST398 was the necessity to identify virulence factors among pathogenic predominant in Asian regions (Asai et al., 2012; Yan et al., S. aureus. 2014). In total, six known spa types (t034, t127, t518, t730, Several studies examined for the presence of SEs genes among t1456, and t2279) and 1 newly identiﬁed spa type (t17182) were S. aureus cultured from raw milk and their food products (Asao identiﬁed in this study. A previous study also observed spa et al., 2003; Song et al., 2015; Cheng et al., 2016; Liu et al., diversity among the STs although some spa types corresponded 2017). However, few reports assessed the enterotoxin producing with either an ST or a CC (Chao et al., 2015). The spa capacity of these isolates in China. To our best knowledge, this types, t127 and t2279, have been reported as community- study ﬁrstly reported the production of 4 classic SEs in raw dairy associated clones previously, and these were the top two milk in China. The results showed that >90% of the SEs (sea to frequently distributed genotypes among raw milk samples where sed) genes carried S. Aureus isolates could produce enterotoxins. all isolates of both types were identiﬁed as ST1 (Song et al., Additionally, 54 (70.1%, 54/77) of the SE gene carrying S. aureus 2015). Considering the transmission of bacterial species between simultaneously produced two types of enterotoxins, including humans and livestock is increasingly being detected in farm one MRSA isolate (positive for SEA and SEC). Once enterotoxins workers in several countries (Huijsdens et al., 2006; Kateete were already produced, and these can generally retain their et al., 2013), a recent study showed that the t127 clone could biological activity even after heat treatment (Cavicchioli et al., be present in cows, humans and environments (Papadopoulos 2015). Thus, it is necessary to develop measures to eliminate the et al., 2018). Although isolates of this spa type exhibited less contamination of this bacterium in dairy products. antimicrobial resistance in this study, the potential of bioﬁlm The study also investigated the distribution of bioﬁlm and and enterotoxin producing would lead to persistent existence adhesion related genes among all isolate, some of which are and subsequent contamination. Therefore, this clone could be also related to bacterial virulence (Rasmussen et al., 2013). In important source of contaminations in cow farms, leading to this study, all 96 isolates harbored the icaAD, fnbA, clfAB, quickly spread and large infections in both dairy herd and human and cna genes and 92.7% of the isolates harbored the fnbB community. gene. In contrast the bap gene was only detected in one Isolates of ST398 types corresponded to one t034 (MRSA) isolate. Thus, these isolates have the ability to form bioﬁlm and 5 to t1456 (MSSA) along with each of the other STs being a feature that suggests these bacteria have the potential to linked to sole spa type. Of note, the ST398-t1456 MSSA was ﬁrstly Frontiers in Microbiology | www.frontiersin.org 12 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus identiﬁed in China, while the ST398-t1456 clone was related CONCLUSIONS to LA-MRSA in Europe (Köck et al., 2013). Furthermore, the In summary, our research provides detailed epidemiological newly identiﬁed spa type t17182 corresponded to ST7, which survey on the prevalence of S. aureus in raw milk of dairy has been reported to be related to bovine mastitis (Li T. et al., cows with mastitis in Beijing, China. This study demonstrated 2017). Moreover, ST50-t518 found in this study was reported to a rather high prevalence of S. aureus with enterotoxigenic be mainly present in bovines in Denmark (Hasman et al., 2010). and bioﬁlm forming abilities that may contribute to S. aureus The other spa type t730, has been less frequently detected then persisting in the dairy farms leading to severe infections and before, and corresponded to the bovine milk-associated sequence subsequent food poisoning. To the best of our knowledge, this type ST97 (Gopal and Divya, 2017). In this study agr type III was study ﬁrstly reported the classic SEs production in raw milk the most predominant agr type (71.9%) among S. aureus isolates, from cows in China. However the percentage of MDR and which is in accordance with a previous report from Brazil (48.2%) MRSA isolates was low in this study, their pathogenicity and (Silva et al., 2013). However, agrI and agr II could be predominant transmission risk cannot be ignored. Of note, it is necessary to types according to previous reports (Fabres-Klein et al., 2015; control and eliminate the present of MDR, enterotoxigenic and Khoramrooz et al., 2016; Mistry et al., 2016). Only 14.6 and 13.5% bioﬁlm formatting S. aureus in raw milk. Additionally, our study of our isolates were identiﬁed as agr I and IV respectively, which also demonstrated the genetic diversity these isolates. Results are lower than previous reports (Fabres-Klein et al., 2015; Mistry of the present study highlight the dominant genetic lineages of et al., 2016). Similar to other studies the agr II was not identiﬁed livestock associated found not only in China but also worldwide. in the current study (Fabres-Klein et al., 2015; Khoramrooz et al., Although new spa type variants were found, their lineage related 2016; Mistry et al., 2016). sequence type suggested that these strains may also associate PFGE is generally recognized as the current gold standard with bovine mastitis. Signiﬁcant diﬀerences genetic diversity method, and it has been widely used in genotyping of various along with antimicrobial resistance, virulence factors and bioﬁlm bacteria including bovine mastitis associated S. aureus (De formation were observed for S. aureus isolates from raw milk. Oliveira et al., 2000; McMillan et al., 2016). Previous studies It was shown that S. aureus with similar genetic characteristic demonstrated that diﬀerent clonal lineages may exhibit speciﬁc displayed speciﬁc antimicrobial resistance patterns, virulence patterns of antimicrobial resistance and contain various virulence gene proﬁles, bioﬁlm formations and geographic features and factors (Hata et al., 2010; Song et al., 2015). In this study, isolates diﬀerent clones could colonize in one dairy host. Therefore, of the PFGE cluster II (56.3%) and cluster I (15.6%) were the most monitoring the genotypes of S. aureus in dairy cow would frequently detected. All belonged to ST1 (CC1), t127/2279 along give assistance to distinguish prevalent clones, which can help with the agr type or agr III which were grouped in these two dairy farms develop control measures for mastitis caused by clusters. The agr system is related to the regulation of virulence S. aureus. factors and diﬀerent agr groups may have speciﬁc virulence patterns (Melchior et al., 2009; Khoramrooz et al., 2016). This study showed that isolates of agr III of represented by two AVAILABILITY OF DATA AND MATERIALS clones (PFGE Cluster I/II-CC1-ST1-t127/2279), carried more The aggregate data supporting ﬁndings contained within this virulence genes than those of agr I and agr IV types, suggesting manuscript will be shared upon request submitted to the that agr proﬁles may be associated with the virulence potential corresponding author. of S. aureus. Furthermore, isolates in PFGE Cluster II-CC1- ST1-t127-agr III exhibited the most diversities of antimicrobial resistant, while isolates in PFGE Cluster I-CC1-ST1-t2279-agr AUTHOR CONTRIBUTIONS III was only resistant to PEN. Of note, the 5 MSSA-ST398- WW, ZB, XL, FL, and SF designed experiments. TJ, ZP, JX, and t1456-agr I isolates expressed the most MDR patterns but LY carried out experiments. WW and XL analyzed experimental with no virulence genes and showed weakly bioﬁlm formation, data. WW, ZB, FL, and SF wrote the manuscript. whereas the MRSA-ST398-t034-agr I clone expressed MDR and virulence (pvl-sea-sec) as well as showing moderate bioﬁlm formation in this study. All isolates within PFGE cluster III- FUNDING CC97-ST97-t730-agr I clone were resistant to PEN, CIP, and This study was funded by the National Key R&D Program ENO, while all isolates in the PFGE cluster IV-CC7-ST7-t17182- agr I showed resistant to CIP and ENO. Geographically, isolates of China (2016YFD0401102), and China Food Safety Talent Competency Development Initiative: CFSA 523 from farm A and farm B were well distinguished phylogenetically in this study. It is interesting that we found diﬀerent isolates Program. from the same mastitic milk sample that showed diﬀerent genotypes or phenotypes in this study, which conﬁrmed the ACKNOWLEDGMENTS fact that diﬀerent clones could colonize in one host, making it harder to eliminate and control S. aureus infections in dairy We sincerely thank all the participants who took part in this cows. study. Frontiers in Microbiology | www.frontiersin.org 13 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus REFERENCES bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 186, 1518–1530. doi: 10.1128/JB.186.5.1518-1530.2004 Aires-de-Sousa, M. (2017). Methicillin-resistant Staphylococcus aureus Felipe, V., Morgante, C. A., Somale, P. S., Varroni, F., Zingaretti, M. L., Bachetti, among animals: current overview. Clin. Microbiol. Infect. 23, 373–380. R. A., et al. (2017). Evaluation of the bioﬁlm forming ability and its associated doi: 10.1016/j.cmi.2016.11.002 genes in Staphylococcus species isolates from bovine mastitis in Argentinean Asai, T., Hiki, M., Baba, K., Usui, M., Ishihara, K., and Tamura, Y. (2012). Presence dairy farms. Microb. Pathog. 104, 278–286. doi: 10.1016/j.micpath.2017.01.047 of Staphylococcus aureus ST398 and ST9 in swine in Japan. Jpn. J. Infect. Dis. 65, Giacinti, G., Carfora, V., Caprioli, A., Sagrafoli, D., Marri, N., Giangolini, G., et al. 551–552. doi: 10.7883/yoken.65.551 (2017). Prevalence and characterization of methicillin-resistant Staphylococcus Asao, T., Kumeda, Y., Kawai, T., Shibata, T., Oda, H., Haruki, K., et al. aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus (2003). An extensive outbreak of staphylococcal food poisoning due to low- aureus in dairy sheep farms in central Italy. J. Dairy Sci. 100, 7857–7863. fat milk in Japan: estimation of enterotoxin A in the incriminated milk and doi: 10.3168/jds.2017-12940 powdered skim milk. Epidemiol. Infect. 130, 33–40. doi: 10.1017/S09502688020 Gomes, F., and Henriques, M. (2016). Control of bovine mastitis: old 07951 and recent therapeutic approaches. Curr. Microbiol. 72, 377–382. Basanisi, M. G., La Bella, G., Nobili, G., Franconieri, I., and La Salandra, G. (2017). doi: 10.1007/s00284-015-0958-8 Genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolated Gopal, S., and Divya, K. C. (2017). Can methicillin-resistant Staphylococcus from milk and dairy products in South Italy. Food Microbiol. 62, 141–146. aureus prevalence from dairy cows in India act as potential risk for doi: 10.1016/j.fm.2016.10.020 community-associated infections? A review. Vet. World. 10, 311–318. Bergdoll, M. S., Crass, B. A., Reiser, R. F., Robbins, R. N., and Davis, J. P. doi: 10.14202/vetworld.2017.311-318 (1981). A new staphylococcal enterotoxin, enterotoxin F, associated with Harmsen, D., Claus, H., Witte, W., Rothgänger, J., Claus, H., Turnwald, toxic-shock-syndrome Staphylococcus aureus isolates. Lancet 1, 1017–1021 D., et al. (2003). Typing of methicillin-resistant Staphylococcus aureus doi: 10.1016/S0140-6736(81)92186-3 in a university hospital setting by using novel software for spa repeat Cavicchioli, V. Q., Scatamburlo, T. M., Yamazi, A. K., Pieri, F. A., and determination and database management. J. Clin. Microbiol. 41, 5442–5448. Nero, L. A. (2015). Occurrence of Salmonella, Listeria monocytogenes, and doi: 10.1128/JCM.41.12.5442-5448.2003 enterotoxigenic Staphylococcus in goat milk from small and medium-sized Hasman, H., Moodley, A., Guardabassi, L., Stegger, M., Skov, R. L., and farms located in Minas Gerais State, Brazil. J. Dairy. Sci. 98, 8386–8390. Aarestrup, F. M. (2010). Spa type distribution in Staphylococcus aureus doi: 10.3168/jds.2015-9733 originating from pigs, cattle and poultry. Vet. Microbiol. 141, 326–331. Chao, G., Bao, G., Cao, Y., Yan, W., Wang, Y., Zhang, X., et al. (2015). Prevalence doi: 10.1016/j.vetmic.2009.09.025 and diversity of enterotoxin genes with genetic background of Staphylococcus Hata, E., Katsuda, K., Kobayashi, H., Uchida, I., Tanaka, K., and Eguchi, M. (2010). aureus isolates from diﬀerent origins in China. Int. J. Food Microbiol. 211, Genetic variation among Staphylococcus aureus strains from bovine milk and 142–147. doi: 10.1016/j.ijfoodmicro.2015.07.018 their relevance to methicillin-resistant isolates from humans. J. Clin. Microbiol. Cheng, J., Wang, Y., Cao, Y., Yan, W., Niu, X., Zhou, L., et al. (2016). The 48, 2130–2139. doi: 10.1128/JCM.01940-09 Distribution of 18 enterotoxin and enterotoxin-like genes in Staphylococcus Hennekinne, J. A., De Buyser, M. L., and Dragacci, S. (2012). Staphylococcus aureus aureus strains from diﬀerent sources in East China. Foodborne Pathog. Dis. 13, and its food poisoning toxins: characterization and outbreak investigation. 171–176. doi: 10.1089/fpd.2015.1963 FEMS Microbiol. Rev. 36, 815–836. doi: 10.1111/j.1574-6976.2011.00311.x CLSI (2015). Methods for Antimicrobial Dilution and Disk Susceptibility Testing Hoang, P. H., Awasthi, S. P., DO Nguyen, P., Nguyen, N. L., Nguyen, of Infrequently Isolated or Fastidious Bacteria; Approved Guideline. Wayne; D. T., LE, N. H., et al. (2017). Antimicrobial resistance proﬁles and Pennsylvania, PA: Clinical Laboratory Standards Institute. molecular characterization of Escherichia coli strains isolated from healthy Darwish, S. F., and Asfour, H. A. (2013). Investigation of bioﬁlm forming ability in adults in Ho Chi Minh City, Vietnam. J. Vet. Med. Sci. 79, 479–485. Staphylococci causing bovine mastitis using phenotypic and genotypic assays. doi: 10.1292/jvms.16-0639 Scientiﬁc World J. 2013, 378492. doi: 10.1155/2013/378492 Huijsdens, X. W., van Dijke, B. J., Spalburg, E., van Santen-Verheuvel, M. G., De Oliveira, A. P., Watts, J. L., Salmon, S. A., and Aarestrup, F. M. (2000). Heck, M. E., Pluister, G. N., et al. (2006). Community-acquired MRSA and pig- Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine farming. Ann. Clin. Microbiol. Antimicrob. 5:26. doi: 10.1186/1476-0711-5-26 mastitis in Europe and the United States. J. Dairy Sci. 83, 855–862. Jakobsen, R. A., Heggebø, R., Sunde, E. B., and Skjervheim, M. (2011). doi: 10.3168/jds.S0022-0302(00)74949-6 Staphylococcus aureus and Listeria monocytogenes in Norwegian raw milk Dhanawade, N. B., Kalorey, D. R., Srinivasan, R., Barbuddhe, S. B., and Kurkure, cheese production. Food Microbiol. 28, 492–496. doi: 10.1016/j.fm.2010.10.017 N. V. (2010). Detection of intercellular adhesion genes and bioﬁlm production Jans, C., Merz, A., Johler, S., Younan, M., Tanner, S. A., Kaindi, D. W. M., in Staphylococcus aureus isolated from bovine subclinical mastitis. Vet. Res. et al. (2017). East and West African milk products are reservoirs for human Commun. 34, 81–89. doi: 10.1007/s11259-009-9326-0 and livestock-associated Staphylococcus aureus. Food Microbiol. 65, 64–73. Dufour, S., Dohoo, I. R., Barkema, H. W., Descôteaux, L., Devries, T. J., Reyher, doi: 10.1016/j.fm.2017.01.017 K. K., et al. (2012). Manageable risk factors associated with the lactational Jarraud, S., Mougel, C., Thioulouse, J., Lina, G., Meugnier, H., Forey, F., incidence, elimination, and prevalence of Staphylococcus aureusintramammary et al. (2002). Relationships between S. aureus genetic background, virulence infections in dairy cows. J. Dairy Sci. 95, 1283–1300. doi: 10.3168/jds.20 factors, agrgroups (Allele), and human disease. Infect. Immun. 70, 631–641. 11-4711 doi: 10.1128/IAI.70.2.631-641.2002 Enright, M. C., Day, N. P., Davies, C. E., Peacock, S. J., and Spratt, B. G. (2000). Jessen, L. R., Sørensen, T. M., Lilja, Z. L., Kristensen, M., Hald, T., and Damborg, Multilocus sequence typing for characterization of methicillin-resistant and P. (2017). Cross-sectional survey on the use and impact of the Danish national methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38, antibiotic use guidelines for companion animal practice. Acta. Vet. Scand. 59, 1008–1015. doi: 10.1128/JCM.02421-12 81. doi: 10.1186/s13028-017-0350-8 Esposito, S., Purrello, S. M., Bonnet, E., Novelli, A., Tripodi, F., Pascale, R., et al. Johler, S.,Weder, D.,Bridy, C.,Huguenin, M. C., Robert, L., Hummerjohann, J., et al. (2013). Central venous catheter-related bioﬁlm infections: an up-to-date focus (2015). Outbreak of staphylococcal food poisoning among children and staﬀ at on meticillin-resistant Staphylococcus aureus. J. Glob. Antimicrob. Resist. 1, a Swiss boarding school due to soft cheese made from raw milk. J. Dairy Sci. 98, 71–78. doi: 10.1016/j.jgar.2013.03.002 2944–2948. doi: 10.3168/jds.2014-9123 Fabres-Klein, M. H., Caizer Santos, M. J., Contelli Klein, R., Nunes de Souza, G., Kateete, D. P., Kabugo, U., Baluku, H., Nyakarahuka, L., Kyobe, S., Okee, M., et al. and de Oliveira Barros Ribon, A. (2015). An association between milk and slime (2013). Prevalence and antimicrobial susceptibility patterns of bacteria from increases bioﬁlm production by bovine Staphylococcus aureus. BMC Vet. Res. milkmen and cows with clinical mastitis in and around Kampala, Uganda. PLoS 11, 3. doi: 10.1186/s12917-015-0319-7 ONE 8:e63413. doi: 10.1371/journal.pone.0063413 Feil, E. J., Li, B. C., Aanensen, D. M., Hanage, W. P., and Spratt, B. G. (2004). Khoramian, B., Jabalameli, F., Niasari-Naslaji, A., Taherikalani, M., and Emaneini, eBURST: inferring patterns of evolutionary descent among clusters of related M. (2015). Comparison of virulence factors and bioﬁlm formation among Frontiers in Microbiology | www.frontiersin.org 14 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus Staphylococcus aureus strains isolated from human and bovine infections. Pereyra, E. A., Picech, F., Renna, M. S., Baravalle, C., Andreotti, C. S., Russi, R., et al. Microb. Pathog. 88, 73–77. doi: 10.1016/j.micpath.2015.08.007 (2016). Detection of Staphylococcus aureus adhesion and bioﬁlm-producing Khoramrooz, S. S., Mansouri, F., Marashifard, M., Malek Hosseini, S. A., Akbarian genes and their expression during internalization in bovine mammary epithelial Chenarestane-Olia, F., Ganavehei, B., et al. (2016). Detection of bioﬁlm related cells. Vet. Microbiol. 183, 69–77. doi: 10.1016/j.vetmic.2015.12.002 genes, classical enterotoxin genes and agr typing among Staphylococcus aureus Price, L. B., Stegger, M., Hasman, H., Aziz, M., Larsen, J., Andersen, P. isolated from bovine with subclinical mastitis in southwest of Iran. Microb. S., et al. (2012). Staphylococcus aureus CC398: host adaptation and Pathog. 97, 45–51. doi: 10.1016/j.micpath.2016.05.022 emergence of methicillin resistance in livestock. MBio. 3:e00305-11. Klein, R. C., Fabres-Klein, M. H., Brito, M. A., Fietto, L. G., and Ribon Ade, O. doi: 10.1128/mBio.00305-11 (2012). Staphylococcus aureus of bovine origin: genetic diversity, prevalence Rasmussen, G., Monecke, S., Ehricht, R., and Söderquist, B. (2013). and the expression of adhesin-encoding genes. Vet. Microbiol. 160, 183–188. Prevalence of clonal complexes and virulence genes among commensal doi: 10.1016/j.vetmic.2012.05.025 and invasive Staphylococcus aureus isolates in Sweden. PLoS ONE 8:e77477. Köck, R., Schaumburg, F., Mellmann, A., Köksal, M., Jurke, A., Becker, K., doi: 10.1371/journal.pone.0077477 et al. (2013). Livestock-associated methicillin-resistant Staphylococcus aureus Ribot, E. M., Fair, M. A., Gautom, R., Cameron, D. N., Hunter, S. B., Swaminathan, (MRSA) as causes of human infection and colonization in Germany. PLoS ONE B., et al. (2006). Standardization of pulsed-ﬁeld gel electrophoresis 8:e55040. doi: 10.1371/journal.pone.0055040 protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Lee, S. H., Mangolin, B. L., Gonçalves, J. L., Neeﬀ, D. V., Silva, M. P., Cruz, A. G., Shigella for PulseNet. Foodborne Pathog. Dis. 3, 59–67. doi: 10.1089/fpd. et al. (2014). Bioﬁlm-producing ability of Staphylococcus aureus isolates from 2006.3.59 Brazilian dairy farms. J. Dairy Sci. 97, 1812–1816. doi: 10.3168/jds.2013-7387 Rola, J. G., Czubkowska, A., Korpysa-Dzirba, W., and Osek, J. (2016). Li, J., Hao, H., Cheng, G., Liu, C., Ahmed, S., Shabbir, M. A. B., et al. Occurrence of Staphylococcus aureus on farms with small scale production (2017). Microbial shifts in the intestinal microbiota of Salmonella of raw milk cheeses in Poland. Toxins (Basel). 8:E62. doi: 10.3390/toxins80 infected chickens in response to enroﬂoxacin. Front. Microbiol. 8:1711. 30062 doi: 10.3389/fmicb.2017.01711 Rola, J. G., Korpysa-Dzirba, W., Czubkowska, A., and Osek, J. (2015). Prevalence Li, L., Zhou, L., Wang, L., Xue, H., and Zhao, X. (2015). Characterization of enterotoxin genes and antimicrobial resistance of coagulase-positive of methicillin-resistant and -susceptible staphylococcal isolates staphylococci recovered from raw cow milk. J. Dairy Sci. 98, 4273–4278. from bovine milk in northwestern China. PLoS ONE 10:e0116699. doi: 10.3168/jds.2014-9064 doi: 10.1371/journal.pone.0116699 Rong, D., Wu, Q., Xu, M., Zhang, J. and Yu, S. (2017). Prevalence, virulence Li, T., Lu, H., Wang, X., Gao, Q., Dai, Y., Shang, J., et al. (2017). Molecular genes, antimicrobial susceptibility, and genetic diversity of Staphylococcus characteristics of Staphylococcus aureus causing bovine mastitis between 2014 aureus from retail aquatic products in China. Front. Microbiol. 8:714. and 2015. Front. Cell Infect. Microbiol. 7:127. doi: 10.3389/fcimb.2017.00127 doi: 10.3389/fmicb.2017.00714 Liu, H., Li, S., Meng, L., Dong, L., Zhao, S., Lan, X., et al. (2017). Prevalence, Rosec, J. P., and Gigaud, O. (2002). Staphylococcal enterotoxin genes of classical antimicrobial susceptibility, and molecular characterization of Staphylococcus and new types detected by PCR in France. Int. J. Food Microbiol. 77, 61–70. aureus isolated from dairy herds in northern China. J. Dairy Sci. 100, doi: 10.1016/S0168-1605(02)00044-2 8796–8803. doi: 10.3168/jds.2017-13370 Schlievert, P. M., Shands, K. N., Dan, B. B., Schmid, G. P., and Nishimura, R. D. McClure, J. A., Conly, J. M., Lau, V., Elsayed, S., Louie, T., Hutchins, W., (1981). Identiﬁcation and characterization of an exotoxin from Staphylococcus et al. (2006). Novel multiplex PCR assay for detection of the staphylococcal aureus associated with toxic-shock syndrome. J. Infect. Dis. 143, 509–516. virulence marker Panton-Valentine leukocidin genes and simultaneous doi: 10.1093/infdis/143.4.509 discrimination of methicillin-susceptible from -resistant staphylococci. J Schroeder, J. W. (2012). Bovine Mastitis and Milking Management. North Dakota ClinMicrobiol. 44, 1141–1144. doi: 10.1128/JCM.44.3.1141-1144.2006 State University. Available online at: http://www.clemson.edu/extension/ McMillan, K., Moore, S. C., McAuley, C. M., Fegan, N., and Fox, E. M. (2016). scaged/scﬀa/career-development-events/ﬁles/dairy-evaluation/mastitis- Characterization of Staphylococcus aureus isolates from raw milk sources in control-programs.pdf (Accessed 2018 March). Victoria, Australia. BMC Microbiol. 16, 169. doi: 10.1186/s12866-016-0789-1 Shopsin, B., Mathema, B., Alcabes, P., Said-Salim, B., Lina, G., Melchior, M. B., van Osch, M. H., Graat, R. M., van Duijkeren, E., Mevius, D. J., Matsuka, A., et al. (2003). Prevalence of agr speciﬁcity groups Nielen, M., et al. (2009). Bioﬁlm formation and genotyping of Staphylococcus among Staphylococcus aureus strains colonizing children and their aureus bovine mastitis isolates: evidence for lack of penicillin-resistance in Agr- guardians. J. Clin. Microbiol. 41, 456–459. doi: 10.1128/JCM.41.1.456-45 type II strains. Vet. Microbiol. 137, 83–89. doi: 10.1016/j.vetmic.2008.12.004 9.2003 Mistry, H., Sharma, P., Mahato, S., Saravanan, R., Kumar, P. A., and Bhandari, V. Silva, N. C., Guimarães, F. F., Manzi, M. P., Budri, P. E., Gómez-Sanz, E., Benito, (2016). Prevalence and characterization of oxacillin susceptible mecA-positive D., et al. (2013). Molecular characterization and clonal diversity of methicillin- clinical isolates of Staphylococcus aureus causing bovine mastitis in India. PLoS susceptible Staphylococcus aureus in milk of cows with mastitis in Brazil. J. ONE 11:e0162256. doi: 10.1371/journal.pone.0162256 Dairy Sci. 96, 6856–6862. doi: 10.3168/jds.2013-6719 Murakami, K., Minamide, W., Wada, K., Nakamura, E., Teraoka, H., and Song, M., Bai, Y., Xu, J., Carter, M. Q., Shi, C., and Shi, X. (2015). Genetic Watanabe, S. (1991). Identiﬁcation of methicillin-resistant strains of diversity and virulence potential of Staphylococcus aureus isolates from raw staphylococci by polymerase chain reaction. J. Clin. Microbiol. 29, 2240–2244. and processed food commodities in Shanghai. Int. J. Food Microbiol. 195, 1–8. Murchan, S., Kaufmann, M. E., Deplano, A., de Ryck, R., Struelens, M., Zinn, C. doi: 10.1016/j.ijfoodmicro.2014.11.020 E., et al. (2003). Harmonization of pulsed-ﬁeld gel electrophoresis protocols for Tarekgne, E. K., Skjerdal, T., Skeie, S., Rudi, K., Porcellato, D., Félix, B., epidemiological typing of strains of methicillin-resistant Staphylococcus aureus: et al. (2016). Enterotoxin gene proﬁle and molecular characterization of a single approach developed by consensus in 10 European laboratories and Staphylococcus aureus isolates from bovine bulk milk and milk products its application for tracing the spread of related strains. J. Clin. Microbiol. 41, of Tigray region, Northern Ethiopia. J. Food Prot. 79, 1387–1395. 1574–1585. doi: 10.1128/JCM.41.4.1574-1585.2003 doi: 10.4315/0362-028X.JFP-16-003 Müsken, M., Di Fiore, S., Römling, U., and Häussler, S. (2010). A 96-well- Wang, D., Zhang, L., Zhou, X., He, Y., Yong, C., Shen, M., et al. (2016). plate-based optical method for the quantitative and qualitative evaluation of Antimicrobial susceptibility, virulence genes, and randomly ampliﬁed Pseudomonas aeruginosa bioﬁlm formation and its application to susceptibility polymorphic DNA analysis of Staphylococcus aureus recovered from testing. Nat. Protoc. 5, 1460–1469. doi: 10.1038/nprot.2010.110 bovine mastitis in Ningxia, China. J. Dairy Sci. 99, 9560–9569. Papadopoulos, P., Papadopoulos, T., Angelidis, A. S., Boukouvala, E., Zdragas, doi: 10.3168/jds.2016-11625 A., Papa, A., et al. (2018). Prevalence of Staphylococcus aureus and Wardyn, S. E., Forshey, B. M., and Smith, T. C. (2012). High prevalence of methicillin-resistant S. aureus (MRSA) along the production chain of Panton-Valentine leukocidin among methicillin-sensitive Staphylococcus of dairy products in north-western Greece. Food. Microbiol. 69, 43–50. aureus colonization isolates in rural Iowa. Microb. Drug. Resist. 18, 427–433. doi: 10.1016/j.fm.2017.07.016 doi: 10.1089/mdr.2011.0239 Frontiers in Microbiology | www.frontiersin.org 15 June 2018 | Volume 9 | Article 1123 Wang et al. Prevalence and Characterization of Staphylococcus aureus Xie, Y., He, Y., Gehring, A., Hu, Y., Li, Q., Tu, S. I., et al. (2011). Zmantar, T., Chaieb, K., Makni, H., Miladi, H., Abdallah, F. B., Mahdouani, Genotypes and toxin gene proﬁles of Staphylococcus aureus clinical K., et al. (2008). Detection by PCR of adhesins genes and slime isolates from China. PLoS ONE 6:e28276. doi: 10.1371/journal.pone. production in clinical Staphylococcus aureus. J. Basic. Microbiol. 48, 308–314. 0028276 doi: 10.1002/jobm.200700289 Yan, Q., Wang, J., Gangiredla, J., Cao, Y., Martins, M., Gopinath, G. R., et al. (2015). Comparative genotypic and phenotypic analysis of Cronobacter species Conﬂict of Interest Statement: The authors declare that the research was cultured from four powdered infant formula production facilities: indication of conducted in the absence of any commercial or ﬁnancial relationships that could pathoadaptation along the food chain. Appl. Environ. Microbiol. 81, 4388–4402. be construed as a potential conﬂict of interest. doi: 10.1128/AEM.00359-15 Yan, X., Yu, X., Tao, X., Zhang, J., Zhang, B., Dong, R., et al. (2014). Copyright © 2018 Wang, Lin, Jiang, Peng, Xu, Yi, Li, Fanning and Baloch. This is an Staphylococcus aureus ST398 from slaughter pigs in northeast China. open-access article distributed under the terms of the Creative Commons Attribution Int. J. Med. Microbiol. 304, 379–383. doi: 10.1016/j.ijmm.2013. License (CC BY). The use, distribution or reproduction in other forums is permitted, 12.003 provided the original author(s) and the copyright owner are credited and that the Zecconi, A., and Scali, F. (2013). Staphylococcus aureus virulence factors in evasion original publication in this journal is cited, in accordance with accepted academic from innate immune defenses in human and animal diseases. Immunol. Lett. practice. No use, distribution or reproduction is permitted which does not comply 150, 12–22. doi: 10.1016/j.imlet.2013.01.004 with these terms. Frontiers in Microbiology | www.frontiersin.org 16 June 2018 | Volume 9 | Article 1123

http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png

Frontiers in Microbiology Unpaywall

http://www.deepdyve.com/lp/unpaywall/prevalence-and-characterization-of-staphylococcus-aureus-cultured-from-mb90HH0wK1

Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

Loading next page...

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher: Unpaywall
ISSN: 1664-302X
DOI: 10.3389/fmicb.2018.01123
Publisher site: See Article on Publisher Site

Abstract

Journal

Frontiers in Microbiology – Unpaywall

Published: Jun 22, 2018

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

References

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies