Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The apocytochrome b gene in maize mitochondria does not contain introns and is preceded by a potential ribosome binding site

The apocytochrome b gene in maize mitochondria does not contain introns and is preceded by a... The EMBO Journal vol.3 no.9 pp.2107-2113, 1984 The apocytochrome b gene in maize mitochondria does not contain introns and is preceded by a potential ribosome binding site Adam J.Dawson1, Valerie P.Jones and a remarkably constant G + C content of - 47%, which Christopher J.Leaver together with sequence analysis, suggests that long stretches of A+ T-rich non-coding DNA, such as are found in Sac- Department of Botany, King's Buildings, University of Edinburgh, charomyces cerevisiae, are absent. Mayfield Road, Edinburgh EH9 3JH, UK These observations raise important questions as to why, for 'Present address: Amersham International p.l.c., White Lion Road, Amersham, Bucks HP7 9LL, UK example, the plant mitochondrial genome is so large and, what is the functional significance, if any, of the wide range Communicated by C.J.Leaver size found in different plants. While the recent of genome The apocytochrome b (COB) gene has been isolated from finding that mtDNA from a range of plant species show ex- maize (Zea mays L.) mitochondrial DNA. Sequence analysis tensive and widespread homology to chloroplast DNA (Stem reveals that the coding region of the gene is 1164 bp long and, and Palmer, 1984) provides a partial answer to these ques- in contrast with the homologous gene from yeast, does not we are currently investigating whether plant mtDNA tions, contain introns or TGA (Trp) codons. The predicted poly- contains additional structural genes not present in other peptide encoded by the gene has a mol. wt. of 42 868 daltons, Analysis of the polypeptides synthesised by organisms. and shows -480Vo amino acid sequence homology with the isolated plant mitochondria reveals the presence of at least corresponding yeast and mammalian polypeptides. Hydro- radioactively labelled polypeptides with mol. wts. 18-20 pathic profies of the polypeptide indicate the presence of from 8000 to 58 000 (Leaver et al., 1983a). The ranging nine, membrane spanning hydrophobic domains suggesting of these polypeptides are associated with the inner majority that it is organised in the inner mitochondrial membrane in a membrane and to date subunits I and II of mitochondrial similar fashion to that proposed for apocytochrome b in c oxidase and subunit 9 of the portion of cytochrome Fo other organisms. The COB gene is preceded by a sequence ATPase have been identified (Leaver and Gray, 1982). The 5' -AGTTGTCA-3' which may act as a ribosome binding site recent demonstration that the a-subunit of the F1 ATPase is in the mRNA since: (i) it shows 67.5%/o complementarity with in isolated plant mitochondria, and by extrapol- synthesised an octanucleotide at the 3' end of the maize mitochondrial encoded in plant mtDNA, suggests that the plant mito- ation 18S rRNA, located in a position homologous to that of the genome does indeed contain additional genetic chondrial Escherichia coli Shine and Dalgamo sequence, and (ii) a simi- information, since this subunit is encoded in the nucleus in sequence precedes several other plant mitochondrial genes lar (Hack and Leaver, 1983; Boutry et al., other organisms at a distance of 15-20 nucleotides from the ATG initiation 1983). RNA transcript analysis shows that the gene is tran- codon. The only genes so far characterised on the mtDNA of scribed in a complex manner with the presumed mature plants are those encoding the 26S, 18S and 5S rRNAs higher mRNA (-2.25 kb) probably being derived by sequential to plant mtDNA; Leaver and Gray, latter being unique (the from a larger primary transcript. processing gene encoding subunit II of 1982), and a single protein-coding words: apocytochrome b/maize/mitochondria/plant Key c oxidase and Leaver, 1981). This latter (Fox cytochrome mtDNA identified by the use of heterologous was initially gene maize (Zea mays L.) mtDNA restric- between hybridisation and mitochondrial gene probes from tion fragments specific Introduction confirmed the identity of the cyto- analysis yeast. Sequence subunit II gene (COII, formerly termed c oxidase genomes of higher plants are considerably chrome The mitochondrial and virtue of the homology of Fox Leaver, 1981) by and more complex than comparable genomes in animal moxI by larger amino acid sequence with the corresponding the and fungal (19-94 kb) cells (Grivell, 1983). Cur- predicted (14-18 kb) bovine sequences. It also revealed major differences yeast and suggest that the range extends from 218 kb in rent estimates and codon usage compared with the hom- in gene structure and Shields, 1984) to -2400 kb in some Brassica sp. (Palmer in other organisms. The maize COII gene con- gene with a 7- to 8-fold variation within a single plant ologous cucurbits, a located intron not found in the cor- tains unique, centrally et 1981). Analysis of plant mitochondrial family (Ward al., and animal In addition, it appears genes. responding fungal by restriction enzyme digestion and re- DNAs (mtDNAs) exhibit a further variation in the once mtDNAs that plant kinetics suggests that the mitochondrial genomes naturation code. The CGG codon which normally 'universal' genetic are of unique sequences carried on dis- primarily composed codes for tryptophan, whereas the probably specifies arginine circular molecules which are derived from each other by crete which encodes in the fungal and UGA tryptophan triplet This intermolecular recombination is appar- recombination. code is a stop codon, probably animal mitochondrial genetic mediated short repeated sequences which may rep- ently by code and Leaver, 1981; 'universal' (Fox as in the genetic to 5-100% of the total mtDNA (Palmer and resent up and Brennicke, 1983). Hiesel Schardl et al., 1984). Shields, 1984; of the information content, gene our knowledge To extend The and variable size of the plant mitochondrial large of the mitochondrial genome, plant structure and expression is not reflected in a variability in the base compo- genome b (designated COB) the gene we have isolated apocytochrome sition. The mtDNA of all plant species examined to date have Press Oxford, England. IRL Limited, A.J.Dawson, V.P.Jones and CJ.Leaver from maize. This gene has been Kb sequenced in a number of mammalian Anderson et (e.g., Bibb et al., 1981; al., 1981) and fungal and (e.g., Nobrega Tzagoloff, 1980; Waring et al., 1981) mitochondrial but not in genomes, any higher 23.2- plant. In mammals the COB is gene and relatively simple does not contain whereas in some the introns, has fungi gene a mosaic organisation to five introns in S. containing up cer- 9.4 evisiae (Nobrega and Lazowska et Tzagoloff, 1980; al., 1980; et least Jacq al., 1982). At one of these bI4 in introns, yeast, 6.6-o encodes a protein which ('maturase') is to be thought in- volved in the excision of other introns la Salle et (De al., 1982). 4.4- Here we describe the isolation and of the analysis for gene apocytochrome b from maize mitochondria. Our isolation of the COB gene provides the first evidence that apocytochrome b, a key component of the mitochondrial electron transport is in chain, encoded the mtDNA of A higher plants. compari- son of the coding and of surrounding sequences the COB gene with those of COII that TGA not suggest does occur 2.3 in plant mitochondrial genes. Furthermore, of analysis se- 2.0- quences 5' to the COB gene has also revealed the presence of an octanucleotide sequence which shows complementarity to sequence near the 3' end of the maize rRNA and 18S could function as a ribosome binding site in maize mitochondrial messenger RNAs. The ABCD derived amino acid for sequence AE apo- FGHJ cytochrome b has also allowed to be made predictions about the structure and function 1. Identification of of this in the inner maize mtDNA protein mito- Fig. restriction fragments containing to the lactis chondrial membrane sequences homologous K. b. (this paper, and gene encoding apocytochrome Saraste, 1984). Maize mtDNA was with the restriction digested enzymes HindlII (A,B), EcoRI and (C,D), BamHI fractionated on (E,F) (G,H), Sail 1% Results (w/v) and stained with ethidium agarose gels bromide DNA (A,C,E,G). was transferred to Identification and cloning the nitrocellulose, with a 32P-labelled of maize COB hybridised MboI gene fragment of lactis K. mtDNA a of the COB and containing portion gene An M13 mp7 clone of a 750-bp MboI from fragment within Mol. wt. autoradiographed DNA (B,D,F,H). marker, X with digested the COB gene of Kluyveromyces lactis (M13-3.8: a HindIII. gift from M.de Haan and L.A.Grivell, University of Amsterdam) was labelled with 32P by second strand synthesis. This nated clone, was identified pbE4, (see Figure and shown to con- 2) which contains 65% of the coding sequence for tain apocyto- a 5.1-kb single mtDNA fragment which co-migrated with chrome was b, hybridised under the non-stringent conditions identified fragment by hybridisation with the K. lactis (Tm 47°C) to restriction fragments of maize mtDNA which COB probe (Figure clone ID). Similarly designated pbB2 had been separated by gel electrophoresis and transferred to a (see Figure the 13.1-kb 2), containing BamHI fragment nitrocellulose filter. Major hybridisation was obtained with identified in was IF isolated from a Figure of cloned library 1.8-kb HindIII, 5.1-kb EcoRI, 13.1-kb BamHI and BamHI 10.5-kb mtDNA fragments. Sall fragments (Figure 1). The probe also hybridised a to DNA sequence analysis number of additional mtDNA restriction fragments at much The three mtDNA cloned in lower fragments intensity. pZmH1790, and Essentially similar patterns pbE4 of hybridisation were pbB2 with the were digested restriction obtained using enzyme COB-specific probes from S. cerevisiae, HindlII, or and Aspergillus EcoRI, Sau3A, MspI, AluI subcloned into nidulans and Bos TaqI M13 taurus (data not shown). and DNA The 1.8-kb mp8 mp9 (see Figure of HindlII fragment 2). sequence analysis these (Figure 1A,B) was isolated by subclones the electroelution from a 1 0/o by dideoxy chain-termination method (w/v) agarose gel and cloned in the (Sanger et revealed HindlII the of a site of al., 1980) presence continuous pBR328. A recombinant clone containing the open frame of 1164 1.8-kb reading fragment was bp (Figure 3), which when isolated and designated pZmH1790. translated, amino Plasmid gave predicted acid DNA from this clone sequence with an overall was used to prepare a restric- of homology and with tion map in order 4807o 47% the corresponding to guide yeast and subsequent DNA sequence analy- beef The maize sis (included in sequences. Figure 2). apocytochrome b protein deduced from the DNA nucleotide is sequence sequence 388 amino analysis confirmed acids long and has that pZmHl790 con- a mol. wt. of 42 tained a 868 daltons. mtDNA fragment with a single long open reading frame (ORF) which was bounded at its 3' end by a HindIII Transcript analysis site. The ORF encoded 154 amino acids which showed good To confirm that the maize COB gene was expressed in vivo homology with the amino-terminal portion of published apo- and to investigate whether the initial gene transcript was pro- cytochrome b - sequences (e.g., yeast Nobrega and Tzago- cessed, specific were gene probes hybridised to purified total loff, 1980 and animals Anderson et al., 1981). To isolate mitochondrial RNA. The RNA was fractionated by electro- the remainder of the gene, the 1.8-kb mtDNA fragment was on phoresis denaturing formaldehyde-agarose (1.30/0 w/v) isolated from pZmH1790 and used to probe a library of gels, transferred to nitrocellulose and analysed by hybridis- cloned EcoRI fragments of mtDNA. A single clone, desig- ation with 32P-labelled DNA probes. When the plasmid 2108 Apocytochrome b in gene maize mitochondria ~~EcoR Ir pbE4 BamHIF-7 pbB2 4_ l K pZt-EH2200 HindM1_ 1790 ^ pZmnH 'H/A H/ASST A T ASSS TA A AASA AA A S SA MS MS TS WI LlY I I _ I I\/ I V I ml 11 I lOObp 2. Restriction map of maize mtDNA containing the apocytochrome b gene and flanking sequences. The pBR328 clones of Fig. mtDNA restriction fragments used in this study are indicated in the upper part of the figure. The lower portion of the figure indicates restriction sites used for M13 cloning and sequencing; arrows below the map show the direction and extent of sequence analysis from each restriction site. Abbreviations: A, the AluI; B, BamHI; E, FcoRI; H, HindIII; M, MspI; S, Sau3A; T, TaqI. -180 * TTCGA6AATCAACTAACCAACAAATCCSTA6CCCAG6TBATTC6CTGCCTCCCTCTCSCCAAACCAAAATG6ATGAATCTTCTCAT6CAG -90 * GATAGAAAA5A6AA 9TTGTC CTTTTTTCTTATTCAGGGC6CTGCSAAGCATCAA9GCAA6GGG6TAAATAAAATAA96G66AA9A9 1 * AT6ACTATAAGSAACCAACSATTCTCTCTTCTTAAACAACCTATATACTCCACACTTAACCABCATTTAATABATTATCCAACCCCAB6C Q O P I Y S TL N Q H L I D Y P T P S T I R N R F S L L K AATCTTABTTATT66TGGB96TTCGGTT9CTTA6CT69TATTTGTTTA9TCATTCASATAGT6ACT96C9TTTTTTTASCTATGCATTAC 9 V T F L A Y C L A 6 I C L V I I 6 V MH L S Y W W 6 F 6 191 * * ACACCTCAT6TG6ATCTA6CTTTCAACA6C6TA6AACACATTAT6A6AGATBTT6AAG66B6CT66TT6CTCC6TTATATGCATSCTAAT V D L A F N S V E H M D E 6 6 W L L R Y M H A N T P H I R V 271 * + SG66CAAGTAT6TTTCTCATT9T66TTCACCTTCATATTTTTC6T66TCTATATCAT6C6A6TTATA6CA6TCCTA6S6AATTTGTTTGG G I F R L Y Y S P R E F V W A S M L I V V H L H B H AS 361 * * T6TCTC66AGTT9TCATATTCCTATTAAT6ATTT6GACA6CTTTTATA9GATAC6TACCACCTT666BTCAGAT6ABCTTTTSBGSAGCA Y V P P W M S F W A G I T A F I 6 C L V V I F L L M V 6 451 * ACAG AATTACAA6CTTA6CTAGC5CCATACCA6TAGTA66AGATACCATA6TBACTT69CTTT6G66T66TTTCTCC5T66ACAATSCC I P V I V T W L W 6 F S V D N A T V I T S L A S A V 6 D t G ACCTTAAATCGTTTTTTTA6TCTCCATCATTTACTCCCCCTTATTTTA9CAG9C6CCA9TCTTCTTCATCT69CTGCATT6CATCAATAT H L I L A 6 A S L L H L A A L H O Y T L N R F S L H L P L 631 * * G6ATCAAATAATCCATTGG6T6TACATTCTSA6AT66ATAAAATT6CTTCTTACCCTTATTTTTATSTAAAG6ATCTTGTASGTCG6STA Y Y V K D L V W V I A S P F Y G V H S E M D K 6 S N N P L 721 a GCTTCT6CTATCTTTTTTTCCATTTG6ATTTTTTTT6CTCCAAAT9TTTT6666CATCCCGACAATTATATACCT9CTAATCCSAT6CCC F 6 H P D N Y I P A N P M P A S A I S I W I F A P N V L FF 9ll * * ACCCCSCCTCATATT6TGCC6GAATGGTATTTCCTACCGATCCATGCCATTCTTCSCAGTATACCT6ACAAA6C6666GT6TAGCCGCA A I L R S I P D K A V A A T P H I V P E W Y F L P I H 6 6 901 a * ATA6CACCAGTTTTTATATCTCTCTT6SCTTTACCTTTTTTTAAA6AAAT6TAT9T9CSTA9TTCAASTTTTCGACCGATTCACCAAGGA V A P F Y V R S S S F R P I Q 6 I P F I S L L L F K E M 991 * a ATATTTTG6TTGCTTTTGSCS6ATT6CTTACTACTA66TT66ATCG6AT6TCAACCT6T66G6ACACCATTT6TTACTATTGGACAAATT W P V E A P F V T I 6 1I I L L A D C L L L 6 I G C F W L Q 1081 * * TcTTCTTTCTTTTTCTTCTT9TTCTTT6CCATAACGCCCATTCCe66ACGAGTT66AAGAG6AATTCCAAAATATTACACSGAATA6ACT P R V 6 R G I P T E S F F F F L F F A I T P I G K Y Y WATCGCACCSGATC sequence b. The predicted amino acid COB gene and the amino acid of Flg. 3. DNA sequence of the maize mitochondrial predicted sequence apocytochrome Fox and Leaver (1981). The proposed was translated as as was translated according to the universal genetic code except CGG (W) proposed by tryptophan ribosome binding site preceding the ATG initiation codon is boxed. 2109 V.P.Jones A.J.Dawson, and C.J.Leaver chondrial pZmEH680 (see which contains membrane, a was Figure 2) sequences 'hydropathy' profile constructed lying the completely within the COB using indices of and Doolittle coding region, is used as a Kyte (1982). probe, Hydropathy values for blocks of a major of -2.25 kb is detected 11 amino acids in the transcript This predicted (Figure 4B). sequence were calculated and the is considerably than the 1164 bases which summed value above the larger the plotted specify pos- ition of the central coding region of the COB In addition a less amino acid in the block (Figure 5). The gene. abundant block was transcript of -4.2 kb and several minor of successively one amino acid transcripts to displaced by up through- out the of 9.0 kb are revealed on of the blot. length the from amino to longer exposure Hybridis- polypeptide carboxy termini. ation to the upstream clone Taking summed values for blocks in this pZmEH2200 (see Figure way 2) empha- reveals additional a number sises the hybridisation to of mol. wt. of 'domains' with high presence predominantly hydro- but does not the 2.25-kb transcripts (Figure 4C) or identify tran- phobic (positive hydropathy) hydrophilic (negative hy- to be the mature script presumed mRNA. dropathy) characteristics, but reduces the effects of short term variation. Identification of hydrophobic domains in the predicted apo- The identifies plot nine 'domains' in hydrophobic the cytochrome b poly- polypeptide peptide (I IX), which are from separated each other by To further confirmation that provide the COB se- putative more hydrophilic regions. These domains correspond closely encodes and quence apocytochrome also to b, predict the with the putative hydrophobic domains predicted by similar organisation of maize apocytochrome b in the inner mito- analyses of apocytochrome b in a variety of fungi and mam- mals, conducted by Saraste (1984) Kb and by Widger et al., 1984). Discussion b is Cytochrome subunit IV of the multisubunit respiratory III complex (also called the cytochrome bc1 complex of ubi- 4.2 quinol:cytochrome c oxidoreductase), located in the inner 3.6 mitochondrial membrane of all organisms examined to date et Hauska (Kreike al., 1979; et al., 1983). Our determination of the maize 2.25 COB gene sequence represents the first evidence that 1.9 apocytochrome b is encoded in the plant mitochondrial genome. Nucleotide sequence and codon usage The single long ORF of 1164 bp (Figure 3) is assumed to represent the maize COB gene since it displays 52 and 47% sequence homology with the COB genes in S. cerevisiae (Nobrega and Tzagoloff, 1980) and Homo sapiens (Anderson et al., 1981), respectively. The does gene not appear to con- tain introns, in contrast with COB in many fungi (Nobrega and Tzagoloff, 1980; Waring et al., 1981; Citterich et al., A B Cj and the 1983) COII gene in maize mitochondria (Fox and Leaver, 1981). However, because of the low amino acid Fig. 4. Transcripts of the maize apocytochrome b gene. Total maize sequence conservation at the amino and carboxy mtRNA was fractionated by termini of electrophoresis through a 1.30/o (w/v) agarose- formaldehyde gel and stained with the ethidium bromide (A). 26S and 18S predicted polypeptides (Figure 5, upper panel) the possi- mitochondrial RNAs are visualised as stained bands at -3.6 kb and bility that introns exist near the 5' and 3' ends of the gene 1.9 kb, respectively. Parallel unstained tracks were transferred to cannot be formally excluded. Like the COB gene, the maize nitrocellulose and hybridised with a 32P-labelled (B) internal gene probe, COI (Isaac et al., in preparation) and pZmEH680 and Oenothera COII (Hiesel with (C) an upstream probe, pZmEH2200 (see Figure 2 for origins of E. and Brennicke, 1983) probes). coli rRNAs, cowpea chlorotic genes do not contain introns. mottle virus and tobacco mosaic virus RNAs were used as RNA size The standards. maize COB gene contains 12 TGG triplets, 11 at pos- I;PN I '37 P 2M - I q g m : c * aC: M ri I 30 In riv I IF Il:- co 11 1 I I VI Vil Vil V1 20°o{ I U w --J.- - ' cr MA IJV v Jw 'AJU 250 AMINO ACID NUMBER Fig. 5. Hydropathy profile of the predicted maize apocytochrome b polypeptide. The profile was calculated according to Kyte and Doolittle (1982) using an 11 amino acid window panel). Oower Hydrophobic domains (I IX) which are predicted to lie within the membrane have hydropathy >0, hydrophilic regions are <0. Amino acid I is encoded by nucleotides shown in Figure 3. I-3 The upper bar diagram illustrates amino acid conservation between the predicted amino acid sequences of apocytochrome b from (1) maize, (2) A. nidulans (Waring et al., 1981), (3) S. cerevisiae (Nobrega and Tzagoloff, 1980), and (4) H. sapiens (Anderson et al., 1981). Identical amino acids are indicated by a solid vertical bar. 2110 Apocytochrome b gene in maize niitochondna E. coli 16S rRNA 3' AU CCAC UAGGUUGGCGUCCAAGGG complexity of the observed transcript pattern depends as (3' terminus) . :11:1 much on the relative rates of the processing steps as on the ....C ,' ..l ,.. Maize 185 Mt rRNA 31' CU presence of introns (Coruzzi et al., 1981; Thalenfeld et al., UCCUAAGUlUAGGUCGGUGUCCAAGGu (3' terminus) 1983). *A ** AGUUGUCA Maize COB 5' GAGG CGAUAGAAAAGAGAAAUGA The origin of the two highest mol. wt. RNA species (Figure ** *4F* AGUUGUCA 4c) is of particular interest because the differential hybridis- Oenothera COB 5' CAAG CGAUAGGAAAAAGGAAUGG * 4* 4* ation of pZmEH680 and pZmEH2200 to these RNAs sug- Maize COI 5' AUAA GGUUUUCA AAACGAAAAAAAAAUGA * * *** gests that they could be transcripts of a gene upstream from Sorghum COI 5' GGUU (IGAAAUCA AAACGAAAAAAAAAUGA COB, whose 3' tail extends into the 5' end of the COB gene. *4*F Maize COII 5' GCUC CUACUUCU GGUGCUGCCAAUGA However, the 1600 bp of sequence 5' to COB (shown par- Oenothera COII 5' AGCG GAGAGUCA AAAAGAAACCAAAGCAAAUGA tially in Figure 3) contains no open reading frames longer than 160 bp on either strand, nor any sequence capable of Fig. 6. A proposed ribosome binding site in higher plant mitochondrial specifying conventional tRNAs. mRNAs. The 3'-terminal sequences of E. coli 16S rRNA and maize 18S A putative ribosome binding site upstream from plant mito- mt rRNA are compared, with identical nucleotides being shown by a vertical line. The Shine and Dalgarno sequence of the E. coli 16S rRNA, chondrial initiation codons postulated to function in the attachment of the ribosome to mRNA, and The mRNAs encoded by higher plant mitochondria are seem- the equivalent octanucleotide in maize 18S mt rRNA are boxed. ingly much longer than the genes they contain, and it is likely Nucleotides 5' to the initiation codon (underlined) of six plant mitochondrial genes which are capable of base pairing with the putative at least part of the additional sequence will lie 5' to the that mRNA-binding sequence in maize mt rRNA are indicated with an asterisk. initiation codon. Some mechanism must presumably exist, Source of sequence data: Maize: COB, this work; COI, P.G.Isaac, therefore, to confer specificity for translation initiation on the V.P.Jones and C.J.Leaver, in preparation; COII, Fox and Leaver, 1981. correct in the mRNA. In the eubacteria (Rosenberg and point COB, A.Brennicke, personal communication; COII, Hiesel and Oenothera: 1979) and chloroplasts (Whitfeld and Bottomley, Sorghum: COI, D.K.Hanson, J.N.Bailey-Serres, T.D.Fox Court, Brennicke, 1983. and data. C.J.Leaver, unpublished 1983), RNA transcription starts 50-500 nucleotides up- stream from the initiation codon of most protein coding itions where the amino acid tryptophan is conserved at the It has been postulated that specificity for translation genes. point in at least four of the eight other known homologous initiation at this point is conferred by a ribosome binding site b sequences. The triplet TGA is not found, apocytochrome which is though to base pair with a complementary sequence which confirms that TGA is not used as a trypto- however, Shine and Dalgarno sequence) located very near to the 3' (the in plant mitochondria (Fox and Leaver, 1981). A phan codon end of the 16S rRNA of the small ribosomal subunit (Shine codon occurs in the gene (encoding amino acid single CGG and 1974; Steitz and Jakes, 1975). Dalgarno, in a conserved region of the polypeptide 239), rather poorly A comparison of the 18S rRNAs in wheat (Spencer et al., This triplet has been translated as Trp (Figure 5, upper panel). 1984) and maize (Chao et al., 1983) mitochondria with the E. Fox and Leaver (1981) and Hiesel in view of the findings of 16S rRNA sequence, has revealed a remarkable conser- coli and Brennicke (1983). vation of primary and secondary structure (Spencer et al., there is a consistent bias in favour In the maize COB gene 1984). However, at the 3' termini of the plant mitochondrial of triplets ending in T (4207o). A similar trend occurs in the 18S rRNA sequences, part of the E. coli Shine and Dalgarno and in the Oenothera COII gene, maize COI and COII genes, is replaced by a (5'-CACCUCCU-3') specifically sequence average 38% of the codons end in T. This contrasts where on 6). Analysis of novel sequence (5' -UGAAUCCU-3') (Figure in mitochondrial genes, where T and A with the bias fungal mitochondrial coding genes a of higher plant protein variety and mammalian mito- predominate (Waring et al., 1981) all to be preceded, - 13-18 (Figure 6) shows that appear where A and C are favoured in the third chondrial genes, initiation codon, by a tetranucleo- nucleotides 5' to the AUG et position (Anderson al., 1981). 4/4 with the 18S tide 3/4 or complementarity displaying of the maize COB gene Transcription and Dalgarno' type sequence, rRNA-specific 'Shine additional to the remainder of 2.25 kb to the internal 5'-UGAA. In most, homology The major RNA species of hybridising occurs in this The is to be the COB the 'Shine and Dalgarno' sequence region. (pZmEH680; Figure 4B) presumed probe is COII from most abundant and be- which displays poor complementarity because it is the transcript only gene mRNA, results et unpub- but recent sequencing (Dawson al., cause it does not hybridise to the upstream probe (pZmEH- maize, that translation of this may start - 1.1 kb longer than the lished indicate gene 2200). This mRNA is, however, data) hundred nucleotides from the sequence that the mol- several upstream COB bases) it encodes, suggesting gene (1164 Fox and Leaver The absence of the for other determined by (1981). ecule could carry coding sequences genes. in the ribosome site published sequence identified by both the internal and proposed binding The transcript pattern would not then be unexpected. is The use of COB probes strikingly complex. upstream whether this to be established sequence, poten- DNA shows that all of these hybridis- It remains strand-specific probes with the mitochondrial 18S of arise from the COB strand. The capable base-pairing RNA species encoding tially ing a ribosome site. its acts as binding However, resembles that of the intron- rRNA, actually of this pattern complexity of with to the in- and constancy position respect maize COII and Leaver, 1981) but ubiquity containing gene (Fox that it could some role in the itiation codon suggest play with that of the maize COI gene (V.P.Jones, un- contrasts ribosome sites E. coli binding display initiation of translation. which has no introns and apparently only two published data) but in the of fungi proposed known whether the various tran- a similar constancy position, It is not major transcripts. site fall be- ribosome anywhere initiation and/or termination mitochondrial binding may arise from scripts multiple from the initiation 8 and 116 nucleotides of a tween upstream or from processing longer precursor events, sequential codon et 1982). the second alternative seems to (Li al., In apply molecule. yeast, 6 also reveal that most in shown Figure Christianson et and the The sequences and 1982; al., 1983), (Osinga Tabak, 2111 and CJ.Leaver AJ.Dawson, V.P.Jones known mitochondrial and AUG initiation codons are the of mitochondrial plant genomes, higher presence chloroplast DNA A residues. into the mitochondrial genes are initiated followed by Many prokaryotic sequences integrated plant with similar and it is that this A residue is be the result of a common or of an thought sequences, genome, may ancestry involved in four base interactions with the tRNApet anti- of information between these pair exchange genetic organelles codon and their evolution. Weissman, 1978). Sequence loop (Taniguchi during of the wheat mt and tRNApet gene (Gray Spencer, analysis has shown that the anticodon contains the se- loop 1983) and methods Materials 5'UCAU which would be of interacting with capable quence a 5'AUGA in a similar fashion. It Isolation DNA is maize and RNA possible, of mitochondrial quadruplet that this A residue could lend a second level Seeds of maize line B37N of Hi-Bred therefore, (Z. mays L.) Des (Pioneer International, were in darkness at 28'C for 4 Gradient to the AUG codon at which translation Moines, IA) grown from the days. purified specificity mitochondria were from the and tissue as prepared coleoptile mesocotyl mRNA commences. described et and mtDNA previously (Leaver al., solubil- 1983a) purified by order in the b isation of the mitchondria in structures maize poly- I% 50 mM apocytochrome Higher (w/v) N-lauroyl sarcosine, EDTA, 100 mM Tris-HCI with 100 (pH 8.0); digestion proteinase peptide jg/ml (Bethesda Research at 600C for 1 h followed CsCI-EtBr Labs.) by equilibrium density The encoded COB in maize by contains predicted polypeptide gradient centrifugation (Fox, 1979). 388 amino acids similar number to b apocytochrome Mitochondrial RNA was isolated very from the mitochondria as (a purified in other described Koller et al. and mtDNA and has a mol. wt. of 42 868. removed with Prelimi- by (1982) by digestion eukaryotes) RNase-free DNase I Biochemical models for (Worthington Corp.) according to Smith the structure and functional of organisation nary and Ellis (1981). this in the inner mitochondrial membrane have polypeptide Restriction and DNA been enzyme et al., digestion gel electrophoresis of 1984; Widger 1984), recently proposed (Saraste, DNA - 5 was with restriction in 20 based on buffer under and of the (0.1 sg) digested enzymes Doolittle, 1982) t1 hydropathy plots (Kyte the conditions recommended the Research by suppliers (Bethesda amino acid Labs., of various and animal fungal predicted sequences or Amersham mtDNA Boehringer International). contained a non- frequently b. 5 shows a panel) similar apocytochromes Figure (lower contaminant which inhibited unless a 5- dialysable to 10-fold excess digestions of the maize the presence of nine of restriction illustrating was used. plot polypeptide, enzyme DNA of domains I 1-30 kb were to This plot corre- fragments separated by electrophoresis 0.8 IX). through hydrophobic (labelled or lINo I low a 40 (w/v) mM 20 mM in remarkable detail to agarose (Miles, type EEO) using those of the bovine and Tris, yeast sponds sodium 1 mM EDTA 8.2. acetate, Smaller buffer, pH fragments b (10- most of the numer- 1984); hence, apocytochromes (Saraste, were on 1000 6% bp) separated (w/v) polyacrylamide gels (29:1, acrylamide: ous amino acid substitutions in the maize polypeptide (48% a 1 x TBE buffer mM bisacrylamide) 89 mM boric using (89 Tris, acid, and 47% to the and human poly- 2 mM DNA were in yeast EDTA, pH 8.3). fragments stained ethidium bromide sequence homology and recovered from electroelution are agarose et and to be silent in terms of gels by (McDonell al., 1977) their peptides, respectively) likely from 'crush-soak' extraction and polyacrylamide gels by effects on conformation. (Maxam Gilbert, domain IX is Significantly, protein 1977). in both and despite a very low position, preserved magnitude DNA level of amino acid between the various 32P-Labelling of sequence homology Double-stranded DNA was labelled with in this This makes the existence [a32P]dCTP by nick-translation polypeptides finding region. et (Rigby al., 1977). Single-stranded DNA clones in phage M13 were labelled of an intron in the 3' of the maize COB gene seem region modification of the by sequencing reaction and (Hu Messing, 1982) except unlikely. that the was used sequencing primer and strands were separated prior to Saraste and et al. (1984) suggest domains (1984) Widger hybridisation. I - IX form membrane a helices, spanning and hydrophobic DNA:DNA hybridisation on the invariance of histidine 88, 102, residues propose (based DNA were fragments transferred to nitrocellulose as described by Southern 189 and that the two protohaem pros- electron-carrying 203) and with (1975) hybridised 32P-labelled under probe conditions determined by thetic of b are sandwiched in the mem- the of groups cytochrome expected between degree sequence homology and blotted DNA probe brane between helices and V. et These II The maize amino acid se- (Howley al., 1979). conditions, experimentally determined to yield the lowest signal:noise were: could the ratio, homologous hybridisation, helices and contains the requisite pre-hybridis- quence specify ation 1 (2 h), hybridisation and first washes (16 h) (3 x 20 min) in 4 x SSC, conserved histidine residues. if the models are correct, Thus, Denhardt's solution, 50% formamide and 25 tg/ml denatured herring sperm the encoded the maize COB gene could form a by protein DNA at 37°C. Final (Serva) washes x 5 in 2 x (4 min) SSC at 200C. Under functional molecule. these for maize conditions, mtDNA + C content biologically (G 47%) hybridisation is at T - - 26'C and the final wash Tm et have shown exists at 380C. Heterologous al. that some homology hybridisation, Widger (1984) pre- and hybridisation (2 h) hybridisation in 4 x (72 h) SSC, 10 x Denhardt's between the amino acid of b from sol- apocytochrome sequences SDS and 100 ution, 0.1I% (w/v) carrier DNA yg/ml at 52°C. Washes (3 x 15 five mitochondrial and two encoded pro- sources, chloroplast in 2 x SSC at 520C. min) Hybridisation is at 470C below the Tm of a maize teins: wt. 23 and the '17-kd' protein cytochrome 000) mtDNA b6 (mol. and mtDNA homoduplex sequences showing as little as 50% of the These with the two are adjacent on the could be genes homology probe identified. b6f complex. DNA and the aligned can be chloroplast map polypeptides Recombinant DNA techniques end-to-end with sequences in the mitochondrial homologous MtDNA restriction enzyme fragments were ligated to appropriately digested b. A of six acids separates the car- apocytochrome gap amino M13 pBR328, mp8 or M13 mp9 RFDNA (Messing and Vieira, 1982) using terminus of the ter- protein from the amino T4-DNA boxy aligned b6 ligase (Boehringer). The ligated DNA was used to transform E. coli HBIOI minus of the protein (Widger et 1984). (plasmid vectors; Bolivar and aligned '17-kd' al., Backman, 1979) or (M13 JMIOI vec- and tors, Messing Vieira, 1982) as described by Dagert and Ehrlich (1979). The maize b also shows homology sequence E. apocytochrome coli colonies containing recombinant clones were selected either by antibiotic to the and '17-kd' con- sequences and, uniquely, b6 protein resistance characteristics (pBR328) or on the basis digestion of of the chromo- tains a methionine residue which exactly with the corresponds genic substrate X-gal (M13). Plasmid clones containing sequences of interest of the initiator the '17-kd' were identified by colony hybridisation (Grunstein and Hogness, position methionine codon of 1975); similarly M13 clones were identified by plaque hybridisation (Benton and protein.n Davis, 1977). pBR328 'libraries' of cloned mtDNA fragments generated after It is to that the interesting speculate sequence homologies digestion with EcoRI, HindlII or BamHIwere prepared and maintained as between different functional in both and et genes described by Gergen al. (1979). chloroplasts 2112 Apocytochrome b gene in maize mitochondris DNA sequence analysis Leaver,C.J., Hack,E., Dawson,A.J., Isaac,P.G. and Jones,V.P. (1983b) in Wolf,K., Schewyen,R.J. and Kaudewitz,F. (eds.), Mitochondria 1983, De All DNA sequence determination was performed by complementary strand 269-283. Gruyter, Berlin-NY, pp. elongation/termination of single-stranded template DNA cloned in M13 and Biochem- Lehrach,H., Diamond,D., Wozney,J.M. Boedtker,H. (1977) (Sanger et al., 1977,1980) using [ct32P]dCTP (410 Ci/mmol, Amersham Inter- 4743-4751. istry (Wash.), 26, national). The sequencing strategies are shown in Figure 2. and J. Biol. Li,M., Tzagoloff,A., Underbrink-Lyon,K. Martin,N.C. (1982) RNA transcript analysis 5921-5928. Chem., 257, in % RNA (10-20 was fractionated under denaturing conditions 1.3 ytg) and Proc. Acad. Sci. 560- Maxam,A.M. Gilbert,W. (1977) Natl. USA, 74, nitro- (w/v) agarose-formaldehyde gels (Lehrach et al., 1977) and blotted to cellulose by the method of Thomas (1980). Parallel gel tracks of mtRNA and and J. Mol. McDonnell,M.W., Simon,M.N. Studier,F.W. (1977) Biol., 110, E. coli rRNA were stained with ethidium bromide to provide mol. wt. 119-146. in markers. Filters were pre-hybridised (4 h) and hybridised (16 h) 50%o (v/v) and Vieira,J. 269-276. Messing,J. (1982) Gene, 19, formamide, 5 x Denhardt's solution, 0.1I% (w/v) SDS, 5 x SSC and and J. Biol. 9828-9837. Nobrega,F.G. Tzagoloff,A. (1980) Chem., 255, contained 1-2 200 jg/ml herring sperm DNA at 42°C. Hybridisations Acids 3617-3626. and Nucleic ,g Osinga,K.A. Tabak,H.F. (1982) Res., 10, 32P-labelled DNA (I06l107 d.p.m.4cg) and unbound probe was removed by 437-440. and Palmer,J.D. Shields,C.R. (1984) Nature, 307, two washes (10 min each) in 2 x SSC, 0.10%o (w/v) SDS and two washes J. Mol. and Rigby,P.W.J., Dieckmann,M., Rhodes,C. Bery,P. (1977) Biol., (10 min each) in 0.1 x SSC, 0.%lo (w/v) SDS at 20°C. 237-251. 113, Annu. Rev. 319-353. and Rosenberg,M. Court,D. (1979) Genet., 13, Acknowledgements Brown,N.L., Coulson,A.R., Fiddes,J.C., Sanger,F., Air,G.M., Barrell,B.G., 687- and Mr M.de Haan of the Univer- Hutchinson,C.A., Slocombe,P.M. Smith,M. (1977) Nature, 265, We are grateful to Professor L.A.Grivell and sity of Amsterdam. Dr S.Anderson, M.R.C., Cambridge, and Dr T.D.Fox, and Sanger,F., Coulson,A.R., Barreli,B.G., Smith,A.J.H. Roe,B.A. (1980) Cornell University, for advice and the gift of heterologous gene probes. This 161-178. J. Mol. the Science and Biol., 143, work was supported by research grants from Engineering 367-372. FEBS Council to C.J.Leaver and Saraste,M. (1984) Lett., 166, Research Council and the Research Agricultural and in and Schardl,C.L., Lonsdale,D.M., Pring,D.R. Rose,K.R. (1984) Nature, to A.J.Dawson V.P.Jones. postgraduate studentships press. Proc. Acad. Sci. USA, 1342-1346. and Natl. Shine,J. Dalgarno,L. (1974) 71, References J. Mol. 127-137. and Genet., 1, Smith,S.M. Ellis,R.J. (1981) Appl. De Coulson,A.R., Anderson,S., Bankier,A.T., Barrell,B.G., Bruijn,M.H.L., J. Mol. 503-517. Southern,E.M. (1975) Biol., 98, Drouin,J., Eperon,I.C., Nierlich,D.P., Roe,B.A., Sanger,F., Schreier, and Proc. NatI. Acad. Sci. Spencer,D.F., Schnare,M.N. Gray,M.W. (1984) and 457- P.H., Smith,A.J.H., Staden,R. Young,I.G. (1981) Nature, 290, 493-497. USA, 81, Proc. NatI. Acad. Sci. 4734-4738. and USA, 72, Steitz,J.A. Jakes,K. (1975) and Science 180-182. Benton,W.D. Davis,R.W. (1977) (Wash.), 196, Proc. Natl. Acad. Sci. in and USA, Palmer,J.D. press. Stern,D.B. (1984) Van and Bibb,M.J., Etten,R.A., Wright,C.T., Walberg,M.W. Clayton,D.A. J. Mol. 533-565. and Biol., 118, Taniguchi,T. Weissman,C. (1978) 167-180. (1981) Cell, 26, and J. Biol. 610- Chem., 258, Thalenfeld,B,E., Hill,J. Tzagoloff,A. (1983) and Methods Enymol., 245-267. Bolivar,F. Backman,K. (1979) 68, and J. Biol. Chem., 258, 8524- Boutry,M., Briquet,M. Goffeau,A. (1983) NatI. Acad. Sci. 5201-5205. Proc. USA, 77, Thomas,P.S. (1980) and 793-803. Cell, 25, Ward,B.L., Anderson,R.S. Bendich,A.J. (1981) and III. Plant 71, 190- Chao,S., Sederoff,R.R. Levings,C.S., (1983) Physiol., and Scazz- McPhail-Berks,M. Waring,R.B., Davies,R.W., Lee,S., Grisi,E., 4-11. Cell, 27, occhio,C. (1981) and Rabinowitz,M. (1983) Christianson,T., Edwards,J.C., Mueller,D.M. Annu. Rev. Plant 279- and 34, Whitfeld,P.R. Bottomley,W. (1983) Physiol., Sci. 5564-5568. Proc. Natl. Acad. USA, 80, and EMBO J., 2, 1235-1242. Citterich,M.H., Morelli,G. Macino,G. (1983) and Proc. Natl. Herrmann,R. Trebst,A. (1984) Widger,W.R., Cramer,W.A., and J. Biol. Coruzzi,G., Bonitz,S.G., Thalenfeld,B.E. Tzagoloff,A. (1981) Acad. Sci. 674-678. USA, 81, 12780-12787. Chem., 256, and 23-28. Dagert,M. Ehrlich,S.D. (1979) Gene, 6, revised on 20 June 1984 Received on 25 1984; May and Cell, 28, 721-732. De la Salle,H., Jacq,C. Slonimski,P.P. (1982) J. Mol. 63-82. Fox,T.D. (1979) Biol., 130, 315-323. and Cell, 26, Fox,T.D. Leaver,C.J. (1981) and Nucleic Acids Res., 7, Wensik,P.C. (1979) Gergen,J.P., Stern,R.H. 21 15-2136. FEBS 323-327. and Lett., 161, Gray,M.W. Spencer,D.F. (1983) in and Kaudewtiz,F. (eds.), Grivell,L.A. (1983) Wolf,K., Schewyen,R.J. De Berlin 25-45. Mitochondria 1983, Gruyter, NY, pp. Proc. Natl. Acad. Sci. USA, 72, and Grunstein,M. Hogness,D.S. (1975) 3961-3965. EMBO 2783-2789. and J., 2, Hack,E. Leaver,C.J. (1983) and Biochim. Lockau,W. (1983) Biophys. Hauska,G., Hurt,E., Gabellini,N. 97-133. Acta, 726, EMBO 2173-2178. and J., 2, Hiesel,R. Brennicke,A. (1983) and J. Biol. (1979) Martin,M.A. Howley,P.M., Israel,M.A., Law,M.-F. Chem., 254, 271-277. and Gene, 17, Hu,N-t Messing,J. (1982) Claisse,M., Groudinsky,O., Jacq,C., Pajot,P., Lazowska,J., Dujardin,G., de la Guiard,B., Salle,H., Grandchamp,C., Labouesse,M., Gargouri,A., in and Slonimski,P.P., Slonimski,P.P. (1982) Spyridakis,A., Dreyfus,M. Cold Harbor and Mitochondrial Borst,P. Attardi,G. (eds.), Genes, Spring 155-183. Laboratory Press, NY, pp. Eur. J. 17-23. and Biochem., 122, Koller,B., Delius,H. Dyer,T.A. (1982) van Boer,P.H., Hemert,F.J., Schewyen,R.J., Kreike,J., Bechmann,H., and Eur. J. Biochem., 101, 607-617. Kaudewitz,F. Groot,G.S.P. (1979) J. Mol. 105-132. and Biol., 157, Kyte,J. Doolittle,R.F. (1982) and 333-348. Lazowska,J., Jacq,C. Slonimski,P.P. (1980) Cell, 22, Annu. Rev. Plant 373-402. 33, and Physiol., Leaver,C.J. Gray,M.W. (1982) Leaver,C.J., Hack,E. and Forde,B.G. (1983a) Methods En7vmol., 43, 476- http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

The apocytochrome b gene in maize mitochondria does not contain introns and is preceded by a potential ribosome binding site

Download PDF
7 pages

Loading next page...
 
/lp/springer-journals/the-apocytochrome-b-gene-in-maize-mitochondria-does-not-contain-kBZigk6Mgi

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1984
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1002/j.1460-2075.1984.tb02098.x
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal vol.3 no.9 pp.2107-2113, 1984 The apocytochrome b gene in maize mitochondria does not contain introns and is preceded by a potential ribosome binding site Adam J.Dawson1, Valerie P.Jones and a remarkably constant G + C content of - 47%, which Christopher J.Leaver together with sequence analysis, suggests that long stretches of A+ T-rich non-coding DNA, such as are found in Sac- Department of Botany, King's Buildings, University of Edinburgh, charomyces cerevisiae, are absent. Mayfield Road, Edinburgh EH9 3JH, UK These observations raise important questions as to why, for 'Present address: Amersham International p.l.c., White Lion Road, Amersham, Bucks HP7 9LL, UK example, the plant mitochondrial genome is so large and, what is the functional significance, if any, of the wide range Communicated by C.J.Leaver size found in different plants. While the recent of genome The apocytochrome b (COB) gene has been isolated from finding that mtDNA from a range of plant species show ex- maize (Zea mays L.) mitochondrial DNA. Sequence analysis tensive and widespread homology to chloroplast DNA (Stem reveals that the coding region of the gene is 1164 bp long and, and Palmer, 1984) provides a partial answer to these ques- in contrast with the homologous gene from yeast, does not we are currently investigating whether plant mtDNA tions, contain introns or TGA (Trp) codons. The predicted poly- contains additional structural genes not present in other peptide encoded by the gene has a mol. wt. of 42 868 daltons, Analysis of the polypeptides synthesised by organisms. and shows -480Vo amino acid sequence homology with the isolated plant mitochondria reveals the presence of at least corresponding yeast and mammalian polypeptides. Hydro- radioactively labelled polypeptides with mol. wts. 18-20 pathic profies of the polypeptide indicate the presence of from 8000 to 58 000 (Leaver et al., 1983a). The ranging nine, membrane spanning hydrophobic domains suggesting of these polypeptides are associated with the inner majority that it is organised in the inner mitochondrial membrane in a membrane and to date subunits I and II of mitochondrial similar fashion to that proposed for apocytochrome b in c oxidase and subunit 9 of the portion of cytochrome Fo other organisms. The COB gene is preceded by a sequence ATPase have been identified (Leaver and Gray, 1982). The 5' -AGTTGTCA-3' which may act as a ribosome binding site recent demonstration that the a-subunit of the F1 ATPase is in the mRNA since: (i) it shows 67.5%/o complementarity with in isolated plant mitochondria, and by extrapol- synthesised an octanucleotide at the 3' end of the maize mitochondrial encoded in plant mtDNA, suggests that the plant mito- ation 18S rRNA, located in a position homologous to that of the genome does indeed contain additional genetic chondrial Escherichia coli Shine and Dalgamo sequence, and (ii) a simi- information, since this subunit is encoded in the nucleus in sequence precedes several other plant mitochondrial genes lar (Hack and Leaver, 1983; Boutry et al., other organisms at a distance of 15-20 nucleotides from the ATG initiation 1983). RNA transcript analysis shows that the gene is tran- codon. The only genes so far characterised on the mtDNA of scribed in a complex manner with the presumed mature plants are those encoding the 26S, 18S and 5S rRNAs higher mRNA (-2.25 kb) probably being derived by sequential to plant mtDNA; Leaver and Gray, latter being unique (the from a larger primary transcript. processing gene encoding subunit II of 1982), and a single protein-coding words: apocytochrome b/maize/mitochondria/plant Key c oxidase and Leaver, 1981). This latter (Fox cytochrome mtDNA identified by the use of heterologous was initially gene maize (Zea mays L.) mtDNA restric- between hybridisation and mitochondrial gene probes from tion fragments specific Introduction confirmed the identity of the cyto- analysis yeast. Sequence subunit II gene (COII, formerly termed c oxidase genomes of higher plants are considerably chrome The mitochondrial and virtue of the homology of Fox Leaver, 1981) by and more complex than comparable genomes in animal moxI by larger amino acid sequence with the corresponding the and fungal (19-94 kb) cells (Grivell, 1983). Cur- predicted (14-18 kb) bovine sequences. It also revealed major differences yeast and suggest that the range extends from 218 kb in rent estimates and codon usage compared with the hom- in gene structure and Shields, 1984) to -2400 kb in some Brassica sp. (Palmer in other organisms. The maize COII gene con- gene with a 7- to 8-fold variation within a single plant ologous cucurbits, a located intron not found in the cor- tains unique, centrally et 1981). Analysis of plant mitochondrial family (Ward al., and animal In addition, it appears genes. responding fungal by restriction enzyme digestion and re- DNAs (mtDNAs) exhibit a further variation in the once mtDNAs that plant kinetics suggests that the mitochondrial genomes naturation code. The CGG codon which normally 'universal' genetic are of unique sequences carried on dis- primarily composed codes for tryptophan, whereas the probably specifies arginine circular molecules which are derived from each other by crete which encodes in the fungal and UGA tryptophan triplet This intermolecular recombination is appar- recombination. code is a stop codon, probably animal mitochondrial genetic mediated short repeated sequences which may rep- ently by code and Leaver, 1981; 'universal' (Fox as in the genetic to 5-100% of the total mtDNA (Palmer and resent up and Brennicke, 1983). Hiesel Schardl et al., 1984). Shields, 1984; of the information content, gene our knowledge To extend The and variable size of the plant mitochondrial large of the mitochondrial genome, plant structure and expression is not reflected in a variability in the base compo- genome b (designated COB) the gene we have isolated apocytochrome sition. The mtDNA of all plant species examined to date have Press Oxford, England. IRL Limited, A.J.Dawson, V.P.Jones and CJ.Leaver from maize. This gene has been Kb sequenced in a number of mammalian Anderson et (e.g., Bibb et al., 1981; al., 1981) and fungal and (e.g., Nobrega Tzagoloff, 1980; Waring et al., 1981) mitochondrial but not in genomes, any higher 23.2- plant. In mammals the COB is gene and relatively simple does not contain whereas in some the introns, has fungi gene a mosaic organisation to five introns in S. containing up cer- 9.4 evisiae (Nobrega and Lazowska et Tzagoloff, 1980; al., 1980; et least Jacq al., 1982). At one of these bI4 in introns, yeast, 6.6-o encodes a protein which ('maturase') is to be thought in- volved in the excision of other introns la Salle et (De al., 1982). 4.4- Here we describe the isolation and of the analysis for gene apocytochrome b from maize mitochondria. Our isolation of the COB gene provides the first evidence that apocytochrome b, a key component of the mitochondrial electron transport is in chain, encoded the mtDNA of A higher plants. compari- son of the coding and of surrounding sequences the COB gene with those of COII that TGA not suggest does occur 2.3 in plant mitochondrial genes. Furthermore, of analysis se- 2.0- quences 5' to the COB gene has also revealed the presence of an octanucleotide sequence which shows complementarity to sequence near the 3' end of the maize rRNA and 18S could function as a ribosome binding site in maize mitochondrial messenger RNAs. The ABCD derived amino acid for sequence AE apo- FGHJ cytochrome b has also allowed to be made predictions about the structure and function 1. Identification of of this in the inner maize mtDNA protein mito- Fig. restriction fragments containing to the lactis chondrial membrane sequences homologous K. b. (this paper, and gene encoding apocytochrome Saraste, 1984). Maize mtDNA was with the restriction digested enzymes HindlII (A,B), EcoRI and (C,D), BamHI fractionated on (E,F) (G,H), Sail 1% Results (w/v) and stained with ethidium agarose gels bromide DNA (A,C,E,G). was transferred to Identification and cloning the nitrocellulose, with a 32P-labelled of maize COB hybridised MboI gene fragment of lactis K. mtDNA a of the COB and containing portion gene An M13 mp7 clone of a 750-bp MboI from fragment within Mol. wt. autoradiographed DNA (B,D,F,H). marker, X with digested the COB gene of Kluyveromyces lactis (M13-3.8: a HindIII. gift from M.de Haan and L.A.Grivell, University of Amsterdam) was labelled with 32P by second strand synthesis. This nated clone, was identified pbE4, (see Figure and shown to con- 2) which contains 65% of the coding sequence for tain apocyto- a 5.1-kb single mtDNA fragment which co-migrated with chrome was b, hybridised under the non-stringent conditions identified fragment by hybridisation with the K. lactis (Tm 47°C) to restriction fragments of maize mtDNA which COB probe (Figure clone ID). Similarly designated pbB2 had been separated by gel electrophoresis and transferred to a (see Figure the 13.1-kb 2), containing BamHI fragment nitrocellulose filter. Major hybridisation was obtained with identified in was IF isolated from a Figure of cloned library 1.8-kb HindIII, 5.1-kb EcoRI, 13.1-kb BamHI and BamHI 10.5-kb mtDNA fragments. Sall fragments (Figure 1). The probe also hybridised a to DNA sequence analysis number of additional mtDNA restriction fragments at much The three mtDNA cloned in lower fragments intensity. pZmH1790, and Essentially similar patterns pbE4 of hybridisation were pbB2 with the were digested restriction obtained using enzyme COB-specific probes from S. cerevisiae, HindlII, or and Aspergillus EcoRI, Sau3A, MspI, AluI subcloned into nidulans and Bos TaqI M13 taurus (data not shown). and DNA The 1.8-kb mp8 mp9 (see Figure of HindlII fragment 2). sequence analysis these (Figure 1A,B) was isolated by subclones the electroelution from a 1 0/o by dideoxy chain-termination method (w/v) agarose gel and cloned in the (Sanger et revealed HindlII the of a site of al., 1980) presence continuous pBR328. A recombinant clone containing the open frame of 1164 1.8-kb reading fragment was bp (Figure 3), which when isolated and designated pZmH1790. translated, amino Plasmid gave predicted acid DNA from this clone sequence with an overall was used to prepare a restric- of homology and with tion map in order 4807o 47% the corresponding to guide yeast and subsequent DNA sequence analy- beef The maize sis (included in sequences. Figure 2). apocytochrome b protein deduced from the DNA nucleotide is sequence sequence 388 amino analysis confirmed acids long and has that pZmHl790 con- a mol. wt. of 42 tained a 868 daltons. mtDNA fragment with a single long open reading frame (ORF) which was bounded at its 3' end by a HindIII Transcript analysis site. The ORF encoded 154 amino acids which showed good To confirm that the maize COB gene was expressed in vivo homology with the amino-terminal portion of published apo- and to investigate whether the initial gene transcript was pro- cytochrome b - sequences (e.g., yeast Nobrega and Tzago- cessed, specific were gene probes hybridised to purified total loff, 1980 and animals Anderson et al., 1981). To isolate mitochondrial RNA. The RNA was fractionated by electro- the remainder of the gene, the 1.8-kb mtDNA fragment was on phoresis denaturing formaldehyde-agarose (1.30/0 w/v) isolated from pZmH1790 and used to probe a library of gels, transferred to nitrocellulose and analysed by hybridis- cloned EcoRI fragments of mtDNA. A single clone, desig- ation with 32P-labelled DNA probes. When the plasmid 2108 Apocytochrome b in gene maize mitochondria ~~EcoR Ir pbE4 BamHIF-7 pbB2 4_ l K pZt-EH2200 HindM1_ 1790 ^ pZmnH 'H/A H/ASST A T ASSS TA A AASA AA A S SA MS MS TS WI LlY I I _ I I\/ I V I ml 11 I lOObp 2. Restriction map of maize mtDNA containing the apocytochrome b gene and flanking sequences. The pBR328 clones of Fig. mtDNA restriction fragments used in this study are indicated in the upper part of the figure. The lower portion of the figure indicates restriction sites used for M13 cloning and sequencing; arrows below the map show the direction and extent of sequence analysis from each restriction site. Abbreviations: A, the AluI; B, BamHI; E, FcoRI; H, HindIII; M, MspI; S, Sau3A; T, TaqI. -180 * TTCGA6AATCAACTAACCAACAAATCCSTA6CCCAG6TBATTC6CTGCCTCCCTCTCSCCAAACCAAAATG6ATGAATCTTCTCAT6CAG -90 * GATAGAAAA5A6AA 9TTGTC CTTTTTTCTTATTCAGGGC6CTGCSAAGCATCAA9GCAA6GGG6TAAATAAAATAA96G66AA9A9 1 * AT6ACTATAAGSAACCAACSATTCTCTCTTCTTAAACAACCTATATACTCCACACTTAACCABCATTTAATABATTATCCAACCCCAB6C Q O P I Y S TL N Q H L I D Y P T P S T I R N R F S L L K AATCTTABTTATT66TGGB96TTCGGTT9CTTA6CT69TATTTGTTTA9TCATTCASATAGT6ACT96C9TTTTTTTASCTATGCATTAC 9 V T F L A Y C L A 6 I C L V I I 6 V MH L S Y W W 6 F 6 191 * * ACACCTCAT6TG6ATCTA6CTTTCAACA6C6TA6AACACATTAT6A6AGATBTT6AAG66B6CT66TT6CTCC6TTATATGCATSCTAAT V D L A F N S V E H M D E 6 6 W L L R Y M H A N T P H I R V 271 * + SG66CAAGTAT6TTTCTCATT9T66TTCACCTTCATATTTTTC6T66TCTATATCAT6C6A6TTATA6CA6TCCTA6S6AATTTGTTTGG G I F R L Y Y S P R E F V W A S M L I V V H L H B H AS 361 * * T6TCTC66AGTT9TCATATTCCTATTAAT6ATTT6GACA6CTTTTATA9GATAC6TACCACCTT666BTCAGAT6ABCTTTTSBGSAGCA Y V P P W M S F W A G I T A F I 6 C L V V I F L L M V 6 451 * ACAG AATTACAA6CTTA6CTAGC5CCATACCA6TAGTA66AGATACCATA6TBACTT69CTTT6G66T66TTTCTCC5T66ACAATSCC I P V I V T W L W 6 F S V D N A T V I T S L A S A V 6 D t G ACCTTAAATCGTTTTTTTA6TCTCCATCATTTACTCCCCCTTATTTTA9CAG9C6CCA9TCTTCTTCATCT69CTGCATT6CATCAATAT H L I L A 6 A S L L H L A A L H O Y T L N R F S L H L P L 631 * * G6ATCAAATAATCCATTGG6T6TACATTCTSA6AT66ATAAAATT6CTTCTTACCCTTATTTTTATSTAAAG6ATCTTGTASGTCG6STA Y Y V K D L V W V I A S P F Y G V H S E M D K 6 S N N P L 721 a GCTTCT6CTATCTTTTTTTCCATTTG6ATTTTTTTT6CTCCAAAT9TTTT6666CATCCCGACAATTATATACCT9CTAATCCSAT6CCC F 6 H P D N Y I P A N P M P A S A I S I W I F A P N V L FF 9ll * * ACCCCSCCTCATATT6TGCC6GAATGGTATTTCCTACCGATCCATGCCATTCTTCSCAGTATACCT6ACAAA6C6666GT6TAGCCGCA A I L R S I P D K A V A A T P H I V P E W Y F L P I H 6 6 901 a * ATA6CACCAGTTTTTATATCTCTCTT6SCTTTACCTTTTTTTAAA6AAAT6TAT9T9CSTA9TTCAASTTTTCGACCGATTCACCAAGGA V A P F Y V R S S S F R P I Q 6 I P F I S L L L F K E M 991 * a ATATTTTG6TTGCTTTTGSCS6ATT6CTTACTACTA66TT66ATCG6AT6TCAACCT6T66G6ACACCATTT6TTACTATTGGACAAATT W P V E A P F V T I 6 1I I L L A D C L L L 6 I G C F W L Q 1081 * * TcTTCTTTCTTTTTCTTCTT9TTCTTT6CCATAACGCCCATTCCe66ACGAGTT66AAGAG6AATTCCAAAATATTACACSGAATA6ACT P R V 6 R G I P T E S F F F F L F F A I T P I G K Y Y WATCGCACCSGATC sequence b. The predicted amino acid COB gene and the amino acid of Flg. 3. DNA sequence of the maize mitochondrial predicted sequence apocytochrome Fox and Leaver (1981). The proposed was translated as as was translated according to the universal genetic code except CGG (W) proposed by tryptophan ribosome binding site preceding the ATG initiation codon is boxed. 2109 V.P.Jones A.J.Dawson, and C.J.Leaver chondrial pZmEH680 (see which contains membrane, a was Figure 2) sequences 'hydropathy' profile constructed lying the completely within the COB using indices of and Doolittle coding region, is used as a Kyte (1982). probe, Hydropathy values for blocks of a major of -2.25 kb is detected 11 amino acids in the transcript This predicted (Figure 4B). sequence were calculated and the is considerably than the 1164 bases which summed value above the larger the plotted specify pos- ition of the central coding region of the COB In addition a less amino acid in the block (Figure 5). The gene. abundant block was transcript of -4.2 kb and several minor of successively one amino acid transcripts to displaced by up through- out the of 9.0 kb are revealed on of the blot. length the from amino to longer exposure Hybridis- polypeptide carboxy termini. ation to the upstream clone Taking summed values for blocks in this pZmEH2200 (see Figure way 2) empha- reveals additional a number sises the hybridisation to of mol. wt. of 'domains' with high presence predominantly hydro- but does not the 2.25-kb transcripts (Figure 4C) or identify tran- phobic (positive hydropathy) hydrophilic (negative hy- to be the mature script presumed mRNA. dropathy) characteristics, but reduces the effects of short term variation. Identification of hydrophobic domains in the predicted apo- The identifies plot nine 'domains' in hydrophobic the cytochrome b poly- polypeptide peptide (I IX), which are from separated each other by To further confirmation that provide the COB se- putative more hydrophilic regions. These domains correspond closely encodes and quence apocytochrome also to b, predict the with the putative hydrophobic domains predicted by similar organisation of maize apocytochrome b in the inner mito- analyses of apocytochrome b in a variety of fungi and mam- mals, conducted by Saraste (1984) Kb and by Widger et al., 1984). Discussion b is Cytochrome subunit IV of the multisubunit respiratory III complex (also called the cytochrome bc1 complex of ubi- 4.2 quinol:cytochrome c oxidoreductase), located in the inner 3.6 mitochondrial membrane of all organisms examined to date et Hauska (Kreike al., 1979; et al., 1983). Our determination of the maize 2.25 COB gene sequence represents the first evidence that 1.9 apocytochrome b is encoded in the plant mitochondrial genome. Nucleotide sequence and codon usage The single long ORF of 1164 bp (Figure 3) is assumed to represent the maize COB gene since it displays 52 and 47% sequence homology with the COB genes in S. cerevisiae (Nobrega and Tzagoloff, 1980) and Homo sapiens (Anderson et al., 1981), respectively. The does gene not appear to con- tain introns, in contrast with COB in many fungi (Nobrega and Tzagoloff, 1980; Waring et al., 1981; Citterich et al., A B Cj and the 1983) COII gene in maize mitochondria (Fox and Leaver, 1981). However, because of the low amino acid Fig. 4. Transcripts of the maize apocytochrome b gene. Total maize sequence conservation at the amino and carboxy mtRNA was fractionated by termini of electrophoresis through a 1.30/o (w/v) agarose- formaldehyde gel and stained with the ethidium bromide (A). 26S and 18S predicted polypeptides (Figure 5, upper panel) the possi- mitochondrial RNAs are visualised as stained bands at -3.6 kb and bility that introns exist near the 5' and 3' ends of the gene 1.9 kb, respectively. Parallel unstained tracks were transferred to cannot be formally excluded. Like the COB gene, the maize nitrocellulose and hybridised with a 32P-labelled (B) internal gene probe, COI (Isaac et al., in preparation) and pZmEH680 and Oenothera COII (Hiesel with (C) an upstream probe, pZmEH2200 (see Figure 2 for origins of E. and Brennicke, 1983) probes). coli rRNAs, cowpea chlorotic genes do not contain introns. mottle virus and tobacco mosaic virus RNAs were used as RNA size The standards. maize COB gene contains 12 TGG triplets, 11 at pos- I;PN I '37 P 2M - I q g m : c * aC: M ri I 30 In riv I IF Il:- co 11 1 I I VI Vil Vil V1 20°o{ I U w --J.- - ' cr MA IJV v Jw 'AJU 250 AMINO ACID NUMBER Fig. 5. Hydropathy profile of the predicted maize apocytochrome b polypeptide. The profile was calculated according to Kyte and Doolittle (1982) using an 11 amino acid window panel). Oower Hydrophobic domains (I IX) which are predicted to lie within the membrane have hydropathy >0, hydrophilic regions are <0. Amino acid I is encoded by nucleotides shown in Figure 3. I-3 The upper bar diagram illustrates amino acid conservation between the predicted amino acid sequences of apocytochrome b from (1) maize, (2) A. nidulans (Waring et al., 1981), (3) S. cerevisiae (Nobrega and Tzagoloff, 1980), and (4) H. sapiens (Anderson et al., 1981). Identical amino acids are indicated by a solid vertical bar. 2110 Apocytochrome b gene in maize niitochondna E. coli 16S rRNA 3' AU CCAC UAGGUUGGCGUCCAAGGG complexity of the observed transcript pattern depends as (3' terminus) . :11:1 much on the relative rates of the processing steps as on the ....C ,' ..l ,.. Maize 185 Mt rRNA 31' CU presence of introns (Coruzzi et al., 1981; Thalenfeld et al., UCCUAAGUlUAGGUCGGUGUCCAAGGu (3' terminus) 1983). *A ** AGUUGUCA Maize COB 5' GAGG CGAUAGAAAAGAGAAAUGA The origin of the two highest mol. wt. RNA species (Figure ** *4F* AGUUGUCA 4c) is of particular interest because the differential hybridis- Oenothera COB 5' CAAG CGAUAGGAAAAAGGAAUGG * 4* 4* ation of pZmEH680 and pZmEH2200 to these RNAs sug- Maize COI 5' AUAA GGUUUUCA AAACGAAAAAAAAAUGA * * *** gests that they could be transcripts of a gene upstream from Sorghum COI 5' GGUU (IGAAAUCA AAACGAAAAAAAAAUGA COB, whose 3' tail extends into the 5' end of the COB gene. *4*F Maize COII 5' GCUC CUACUUCU GGUGCUGCCAAUGA However, the 1600 bp of sequence 5' to COB (shown par- Oenothera COII 5' AGCG GAGAGUCA AAAAGAAACCAAAGCAAAUGA tially in Figure 3) contains no open reading frames longer than 160 bp on either strand, nor any sequence capable of Fig. 6. A proposed ribosome binding site in higher plant mitochondrial specifying conventional tRNAs. mRNAs. The 3'-terminal sequences of E. coli 16S rRNA and maize 18S A putative ribosome binding site upstream from plant mito- mt rRNA are compared, with identical nucleotides being shown by a vertical line. The Shine and Dalgarno sequence of the E. coli 16S rRNA, chondrial initiation codons postulated to function in the attachment of the ribosome to mRNA, and The mRNAs encoded by higher plant mitochondria are seem- the equivalent octanucleotide in maize 18S mt rRNA are boxed. ingly much longer than the genes they contain, and it is likely Nucleotides 5' to the initiation codon (underlined) of six plant mitochondrial genes which are capable of base pairing with the putative at least part of the additional sequence will lie 5' to the that mRNA-binding sequence in maize mt rRNA are indicated with an asterisk. initiation codon. Some mechanism must presumably exist, Source of sequence data: Maize: COB, this work; COI, P.G.Isaac, therefore, to confer specificity for translation initiation on the V.P.Jones and C.J.Leaver, in preparation; COII, Fox and Leaver, 1981. correct in the mRNA. In the eubacteria (Rosenberg and point COB, A.Brennicke, personal communication; COII, Hiesel and Oenothera: 1979) and chloroplasts (Whitfeld and Bottomley, Sorghum: COI, D.K.Hanson, J.N.Bailey-Serres, T.D.Fox Court, Brennicke, 1983. and data. C.J.Leaver, unpublished 1983), RNA transcription starts 50-500 nucleotides up- stream from the initiation codon of most protein coding itions where the amino acid tryptophan is conserved at the It has been postulated that specificity for translation genes. point in at least four of the eight other known homologous initiation at this point is conferred by a ribosome binding site b sequences. The triplet TGA is not found, apocytochrome which is though to base pair with a complementary sequence which confirms that TGA is not used as a trypto- however, Shine and Dalgarno sequence) located very near to the 3' (the in plant mitochondria (Fox and Leaver, 1981). A phan codon end of the 16S rRNA of the small ribosomal subunit (Shine codon occurs in the gene (encoding amino acid single CGG and 1974; Steitz and Jakes, 1975). Dalgarno, in a conserved region of the polypeptide 239), rather poorly A comparison of the 18S rRNAs in wheat (Spencer et al., This triplet has been translated as Trp (Figure 5, upper panel). 1984) and maize (Chao et al., 1983) mitochondria with the E. Fox and Leaver (1981) and Hiesel in view of the findings of 16S rRNA sequence, has revealed a remarkable conser- coli and Brennicke (1983). vation of primary and secondary structure (Spencer et al., there is a consistent bias in favour In the maize COB gene 1984). However, at the 3' termini of the plant mitochondrial of triplets ending in T (4207o). A similar trend occurs in the 18S rRNA sequences, part of the E. coli Shine and Dalgarno and in the Oenothera COII gene, maize COI and COII genes, is replaced by a (5'-CACCUCCU-3') specifically sequence average 38% of the codons end in T. This contrasts where on 6). Analysis of novel sequence (5' -UGAAUCCU-3') (Figure in mitochondrial genes, where T and A with the bias fungal mitochondrial coding genes a of higher plant protein variety and mammalian mito- predominate (Waring et al., 1981) all to be preceded, - 13-18 (Figure 6) shows that appear where A and C are favoured in the third chondrial genes, initiation codon, by a tetranucleo- nucleotides 5' to the AUG et position (Anderson al., 1981). 4/4 with the 18S tide 3/4 or complementarity displaying of the maize COB gene Transcription and Dalgarno' type sequence, rRNA-specific 'Shine additional to the remainder of 2.25 kb to the internal 5'-UGAA. In most, homology The major RNA species of hybridising occurs in this The is to be the COB the 'Shine and Dalgarno' sequence region. (pZmEH680; Figure 4B) presumed probe is COII from most abundant and be- which displays poor complementarity because it is the transcript only gene mRNA, results et unpub- but recent sequencing (Dawson al., cause it does not hybridise to the upstream probe (pZmEH- maize, that translation of this may start - 1.1 kb longer than the lished indicate gene 2200). This mRNA is, however, data) hundred nucleotides from the sequence that the mol- several upstream COB bases) it encodes, suggesting gene (1164 Fox and Leaver The absence of the for other determined by (1981). ecule could carry coding sequences genes. in the ribosome site published sequence identified by both the internal and proposed binding The transcript pattern would not then be unexpected. is The use of COB probes strikingly complex. upstream whether this to be established sequence, poten- DNA shows that all of these hybridis- It remains strand-specific probes with the mitochondrial 18S of arise from the COB strand. The capable base-pairing RNA species encoding tially ing a ribosome site. its acts as binding However, resembles that of the intron- rRNA, actually of this pattern complexity of with to the in- and constancy position respect maize COII and Leaver, 1981) but ubiquity containing gene (Fox that it could some role in the itiation codon suggest play with that of the maize COI gene (V.P.Jones, un- contrasts ribosome sites E. coli binding display initiation of translation. which has no introns and apparently only two published data) but in the of fungi proposed known whether the various tran- a similar constancy position, It is not major transcripts. site fall be- ribosome anywhere initiation and/or termination mitochondrial binding may arise from scripts multiple from the initiation 8 and 116 nucleotides of a tween upstream or from processing longer precursor events, sequential codon et 1982). the second alternative seems to (Li al., In apply molecule. yeast, 6 also reveal that most in shown Figure Christianson et and the The sequences and 1982; al., 1983), (Osinga Tabak, 2111 and CJ.Leaver AJ.Dawson, V.P.Jones known mitochondrial and AUG initiation codons are the of mitochondrial plant genomes, higher presence chloroplast DNA A residues. into the mitochondrial genes are initiated followed by Many prokaryotic sequences integrated plant with similar and it is that this A residue is be the result of a common or of an thought sequences, genome, may ancestry involved in four base interactions with the tRNApet anti- of information between these pair exchange genetic organelles codon and their evolution. Weissman, 1978). Sequence loop (Taniguchi during of the wheat mt and tRNApet gene (Gray Spencer, analysis has shown that the anticodon contains the se- loop 1983) and methods Materials 5'UCAU which would be of interacting with capable quence a 5'AUGA in a similar fashion. It Isolation DNA is maize and RNA possible, of mitochondrial quadruplet that this A residue could lend a second level Seeds of maize line B37N of Hi-Bred therefore, (Z. mays L.) Des (Pioneer International, were in darkness at 28'C for 4 Gradient to the AUG codon at which translation Moines, IA) grown from the days. purified specificity mitochondria were from the and tissue as prepared coleoptile mesocotyl mRNA commences. described et and mtDNA previously (Leaver al., solubil- 1983a) purified by order in the b isation of the mitchondria in structures maize poly- I% 50 mM apocytochrome Higher (w/v) N-lauroyl sarcosine, EDTA, 100 mM Tris-HCI with 100 (pH 8.0); digestion proteinase peptide jg/ml (Bethesda Research at 600C for 1 h followed CsCI-EtBr Labs.) by equilibrium density The encoded COB in maize by contains predicted polypeptide gradient centrifugation (Fox, 1979). 388 amino acids similar number to b apocytochrome Mitochondrial RNA was isolated very from the mitochondria as (a purified in other described Koller et al. and mtDNA and has a mol. wt. of 42 868. removed with Prelimi- by (1982) by digestion eukaryotes) RNase-free DNase I Biochemical models for (Worthington Corp.) according to Smith the structure and functional of organisation nary and Ellis (1981). this in the inner mitochondrial membrane have polypeptide Restriction and DNA been enzyme et al., digestion gel electrophoresis of 1984; Widger 1984), recently proposed (Saraste, DNA - 5 was with restriction in 20 based on buffer under and of the (0.1 sg) digested enzymes Doolittle, 1982) t1 hydropathy plots (Kyte the conditions recommended the Research by suppliers (Bethesda amino acid Labs., of various and animal fungal predicted sequences or Amersham mtDNA Boehringer International). contained a non- frequently b. 5 shows a panel) similar apocytochromes Figure (lower contaminant which inhibited unless a 5- dialysable to 10-fold excess digestions of the maize the presence of nine of restriction illustrating was used. plot polypeptide, enzyme DNA of domains I 1-30 kb were to This plot corre- fragments separated by electrophoresis 0.8 IX). through hydrophobic (labelled or lINo I low a 40 (w/v) mM 20 mM in remarkable detail to agarose (Miles, type EEO) using those of the bovine and Tris, yeast sponds sodium 1 mM EDTA 8.2. acetate, Smaller buffer, pH fragments b (10- most of the numer- 1984); hence, apocytochromes (Saraste, were on 1000 6% bp) separated (w/v) polyacrylamide gels (29:1, acrylamide: ous amino acid substitutions in the maize polypeptide (48% a 1 x TBE buffer mM bisacrylamide) 89 mM boric using (89 Tris, acid, and 47% to the and human poly- 2 mM DNA were in yeast EDTA, pH 8.3). fragments stained ethidium bromide sequence homology and recovered from electroelution are agarose et and to be silent in terms of gels by (McDonell al., 1977) their peptides, respectively) likely from 'crush-soak' extraction and polyacrylamide gels by effects on conformation. (Maxam Gilbert, domain IX is Significantly, protein 1977). in both and despite a very low position, preserved magnitude DNA level of amino acid between the various 32P-Labelling of sequence homology Double-stranded DNA was labelled with in this This makes the existence [a32P]dCTP by nick-translation polypeptides finding region. et (Rigby al., 1977). Single-stranded DNA clones in phage M13 were labelled of an intron in the 3' of the maize COB gene seem region modification of the by sequencing reaction and (Hu Messing, 1982) except unlikely. that the was used sequencing primer and strands were separated prior to Saraste and et al. (1984) suggest domains (1984) Widger hybridisation. I - IX form membrane a helices, spanning and hydrophobic DNA:DNA hybridisation on the invariance of histidine 88, 102, residues propose (based DNA were fragments transferred to nitrocellulose as described by Southern 189 and that the two protohaem pros- electron-carrying 203) and with (1975) hybridised 32P-labelled under probe conditions determined by thetic of b are sandwiched in the mem- the of groups cytochrome expected between degree sequence homology and blotted DNA probe brane between helices and V. et These II The maize amino acid se- (Howley al., 1979). conditions, experimentally determined to yield the lowest signal:noise were: could the ratio, homologous hybridisation, helices and contains the requisite pre-hybridis- quence specify ation 1 (2 h), hybridisation and first washes (16 h) (3 x 20 min) in 4 x SSC, conserved histidine residues. if the models are correct, Thus, Denhardt's solution, 50% formamide and 25 tg/ml denatured herring sperm the encoded the maize COB gene could form a by protein DNA at 37°C. Final (Serva) washes x 5 in 2 x (4 min) SSC at 200C. Under functional molecule. these for maize conditions, mtDNA + C content biologically (G 47%) hybridisation is at T - - 26'C and the final wash Tm et have shown exists at 380C. Heterologous al. that some homology hybridisation, Widger (1984) pre- and hybridisation (2 h) hybridisation in 4 x (72 h) SSC, 10 x Denhardt's between the amino acid of b from sol- apocytochrome sequences SDS and 100 ution, 0.1I% (w/v) carrier DNA yg/ml at 52°C. Washes (3 x 15 five mitochondrial and two encoded pro- sources, chloroplast in 2 x SSC at 520C. min) Hybridisation is at 470C below the Tm of a maize teins: wt. 23 and the '17-kd' protein cytochrome 000) mtDNA b6 (mol. and mtDNA homoduplex sequences showing as little as 50% of the These with the two are adjacent on the could be genes homology probe identified. b6f complex. DNA and the aligned can be chloroplast map polypeptides Recombinant DNA techniques end-to-end with sequences in the mitochondrial homologous MtDNA restriction enzyme fragments were ligated to appropriately digested b. A of six acids separates the car- apocytochrome gap amino M13 pBR328, mp8 or M13 mp9 RFDNA (Messing and Vieira, 1982) using terminus of the ter- protein from the amino T4-DNA boxy aligned b6 ligase (Boehringer). The ligated DNA was used to transform E. coli HBIOI minus of the protein (Widger et 1984). (plasmid vectors; Bolivar and aligned '17-kd' al., Backman, 1979) or (M13 JMIOI vec- and tors, Messing Vieira, 1982) as described by Dagert and Ehrlich (1979). The maize b also shows homology sequence E. apocytochrome coli colonies containing recombinant clones were selected either by antibiotic to the and '17-kd' con- sequences and, uniquely, b6 protein resistance characteristics (pBR328) or on the basis digestion of of the chromo- tains a methionine residue which exactly with the corresponds genic substrate X-gal (M13). Plasmid clones containing sequences of interest of the initiator the '17-kd' were identified by colony hybridisation (Grunstein and Hogness, position methionine codon of 1975); similarly M13 clones were identified by plaque hybridisation (Benton and protein.n Davis, 1977). pBR328 'libraries' of cloned mtDNA fragments generated after It is to that the interesting speculate sequence homologies digestion with EcoRI, HindlII or BamHIwere prepared and maintained as between different functional in both and et genes described by Gergen al. (1979). chloroplasts 2112 Apocytochrome b gene in maize mitochondris DNA sequence analysis Leaver,C.J., Hack,E., Dawson,A.J., Isaac,P.G. and Jones,V.P. (1983b) in Wolf,K., Schewyen,R.J. and Kaudewitz,F. (eds.), Mitochondria 1983, De All DNA sequence determination was performed by complementary strand 269-283. Gruyter, Berlin-NY, pp. elongation/termination of single-stranded template DNA cloned in M13 and Biochem- Lehrach,H., Diamond,D., Wozney,J.M. Boedtker,H. (1977) (Sanger et al., 1977,1980) using [ct32P]dCTP (410 Ci/mmol, Amersham Inter- 4743-4751. istry (Wash.), 26, national). The sequencing strategies are shown in Figure 2. and J. Biol. Li,M., Tzagoloff,A., Underbrink-Lyon,K. Martin,N.C. (1982) RNA transcript analysis 5921-5928. Chem., 257, in % RNA (10-20 was fractionated under denaturing conditions 1.3 ytg) and Proc. Acad. Sci. 560- Maxam,A.M. Gilbert,W. (1977) Natl. USA, 74, nitro- (w/v) agarose-formaldehyde gels (Lehrach et al., 1977) and blotted to cellulose by the method of Thomas (1980). Parallel gel tracks of mtRNA and and J. Mol. McDonnell,M.W., Simon,M.N. Studier,F.W. (1977) Biol., 110, E. coli rRNA were stained with ethidium bromide to provide mol. wt. 119-146. in markers. Filters were pre-hybridised (4 h) and hybridised (16 h) 50%o (v/v) and Vieira,J. 269-276. Messing,J. (1982) Gene, 19, formamide, 5 x Denhardt's solution, 0.1I% (w/v) SDS, 5 x SSC and and J. Biol. 9828-9837. Nobrega,F.G. Tzagoloff,A. (1980) Chem., 255, contained 1-2 200 jg/ml herring sperm DNA at 42°C. Hybridisations Acids 3617-3626. and Nucleic ,g Osinga,K.A. Tabak,H.F. (1982) Res., 10, 32P-labelled DNA (I06l107 d.p.m.4cg) and unbound probe was removed by 437-440. and Palmer,J.D. Shields,C.R. (1984) Nature, 307, two washes (10 min each) in 2 x SSC, 0.10%o (w/v) SDS and two washes J. Mol. and Rigby,P.W.J., Dieckmann,M., Rhodes,C. Bery,P. (1977) Biol., (10 min each) in 0.1 x SSC, 0.%lo (w/v) SDS at 20°C. 237-251. 113, Annu. Rev. 319-353. and Rosenberg,M. Court,D. (1979) Genet., 13, Acknowledgements Brown,N.L., Coulson,A.R., Fiddes,J.C., Sanger,F., Air,G.M., Barrell,B.G., 687- and Mr M.de Haan of the Univer- Hutchinson,C.A., Slocombe,P.M. Smith,M. (1977) Nature, 265, We are grateful to Professor L.A.Grivell and sity of Amsterdam. Dr S.Anderson, M.R.C., Cambridge, and Dr T.D.Fox, and Sanger,F., Coulson,A.R., Barreli,B.G., Smith,A.J.H. Roe,B.A. (1980) Cornell University, for advice and the gift of heterologous gene probes. This 161-178. J. Mol. the Science and Biol., 143, work was supported by research grants from Engineering 367-372. FEBS Council to C.J.Leaver and Saraste,M. (1984) Lett., 166, Research Council and the Research Agricultural and in and Schardl,C.L., Lonsdale,D.M., Pring,D.R. Rose,K.R. (1984) Nature, to A.J.Dawson V.P.Jones. postgraduate studentships press. Proc. Acad. Sci. USA, 1342-1346. and Natl. Shine,J. Dalgarno,L. (1974) 71, References J. Mol. 127-137. and Genet., 1, Smith,S.M. Ellis,R.J. (1981) Appl. De Coulson,A.R., Anderson,S., Bankier,A.T., Barrell,B.G., Bruijn,M.H.L., J. Mol. 503-517. Southern,E.M. (1975) Biol., 98, Drouin,J., Eperon,I.C., Nierlich,D.P., Roe,B.A., Sanger,F., Schreier, and Proc. NatI. Acad. Sci. Spencer,D.F., Schnare,M.N. Gray,M.W. (1984) and 457- P.H., Smith,A.J.H., Staden,R. Young,I.G. (1981) Nature, 290, 493-497. USA, 81, Proc. NatI. Acad. Sci. 4734-4738. and USA, 72, Steitz,J.A. Jakes,K. (1975) and Science 180-182. Benton,W.D. Davis,R.W. (1977) (Wash.), 196, Proc. Natl. Acad. Sci. in and USA, Palmer,J.D. press. Stern,D.B. (1984) Van and Bibb,M.J., Etten,R.A., Wright,C.T., Walberg,M.W. Clayton,D.A. J. Mol. 533-565. and Biol., 118, Taniguchi,T. Weissman,C. (1978) 167-180. (1981) Cell, 26, and J. Biol. 610- Chem., 258, Thalenfeld,B,E., Hill,J. Tzagoloff,A. (1983) and Methods Enymol., 245-267. Bolivar,F. Backman,K. (1979) 68, and J. Biol. Chem., 258, 8524- Boutry,M., Briquet,M. Goffeau,A. (1983) NatI. Acad. Sci. 5201-5205. Proc. USA, 77, Thomas,P.S. (1980) and 793-803. Cell, 25, Ward,B.L., Anderson,R.S. Bendich,A.J. (1981) and III. Plant 71, 190- Chao,S., Sederoff,R.R. Levings,C.S., (1983) Physiol., and Scazz- McPhail-Berks,M. Waring,R.B., Davies,R.W., Lee,S., Grisi,E., 4-11. Cell, 27, occhio,C. (1981) and Rabinowitz,M. (1983) Christianson,T., Edwards,J.C., Mueller,D.M. Annu. Rev. Plant 279- and 34, Whitfeld,P.R. Bottomley,W. (1983) Physiol., Sci. 5564-5568. Proc. Natl. Acad. USA, 80, and EMBO J., 2, 1235-1242. Citterich,M.H., Morelli,G. Macino,G. (1983) and Proc. Natl. Herrmann,R. Trebst,A. (1984) Widger,W.R., Cramer,W.A., and J. Biol. Coruzzi,G., Bonitz,S.G., Thalenfeld,B.E. Tzagoloff,A. (1981) Acad. Sci. 674-678. USA, 81, 12780-12787. Chem., 256, and 23-28. Dagert,M. Ehrlich,S.D. (1979) Gene, 6, revised on 20 June 1984 Received on 25 1984; May and Cell, 28, 721-732. De la Salle,H., Jacq,C. Slonimski,P.P. (1982) J. Mol. 63-82. Fox,T.D. (1979) Biol., 130, 315-323. and Cell, 26, Fox,T.D. Leaver,C.J. (1981) and Nucleic Acids Res., 7, Wensik,P.C. (1979) Gergen,J.P., Stern,R.H. 21 15-2136. FEBS 323-327. and Lett., 161, Gray,M.W. Spencer,D.F. (1983) in and Kaudewtiz,F. (eds.), Grivell,L.A. (1983) Wolf,K., Schewyen,R.J. De Berlin 25-45. Mitochondria 1983, Gruyter, NY, pp. Proc. Natl. Acad. Sci. USA, 72, and Grunstein,M. Hogness,D.S. (1975) 3961-3965. EMBO 2783-2789. and J., 2, Hack,E. Leaver,C.J. (1983) and Biochim. Lockau,W. (1983) Biophys. Hauska,G., Hurt,E., Gabellini,N. 97-133. Acta, 726, EMBO 2173-2178. and J., 2, Hiesel,R. Brennicke,A. (1983) and J. Biol. (1979) Martin,M.A. Howley,P.M., Israel,M.A., Law,M.-F. Chem., 254, 271-277. and Gene, 17, Hu,N-t Messing,J. (1982) Claisse,M., Groudinsky,O., Jacq,C., Pajot,P., Lazowska,J., Dujardin,G., de la Guiard,B., Salle,H., Grandchamp,C., Labouesse,M., Gargouri,A., in and Slonimski,P.P., Slonimski,P.P. (1982) Spyridakis,A., Dreyfus,M. Cold Harbor and Mitochondrial Borst,P. Attardi,G. (eds.), Genes, Spring 155-183. Laboratory Press, NY, pp. Eur. J. 17-23. and Biochem., 122, Koller,B., Delius,H. Dyer,T.A. (1982) van Boer,P.H., Hemert,F.J., Schewyen,R.J., Kreike,J., Bechmann,H., and Eur. J. Biochem., 101, 607-617. Kaudewitz,F. Groot,G.S.P. (1979) J. Mol. 105-132. and Biol., 157, Kyte,J. Doolittle,R.F. (1982) and 333-348. Lazowska,J., Jacq,C. Slonimski,P.P. (1980) Cell, 22, Annu. Rev. Plant 373-402. 33, and Physiol., Leaver,C.J. Gray,M.W. (1982) Leaver,C.J., Hack,E. and Forde,B.G. (1983a) Methods En7vmol., 43, 476-

Journal

The EMBO Journal – Springer Journals

Published: Sep 1, 1984

Keywords: apocytochrome b; maize; mitochondria; plant mtDNA

There are no references for this article.