Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency

Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase... 9348–9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 Published online 20 June 2017 doi: 10.1093/nar/gkx550 Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency 1,† 1,† 1 2 3 Zheng Zhang , Bryan C. Nikolai , Leah A. Gates , Sung Yun Jung , Edward B. Siwak , 1,4 3 1 1,* Bin He , Andrew P. Rice , Bert W. O’Malley and Qin Feng 1 2 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA, Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX, USA, Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, TX, USA and Department of Medicine-Hematology & Oncology, Baylor College of Medicine, Houston, TX, USA Received February 06, 2017; Revised May 25, 2017; Editorial Decision June 13, 2017; Accepted June 15, 2017 ABSTRACT INTRODUCTION Human immunodeficiency virus (HIV) is a retrovirus that In eukaryotic cells, the gene expression status causes acquired immunodeficiency syndrome. HIV infec- is strictly controlled by epigenetic modifications tion of CD4+ helper T lymphocytes is a multistep process, on chromatin. The repressive status of chromatin involving fusion and entry through interaction with CD4 re- largely contributes to HIV latency. Studies have ceptor and CCR5 co-receptor, reverse transcription of HIV shown that modification of histone H3K27 acts as viral RNA into double-stranded viral DNA, and integra- a key molecular switch for activation or suppression tion of viral DNA into the host cell genome. Combination of many cellular genes. In this study, we found that Antiretroviral Therapy (cART), also known as highly ac- K27-acetylated histone H3 specifically recruited Su- tive antiretroviral therapy (HAART), employs the use of per Elongation Complex (SEC), the transcriptional three or more antiretroviral drugs to inhibit the key steps of elongation complex essential for HIV-1 long terminal HIV infection, and has been very effective in HIV-infected repeat (LTR)-mediated and general cellular transcrip- patients by suppressing HIV replication and maintaining the virus at undetectable levels. However, although continu- tion. Interestingly, H3K27 acetylation further stim- ous cART is life-prolonging, it never eradicates HIV infec- ulates H3R26 methylation, which subsequently ab- tion or cures this disease. Interruption of treatment quickly rogates the recruitment of SEC, forming a negative results in virus replication and recurrence of the disease feedback regulatory loop. Importantly, by inhibiting (1). Therefore, HIV-infected patients must receive lifelong methyltransferase activity of CARM1, the enzyme re- cART treatment, which presents economic and therapeutic sponsible for H3R26 methylation, HIV-1 transcription burdens. is reactivated in several HIV latency cell models, in- The principal impediment to eradication of HIV infec- cluding a primary resting CD4+ T cell model. When tion is the latent reservoir of HIV provirus. HIV provirus combined with other latency disrupting compounds persists in multiple tissues and cells, particularly the long- such as JQ1 or vorinostat/SAHA, the CARM1 in- lasting, resting CD4+ T cells. Reversing proviral latency is hibitor achieved synergistic effects on HIV-1 activa- believed to be a major challenge for strategies to eradicate HIV from an individual and achieve a functional cure. To tion. This study suggests that coordinated and dy- this end, recently discussed and tested approaches to tar- namic modifications at histone H3K27 and H3R26 or- get latency involve ‘shock and kill’ strategies, which pro- chestrate HIV-1 LTR-mediated transcription, and po- pose to reactivate (‘shock’) latent HIV in the presence of tentially opens a new avenue to disrupt latent HIV-1 cART and apply immune-based therapy to purge (‘kill’) infection by targeting specific epigenetic enzymes. these reservoirs (2,3). Mechanistically, epigenetic transcrip- tional processes drive HIV latency in T cells, as the repres- sive status of chromatin largely contributes to HIV latency (4). In order to reactivate the latent virus, it is essential to To whom correspondence should be addressed. Tel: +1 713 798 6247; Fax: +1 713 790 1275; Email: [email protected] These authors contributed equally to this work as rst fi authors. Present address: Zheng Zhang, Department of Lymphoma and Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX, USA. C The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2017, Vol. 45, No. 16 9349 ‘open’ the repressive structure of chromatin that harbors In this study, the Super Elongation Complex (SEC) was the provirus. For instance, it is generally accepted that hi- identified as an H3K27ac-associated complex based on a stone deacetylases (HDACs) are involved in maintenance peptide pull-down/mass spectrum analysis. Interestingly, of repressive chromatin status on the HIV-1 promoter, and the consequent H3R26 methylation event abrogated SEC restoration of histone acetylation by an HDAC inhibitor recruitment, suggesting that H3K27ac is a positive regu- treatment loosens the repressive chromatin structure and re- lator of HIV transcription, whereas H3R26me is a nega- activates latent HIV (5–7). However, the molecular mecha- tive regulator. Consistent with this observation, a CARM1- nism of how site-specific histone acetylation contributes to specific small molecule inhibitor functions as a potent la- transcriptional reactivation on HIV proviral regulatory se- tency reversing agent (LRA) in both cell line and primary quences remains elusive. CD4+ T cell models of HIV latency. When combined with Lysine 27 (K27) on the histone H3 tail is subject to two other latency disrupting compounds, the CARM1 inhibitor covalent modifications: methylation and acetylation. Tri- achieved synergistic effects on HIV-1 reactivation. methylation of H3K27 (H3K27me3) is a transcriptional repression ‘mark’, and its function has been well docu- MATERIALS AND METHODS mented (8–10). The responsible methyltransferase EZH2 In vitro histone methylation assays (Enhancer of Zeste 2) is an essential component of the PRC2 (Polycomb repressive complex 2), and is involved in The in vitro methylation assays were performed as described silencing many important genes during development and previously (25). Briefly, 100 ng of histone methyltransferase cell differentiation (11–13). Interestingly, EZH2 was found enzymes were incubated with substrates (recombinant his- to participate in silencing HIV-1 by methylation of histones tones or histone peptides) in the presence of 20 mM Tris– located at the HIV-1 LTR region (14). A histone lysine HCl (pH 8.0), 4 mM EDTA, 1 mM phenylmethylsulfonyl methyltransferase (HKMT) inhibitor that targets EZH2, 3- 3 fluoride, 0.5 mM dithiothreitol, and 1 lof[ H]AdoMet deazaneplanocin A, can reactivate silenced proviruses (15). (13.3 Ci/mM; PerkinElmer Life Sciences). The reactions Similarly, GSK343, a specific EZH2 /EZH1 inhibitor, has ◦ were incubated at 30 C for 1 h before the proteins were sep- been reported to sensitize the latent HIV to reactivation ef- arated in a 4–15% SDS-polyacrylamide gel (or 10–20% Tris- fect of the HDAC inhibitor vorinostat (16). Tricine gel for methylation of histone peptides). After fixa- In contrast to H3K27 methylation, acetylation at H3K27 tion in a mixture containing 50% methanol and 10% acetic (H3K27ac) is a key epigenetic mark that correlates with acid for 20 min, the gels were treated with autoradiography gene transcriptional activation (17,18). Because methyla- Amplify reagent (Amersham Biosciences) for 20 min, dried, tion and acetylation occur on the same residue and have op- and exposed to X-ray films. Recombinant EZH2 protein posite functions, it is anticipated that there is an antagonis- complex, wildtype, K27-acetylated, and K27-trimethylated tic switch between methylation and acetylation on H3K27. histone H3 proteins were purchased from Active Motif. Re- Indeed, knockout of EZH2 or Suz12 (another integral com- combinant CARM1 protein was obtained from Millipore, ponent in PRC2) abrogates H3K27me3, and meanwhile and p300 protein was generated from the baculoviral system greatly enhances the level of H3K27ac in mouse ES cells as previously described (33). (19). Similarly, histone deacetylase inhibitors LBH589 and LAQ824 increase histone acetylation levels, and simultane- Plasmid DNA ously decrease H3K27 methylation levels in primary human acute leukemia cells (20). Therefore, it is expected that en- Histone H3 K27M mutant and its corresponding wildtype hancing H3K27ac levels could contribute to re-activation H3 were constructed in a pET16b expression vector. The of silenced HIV provirus. K27M mutation was generated by PCR-based site-directed In this study, we investigated how H3K27 acetylation mutagenesis. The sequences of the PCR primers are: regulates HIV-1 transcription. We found that H3K27ac is 5 GCTACAAAAGCCGCTCGCATGAGTGCGCCC a preferable substrate for H3R26 methylation catalyzed TCTACTGG-3 (forward); 5 -CCAGTAGAGGGCGC by a transcriptional coregulator protein termed CARM1 ACTCATGCGAGCGGCTTTTGTAGC-3 (reverse). (Coactivator-associated arginine methyltransferase 1). Similarly, the pInducer20 lentiviral vector was used to CARM1 belongs to the protein arginine methyltrans- generate expression vectors for wildtype H3 and H3K27M ferase (PRMT) family, and it catalyzes the transfer of (34). pCMV-Flag-Tat was previously generated from Dr methyl groups from S-adenosyl-L-methionine to the guani- Andrew Rice’s laboratory (35). dine nitrogens of arginine, producing asymmetric dimethy- lated arginine (Rme2a) as its final product ( 21,22). As Histone peptides, pull-down and western blot analysis a transcriptional co-regulator, CARM1 methylates multi- ple nuclear proteins involved in gene transcription, includ- Biotinylated histone H3(23-42) peptides (unmodified, ing histone H3, transcriptional coactivators CBP/p300 and K27ac, R26me2a, and R26me2a+K27ac) were purchased SRCs, mediator Med12, RNA pol II, RNA-binding pro- from JPT Peptides Inc. Biotinylated histone H3(18-35) teins PABP1, HuR, and HuD, as well as the splicing factors peptides (unmodified, K27M mutated, and K27M mu- CA150, SAP49, and SmB (23–30). CARM1 methylates hi- tation with R26me2a modification) were synthesized at stone H3 mainly on two sites, R17 and R26, with an ad- Peptide 2.0 Inc. For each pull-down analysis, 0.25 g ditional methylation site R42 that was recently identified of peptide was immobilized onto 25 l Dynabeads 280 (31,32). streptavidin (Life Technology, Inc), followed by addition of 1 mg HeLa nuclear extract and incubated at 4 Cfor 9350 Nucleic Acids Research, 2017, Vol. 45, No. 16 2 h. After binding, the beads were washed three times mented with 10% fetal bovine serum (FBS), penicillin (100 with wash buffer BC150 (20 mM Tris–HCl pH 7.9, 10% IU/ml), and streptomycin (100 g/ml). The 2D10 cell line glycerol, 0.2 mM EDTA, 150 mM KCl) before addition is a gift from Dr Jonathan Karn (Case Western Reserve of 2× SDS sample buffer and loading for SDS-PAGE and University), and the cells were maintained in RPMI 1640 western blot analysis. The antibodies used for western blot medium (without phenol red) supplemented with 10% heat- were: H3R26me2a antibody from Millipore; H3R17me2a inactivated FBS, penicillin (100 IU/ml), streptomycin (100 antibody from Active Motif; ELL, ENL, AF9, CARM1, g/ml) and 25 mM HEPES at 37 Cin5%CO . For NE AFF1 and AFF4 antibodies from Bethyl laboratories; preparation, HeLa S3 cell pellets were obtained from the p300, Cyclin T1 and CDK9 antibodies from Santa Cruz National Cell Culture Center (Minneapolis, MN), and NE biotechnology, Inc; and -actin antibody from Sigma. was prepared following the standard Dignam protocol (37). Mass spectrometry sample preparation and analysis Transient transfection (plasmid and siRNA knockdown) and Following the peptide pull-down assay, streptavidin beads luciferase analysis were washed and then boiled in 30 ul of 1× NUPAGE TransIT LT1 reagent (Mirus Bio LLC) was used to LDS sample buffer (Invitrogen) and subjected to SDS- transfect plasmid DNA to TMZ-bl cells. Lipofectamine PAGE (NuPAGE 10% Bis–Tris Gel, Invitrogen) and visual- RNAiMax transfection reagent (Thermo Fisher Scientific) ized with Coomassie Brilliant blue-stain. The SDS-PAGE wasusedtotransfect siRNA/plasmid DNA to TMZ-bl gel was excised, destained and subject to in-gel digestion cells. CARM1 and control SMARTpool siRNA (Dharma- using 100 ng of trypsin (GenDepot T9600). The tryptic con ON-TARGETplus) were purchased from GE Health- peptides were resuspended in 10 ul of 0.1% formic acid care. Luciferase activity was determined using the Promega and subjected to nanoHPLC–MS/MS system, which con- luciferase assay kit following the manufacturer’s instruc- sists of a nano-LC 1000 system (Thermo Scientific) and a tions (Promega Corp., Madison, WI, USA). LTQ Orbitrap Elite™ (Thermo Scientific) mass spectrom- eter. The peptides were loaded onto a Reprosil-Pur Basic C18 (1.9 m, Dr Maisch GmbH, Germany) pre-column Flow cytometry with a size of 2 cm × 100 m. The pre-column was switched Single cell suspensions were achieved by passage through in-line with an in-housed 50 mm × 150 um analytical col- a 22-gauge syringe before plating at a density of 5 × 10 umn packed with Reprosil-Pur Basic C18 equilibrated in on 24-well plates and treatment with pharmacological com- 0.1% formic acid. The peptides were eluted using a 75-min pounds for 24 h. GFP-expressing cells were quantified using discontinuous gradient of 4–26% acetonitrile/0.1% formic a BD FACSCANTO II and the FACSDIVA software suite acid at a flow rate of 600 nl /min. The eluted peptides were in the Cytometry and Cell Sorting Core at Baylor College directly electro-sprayed into mass spectrometer operated in of Medicine. the data-dependent acquisition mode acquiring fragmenta- tion spectra of the top 50 strongest ions. Obtained MS/MS spectra were parsed against a target-decoy human refseq Chromatin immunoprecipitation (ChIP) assay database in Proteome Discoverer 1.4 (Thermo Fisher) with ChIP assays were performed using the ChIP-IT Express the Mascot algorithm (Mascot 2.4, Matrix Science). The kit (Active Motif) following the manufacturer’s proto- precursor mass tolerance was confined within 20 ppm with a col except for the DNA purification step. We sheared fragment mass tolerance of 0.5 Da and a maximum of four the chromatin to an average size of 300–400 bp by missed cleavage allowed. Dynamic modification of oxida- sonication. The sheared chromatin was incubated with tion (methionine), protein N-terminal acetylation and De- indicated antibodies overnight at 4 C. The QIAquick Streak (cysteine) was allowed. The peptides identified from PCR purification kit was used for DNA purification the Mascot result file were validated with 5% false discovery after reverse-crosslinking of immunoprecipitated DNA. rate (FDR). For relative quantification, the data was then Purified DNA was eluted with 50 l of elution buffer and grouped into gene products and assigned homology and 3 l was used for quantitative PCR analysis using the identification quality groups using an in-house developed SensiFAST SYBR Hi-ROX kit from Bioline. The primers algorithm (36). All protein gene products were required to for amplification of Nucleosome 0 locus (Nuc-0) of LTR have at least one identification where a spectral match pass- are: 5 -TGGATCTACCACACACAAGG-3 (forward); ing <1% FDR and >20 ion score or <5% FDR and >30 5 -GTACTAACTTGAAGCACCATCC-3 (reverse). The ion score thresholds were present in order to be chosen for primer sequences for amplification of Nucleosome 1 locus follow-up in this study. Each gene product amount was esti- (Nuc-1)ofLTR are: 5 -GAGCCTGGGAGCTCTCTG- mated using a label-free intensity-based absolute quantifica- 3 (forward); 5 -GCTAGAGATTTTCCACACTG-3 tion (iBAQ) approach (as the sum of peptide areas normal- (reverse). And the primer sequences for amplification ized to the theoretical tryptic peptide potential) and then of DNase I hypersensitive sequence site (DHS) are: reported as a fraction of total protein iBAQ amount per ex- 5 -TTACACCCTATGAGCCAGCATG-3 (forward); periment (in 10–5 units for visual comprehension). 5 -GCTCTCGGGCCATGTGAC-3 (reverse) (38). The additional antibodies used in ChIP assays are: histone H3 Cell lines and nuclear extract (NE) preparation antibody from Novus; H3K27ac, H3K36me3 and pol II TZM-bl cells were initially obtained from the NIH AIDS pSer2 antibodies from Abcam. The H3R26me2aK27ac Reagent Program, and maintained in DMEM supple- antibody was customized at Pocono Rabbit Farm & Nucleic Acids Research, 2017, Vol. 45, No. 16 9351 Laboratory, Inc. and affinity purified by immobilized teins, and as shown in Figure 1F, the histone H3 extracted antigen. from cells with H3K27M mutation contains much higher level of H3R26me2a, suggesting that the crosstalk between H3K27ac and H3R26me2a exists at the cellular level. Fur- Primary T cell model of CCL19-induced HIV latency thermore, we compared the methylation activity on H3 re- The CCL19 latency model initially developed in Dr. Sharon combinant proteins with different modifications, including Lewin’s laboratory has been described previously (39– unmodified, K27-acetylated or K27-tri-methylated histone 41). Briefly, primary CD4+ T-cells were isolated from H3. H3K27ac appears to be the most preferable substrate, healthy donors using a RosetteSep human CD4+ T cell whereas H3K27me3 is the least favorable (Figure 1G). enrichment kit (StemCell) following the manufacturer’s Based on these results, we conclude that K27-acetylated hi- instructions. The resting CD4+ T cells were then nega- stone H3 is a better substrate for CARM1 methylation, and tively selected using CD30 MicroBeads by MACS sep- acetylation on H3K27 could be a priming event for H3R26 aration (Miltenyi Biotec). These cells were treated with methylation (Figure 1H). CCL19 (R&D Biosystems) for 2 days before SF162 virus infection. Five days after infection, cells were stimu- H3K27 acetylation and H3R26 methylation control the re- lated by CARM1 inhibitor 7g (Millipore) in combina- cruitment of Super Elongation Complex (SEC) tion with SAHA or JQ1. Cells were harvested a day af- ter compound treatment, followed by RNA extract us- Histone modifications exert functional consequences on ing Tri-reagent RT (Molecular Research Center, Inc) and epigenetic gene regulation through recruiting ‘reader’ DNase treatment using Direct-zol RNA purification kit proteins that specifically recognize the modified his- (Zymo Research). The expression of the gag RNA level tone marks. The reader proteins subsequently recruit was measured by RT-qPCR analysis using a sensiFAST additional transcriptional machinery to the target gene SYBR Hi-ROX One-step kit (Bioline). The sequences promoter/enhancer to modulate transcription (46). Al- of the primers are: 5 -GGGACCCAGCCATAAAGC-3 though H3K27ac is consistently correlated with gene ac- (forward); 5 -GCTGAATTTGTTACTTGGCTCA-3 (re- tivation, no specific reader has been identified. In addi- verse). These experiments were performed at the Baylor-UT tion, the role of methylation of H3R26, the residue imme- Houston Center for AIDS Research (CFAR) laboratory. diately adjacent to H3K27, is poorly understood. There- fore we performed peptide pull-down assays followed by RESULTS mass spectrometry analysis using K27-acetylated or R26- methylated H3 peptides as bait to identify specific binding Crosstalk between H3K27ac and H3R26me2a partners, i.e. ‘readers’. These biotinylated peptides were im- Because histone H3K27 acetylation is a key epigenetic mark mobilized on streptavidin beads and incubated with HeLa for active gene transcription, we investigated if this modifi- nuclear extract. Proteins bound to the peptides were pre- cation has any functional crosstalk with histone modifica- cipitated and identified by mass spectrometry. A complete tions on other sites. We first examined the residues in im- list of proteins enriched by each peptide is shown in Table mediate proximity to H3K27. Interestingly, we found that 1. Overall, 117 proteins were enriched on H3K27ac pep- H3R26 methylation, catalyzed by CARM1, was greatly en- tide relative to unmodified H3. In contrast, only 31 pro- hanced when H3K27 was acetylated. This appears to be spe- teins showed enrichment with H3R26me2a peptide. Inter- cific for R26 site, as R17 methylation was not altered (Figure estingly, when we searched for protein complexes that are 1A and B). enriched in H3K27ac peptide pull-down, we found multi- ple key subunits of the SEC. But these subunits were signif- Interestingly, when we aligned the known amino acid sequences of CARM1 methylation sites, only H3R26 and icantly decreased in H3R26me2a peptide pull-down (Figure H3R17 contain a lysine residue at the ‘+1’ position. All 2A). The mass spectrum result was confirmed by a separate other substrates have a neutral or hydrophobic residue (Fig- peptide pull-down followed by Western blot analysis (Fig- ure 1C). A previous study on H3R17 methylation reveals ure 2B and C), and was further validated by a pull-down that the positive charge of lysine side chain at ‘+1’ posi- assay using full-length histone H3 proteins as bait (Figure tion can slow down the process of arginine methylation, 2D). These results indicate that H3K27ac directly recruits and acetylation of this lysine neutralizes the charge and SEC subunits, whereas H3R26 methylation precludes this therefore accelerates the reaction (42). In order to confirm recruitment. whether this occurs on H3R26, we mutated the H3K27 residue to methionine and generated the recombinant H3 CARM1 methyltransferase activity is repressive for HIV-1 protein. The H3K27M mutation mimics the natural me- LTR-mediated transcription thionine residue at ‘+1’ position in SRC-3, CBP and p300 coactivators. Interestingly, H3K27M somatic mutation has Positive transcription elongation complex (P-TEFb), a ma- been found in up to 70% of diffuse intrinsic pontine glioma jor component of the SEC, is composed of kinase CDK9 (DIPG) patients and is a driver mutation for tumorigene- and one of the cyclin subunits, cyclin T1and T2. The CDK9 sis (43–45). With an in vitro methylation assay, we showed and cyclin T1 subunits of P-TEFb are essential for HIV- that the histone H3K27M mutant is preferentially methy- 1 transcription. P-TEFb directly interacts with Tat pro- lated by CARM1 on R26, but not on R17 (Figure 1D tein and viral TAR RNA to stimulate HIV-1 transcrip- and E). We also generated stable cell lines that ectopi- tional elongation (47,48). Therefore, our results suggest that cally express wildtype or K27M mutated histone H3 pro- H3K27ac may enhance HIV-1 transcription by recruiting 9352 Nucleic Acids Research, 2017, Vol. 45, No. 16 A C F H3 ++-- H3K27ac --++ kDa -+-+ CARM1 kDa 3 20 15 H-methyl H3R26me2a 43 100 (%) 6 8( 100%) H3 (Blue stain) H3R17me2 H3K27ac H3K27me3 H3R26me2a 85 100 47 (%) 48 100 (%) H3 H3R17me2 Flag 96 100 (%) H3K27ac H3 kDa 15 H3R26me2a B D E Enzymes kDa H3 (Blue stain) CARM1 100 47 17 (H3R26me2a/H3, %) EZH2 complex kDa Pepde CARM1 p300 5 3 H H-methyl kDa substrates 5( 100%) 15 ac m H3R26me2a 5 3 H-methyl Pepdes 20 K27 7R R R26 26 15 H3R17me2 (Blue stain) Pepdes 20 5 H3 (Blue stain) (Blue stain) Figure 1. Histone H3 with K27 acetylation is a better substrate for CARM1 methylation. (A) In vitro histone methylation assay catalyzed by CARM1. Unmodified and K27-acetylated recombinant histone H3 proteins were used as substrates, and the methylation activity was determined either by tritiu m- labeled assay (top panel), or western blot analysis (bottom panel). The relative intensity of signals was determined by ImageJ. (B) Unmodified and K27- acetylated histone peptides (amino acids 23–42) were used as substrates for tritium-labeled in vitro methylation assay catalyzed by CARM1. (C) A sequence alignment of known CARM1 substrates. The ‘R’ residues in red are CARM1 methylation sites. (D) In vitro methylation assay using wildtype histone H3 or histone H3 with a K27M mutation. The names of the recombinant methyltransferases/acetyltransferase were shown in blue. (E) Unmodified and R26- methylated histone H3 peptides (amino acids 18–35) harboring the K27M mutation were used in a methylation assay catalyzed by CARM1 in vitro.(F) Western blot analysis of histones extracted from 293T cells stably expressing vector, wildtype histone H3, or K27M mutated histone H3. The relative intensity of signals was determined by ImageJ. (G) Histone methylation assay catalyzed by CARM1. Unmodified, K27-acetylated, and K27-trimethylated histone H3 proteins were used as substrates. The total histone proteins were shown by Blue stain reagent, and H3R26me2a level was shown by Western blot analysis. The relative intensity of H3R26me2a was normalized by H3 and shown at the bottom. (H) A cartoon model of H3K27ac-regulated H3R26 methylation. and stabilizing the SEC, Tat and TAR multi-complexes. In LTR-mediated transcription through dissociation of SEC. contrast, the subsequent H3R26 methylation catalyzed by We tested this hypothesis in TZM-bl cells, a HeLa cell HIV- CARM1 may dissociate the SEC and attenuate HIV-1 tran- 1 latency model that contains Tat-inducible HIV LTR-Luc scription. and HIV LTR--galactosidase reporter genes. As shown We performed Chromatin-IP analysis in 2D10 cells, a in Figure 3B, overexpression of wild-type CARM1 sig- latency model with a single proviral insertion of HIV- nificantly reduced Tat-mediated transcriptional activity, d2EGFP in the genome of Jurkat CD4+ T cells (49). When whereas methyltransferase mutants of CARM1 did not. we treated the 2D10 cells with TNF to activate the latent Our results indicate that the intrinsic methyltransferase ac- provirus, we observed a significant increase of H3K27ac tivity of CARM1 indeed suppresses HIV-1 transcription. levels on Nuc-0 and Nuc-1 regions of HIV-1 5 LTR. The In addition, when CARM1 was depleted in TZM-bl cells level of increase is correlated with H3K4me3, another epi- by siRNA, Tat-mediated transcription was moderately in- genetic mark for active transcription, and enrichment of creased (Figure 3C). Transcriptional activity was further in- RNA polymerase II (Figure 3A). This result suggests that creased by the addition of JQ1, suggesting that inhibition H3K27 is acetylated when HIV-1 viral transcription is acti- of CARM1 can work with other LRAs to activate HIV-1 vated. proviral transcription. Based on the mass spectrometry data, we hypothesized that H3R26 methylation is a repressive mark for HIV-1 H3(23-42) H3(23-42)K27ac H-methyl/ Western acetyl blot Western blot H3 H3K27M H3(18-35) H3(18-35)K27M H3(18-35) R26me2aK27M Hydrophobic Hydrophilic Hydrophobic Hydrophilic -neutral -charged H3K27ac Flag-Vector H3 Flag-H3 H3K27me3 Flag-H3 K27M Nucleic Acids Research, 2017, Vol. 45, No. 16 9353 Table 1. A complete list of proteins enriched/reduced on H3K27ac or H3R26me2a peptides Proteins enriched on H3K27ac peptide ACACA DNAJA2 FASN KRT3 NKRF ROR2 RSL1D1 TAF6L AFF1 DOT1L FYTTD1 MAML1 NOP2 RPL10A SCAF11 TBK1 AFF4 DSC1 GEMIN5 MAU2 NR4A1 RPL11 SDC4 TMOD3 ATAD5 DYNC1H1 GPATCH8 MCM3AP NRDE2 RPL13 SEC24B TOP3A ATP6V1B2 EEF2 GPC1 MED13 PDE12 RPL14 SH3GL1 TWISTNB BRCA1 EHMT2 GTPBP4 MED27 PGAM5 RPL15 SLFN5 USP39 CCNT1 EIF2S1 HIST1H1C MEN1 PKP2 RPL18 SLX4 VPRBP CDC42EP1 EIF3B HNRNPLL MLH1 PRKDC RPL21 SMARCA2 VWA9 CDT1 EIF5B HOXA10 MLLT1 PRPF38A RPL27 SMCHD1 WTAP CNOT3 ELAVL1 HPS3 MOV10 PRRC2A RPL27A SNAPC4 YLPM1 CSTF1 ELL2 IRF2BP2 MYBBP1A RAD18 RPL30 SPAG5 ZMYM4 CWF19L2 EPRS KAT7 MYBL2 RBM34 RPL7A STAT3 ZNF318 DDX24 ERBB2IP KHDRBS1 NAT10 RERE RPS19 SUGP2 DDX50 ESRP2 KIAA1429 NCBP1 RFX1 RPS2 SYDE1 DNAJA1 FANCI KPNA1 NDE1 RNF169 RPS25 SYNCRIP Protein enriched on H3R26me2 peptide ACTR8 CTSH IRF2BP2 PDIA3 S100A9 VWA9 APOD DDX20 KRT79 RAD18 SH3GL1 ARFGAP3 DYNC1H1 MAML1 RFX1 SLX4 AZGP1 ELL2 NAT10 RPS25 STAT3 CALML3 FAM83D NR4A1 RUNX2 TMOD3 CSTA HMGB1 PDE12 S100A7 UBN1 CARM1 small-molecule inhibitor 7g is a potential latency- To examine the efficacy of 7g during latency reversal in reversing agent for HIV-1 combination with SAHA and JQ1, we used a model sys- tem that establishes latent HIV-1 infection in resting CD4+ Given that the repressive function of CARM1 depends on T cells treated with the cytokine CCL19 [26]. As shown in its methyltransferase activity, we predicted that a CARM1 Figure 4I, when 7g was used alone, gag mRNA was pro- inhibitor could activate HIV-1 proviral transcription. We duced in a dose-dependent manner. And when 2 Mof7g tested the commercially available CARM1-specific in- was used in combination with SAHA or JQ1, a synergistic hibitor 1-Benzyl-3,5-bis-(3-bromo-4-hydroxybenzylidene) effect was observed, in agreement with the result observed piperidin-4-one (termed 7g) in HIV latency models (Figure in 2D10 cells (Figure 4J). Taken together, our data indicate 4A) (50). At the cellular level, 7g potently inhibits H3R26 that the small-molecule inhibitor of CARM1 7g can induce methylation (Figure 4B). Treatment of TZM-bl cells with activation of latent HIV and therefore has potential as a 7g strongly induced HIV-1 transcriptional output as novel therapeutic agent for shock-and-kill strategies. indicated by luciferase activity. Moreover, the co-treatment of 7g with bromodomain inhibitor JQ1 synergistically increased the transcriptional activity (Figure 4C). Similar CARM1 inhibitor 7g activates expression of latent HIV-1 results were observed in 2D10 cells. Treatment of increasing through promoting transcriptional elongation doses of 7g activates the latent provirus in 2D10 cells in Because of the critical role of the SEC in HIV transcrip- a dose-dependent manner (Figure 4D), and 7g exhibits tional elongation, we sought to examine the roles of hi- a synergistic effect with the HDAC inhibitor SAHA and stone modifications and the recruitment of the SEC on JQ1 (Figure 4E and F), suggesting that both acetyla- the HIV-1 LTR in Jurkat 2D10 cells. Due to the lack of tion and methylation are key regulators of HIV latency. ChIP-grade commercial antibodies for H3R26me2a, we Additionally, the geometric means of GFP-positive cells generated and purified our own rabbit polyclonal antibod- were calculated and exhibited a positive correlation with ies recognizing the dual modification H3R26me2aK27ac. the doses of 7g, indicating that 7g not only increases the The specificity of the antibody was confirmed by the his- number of cells expressing HIV, but also increases the level tone H3 peptide-based dot-blot experiment shown in Fig- of expression at the single cell level. ure 5A, and further validated by western blot analysis us- Because both TZM-bl and 2D10 latency models are ing full-length histone H3 and H3K27ac recombinant pro- based on cancer cell lines, we next sought to determine the teins. Both proteins were methylated by CARM1 protein in effect of 7g in a primary resting T cell model of HIV latency. vitro, but only the methylated H3K27ac protein can be rec- First, we determined the toxicity of 7g in PBMCs by mea- ognized by H3R26me2aK27ac antibody (Figure 5B). Be- suring the cell viability and apoptosis after 7g treatment. cause HDAC inhibitors have been reported as LRAs for As shown in Figure 4G and H, 7g exhibits little toxicity HIV-1 in many studies, we used SAHA in our ChIP anal- when being used at 6.3 M. However, it affects cell viability ysis as a positive control. As shown in Figure 5C, treat- and induces apoptosis at higher concentrations such as 12.5 ment of 2D10 cells with SAHA or 7g did not alter the to- M. Therefore to avoid toxicity, we chose to use 2 Mof tal protein levels of the SEC subunits including Cyclin T1, 7g when combined with other LRAs in primary cells. CDK9, ENL, and AFF4, or the transcriptional coregulator 9354 Nucleic Acids Research, 2017, Vol. 45, No. 16 Figure 2. Super Elongation Complex (SEC) are H3K27ac ‘readers’. (A) Key components of SEC were highly enriched on H3K27ac peptide by pull-down analysis. The fold changes over unmodified histone H3 peptide are shown as red (enriched) or blue (reduced). A complete list of all proteins identified by mass spectrometry is shown in Table 1.(B) Peptide pull-down followed by silver stain. (C) Peptide pull-down followed by Western blot analysis to confirm the mass spectrum results in (A). The peptides shown on the bottom were in proportion to the amount of peptides used in the pull-down. ( D) Immunoprecipitation (IP) of SEC subunits from HeLa nuclear extract by recombinant full-length histone H3 proteins (unmodified or K27-acetylated). Histone H3 antibody and protein G beads were added to the IP samples following 2 h of incubation. The mock sample contains all the reagents except for recombinant histone H3. The amount of histones used in the IP was shown by Blue stain. proteins p300 and CARM1. The ChIP assay showed that tion by promoting transcriptional elongation. It is worth H3K27ac was significantly increased on HIV-1 LTR when noting that the recruitment of p300 was elevated in 7g- the cells were treated with SAHA, despite the fact that the treated cells, in agreement with our previous observation levels of total histones were reduced (Figure 5D). Consis- that CARM1 methyltransferase activity is critical to disso- tent with our biochemical observations that H3K27 acety- ciate the p300/SRC-3/CARM1 coactivator complex (25). lation functions as a priming event for H3R26 methylation, we observed that the levels of H3R26me2aK27ac increased DISCUSSION in SAHA treated samples by ChIP, but not in 7g-treated cells, suggesting that endogenous H3R26 methylation on Gene transcription in eukaryotic cells is a complex process HIV-1 LTR depends on CARM1 methyltransferase activity. involving recruitment of multiple transcriptional machiner- Consistently, the recruitment of CylcinT1 and AFF4 was ies. These enzymatic activities/complexes are recruited to greatly enhanced in both SAHA and 7g-treated cells, and the chromatin in a sequential order to modify chromatin consequently promoted the transcriptional elongation ex- structure and facilitate transcriptional initiation and elon- hibited by the increase of Ser2-phosphorylated RNA poly- gation. However, how these processes are coordinated is merase II (Figure 5D). We also observed that 7g treat- largely unknown. In our current study, we demonstrate ment enriched H3K36me3, a histone modification mark that crosstalk occurs between histone H3K27 acetylation for transcriptional elongation, further supporting our con- and H3R26 methylation. Importantly, the change of his- clusion that 7g activates HIV-1 LTR mediated transcrip- tone modifications on K27 and R26 determines the recruit- Nucleic Acids Research, 2017, Vol. 45, No. 16 9355 TSS Nuc-0 Nuc-1 5’ DHS 3’ U3 R U5 HIV-1 5’ LTR IgG H3K27ac H3K4me3 RNA pol II 15 40 7.5 30 * 10 5 5 2.5 TNFα - TNFα + 0 0 0 0 B C CARM1 mRNA HA (CARM1) 2 H3R26me2a 1.5 H3 NS NS 0.5 20000 0 siCtrl RLU RLU siCARM1 - Tat + Tat - Tat + Tat Figure 3. CARM1 methyltransferase activity is repressive for HIV-1 LTR-mediated transcription. (A) Chromatin IP on HIV-1 LTR in 2D10 cells treated with or without TNF for 2 h. The experiment has been repeated two times and the most representative results were shown. *P < 0.05 determined by two-tailed t-test with duplicated ChIP samples per treatment. The error bars were shown as standard error of mean (SEM). DHS: DNase I hypersensitive site. (B) Wildtype or CARM1 methyltransferase-dead mutants Y154R and Y154A were transfected in TZM-bl cells in the absence or presence of Tat, and the relative luciferase activity was measured two days after transfection. Western blot analysis showed the expression levels of CARM1 proteins and H3R26me2a. *P < 0.05 determined by two-tailed t-test. NS, not significant. All transfections were in quadruplicates, and the error bars were shown as SEM. (C) TZM-bl cells were transfected with Tat expressing vector and siRNA for 24 h, followed by treatment of DMSO, JQ1 (0.5 M), or SAHA (0.5 M) for another 24 hours before harvesting cells for luciferase assay. RT-qPCR analysis showed the knockdown efficiency of CARM1 siRNA in TZM-bl cells. *P < 0.05 determined by two-tailed t-test. The experiment was performed in duplicates. The error bars were shown as SEM. ment and dissociation of the SEC protein complex on the AF9/ENL or other component recognizes H3K27ac and HIV-1 LTR. Based on our findings, we propose a work- bring the SEC to the HIV-1 promoter. ing hypothesis as shown in Figure 6. H3K27ac is an active CARM1 has been shown to function as both a transcrip- mark for HIV-1 transcription. SEC interacts and is stabi- tional activator and an attenuator in a context-dependent lized by H3K27ac on HIV-1 LTR, and the recruitment of manner. CARM1 methylates diverse substrates including SEC is essential for HIV-1 transcriptional elongation. Sub- histone H3, RNA binding proteins, transcription factors, sequently, H3K27ac induces CARM1-dependent H3R26 and coactivators. H3R17 is a major CARM1 methylation methylation, resulting in dissociation of SEC and attenu- site on histone, and this modification promotes transcrip- ation of HIV-1 transcription. An interesting question that tional elongation through recruiting TDRD3 and TOP3B arises here is which component of the SEC is the ‘reader’ for to prevent R loop accumulation and/or recruiting PAF1c H3K27ac. AF9 and ENL, the YEATS domain containing (52–54). On the other hand, we and others have shown proteins, have been previously reported as H3K9ac read- that CARM1 can methylate the SRC family of coactivators ers. They can also recognize H3K27ac and H3K18ac but and subsequently attenuate gene transcription by dissocia- with lower affinity ( 51). It remains to be determined whether tion of coactivator complex and degradation of SRC-3 pro- tein (25,27). Our current study reveals an additional mech- % of Input Nuc-0 vector vector WT CARM1-WT DHS Y154R CARM1-Y154R Y154A Nuc-1 CARM1-Y154A vector CARM1-WT Nuc-0 CARM1-Y154R DHS CARM1-Y154A Nuc-1 Nuc-0 DHS DMSO Nuc-1 JQ1 SAHA Nuc-0 DMSO DHS JQ1 Nuc-1 SAHA 9356 Nucleic Acids Research, 2017, Vol. 45, No. 16 Figure 4. The CARM1 inhibitor 7g strongly induces HIV-1 transcription in latent cell models. (A) Chemical structure of 1-Benzyl-3,5-bis-(3-bromo-4- hydroxybenzylidene) piperidin-4-one, the CARM1 inhibitor 7g. (B) 293T cells were treated with 7g for 24 h and Western blot analysis was performed. (C) TZM-bl cells were first transfected with a Tat expressing vector, and then treated with 7g (5 M) with or without the bromodomain inhibitor JQ1 (0.1 or 1 M). Luciferase assay was performed after 24 h of drug treatment. *P < 0.05 determined by two-tailed t-test. The experiment was performed in duplicates, and error bars were shown as standard deviation (SD). (D) 2D10 cells were treated with increasing doses of 7g for 16 h and GFP level was determined by FACS analysis. Each treatment was duplicated and averages were shown. Error bars were shown as SD. (E) 2D10 cells were treated with different doses of 7g and SAHA for 16 h followed by FACS analysis to measure the GFP level. The percentage of activated cells and their geometric mean (GEO) were both shown. The GEO Mean was calculated specifically for GFP+ cells, and was done by gating GFP+ cells and displaying the geometric mean from that gate. (F) 2D10 cells were treated with different doses of 7g and JQ1 for 16 h followed by FACS analysis to measure the GFP level. (G) PBMCs were treated with various concentrations of 7g for 3 days, and the cell viability was determined by CellTiter-Glo luminescent assay. The experiment was performed in triplicates, and error bars were shown as SD. (H) PBMCs were treated with various concentrations of 7g for 24 h, and the levels of full-length (fl) PARP-1 and cleaved form of PARP-1 were determined by Western blot analysis. (I) CCL19-treated primary resting CD4+ T cells were infected by SF162 virus. Five days after infection, cells with latent HIV-1 were stimulated by increasing doses of 7g. The mRNA level of gag was measured by RT-qPCR to determine the activity of 7g on HIV-1 activation at the transcriptional level. The assay was performed in triplicates and SEM was shown. *P < 0.05 determined by two-tailed t-test in comparison with DMSO-treated sample. (J) Evaluation of 7g with a combinatory treatment of SAHA and JQ1 using CCL19 primary T cell model. 7g, 2 M; SAHA, 0.5 M; JQ1, 0.5 M. The assay was performed in triplicates and SEM was shown. *P < 0.05. anism by which CARM1 suppresses transcription through methylate H3R17, suggesting a putative mechanism of reg- H3R26 methylation. It is postulated that at the early stage ulating the CARM1 substrate selectivity (42). of gene transcription, CARM1 preferentially methylates Recently, several HDAC inhibitors have been tested as those substrates that are important for transcriptional ac- LRAs in clinical trials, but the results were not very en- tivation; whereas after transcription is completed, CARM1 couraging. The size of the latent HIV-1 reservoir was not changes substrates and plays repressive role on transcrip- changed by these interventions despite an increase of HIV- tion, facilitating the turn-off stage of transcriptional cycle. 1 transcription (55–58). This outcome suggests that more It remains to be determined how the substrate selectivity of effective immune response is needed for eradiation of re- CARM1 is precisely regulated during transcription. It has activated virus; and probably more likely, short-term treat- been reported that the full-length of CARM1 protein (aa 1– ment with a single LRA may not be potent enough to acti- 585) is required for H3R26 methylation, whereas the mini- vate much latent provirus. Therefore, combination of two or mal methyltransferase domain (aa 147–490) is sufficient to more LRAs, especially LRAs with different targeting mech- Nucleic Acids Research, 2017, Vol. 45, No. 16 9357 Figure 5. The CARM1 inhibitor 7g promotes transcriptional elongation by increasing the recruitment of SEC subunits on HIV-1 LTR. (A) Immuno-dot- blot assay to determine the specificity of the antibody. Various amounts of histone H3.1 (aa 23–42) peptides with /without methylated R26 or acetylated K27 were blotted on nitrocellulose membrane followed by western blot analysis. The H3R26me2aK27ac antibody was affinity-purified and used at 0.2 g/ml. (B) Western blot assay to further determine the specificity of H3R26me2aK27ac antibody. Recombinant histone H3 and H3K27ac proteins were pre-methylated by CARM1 protein in vitro before being analyzed by Western blot analysis. PVDF membrane was used for protein transfer. (C) Western blot analysis to determine the protein levels of SEC subunits and histone modification enzymes in 2D10 cells treated with DMSO, 0.5 M of SAHA, or 5 M of 7g. Cells were treated for 24 h before harvest. (D) ChIP-qPCR analysis of histone modifications and the recruitment of transcriptional coregulators on HIV-1 LTR. The PCR primers amplified the DNA sequence on Nucleosome 1 (Nuc-1). 2D10 cells were treated with DMSO, 0.5 M of SAHA, or 5 M of 7g for 24 h before fixation for ChIP. The assay was performed in duplicates and SEM was shown. * P < 0.05 determined by two-tailed t-test in comparison with DMSO treated samples. anisms, will likely be needed to achieve a better clinical re- suppressive epigenetic marks would synergistically activate sponse. Indeed, a previous study showed that using a com- HIV transcription. bination of EZH2 inhibitors and HDAC inhibitors led to a Treatment with HDAC inhibitors increases total his- synergistic activation of latent virus in comparison to single tone acetylation levels, which generally facilitate transcrip- treatments (16). In this study, we aimed to identify addi- tional initiation and elongation. The BET inhibitor JQ1 tional epigenetic enzymes that control HIV gene transcrip- frees the limited amount of P-TEFb used by host tran- tion, with an anticipation that selectively targeting multiple scription factor-mediated transcription by inhibition of 9358 Nucleic Acids Research, 2017, Vol. 45, No. 16 P30 CA125123, S10 RR024574]. Funding for open access charge: NIH [R21AI122418]. Conflict of interest statement. None declared. REFERENCES 1. Chun,T.W., Davey,R.T. Jr, Engel,D., Lane,H.C. and Fauci,A.S. (1999) Re-emergence of HIV after stopping therapy. Nature, 401, 874–875. 2. Deeks,S.G. (2012) HIV: shock and kill. Nature, 487, 439–440. 3. Savarino,A., Mai,A., Norelli,S., El Daker,S., Valente,S., Rotili,D., Altucci,L., Palamara,A.T. and Garaci,E. (2009) “Shock and kill” effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence. Retrovirology, 6, 4. Lusic,M. and Giacca,M. (2015) Regulation of HIV-1 latency by chromatin structure and nuclear architecture. J. Mol. Biol., 427, 688–694. 5. Archin,N.M., Espeseth,A., Parker,D., Cheema,M., Hazuda,D. and Margolis,D.M. (2009) Expression of latent HIV induced by the potent HDAC inhibitor suberoylanilide hydroxamic acid. AIDS Res. Hum. Retroviruses, 25, 207–212. 6. Wightman,F., Ellenberg,P., Churchill,M. and Lewin,S.R. (2012) HDAC inhibitors in HIV. Immunol. Cell Biol., 90, 47–54. Figure 6. Working model. Histone H3 K27 acetylation (H3K27ac) is an 7. Wei,D.G., Chiang,V., Fyne,E., Balakrishnan,M., Barnes,T., epigenetic mark that recruits SEC to HIV-1 LTR. K27ac also promotes Graupe,M., Hesselgesser,J., Irrinki,A., Murry,J.P., Stepan,G. et al. R26 methylation (H3R26me2a) catalyzed by CARM1, which subsequently (2014) Histone deacetylase inhibitor romidepsin induces HIV causes dissociation of SEC and attenuation of transcription, resulting in a expression in CD4 T cells from patients on suppressive antiretroviral negative feedback regulatory loop. therapy at concentrations achieved by clinical dosing. PLoS Pathogens, 10, e1004071. 8. Boyer,L.A., Plath,K., Zeitlinger,J., Brambrink,T., Medeiros,L.A., BRD4, meanwhile relieving the direct suppression function Lee,T.I., Levine,S.S., Wernig,M., Tajonar,A., Ray,M.K. et al. (2006) of BRD2 and ultimately facilitating the elongation pro- Polycomb complexes repress developmental regulators in murine cess (59–61). In contrast to these known LRAs, CARM1 embryonic stem cells. Nature, 441, 349–353. 9. Lee,T.I., Jenner,R.G., Boyer,L.A., Guenther,M.G., Levine,S.S., inhibitor functions through a completely different mecha- Kumar,R.M., Chevalier,B., Johnstone,S.E., Cole,M.F., Isono,K. nism. It limits histone methylation at H3R26, therefore in- et al. (2006) Control of developmental regulators by Polycomb in creasing the enrichment of SEC for HIV-1 transcription. human embryonic stem cells. Cell, 125, 301–313. It was reported that the subunits of SEC, including ELL2, 10. Francis,N.J., Kingston,R.E. and Woodcock,C.L. (2004) Chromatin compaction by a polycomb group protein complex. Science, 306, AFF1, or AFF4, facilitate the activation of latent HIV-1 1574–1577. in Jurkat/2D10 cells (62), indicating that up-regulation of 11. Vire,E., Brenner,C., Deplus,R., Blanchon,L., Fraga,M., Didelot,C., transcriptional elongation is an efficient strategy to reverse Morey,L., Van Eynde,A., Bernard,D., Vanderwinden,J.M. et al. HIV-1 latency, and that a combination of therapeutic ap- (2006) The Polycomb group protein EZH2 directly controls DNA proaches at multiple steps of HIV transcription will syn- methylation. Nature, 439, 871–874. 12. Richter,G.H., Plehm,S., Fasan,A., Rossler,S., Unland,R., ergistically activate HIV-1 RNA production. Indeed, treat- Bennani-Baiti,I.M., Hotfilder,M., Lowel,D., von Luettichau,I., ment with a CARM1 inhibitor synergizes with SAHA and Mossbrugger,I. et al. (2009) EZH2 is a mediator of EWS/FLI1 JQ1 to increase HIV transcription. In summary, our results driven tumor growth and metastasis blocking endothelial and reveal a crosstalk between histone modifications, and sug- neuro-ectodermal differentiation. Proc. Natl. Acad. Sci. U.S.A., 106, 5324–5329. gest a novel epigenomic approach for activation of latent 13. Hunkapiller,J., Shen,Y., Diaz,A., Cagney,G., McCleary,D., HIV-1. Ramalho-Santos,M., Krogan,N., Ren,B., Song,J.S. and Reiter,J.F. (2012) Polycomb-like 3 promotes polycomb repressive complex 2 binding to CpG islands and embryonic stem cell self-renewal. PLoS ACKNOWLEDGEMENTS Genet., 8, e1002576. 14. Matsuda,Y., Kobayashi-Ishihara,M., Fujikawa,D., Ishida,T., We thank Drs Ming-Jer Tsai, Sophia Tsai, Roberto Arduino Watanabe,T. and Yamagishi,M. (2015) Epigenetic heterogeneity in and Donghang Cheng for their helpful discussion. HIV-1 latency establishment. Sci. Rep., 5, 7701. 15. Friedman,J., Cho,W.K., Chu,C.K., Keedy,K.S., Archin,N.M., Margolis,D.M. and Karn,J. (2011) Epigenetic silencing of HIV-1 by FUNDING the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J. Virol., 85, 9078–9089. Creative and Novel Ideas in HIV Research (CNIHR) pro- 16. Tripathy,M.K., McManamy,M.E., Burch,B.D., Archin,N.M. and gram from National Institutes of Health (NIH) (to Q.F.); Margolis,D.M. (2015) H3K27 demethylation at the proviral promoter sensitizes latent HIV to the effects of vorinostat in ex vivo cultures of NIH [R21AI122418 to Q.F.]; Cancer Prevention Research resting CD4+ T cells. J. Virol., 89, 8392–8405. Institute of Texas (CPRIT) [RP110784 to B.H.]; Ameri- 17. Kimura,H. (2013) Histone modifications for human epigenome can Cancer Society [RSG-13-061-01 to B.H.]; Baylor Col- analysis. J. Hum. Genet., 58, 439–445. lege of Medicine: the CFAR core [NIH P30 AI036211]; 18. Wang,Z., Zang,C., Rosenfeld,J.A., Schones,D.E., Barski,A., Cytometry and Cell Sorting Core [NIH P30 AI036211, Cuddapah,S., Cui,K., Roh,T.Y., Peng,W., Zhang,M.Q. et al. (2008) Nucleic Acids Research, 2017, Vol. 45, No. 16 9359 Combinatorial patterns of histone acetylations and methylations in 37. Dignam,J.D., Lebovitz,R.M. and Roeder,R.G. (1983) Accurate the human genome. Nat. Genet., 40, 897–903. transcription initiation by RNA polymerase II in a soluble extract 19. Pasini,D., Malatesta,M., Jung,H.R., Walfridsson,J., Willer,A., from isolated mammalian nuclei. Nucleic Acids Res., 11, 1475–1489. Olsson,L., Skotte,J., Wutz,A., Porse,B., Jensen,O.N. et al. (2010) 38. Rafati,H., Parra,M., Hakre,S., Moshkin,Y., Verdin,E. and Characterization of an antagonistic switch between histone H3 lysine Mahmoudi,T. (2011) Repressive LTR nucleosome positioning by the 27 methylation and acetylation in the transcriptional regulation of BAF complex is required for HIV latency. PLoS Biol., 9, e1001206. Polycomb group target genes. Nucleic Acids Res., 38, 4958–4969. 39. Cameron,P.U., Saleh,S., Sallmann,G., Solomon,A., Wightman,F., 20. Fiskus,W., Pranpat,M., Balasis,M., Herger,B., Rao,R., Evans,V.A., Boucher,G., Haddad,E.K., Sekaly,R.P., Harman,A.N. Chinnaiyan,A., Atadja,P. and Bhalla,K. (2006) Histone deacetylase et al. (2010) Establishment of HIV-1 latency in resting CD4+ T cells inhibitors deplete enhancer of zeste 2 and associated polycomb depends on chemokine-induced changes in the actin cytoskeleton. repressive complex 2 proteins in human acute leukemia cells. Mol. Proc. Natl. Acad. Sci. U.S.A., 107, 16934–16939. Cancer Ther., 5, 3096–3104. 40. Saleh,S., Solomon,A., Wightman,F., Xhilaga,M., Cameron,P.U. and 21. Chen,D., Huang,S.M. and Stallcup,M.R. (2000) Synergistic, p160 Lewin,S.R. (2007) CCR7 ligands CCL19 and CCL21 increase coactivator-dependent enhancement of estrogen receptor function by permissiveness of resting memory CD4+ T cells to HIV-1 infection: a CARM1 and p300. J. Biol. Chem., 275, 40810–40816. novel model of HIV-1 latency. Blood, 110, 4161–4164. 22. Ma,H., Baumann,C.T., Li,H., Strahl,B.D., Rice,R., Jelinek,M.A., 41. Saleh,S., Wightman,F., Ramanayake,S., Alexander,M., Kumar,N., Aswad,D.W., Allis,C.D., Hager,G.L. and Stallcup,M.R. (2001) Khoury,G., Pereira,C., Purcell,D., Cameron,P.U. and Lewin,S.R. Hormone-dependent, CARM1-directed, arginine-specific (2011) Expression and reactivation of HIV in a chemokine induced methylation of histone H3 on a steroid-regulated promoter. Curr. model of HIV latency in primary resting CD4+ T cells. Retrovirology, Biol.: CB, 11, 1981–1985. 8, 80. 23. Cheng,D., Cote,J., Shaaban,S. and Bedford,M.T. (2007) The arginine 42. Yue,W.W., Hassler,M., Roe,S.M., Thompson-Vale,V. and Pearl,L.H. methyltransferase CARM1 regulates the coupling of transcription (2007) Insights into histone code syntax from structural and and mRNA processing. Mol. Cell, 25, 71–83. biochemical studies of CARM1 methyltransferase. EMBO J., 26, 24. Daujat,S., Bauer,U.M., Shah,V., Turner,B., Berger,S. and 4402–4412. Kouzarides,T. (2002) Crosstalk between CARM1 methylation and 43. Wu,G., Broniscer,A., McEachron,T.A., Lu,C., Paugh,B.S., CBP acetylation on histone H3. Curr. Biol.: CB, 12, 2090–2097. Becksfort,J., Qu,C., Ding,L., Huether,R., Parker,M. et al. (2012) 25. Feng,Q., Yi,P., Wong,J. and O’Malley,B.W. (2006) Signaling within a Somatic histone H3 alterations in pediatric diffuse intrinsic pontine coactivator complex: methylation of SRC-3/AIB1 is a molecular gliomas and non-brainstem glioblastomas. Nat. Genet., 44, 251–253. switch for complex disassembly. Mol. Cell. Biol., 26, 7846–7857. 44. Khuong-Quang,D.A., Buczkowicz,P., Rakopoulos,P., Liu,X.Y., 26. Fujiwara,T., Mori,Y., Chu,D.L., Koyama,Y., Miyata,S., Tanaka,H., Fontebasso,A.M., Bouffet,E., Bartels,U., Albrecht,S., Yachi,K., Kubo,T., Yoshikawa,H. and Tohyama,M. (2006) CARM1 Schwartzentruber,J., Letourneau,L. et al. (2012) K27M mutation in regulates proliferation of PC12 cells by methylating HuD. Mol. Cell. histone H3.3 defines clinically and biologically distinct subgroups of Biol., 26, 2273–2285. pediatric diffuse intrinsic pontine gliomas. Acta Neuropathol., 124, 27. Naeem,H., Cheng,D., Zhao,Q., Underhill,C., Tini,M., Bedford,M.T. 439–447. and Torchia,J. (2007) The activity and stability of the transcriptional 45. Bender,S., Tang,Y., Lindroth,A.M., Hovestadt,V., Jones,D.T., coactivator p/CIP/SRC-3 are regulated by CARM1-dependent Kool,M., Zapatka,M., Northcott,P.A., Sturm,D., Wang,W. et al. methylation. Mol. Cell. Biol., 27, 120–134. (2013) Reduced H3K27me3 and DNA hypomethylation are major 28. Sims,R.J. 3rd, Rojas,L.A., Beck,D., Bonasio,R., Schuller,R., drivers of gene expression in K27M mutant pediatric high-grade Drury,W.J. 3rd, Eick,D. and Reinberg,D. (2011) The C-terminal gliomas. Cancer Cell, 24, 660–672. domain of RNA polymerase II is modified by site-specific 46. Butler,J.S. and Dent,S.Y. (2013) The role of chromatin modifiers in methylation. Science, 332, 99–103. normal and malignant hematopoiesis. Blood, 121, 3076–3084. 29. Wei,Y., Horng,J.C., Vendel,A.C., Raleigh,D.P. and Lumb,K.J. (2003) 47. Tahirov,T.H., Babayeva,N.D., Varzavand,K., Cooper,J.J., Sedore,S.C. Contribution to stability and folding of a buried polar residue at the and Price,D.H. (2010) Crystal structure of HIV-1 Tat complexed with CARM1 methylation site of the KIX domain of CBP. Biochemistry, human P-TEFb. Nature, 465, 747–751. 42, 7044–7049. 48. Ott,M., Geyer,M. and Zhou,Q. (2011) The control of HIV 30. Wang,L., Zeng,H., Wang,Q., Zhao,Z., Boyer,T.G., Bian,X. and transcription: keeping RNA polymerase II on track. Cell Host Xu,W. (2015) MED12 methylation by CARM1 sensitizes human Microbe, 10, 426–435. breast cancer cells to chemotherapy drugs. Sci. Adv., 1, e1500463. 49. Pearson,R., Kim,Y.K., Hokello,J., Lassen,K., Friedman,J., Tyagi,M. 31. Bauer,U.M., Daujat,S., Nielsen,S.J., Nightingale,K. and and Karn,J. (2008) Epigenetic silencing of human immunodeficiency Kouzarides,T. (2002) Methylation at arginine 17 of histone H3 is virus (HIV) transcription by formation of restrictive chromatin linked to gene activation. EMBO Rep., 3, 39–44. structures at the viral long terminal repeat drives the progressive entry 32. Casadio,F., Lu,X., Pollock,S.B., LeRoy,G., Garcia,B.A., Muir,T.W., of HIV into latency. J. Virol., 82, 12291–12303. Roeder,R.G. and Allis,C.D. (2013) H3R42me2a is a histone 50. Cheng,D., Valente,S., Castellano,S., Sbardella,G., Di Santo,R., modification with positive transcriptional effects. Proc. Natl. Acad. Costi,R., Bedford,M.T. and Mai,A. (2011) Novel Sci. U.S.A., 110, 14894–14899. 3,5-bis(bromohydroxybenzylidene)piperidin-4-ones as 33. Yi,P., Wang,Z., Feng,Q., Pintilie,G.D., Foulds,C.E., Lanz,R.B., coactivator-associated arginine methyltransferase 1 inhibitors: Ludtke,S.J., Schmid,M.F., Chiu,W. and O’Malley,B.W. (2015) enzyme selectivity and cellular activity. J. Med. Chem., 54, 4928–4932. Structure of a biologically active estrogen receptor-coactivator 51. Li,Y., Wen,H., Xi,Y., Tanaka,K., Wang,H., Peng,D., Ren,Y., Jin,Q., complex on DNA. Mol. Cell, 57, 1047–1058. Dent,S.Y., Li,W. et al. (2014) AF9 YEATS domain links histone 34. Meerbrey,K.L., Hu,G., Kessler,J.D., Roarty,K., Li,M.Z., Fang,J.E., acetylation to DOT1L-mediated H3K79 methylation. Cell, 159, Herschkowitz,J.I., Burrows,A.E., Ciccia,A., Sun,T. et al. (2011) The 558–571. pINDUCER lentiviral toolkit for inducible RNA interference in vitro 52. Yang,Y., Lu,Y., Espejo,A., Wu,J., Xu,W., Liang,S. and Bedford,M.T. and in vivo. Proc. Natl. Acad. Sci. U.S.A., 108, 3665–3670. (2010) TDRD3 is an effector molecule for arginine-methylated 35. Herrmann,C.H. and Rice,A.P. (1995) Lentivirus Tat proteins histone marks. Mol. Cell, 40, 1016–1023. specifically associate with a cellular protein kinase, TAK, that 53. Yang,Y., McBride,K.M., Hensley,S., Lu,Y., Chedin,F. and hyperphosphorylates the carboxyl-terminal domain of the large Bedford,M.T. (2014) Arginine methylation facilitates the recruitment subunit of RNA polymerase II: candidate for a Tat cofactor. J. Virol., of TOP3B to chromatin to prevent R loop accumulation. Mol. Cell, 69, 1612–1620. 53, 484–497. 36. Malovannaya,A., Lanz,R.B., Jung,S.Y., Bulynko,Y., Le,N.T., 54. Wu,J. and Xu,W. (2012) Histone H3R17me2a mark recruits human Chan,D.W., Ding,C., Shi,Y., Yucer,N., Krenciute,G. et al. (2011) RNA polymerase-associated factor 1 complex to activate Analysis of the human endogenous coregulator complexome. Cell, transcription. Proc. Natl. Acad. Sci. U.S.A., 109, 5675–5680. 145, 787–799. 55. Archin,N.M., Liberty,A.L., Kashuba,A.D., Choudhary,S.K., Kuruc,J.D., Crooks,A.M., Parker,D.C., Anderson,E.M., Kearney,M.F., Strain,M.C. et al. (2012) Administration of vorinostat 9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 disrupts HIV-1 latency in patients on antiretroviral therapy. Nature, 59. Bartholomeeusen,K., Xiang,Y., Fujinaga,K. and Peterlin,B.M. (2012) 487, 482–485. Bromodomain and extra-terminal (BET) bromodomain inhibition 56. Archin,N.M., Bateson,R., Tripathy,M.K., Crooks,A.M., Yang,K.H., activate transcription via transient release of positive transcription Dahl,N.P., Kearney,M.F., Anderson,E.M., Coffin,J.M., Strain,M.C. elongation factor b (P-TEFb) from 7SK small nuclear et al. (2014) HIV-1 expression within resting CD4+ T cells after ribonucleoprotein. J. Biol. Chem., 287, 36609–36616. multiple doses of vorinostat. J. Infect. Dis., 210, 728–735. 60. Li,Z., Guo,J., Wu,Y. and Zhou,Q. (2013) The BET bromodomain 57. Elliott,J.H., Wightman,F., Solomon,A., Ghneim,K., Ahlers,J., inhibitor JQ1 activates HIV latency through antagonizing Brd4 Cameron,M.J., Smith,M.Z., Spelman,T., McMahon,J., inhibition of Tat-transactivation. Nucleic Acids Res., 41, 277–287. Velayudham,P. et al. (2014) Activation of HIV transcription with 61. Boehm,D., Calvanese,V., Dar,R.D., Xing,S., Schroeder,S., short-course vorinostat in HIV-infected patients on suppressive Martins,L., Aull,K., Li,P.C., Planelles,V., Bradner,J.E. et al. (2013) antiretroviral therapy. PLoS Pathogens, 10, e1004473. BET bromodomain-targeting compounds reactivate HIV from 58. Sogaard,O.S., Graversen,M.E., Leth,S., Olesen,R., Brinkmann,C.R., latency via a Tat-independent mechanism. Cell Cycle, 12, 452–462. Nissen,S.K., Kjaer,A.S., Schleimann,M.H., Denton,P.W., 62. Li,Z., Lu,H. and Zhou,Q. (2016) A minor subset of super elongation Hey-Cunningham,W.J. et al. (2015) The depsipeptide romidepsin complexes plays a predominant role in reversing HIV-1 latency. Mol. reverses HIV-1 latency in vivo. PLoS Pathogens, 11, e1005142. Cell. Biol., 36, 1194–1205. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency

Download PDF
13 pages

Loading next page...
 
/lp/oxford-university-press/crosstalk-between-histone-modifications-indicates-that-inhibition-of-id2Cb2UIRH

References (64)

Publisher
Oxford University Press
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/gkx550
pmid
28637181
Publisher site
See Article on Publisher Site

Abstract

9348–9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 Published online 20 June 2017 doi: 10.1093/nar/gkx550 Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency 1,† 1,† 1 2 3 Zheng Zhang , Bryan C. Nikolai , Leah A. Gates , Sung Yun Jung , Edward B. Siwak , 1,4 3 1 1,* Bin He , Andrew P. Rice , Bert W. O’Malley and Qin Feng 1 2 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA, Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX, USA, Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, TX, USA and Department of Medicine-Hematology & Oncology, Baylor College of Medicine, Houston, TX, USA Received February 06, 2017; Revised May 25, 2017; Editorial Decision June 13, 2017; Accepted June 15, 2017 ABSTRACT INTRODUCTION Human immunodeficiency virus (HIV) is a retrovirus that In eukaryotic cells, the gene expression status causes acquired immunodeficiency syndrome. HIV infec- is strictly controlled by epigenetic modifications tion of CD4+ helper T lymphocytes is a multistep process, on chromatin. The repressive status of chromatin involving fusion and entry through interaction with CD4 re- largely contributes to HIV latency. Studies have ceptor and CCR5 co-receptor, reverse transcription of HIV shown that modification of histone H3K27 acts as viral RNA into double-stranded viral DNA, and integra- a key molecular switch for activation or suppression tion of viral DNA into the host cell genome. Combination of many cellular genes. In this study, we found that Antiretroviral Therapy (cART), also known as highly ac- K27-acetylated histone H3 specifically recruited Su- tive antiretroviral therapy (HAART), employs the use of per Elongation Complex (SEC), the transcriptional three or more antiretroviral drugs to inhibit the key steps of elongation complex essential for HIV-1 long terminal HIV infection, and has been very effective in HIV-infected repeat (LTR)-mediated and general cellular transcrip- patients by suppressing HIV replication and maintaining the virus at undetectable levels. However, although continu- tion. Interestingly, H3K27 acetylation further stim- ous cART is life-prolonging, it never eradicates HIV infec- ulates H3R26 methylation, which subsequently ab- tion or cures this disease. Interruption of treatment quickly rogates the recruitment of SEC, forming a negative results in virus replication and recurrence of the disease feedback regulatory loop. Importantly, by inhibiting (1). Therefore, HIV-infected patients must receive lifelong methyltransferase activity of CARM1, the enzyme re- cART treatment, which presents economic and therapeutic sponsible for H3R26 methylation, HIV-1 transcription burdens. is reactivated in several HIV latency cell models, in- The principal impediment to eradication of HIV infec- cluding a primary resting CD4+ T cell model. When tion is the latent reservoir of HIV provirus. HIV provirus combined with other latency disrupting compounds persists in multiple tissues and cells, particularly the long- such as JQ1 or vorinostat/SAHA, the CARM1 in- lasting, resting CD4+ T cells. Reversing proviral latency is hibitor achieved synergistic effects on HIV-1 activa- believed to be a major challenge for strategies to eradicate HIV from an individual and achieve a functional cure. To tion. This study suggests that coordinated and dy- this end, recently discussed and tested approaches to tar- namic modifications at histone H3K27 and H3R26 or- get latency involve ‘shock and kill’ strategies, which pro- chestrate HIV-1 LTR-mediated transcription, and po- pose to reactivate (‘shock’) latent HIV in the presence of tentially opens a new avenue to disrupt latent HIV-1 cART and apply immune-based therapy to purge (‘kill’) infection by targeting specific epigenetic enzymes. these reservoirs (2,3). Mechanistically, epigenetic transcrip- tional processes drive HIV latency in T cells, as the repres- sive status of chromatin largely contributes to HIV latency (4). In order to reactivate the latent virus, it is essential to To whom correspondence should be addressed. Tel: +1 713 798 6247; Fax: +1 713 790 1275; Email: [email protected] These authors contributed equally to this work as rst fi authors. Present address: Zheng Zhang, Department of Lymphoma and Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX, USA. C The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2017, Vol. 45, No. 16 9349 ‘open’ the repressive structure of chromatin that harbors In this study, the Super Elongation Complex (SEC) was the provirus. For instance, it is generally accepted that hi- identified as an H3K27ac-associated complex based on a stone deacetylases (HDACs) are involved in maintenance peptide pull-down/mass spectrum analysis. Interestingly, of repressive chromatin status on the HIV-1 promoter, and the consequent H3R26 methylation event abrogated SEC restoration of histone acetylation by an HDAC inhibitor recruitment, suggesting that H3K27ac is a positive regu- treatment loosens the repressive chromatin structure and re- lator of HIV transcription, whereas H3R26me is a nega- activates latent HIV (5–7). However, the molecular mecha- tive regulator. Consistent with this observation, a CARM1- nism of how site-specific histone acetylation contributes to specific small molecule inhibitor functions as a potent la- transcriptional reactivation on HIV proviral regulatory se- tency reversing agent (LRA) in both cell line and primary quences remains elusive. CD4+ T cell models of HIV latency. When combined with Lysine 27 (K27) on the histone H3 tail is subject to two other latency disrupting compounds, the CARM1 inhibitor covalent modifications: methylation and acetylation. Tri- achieved synergistic effects on HIV-1 reactivation. methylation of H3K27 (H3K27me3) is a transcriptional repression ‘mark’, and its function has been well docu- MATERIALS AND METHODS mented (8–10). The responsible methyltransferase EZH2 In vitro histone methylation assays (Enhancer of Zeste 2) is an essential component of the PRC2 (Polycomb repressive complex 2), and is involved in The in vitro methylation assays were performed as described silencing many important genes during development and previously (25). Briefly, 100 ng of histone methyltransferase cell differentiation (11–13). Interestingly, EZH2 was found enzymes were incubated with substrates (recombinant his- to participate in silencing HIV-1 by methylation of histones tones or histone peptides) in the presence of 20 mM Tris– located at the HIV-1 LTR region (14). A histone lysine HCl (pH 8.0), 4 mM EDTA, 1 mM phenylmethylsulfonyl methyltransferase (HKMT) inhibitor that targets EZH2, 3- 3 fluoride, 0.5 mM dithiothreitol, and 1 lof[ H]AdoMet deazaneplanocin A, can reactivate silenced proviruses (15). (13.3 Ci/mM; PerkinElmer Life Sciences). The reactions Similarly, GSK343, a specific EZH2 /EZH1 inhibitor, has ◦ were incubated at 30 C for 1 h before the proteins were sep- been reported to sensitize the latent HIV to reactivation ef- arated in a 4–15% SDS-polyacrylamide gel (or 10–20% Tris- fect of the HDAC inhibitor vorinostat (16). Tricine gel for methylation of histone peptides). After fixa- In contrast to H3K27 methylation, acetylation at H3K27 tion in a mixture containing 50% methanol and 10% acetic (H3K27ac) is a key epigenetic mark that correlates with acid for 20 min, the gels were treated with autoradiography gene transcriptional activation (17,18). Because methyla- Amplify reagent (Amersham Biosciences) for 20 min, dried, tion and acetylation occur on the same residue and have op- and exposed to X-ray films. Recombinant EZH2 protein posite functions, it is anticipated that there is an antagonis- complex, wildtype, K27-acetylated, and K27-trimethylated tic switch between methylation and acetylation on H3K27. histone H3 proteins were purchased from Active Motif. Re- Indeed, knockout of EZH2 or Suz12 (another integral com- combinant CARM1 protein was obtained from Millipore, ponent in PRC2) abrogates H3K27me3, and meanwhile and p300 protein was generated from the baculoviral system greatly enhances the level of H3K27ac in mouse ES cells as previously described (33). (19). Similarly, histone deacetylase inhibitors LBH589 and LAQ824 increase histone acetylation levels, and simultane- Plasmid DNA ously decrease H3K27 methylation levels in primary human acute leukemia cells (20). Therefore, it is expected that en- Histone H3 K27M mutant and its corresponding wildtype hancing H3K27ac levels could contribute to re-activation H3 were constructed in a pET16b expression vector. The of silenced HIV provirus. K27M mutation was generated by PCR-based site-directed In this study, we investigated how H3K27 acetylation mutagenesis. The sequences of the PCR primers are: regulates HIV-1 transcription. We found that H3K27ac is 5 GCTACAAAAGCCGCTCGCATGAGTGCGCCC a preferable substrate for H3R26 methylation catalyzed TCTACTGG-3 (forward); 5 -CCAGTAGAGGGCGC by a transcriptional coregulator protein termed CARM1 ACTCATGCGAGCGGCTTTTGTAGC-3 (reverse). (Coactivator-associated arginine methyltransferase 1). Similarly, the pInducer20 lentiviral vector was used to CARM1 belongs to the protein arginine methyltrans- generate expression vectors for wildtype H3 and H3K27M ferase (PRMT) family, and it catalyzes the transfer of (34). pCMV-Flag-Tat was previously generated from Dr methyl groups from S-adenosyl-L-methionine to the guani- Andrew Rice’s laboratory (35). dine nitrogens of arginine, producing asymmetric dimethy- lated arginine (Rme2a) as its final product ( 21,22). As Histone peptides, pull-down and western blot analysis a transcriptional co-regulator, CARM1 methylates multi- ple nuclear proteins involved in gene transcription, includ- Biotinylated histone H3(23-42) peptides (unmodified, ing histone H3, transcriptional coactivators CBP/p300 and K27ac, R26me2a, and R26me2a+K27ac) were purchased SRCs, mediator Med12, RNA pol II, RNA-binding pro- from JPT Peptides Inc. Biotinylated histone H3(18-35) teins PABP1, HuR, and HuD, as well as the splicing factors peptides (unmodified, K27M mutated, and K27M mu- CA150, SAP49, and SmB (23–30). CARM1 methylates hi- tation with R26me2a modification) were synthesized at stone H3 mainly on two sites, R17 and R26, with an ad- Peptide 2.0 Inc. For each pull-down analysis, 0.25 g ditional methylation site R42 that was recently identified of peptide was immobilized onto 25 l Dynabeads 280 (31,32). streptavidin (Life Technology, Inc), followed by addition of 1 mg HeLa nuclear extract and incubated at 4 Cfor 9350 Nucleic Acids Research, 2017, Vol. 45, No. 16 2 h. After binding, the beads were washed three times mented with 10% fetal bovine serum (FBS), penicillin (100 with wash buffer BC150 (20 mM Tris–HCl pH 7.9, 10% IU/ml), and streptomycin (100 g/ml). The 2D10 cell line glycerol, 0.2 mM EDTA, 150 mM KCl) before addition is a gift from Dr Jonathan Karn (Case Western Reserve of 2× SDS sample buffer and loading for SDS-PAGE and University), and the cells were maintained in RPMI 1640 western blot analysis. The antibodies used for western blot medium (without phenol red) supplemented with 10% heat- were: H3R26me2a antibody from Millipore; H3R17me2a inactivated FBS, penicillin (100 IU/ml), streptomycin (100 antibody from Active Motif; ELL, ENL, AF9, CARM1, g/ml) and 25 mM HEPES at 37 Cin5%CO . For NE AFF1 and AFF4 antibodies from Bethyl laboratories; preparation, HeLa S3 cell pellets were obtained from the p300, Cyclin T1 and CDK9 antibodies from Santa Cruz National Cell Culture Center (Minneapolis, MN), and NE biotechnology, Inc; and -actin antibody from Sigma. was prepared following the standard Dignam protocol (37). Mass spectrometry sample preparation and analysis Transient transfection (plasmid and siRNA knockdown) and Following the peptide pull-down assay, streptavidin beads luciferase analysis were washed and then boiled in 30 ul of 1× NUPAGE TransIT LT1 reagent (Mirus Bio LLC) was used to LDS sample buffer (Invitrogen) and subjected to SDS- transfect plasmid DNA to TMZ-bl cells. Lipofectamine PAGE (NuPAGE 10% Bis–Tris Gel, Invitrogen) and visual- RNAiMax transfection reagent (Thermo Fisher Scientific) ized with Coomassie Brilliant blue-stain. The SDS-PAGE wasusedtotransfect siRNA/plasmid DNA to TMZ-bl gel was excised, destained and subject to in-gel digestion cells. CARM1 and control SMARTpool siRNA (Dharma- using 100 ng of trypsin (GenDepot T9600). The tryptic con ON-TARGETplus) were purchased from GE Health- peptides were resuspended in 10 ul of 0.1% formic acid care. Luciferase activity was determined using the Promega and subjected to nanoHPLC–MS/MS system, which con- luciferase assay kit following the manufacturer’s instruc- sists of a nano-LC 1000 system (Thermo Scientific) and a tions (Promega Corp., Madison, WI, USA). LTQ Orbitrap Elite™ (Thermo Scientific) mass spectrom- eter. The peptides were loaded onto a Reprosil-Pur Basic C18 (1.9 m, Dr Maisch GmbH, Germany) pre-column Flow cytometry with a size of 2 cm × 100 m. The pre-column was switched Single cell suspensions were achieved by passage through in-line with an in-housed 50 mm × 150 um analytical col- a 22-gauge syringe before plating at a density of 5 × 10 umn packed with Reprosil-Pur Basic C18 equilibrated in on 24-well plates and treatment with pharmacological com- 0.1% formic acid. The peptides were eluted using a 75-min pounds for 24 h. GFP-expressing cells were quantified using discontinuous gradient of 4–26% acetonitrile/0.1% formic a BD FACSCANTO II and the FACSDIVA software suite acid at a flow rate of 600 nl /min. The eluted peptides were in the Cytometry and Cell Sorting Core at Baylor College directly electro-sprayed into mass spectrometer operated in of Medicine. the data-dependent acquisition mode acquiring fragmenta- tion spectra of the top 50 strongest ions. Obtained MS/MS spectra were parsed against a target-decoy human refseq Chromatin immunoprecipitation (ChIP) assay database in Proteome Discoverer 1.4 (Thermo Fisher) with ChIP assays were performed using the ChIP-IT Express the Mascot algorithm (Mascot 2.4, Matrix Science). The kit (Active Motif) following the manufacturer’s proto- precursor mass tolerance was confined within 20 ppm with a col except for the DNA purification step. We sheared fragment mass tolerance of 0.5 Da and a maximum of four the chromatin to an average size of 300–400 bp by missed cleavage allowed. Dynamic modification of oxida- sonication. The sheared chromatin was incubated with tion (methionine), protein N-terminal acetylation and De- indicated antibodies overnight at 4 C. The QIAquick Streak (cysteine) was allowed. The peptides identified from PCR purification kit was used for DNA purification the Mascot result file were validated with 5% false discovery after reverse-crosslinking of immunoprecipitated DNA. rate (FDR). For relative quantification, the data was then Purified DNA was eluted with 50 l of elution buffer and grouped into gene products and assigned homology and 3 l was used for quantitative PCR analysis using the identification quality groups using an in-house developed SensiFAST SYBR Hi-ROX kit from Bioline. The primers algorithm (36). All protein gene products were required to for amplification of Nucleosome 0 locus (Nuc-0) of LTR have at least one identification where a spectral match pass- are: 5 -TGGATCTACCACACACAAGG-3 (forward); ing <1% FDR and >20 ion score or <5% FDR and >30 5 -GTACTAACTTGAAGCACCATCC-3 (reverse). The ion score thresholds were present in order to be chosen for primer sequences for amplification of Nucleosome 1 locus follow-up in this study. Each gene product amount was esti- (Nuc-1)ofLTR are: 5 -GAGCCTGGGAGCTCTCTG- mated using a label-free intensity-based absolute quantifica- 3 (forward); 5 -GCTAGAGATTTTCCACACTG-3 tion (iBAQ) approach (as the sum of peptide areas normal- (reverse). And the primer sequences for amplification ized to the theoretical tryptic peptide potential) and then of DNase I hypersensitive sequence site (DHS) are: reported as a fraction of total protein iBAQ amount per ex- 5 -TTACACCCTATGAGCCAGCATG-3 (forward); periment (in 10–5 units for visual comprehension). 5 -GCTCTCGGGCCATGTGAC-3 (reverse) (38). The additional antibodies used in ChIP assays are: histone H3 Cell lines and nuclear extract (NE) preparation antibody from Novus; H3K27ac, H3K36me3 and pol II TZM-bl cells were initially obtained from the NIH AIDS pSer2 antibodies from Abcam. The H3R26me2aK27ac Reagent Program, and maintained in DMEM supple- antibody was customized at Pocono Rabbit Farm & Nucleic Acids Research, 2017, Vol. 45, No. 16 9351 Laboratory, Inc. and affinity purified by immobilized teins, and as shown in Figure 1F, the histone H3 extracted antigen. from cells with H3K27M mutation contains much higher level of H3R26me2a, suggesting that the crosstalk between H3K27ac and H3R26me2a exists at the cellular level. Fur- Primary T cell model of CCL19-induced HIV latency thermore, we compared the methylation activity on H3 re- The CCL19 latency model initially developed in Dr. Sharon combinant proteins with different modifications, including Lewin’s laboratory has been described previously (39– unmodified, K27-acetylated or K27-tri-methylated histone 41). Briefly, primary CD4+ T-cells were isolated from H3. H3K27ac appears to be the most preferable substrate, healthy donors using a RosetteSep human CD4+ T cell whereas H3K27me3 is the least favorable (Figure 1G). enrichment kit (StemCell) following the manufacturer’s Based on these results, we conclude that K27-acetylated hi- instructions. The resting CD4+ T cells were then nega- stone H3 is a better substrate for CARM1 methylation, and tively selected using CD30 MicroBeads by MACS sep- acetylation on H3K27 could be a priming event for H3R26 aration (Miltenyi Biotec). These cells were treated with methylation (Figure 1H). CCL19 (R&D Biosystems) for 2 days before SF162 virus infection. Five days after infection, cells were stimu- H3K27 acetylation and H3R26 methylation control the re- lated by CARM1 inhibitor 7g (Millipore) in combina- cruitment of Super Elongation Complex (SEC) tion with SAHA or JQ1. Cells were harvested a day af- ter compound treatment, followed by RNA extract us- Histone modifications exert functional consequences on ing Tri-reagent RT (Molecular Research Center, Inc) and epigenetic gene regulation through recruiting ‘reader’ DNase treatment using Direct-zol RNA purification kit proteins that specifically recognize the modified his- (Zymo Research). The expression of the gag RNA level tone marks. The reader proteins subsequently recruit was measured by RT-qPCR analysis using a sensiFAST additional transcriptional machinery to the target gene SYBR Hi-ROX One-step kit (Bioline). The sequences promoter/enhancer to modulate transcription (46). Al- of the primers are: 5 -GGGACCCAGCCATAAAGC-3 though H3K27ac is consistently correlated with gene ac- (forward); 5 -GCTGAATTTGTTACTTGGCTCA-3 (re- tivation, no specific reader has been identified. In addi- verse). These experiments were performed at the Baylor-UT tion, the role of methylation of H3R26, the residue imme- Houston Center for AIDS Research (CFAR) laboratory. diately adjacent to H3K27, is poorly understood. There- fore we performed peptide pull-down assays followed by RESULTS mass spectrometry analysis using K27-acetylated or R26- methylated H3 peptides as bait to identify specific binding Crosstalk between H3K27ac and H3R26me2a partners, i.e. ‘readers’. These biotinylated peptides were im- Because histone H3K27 acetylation is a key epigenetic mark mobilized on streptavidin beads and incubated with HeLa for active gene transcription, we investigated if this modifi- nuclear extract. Proteins bound to the peptides were pre- cation has any functional crosstalk with histone modifica- cipitated and identified by mass spectrometry. A complete tions on other sites. We first examined the residues in im- list of proteins enriched by each peptide is shown in Table mediate proximity to H3K27. Interestingly, we found that 1. Overall, 117 proteins were enriched on H3K27ac pep- H3R26 methylation, catalyzed by CARM1, was greatly en- tide relative to unmodified H3. In contrast, only 31 pro- hanced when H3K27 was acetylated. This appears to be spe- teins showed enrichment with H3R26me2a peptide. Inter- cific for R26 site, as R17 methylation was not altered (Figure estingly, when we searched for protein complexes that are 1A and B). enriched in H3K27ac peptide pull-down, we found multi- ple key subunits of the SEC. But these subunits were signif- Interestingly, when we aligned the known amino acid sequences of CARM1 methylation sites, only H3R26 and icantly decreased in H3R26me2a peptide pull-down (Figure H3R17 contain a lysine residue at the ‘+1’ position. All 2A). The mass spectrum result was confirmed by a separate other substrates have a neutral or hydrophobic residue (Fig- peptide pull-down followed by Western blot analysis (Fig- ure 1C). A previous study on H3R17 methylation reveals ure 2B and C), and was further validated by a pull-down that the positive charge of lysine side chain at ‘+1’ posi- assay using full-length histone H3 proteins as bait (Figure tion can slow down the process of arginine methylation, 2D). These results indicate that H3K27ac directly recruits and acetylation of this lysine neutralizes the charge and SEC subunits, whereas H3R26 methylation precludes this therefore accelerates the reaction (42). In order to confirm recruitment. whether this occurs on H3R26, we mutated the H3K27 residue to methionine and generated the recombinant H3 CARM1 methyltransferase activity is repressive for HIV-1 protein. The H3K27M mutation mimics the natural me- LTR-mediated transcription thionine residue at ‘+1’ position in SRC-3, CBP and p300 coactivators. Interestingly, H3K27M somatic mutation has Positive transcription elongation complex (P-TEFb), a ma- been found in up to 70% of diffuse intrinsic pontine glioma jor component of the SEC, is composed of kinase CDK9 (DIPG) patients and is a driver mutation for tumorigene- and one of the cyclin subunits, cyclin T1and T2. The CDK9 sis (43–45). With an in vitro methylation assay, we showed and cyclin T1 subunits of P-TEFb are essential for HIV- that the histone H3K27M mutant is preferentially methy- 1 transcription. P-TEFb directly interacts with Tat pro- lated by CARM1 on R26, but not on R17 (Figure 1D tein and viral TAR RNA to stimulate HIV-1 transcrip- and E). We also generated stable cell lines that ectopi- tional elongation (47,48). Therefore, our results suggest that cally express wildtype or K27M mutated histone H3 pro- H3K27ac may enhance HIV-1 transcription by recruiting 9352 Nucleic Acids Research, 2017, Vol. 45, No. 16 A C F H3 ++-- H3K27ac --++ kDa -+-+ CARM1 kDa 3 20 15 H-methyl H3R26me2a 43 100 (%) 6 8( 100%) H3 (Blue stain) H3R17me2 H3K27ac H3K27me3 H3R26me2a 85 100 47 (%) 48 100 (%) H3 H3R17me2 Flag 96 100 (%) H3K27ac H3 kDa 15 H3R26me2a B D E Enzymes kDa H3 (Blue stain) CARM1 100 47 17 (H3R26me2a/H3, %) EZH2 complex kDa Pepde CARM1 p300 5 3 H H-methyl kDa substrates 5( 100%) 15 ac m H3R26me2a 5 3 H-methyl Pepdes 20 K27 7R R R26 26 15 H3R17me2 (Blue stain) Pepdes 20 5 H3 (Blue stain) (Blue stain) Figure 1. Histone H3 with K27 acetylation is a better substrate for CARM1 methylation. (A) In vitro histone methylation assay catalyzed by CARM1. Unmodified and K27-acetylated recombinant histone H3 proteins were used as substrates, and the methylation activity was determined either by tritiu m- labeled assay (top panel), or western blot analysis (bottom panel). The relative intensity of signals was determined by ImageJ. (B) Unmodified and K27- acetylated histone peptides (amino acids 23–42) were used as substrates for tritium-labeled in vitro methylation assay catalyzed by CARM1. (C) A sequence alignment of known CARM1 substrates. The ‘R’ residues in red are CARM1 methylation sites. (D) In vitro methylation assay using wildtype histone H3 or histone H3 with a K27M mutation. The names of the recombinant methyltransferases/acetyltransferase were shown in blue. (E) Unmodified and R26- methylated histone H3 peptides (amino acids 18–35) harboring the K27M mutation were used in a methylation assay catalyzed by CARM1 in vitro.(F) Western blot analysis of histones extracted from 293T cells stably expressing vector, wildtype histone H3, or K27M mutated histone H3. The relative intensity of signals was determined by ImageJ. (G) Histone methylation assay catalyzed by CARM1. Unmodified, K27-acetylated, and K27-trimethylated histone H3 proteins were used as substrates. The total histone proteins were shown by Blue stain reagent, and H3R26me2a level was shown by Western blot analysis. The relative intensity of H3R26me2a was normalized by H3 and shown at the bottom. (H) A cartoon model of H3K27ac-regulated H3R26 methylation. and stabilizing the SEC, Tat and TAR multi-complexes. In LTR-mediated transcription through dissociation of SEC. contrast, the subsequent H3R26 methylation catalyzed by We tested this hypothesis in TZM-bl cells, a HeLa cell HIV- CARM1 may dissociate the SEC and attenuate HIV-1 tran- 1 latency model that contains Tat-inducible HIV LTR-Luc scription. and HIV LTR--galactosidase reporter genes. As shown We performed Chromatin-IP analysis in 2D10 cells, a in Figure 3B, overexpression of wild-type CARM1 sig- latency model with a single proviral insertion of HIV- nificantly reduced Tat-mediated transcriptional activity, d2EGFP in the genome of Jurkat CD4+ T cells (49). When whereas methyltransferase mutants of CARM1 did not. we treated the 2D10 cells with TNF to activate the latent Our results indicate that the intrinsic methyltransferase ac- provirus, we observed a significant increase of H3K27ac tivity of CARM1 indeed suppresses HIV-1 transcription. levels on Nuc-0 and Nuc-1 regions of HIV-1 5 LTR. The In addition, when CARM1 was depleted in TZM-bl cells level of increase is correlated with H3K4me3, another epi- by siRNA, Tat-mediated transcription was moderately in- genetic mark for active transcription, and enrichment of creased (Figure 3C). Transcriptional activity was further in- RNA polymerase II (Figure 3A). This result suggests that creased by the addition of JQ1, suggesting that inhibition H3K27 is acetylated when HIV-1 viral transcription is acti- of CARM1 can work with other LRAs to activate HIV-1 vated. proviral transcription. Based on the mass spectrometry data, we hypothesized that H3R26 methylation is a repressive mark for HIV-1 H3(23-42) H3(23-42)K27ac H-methyl/ Western acetyl blot Western blot H3 H3K27M H3(18-35) H3(18-35)K27M H3(18-35) R26me2aK27M Hydrophobic Hydrophilic Hydrophobic Hydrophilic -neutral -charged H3K27ac Flag-Vector H3 Flag-H3 H3K27me3 Flag-H3 K27M Nucleic Acids Research, 2017, Vol. 45, No. 16 9353 Table 1. A complete list of proteins enriched/reduced on H3K27ac or H3R26me2a peptides Proteins enriched on H3K27ac peptide ACACA DNAJA2 FASN KRT3 NKRF ROR2 RSL1D1 TAF6L AFF1 DOT1L FYTTD1 MAML1 NOP2 RPL10A SCAF11 TBK1 AFF4 DSC1 GEMIN5 MAU2 NR4A1 RPL11 SDC4 TMOD3 ATAD5 DYNC1H1 GPATCH8 MCM3AP NRDE2 RPL13 SEC24B TOP3A ATP6V1B2 EEF2 GPC1 MED13 PDE12 RPL14 SH3GL1 TWISTNB BRCA1 EHMT2 GTPBP4 MED27 PGAM5 RPL15 SLFN5 USP39 CCNT1 EIF2S1 HIST1H1C MEN1 PKP2 RPL18 SLX4 VPRBP CDC42EP1 EIF3B HNRNPLL MLH1 PRKDC RPL21 SMARCA2 VWA9 CDT1 EIF5B HOXA10 MLLT1 PRPF38A RPL27 SMCHD1 WTAP CNOT3 ELAVL1 HPS3 MOV10 PRRC2A RPL27A SNAPC4 YLPM1 CSTF1 ELL2 IRF2BP2 MYBBP1A RAD18 RPL30 SPAG5 ZMYM4 CWF19L2 EPRS KAT7 MYBL2 RBM34 RPL7A STAT3 ZNF318 DDX24 ERBB2IP KHDRBS1 NAT10 RERE RPS19 SUGP2 DDX50 ESRP2 KIAA1429 NCBP1 RFX1 RPS2 SYDE1 DNAJA1 FANCI KPNA1 NDE1 RNF169 RPS25 SYNCRIP Protein enriched on H3R26me2 peptide ACTR8 CTSH IRF2BP2 PDIA3 S100A9 VWA9 APOD DDX20 KRT79 RAD18 SH3GL1 ARFGAP3 DYNC1H1 MAML1 RFX1 SLX4 AZGP1 ELL2 NAT10 RPS25 STAT3 CALML3 FAM83D NR4A1 RUNX2 TMOD3 CSTA HMGB1 PDE12 S100A7 UBN1 CARM1 small-molecule inhibitor 7g is a potential latency- To examine the efficacy of 7g during latency reversal in reversing agent for HIV-1 combination with SAHA and JQ1, we used a model sys- tem that establishes latent HIV-1 infection in resting CD4+ Given that the repressive function of CARM1 depends on T cells treated with the cytokine CCL19 [26]. As shown in its methyltransferase activity, we predicted that a CARM1 Figure 4I, when 7g was used alone, gag mRNA was pro- inhibitor could activate HIV-1 proviral transcription. We duced in a dose-dependent manner. And when 2 Mof7g tested the commercially available CARM1-specific in- was used in combination with SAHA or JQ1, a synergistic hibitor 1-Benzyl-3,5-bis-(3-bromo-4-hydroxybenzylidene) effect was observed, in agreement with the result observed piperidin-4-one (termed 7g) in HIV latency models (Figure in 2D10 cells (Figure 4J). Taken together, our data indicate 4A) (50). At the cellular level, 7g potently inhibits H3R26 that the small-molecule inhibitor of CARM1 7g can induce methylation (Figure 4B). Treatment of TZM-bl cells with activation of latent HIV and therefore has potential as a 7g strongly induced HIV-1 transcriptional output as novel therapeutic agent for shock-and-kill strategies. indicated by luciferase activity. Moreover, the co-treatment of 7g with bromodomain inhibitor JQ1 synergistically increased the transcriptional activity (Figure 4C). Similar CARM1 inhibitor 7g activates expression of latent HIV-1 results were observed in 2D10 cells. Treatment of increasing through promoting transcriptional elongation doses of 7g activates the latent provirus in 2D10 cells in Because of the critical role of the SEC in HIV transcrip- a dose-dependent manner (Figure 4D), and 7g exhibits tional elongation, we sought to examine the roles of hi- a synergistic effect with the HDAC inhibitor SAHA and stone modifications and the recruitment of the SEC on JQ1 (Figure 4E and F), suggesting that both acetyla- the HIV-1 LTR in Jurkat 2D10 cells. Due to the lack of tion and methylation are key regulators of HIV latency. ChIP-grade commercial antibodies for H3R26me2a, we Additionally, the geometric means of GFP-positive cells generated and purified our own rabbit polyclonal antibod- were calculated and exhibited a positive correlation with ies recognizing the dual modification H3R26me2aK27ac. the doses of 7g, indicating that 7g not only increases the The specificity of the antibody was confirmed by the his- number of cells expressing HIV, but also increases the level tone H3 peptide-based dot-blot experiment shown in Fig- of expression at the single cell level. ure 5A, and further validated by western blot analysis us- Because both TZM-bl and 2D10 latency models are ing full-length histone H3 and H3K27ac recombinant pro- based on cancer cell lines, we next sought to determine the teins. Both proteins were methylated by CARM1 protein in effect of 7g in a primary resting T cell model of HIV latency. vitro, but only the methylated H3K27ac protein can be rec- First, we determined the toxicity of 7g in PBMCs by mea- ognized by H3R26me2aK27ac antibody (Figure 5B). Be- suring the cell viability and apoptosis after 7g treatment. cause HDAC inhibitors have been reported as LRAs for As shown in Figure 4G and H, 7g exhibits little toxicity HIV-1 in many studies, we used SAHA in our ChIP anal- when being used at 6.3 M. However, it affects cell viability ysis as a positive control. As shown in Figure 5C, treat- and induces apoptosis at higher concentrations such as 12.5 ment of 2D10 cells with SAHA or 7g did not alter the to- M. Therefore to avoid toxicity, we chose to use 2 Mof tal protein levels of the SEC subunits including Cyclin T1, 7g when combined with other LRAs in primary cells. CDK9, ENL, and AFF4, or the transcriptional coregulator 9354 Nucleic Acids Research, 2017, Vol. 45, No. 16 Figure 2. Super Elongation Complex (SEC) are H3K27ac ‘readers’. (A) Key components of SEC were highly enriched on H3K27ac peptide by pull-down analysis. The fold changes over unmodified histone H3 peptide are shown as red (enriched) or blue (reduced). A complete list of all proteins identified by mass spectrometry is shown in Table 1.(B) Peptide pull-down followed by silver stain. (C) Peptide pull-down followed by Western blot analysis to confirm the mass spectrum results in (A). The peptides shown on the bottom were in proportion to the amount of peptides used in the pull-down. ( D) Immunoprecipitation (IP) of SEC subunits from HeLa nuclear extract by recombinant full-length histone H3 proteins (unmodified or K27-acetylated). Histone H3 antibody and protein G beads were added to the IP samples following 2 h of incubation. The mock sample contains all the reagents except for recombinant histone H3. The amount of histones used in the IP was shown by Blue stain. proteins p300 and CARM1. The ChIP assay showed that tion by promoting transcriptional elongation. It is worth H3K27ac was significantly increased on HIV-1 LTR when noting that the recruitment of p300 was elevated in 7g- the cells were treated with SAHA, despite the fact that the treated cells, in agreement with our previous observation levels of total histones were reduced (Figure 5D). Consis- that CARM1 methyltransferase activity is critical to disso- tent with our biochemical observations that H3K27 acety- ciate the p300/SRC-3/CARM1 coactivator complex (25). lation functions as a priming event for H3R26 methylation, we observed that the levels of H3R26me2aK27ac increased DISCUSSION in SAHA treated samples by ChIP, but not in 7g-treated cells, suggesting that endogenous H3R26 methylation on Gene transcription in eukaryotic cells is a complex process HIV-1 LTR depends on CARM1 methyltransferase activity. involving recruitment of multiple transcriptional machiner- Consistently, the recruitment of CylcinT1 and AFF4 was ies. These enzymatic activities/complexes are recruited to greatly enhanced in both SAHA and 7g-treated cells, and the chromatin in a sequential order to modify chromatin consequently promoted the transcriptional elongation ex- structure and facilitate transcriptional initiation and elon- hibited by the increase of Ser2-phosphorylated RNA poly- gation. However, how these processes are coordinated is merase II (Figure 5D). We also observed that 7g treat- largely unknown. In our current study, we demonstrate ment enriched H3K36me3, a histone modification mark that crosstalk occurs between histone H3K27 acetylation for transcriptional elongation, further supporting our con- and H3R26 methylation. Importantly, the change of his- clusion that 7g activates HIV-1 LTR mediated transcrip- tone modifications on K27 and R26 determines the recruit- Nucleic Acids Research, 2017, Vol. 45, No. 16 9355 TSS Nuc-0 Nuc-1 5’ DHS 3’ U3 R U5 HIV-1 5’ LTR IgG H3K27ac H3K4me3 RNA pol II 15 40 7.5 30 * 10 5 5 2.5 TNFα - TNFα + 0 0 0 0 B C CARM1 mRNA HA (CARM1) 2 H3R26me2a 1.5 H3 NS NS 0.5 20000 0 siCtrl RLU RLU siCARM1 - Tat + Tat - Tat + Tat Figure 3. CARM1 methyltransferase activity is repressive for HIV-1 LTR-mediated transcription. (A) Chromatin IP on HIV-1 LTR in 2D10 cells treated with or without TNF for 2 h. The experiment has been repeated two times and the most representative results were shown. *P < 0.05 determined by two-tailed t-test with duplicated ChIP samples per treatment. The error bars were shown as standard error of mean (SEM). DHS: DNase I hypersensitive site. (B) Wildtype or CARM1 methyltransferase-dead mutants Y154R and Y154A were transfected in TZM-bl cells in the absence or presence of Tat, and the relative luciferase activity was measured two days after transfection. Western blot analysis showed the expression levels of CARM1 proteins and H3R26me2a. *P < 0.05 determined by two-tailed t-test. NS, not significant. All transfections were in quadruplicates, and the error bars were shown as SEM. (C) TZM-bl cells were transfected with Tat expressing vector and siRNA for 24 h, followed by treatment of DMSO, JQ1 (0.5 M), or SAHA (0.5 M) for another 24 hours before harvesting cells for luciferase assay. RT-qPCR analysis showed the knockdown efficiency of CARM1 siRNA in TZM-bl cells. *P < 0.05 determined by two-tailed t-test. The experiment was performed in duplicates. The error bars were shown as SEM. ment and dissociation of the SEC protein complex on the AF9/ENL or other component recognizes H3K27ac and HIV-1 LTR. Based on our findings, we propose a work- bring the SEC to the HIV-1 promoter. ing hypothesis as shown in Figure 6. H3K27ac is an active CARM1 has been shown to function as both a transcrip- mark for HIV-1 transcription. SEC interacts and is stabi- tional activator and an attenuator in a context-dependent lized by H3K27ac on HIV-1 LTR, and the recruitment of manner. CARM1 methylates diverse substrates including SEC is essential for HIV-1 transcriptional elongation. Sub- histone H3, RNA binding proteins, transcription factors, sequently, H3K27ac induces CARM1-dependent H3R26 and coactivators. H3R17 is a major CARM1 methylation methylation, resulting in dissociation of SEC and attenu- site on histone, and this modification promotes transcrip- ation of HIV-1 transcription. An interesting question that tional elongation through recruiting TDRD3 and TOP3B arises here is which component of the SEC is the ‘reader’ for to prevent R loop accumulation and/or recruiting PAF1c H3K27ac. AF9 and ENL, the YEATS domain containing (52–54). On the other hand, we and others have shown proteins, have been previously reported as H3K9ac read- that CARM1 can methylate the SRC family of coactivators ers. They can also recognize H3K27ac and H3K18ac but and subsequently attenuate gene transcription by dissocia- with lower affinity ( 51). It remains to be determined whether tion of coactivator complex and degradation of SRC-3 pro- tein (25,27). Our current study reveals an additional mech- % of Input Nuc-0 vector vector WT CARM1-WT DHS Y154R CARM1-Y154R Y154A Nuc-1 CARM1-Y154A vector CARM1-WT Nuc-0 CARM1-Y154R DHS CARM1-Y154A Nuc-1 Nuc-0 DHS DMSO Nuc-1 JQ1 SAHA Nuc-0 DMSO DHS JQ1 Nuc-1 SAHA 9356 Nucleic Acids Research, 2017, Vol. 45, No. 16 Figure 4. The CARM1 inhibitor 7g strongly induces HIV-1 transcription in latent cell models. (A) Chemical structure of 1-Benzyl-3,5-bis-(3-bromo-4- hydroxybenzylidene) piperidin-4-one, the CARM1 inhibitor 7g. (B) 293T cells were treated with 7g for 24 h and Western blot analysis was performed. (C) TZM-bl cells were first transfected with a Tat expressing vector, and then treated with 7g (5 M) with or without the bromodomain inhibitor JQ1 (0.1 or 1 M). Luciferase assay was performed after 24 h of drug treatment. *P < 0.05 determined by two-tailed t-test. The experiment was performed in duplicates, and error bars were shown as standard deviation (SD). (D) 2D10 cells were treated with increasing doses of 7g for 16 h and GFP level was determined by FACS analysis. Each treatment was duplicated and averages were shown. Error bars were shown as SD. (E) 2D10 cells were treated with different doses of 7g and SAHA for 16 h followed by FACS analysis to measure the GFP level. The percentage of activated cells and their geometric mean (GEO) were both shown. The GEO Mean was calculated specifically for GFP+ cells, and was done by gating GFP+ cells and displaying the geometric mean from that gate. (F) 2D10 cells were treated with different doses of 7g and JQ1 for 16 h followed by FACS analysis to measure the GFP level. (G) PBMCs were treated with various concentrations of 7g for 3 days, and the cell viability was determined by CellTiter-Glo luminescent assay. The experiment was performed in triplicates, and error bars were shown as SD. (H) PBMCs were treated with various concentrations of 7g for 24 h, and the levels of full-length (fl) PARP-1 and cleaved form of PARP-1 were determined by Western blot analysis. (I) CCL19-treated primary resting CD4+ T cells were infected by SF162 virus. Five days after infection, cells with latent HIV-1 were stimulated by increasing doses of 7g. The mRNA level of gag was measured by RT-qPCR to determine the activity of 7g on HIV-1 activation at the transcriptional level. The assay was performed in triplicates and SEM was shown. *P < 0.05 determined by two-tailed t-test in comparison with DMSO-treated sample. (J) Evaluation of 7g with a combinatory treatment of SAHA and JQ1 using CCL19 primary T cell model. 7g, 2 M; SAHA, 0.5 M; JQ1, 0.5 M. The assay was performed in triplicates and SEM was shown. *P < 0.05. anism by which CARM1 suppresses transcription through methylate H3R17, suggesting a putative mechanism of reg- H3R26 methylation. It is postulated that at the early stage ulating the CARM1 substrate selectivity (42). of gene transcription, CARM1 preferentially methylates Recently, several HDAC inhibitors have been tested as those substrates that are important for transcriptional ac- LRAs in clinical trials, but the results were not very en- tivation; whereas after transcription is completed, CARM1 couraging. The size of the latent HIV-1 reservoir was not changes substrates and plays repressive role on transcrip- changed by these interventions despite an increase of HIV- tion, facilitating the turn-off stage of transcriptional cycle. 1 transcription (55–58). This outcome suggests that more It remains to be determined how the substrate selectivity of effective immune response is needed for eradiation of re- CARM1 is precisely regulated during transcription. It has activated virus; and probably more likely, short-term treat- been reported that the full-length of CARM1 protein (aa 1– ment with a single LRA may not be potent enough to acti- 585) is required for H3R26 methylation, whereas the mini- vate much latent provirus. Therefore, combination of two or mal methyltransferase domain (aa 147–490) is sufficient to more LRAs, especially LRAs with different targeting mech- Nucleic Acids Research, 2017, Vol. 45, No. 16 9357 Figure 5. The CARM1 inhibitor 7g promotes transcriptional elongation by increasing the recruitment of SEC subunits on HIV-1 LTR. (A) Immuno-dot- blot assay to determine the specificity of the antibody. Various amounts of histone H3.1 (aa 23–42) peptides with /without methylated R26 or acetylated K27 were blotted on nitrocellulose membrane followed by western blot analysis. The H3R26me2aK27ac antibody was affinity-purified and used at 0.2 g/ml. (B) Western blot assay to further determine the specificity of H3R26me2aK27ac antibody. Recombinant histone H3 and H3K27ac proteins were pre-methylated by CARM1 protein in vitro before being analyzed by Western blot analysis. PVDF membrane was used for protein transfer. (C) Western blot analysis to determine the protein levels of SEC subunits and histone modification enzymes in 2D10 cells treated with DMSO, 0.5 M of SAHA, or 5 M of 7g. Cells were treated for 24 h before harvest. (D) ChIP-qPCR analysis of histone modifications and the recruitment of transcriptional coregulators on HIV-1 LTR. The PCR primers amplified the DNA sequence on Nucleosome 1 (Nuc-1). 2D10 cells were treated with DMSO, 0.5 M of SAHA, or 5 M of 7g for 24 h before fixation for ChIP. The assay was performed in duplicates and SEM was shown. * P < 0.05 determined by two-tailed t-test in comparison with DMSO treated samples. anisms, will likely be needed to achieve a better clinical re- suppressive epigenetic marks would synergistically activate sponse. Indeed, a previous study showed that using a com- HIV transcription. bination of EZH2 inhibitors and HDAC inhibitors led to a Treatment with HDAC inhibitors increases total his- synergistic activation of latent virus in comparison to single tone acetylation levels, which generally facilitate transcrip- treatments (16). In this study, we aimed to identify addi- tional initiation and elongation. The BET inhibitor JQ1 tional epigenetic enzymes that control HIV gene transcrip- frees the limited amount of P-TEFb used by host tran- tion, with an anticipation that selectively targeting multiple scription factor-mediated transcription by inhibition of 9358 Nucleic Acids Research, 2017, Vol. 45, No. 16 P30 CA125123, S10 RR024574]. Funding for open access charge: NIH [R21AI122418]. Conflict of interest statement. None declared. REFERENCES 1. Chun,T.W., Davey,R.T. Jr, Engel,D., Lane,H.C. and Fauci,A.S. (1999) Re-emergence of HIV after stopping therapy. Nature, 401, 874–875. 2. Deeks,S.G. (2012) HIV: shock and kill. Nature, 487, 439–440. 3. Savarino,A., Mai,A., Norelli,S., El Daker,S., Valente,S., Rotili,D., Altucci,L., Palamara,A.T. and Garaci,E. (2009) “Shock and kill” effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence. Retrovirology, 6, 4. Lusic,M. and Giacca,M. (2015) Regulation of HIV-1 latency by chromatin structure and nuclear architecture. J. Mol. Biol., 427, 688–694. 5. Archin,N.M., Espeseth,A., Parker,D., Cheema,M., Hazuda,D. and Margolis,D.M. (2009) Expression of latent HIV induced by the potent HDAC inhibitor suberoylanilide hydroxamic acid. AIDS Res. Hum. Retroviruses, 25, 207–212. 6. Wightman,F., Ellenberg,P., Churchill,M. and Lewin,S.R. (2012) HDAC inhibitors in HIV. Immunol. Cell Biol., 90, 47–54. Figure 6. Working model. Histone H3 K27 acetylation (H3K27ac) is an 7. Wei,D.G., Chiang,V., Fyne,E., Balakrishnan,M., Barnes,T., epigenetic mark that recruits SEC to HIV-1 LTR. K27ac also promotes Graupe,M., Hesselgesser,J., Irrinki,A., Murry,J.P., Stepan,G. et al. R26 methylation (H3R26me2a) catalyzed by CARM1, which subsequently (2014) Histone deacetylase inhibitor romidepsin induces HIV causes dissociation of SEC and attenuation of transcription, resulting in a expression in CD4 T cells from patients on suppressive antiretroviral negative feedback regulatory loop. therapy at concentrations achieved by clinical dosing. PLoS Pathogens, 10, e1004071. 8. Boyer,L.A., Plath,K., Zeitlinger,J., Brambrink,T., Medeiros,L.A., BRD4, meanwhile relieving the direct suppression function Lee,T.I., Levine,S.S., Wernig,M., Tajonar,A., Ray,M.K. et al. (2006) of BRD2 and ultimately facilitating the elongation pro- Polycomb complexes repress developmental regulators in murine cess (59–61). In contrast to these known LRAs, CARM1 embryonic stem cells. Nature, 441, 349–353. 9. Lee,T.I., Jenner,R.G., Boyer,L.A., Guenther,M.G., Levine,S.S., inhibitor functions through a completely different mecha- Kumar,R.M., Chevalier,B., Johnstone,S.E., Cole,M.F., Isono,K. nism. It limits histone methylation at H3R26, therefore in- et al. (2006) Control of developmental regulators by Polycomb in creasing the enrichment of SEC for HIV-1 transcription. human embryonic stem cells. Cell, 125, 301–313. It was reported that the subunits of SEC, including ELL2, 10. Francis,N.J., Kingston,R.E. and Woodcock,C.L. (2004) Chromatin compaction by a polycomb group protein complex. Science, 306, AFF1, or AFF4, facilitate the activation of latent HIV-1 1574–1577. in Jurkat/2D10 cells (62), indicating that up-regulation of 11. Vire,E., Brenner,C., Deplus,R., Blanchon,L., Fraga,M., Didelot,C., transcriptional elongation is an efficient strategy to reverse Morey,L., Van Eynde,A., Bernard,D., Vanderwinden,J.M. et al. HIV-1 latency, and that a combination of therapeutic ap- (2006) The Polycomb group protein EZH2 directly controls DNA proaches at multiple steps of HIV transcription will syn- methylation. Nature, 439, 871–874. 12. Richter,G.H., Plehm,S., Fasan,A., Rossler,S., Unland,R., ergistically activate HIV-1 RNA production. Indeed, treat- Bennani-Baiti,I.M., Hotfilder,M., Lowel,D., von Luettichau,I., ment with a CARM1 inhibitor synergizes with SAHA and Mossbrugger,I. et al. (2009) EZH2 is a mediator of EWS/FLI1 JQ1 to increase HIV transcription. In summary, our results driven tumor growth and metastasis blocking endothelial and reveal a crosstalk between histone modifications, and sug- neuro-ectodermal differentiation. Proc. Natl. Acad. Sci. U.S.A., 106, 5324–5329. gest a novel epigenomic approach for activation of latent 13. Hunkapiller,J., Shen,Y., Diaz,A., Cagney,G., McCleary,D., HIV-1. Ramalho-Santos,M., Krogan,N., Ren,B., Song,J.S. and Reiter,J.F. (2012) Polycomb-like 3 promotes polycomb repressive complex 2 binding to CpG islands and embryonic stem cell self-renewal. PLoS ACKNOWLEDGEMENTS Genet., 8, e1002576. 14. Matsuda,Y., Kobayashi-Ishihara,M., Fujikawa,D., Ishida,T., We thank Drs Ming-Jer Tsai, Sophia Tsai, Roberto Arduino Watanabe,T. and Yamagishi,M. (2015) Epigenetic heterogeneity in and Donghang Cheng for their helpful discussion. HIV-1 latency establishment. Sci. Rep., 5, 7701. 15. Friedman,J., Cho,W.K., Chu,C.K., Keedy,K.S., Archin,N.M., Margolis,D.M. and Karn,J. (2011) Epigenetic silencing of HIV-1 by FUNDING the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J. Virol., 85, 9078–9089. Creative and Novel Ideas in HIV Research (CNIHR) pro- 16. Tripathy,M.K., McManamy,M.E., Burch,B.D., Archin,N.M. and gram from National Institutes of Health (NIH) (to Q.F.); Margolis,D.M. (2015) H3K27 demethylation at the proviral promoter sensitizes latent HIV to the effects of vorinostat in ex vivo cultures of NIH [R21AI122418 to Q.F.]; Cancer Prevention Research resting CD4+ T cells. J. Virol., 89, 8392–8405. Institute of Texas (CPRIT) [RP110784 to B.H.]; Ameri- 17. Kimura,H. (2013) Histone modifications for human epigenome can Cancer Society [RSG-13-061-01 to B.H.]; Baylor Col- analysis. J. Hum. Genet., 58, 439–445. lege of Medicine: the CFAR core [NIH P30 AI036211]; 18. Wang,Z., Zang,C., Rosenfeld,J.A., Schones,D.E., Barski,A., Cytometry and Cell Sorting Core [NIH P30 AI036211, Cuddapah,S., Cui,K., Roh,T.Y., Peng,W., Zhang,M.Q. et al. (2008) Nucleic Acids Research, 2017, Vol. 45, No. 16 9359 Combinatorial patterns of histone acetylations and methylations in 37. Dignam,J.D., Lebovitz,R.M. and Roeder,R.G. (1983) Accurate the human genome. Nat. Genet., 40, 897–903. transcription initiation by RNA polymerase II in a soluble extract 19. Pasini,D., Malatesta,M., Jung,H.R., Walfridsson,J., Willer,A., from isolated mammalian nuclei. Nucleic Acids Res., 11, 1475–1489. Olsson,L., Skotte,J., Wutz,A., Porse,B., Jensen,O.N. et al. (2010) 38. Rafati,H., Parra,M., Hakre,S., Moshkin,Y., Verdin,E. and Characterization of an antagonistic switch between histone H3 lysine Mahmoudi,T. (2011) Repressive LTR nucleosome positioning by the 27 methylation and acetylation in the transcriptional regulation of BAF complex is required for HIV latency. PLoS Biol., 9, e1001206. Polycomb group target genes. Nucleic Acids Res., 38, 4958–4969. 39. Cameron,P.U., Saleh,S., Sallmann,G., Solomon,A., Wightman,F., 20. Fiskus,W., Pranpat,M., Balasis,M., Herger,B., Rao,R., Evans,V.A., Boucher,G., Haddad,E.K., Sekaly,R.P., Harman,A.N. Chinnaiyan,A., Atadja,P. and Bhalla,K. (2006) Histone deacetylase et al. (2010) Establishment of HIV-1 latency in resting CD4+ T cells inhibitors deplete enhancer of zeste 2 and associated polycomb depends on chemokine-induced changes in the actin cytoskeleton. repressive complex 2 proteins in human acute leukemia cells. Mol. Proc. Natl. Acad. Sci. U.S.A., 107, 16934–16939. Cancer Ther., 5, 3096–3104. 40. Saleh,S., Solomon,A., Wightman,F., Xhilaga,M., Cameron,P.U. and 21. Chen,D., Huang,S.M. and Stallcup,M.R. (2000) Synergistic, p160 Lewin,S.R. (2007) CCR7 ligands CCL19 and CCL21 increase coactivator-dependent enhancement of estrogen receptor function by permissiveness of resting memory CD4+ T cells to HIV-1 infection: a CARM1 and p300. J. Biol. Chem., 275, 40810–40816. novel model of HIV-1 latency. Blood, 110, 4161–4164. 22. Ma,H., Baumann,C.T., Li,H., Strahl,B.D., Rice,R., Jelinek,M.A., 41. Saleh,S., Wightman,F., Ramanayake,S., Alexander,M., Kumar,N., Aswad,D.W., Allis,C.D., Hager,G.L. and Stallcup,M.R. (2001) Khoury,G., Pereira,C., Purcell,D., Cameron,P.U. and Lewin,S.R. Hormone-dependent, CARM1-directed, arginine-specific (2011) Expression and reactivation of HIV in a chemokine induced methylation of histone H3 on a steroid-regulated promoter. Curr. model of HIV latency in primary resting CD4+ T cells. Retrovirology, Biol.: CB, 11, 1981–1985. 8, 80. 23. Cheng,D., Cote,J., Shaaban,S. and Bedford,M.T. (2007) The arginine 42. Yue,W.W., Hassler,M., Roe,S.M., Thompson-Vale,V. and Pearl,L.H. methyltransferase CARM1 regulates the coupling of transcription (2007) Insights into histone code syntax from structural and and mRNA processing. Mol. Cell, 25, 71–83. biochemical studies of CARM1 methyltransferase. EMBO J., 26, 24. Daujat,S., Bauer,U.M., Shah,V., Turner,B., Berger,S. and 4402–4412. Kouzarides,T. (2002) Crosstalk between CARM1 methylation and 43. Wu,G., Broniscer,A., McEachron,T.A., Lu,C., Paugh,B.S., CBP acetylation on histone H3. Curr. Biol.: CB, 12, 2090–2097. Becksfort,J., Qu,C., Ding,L., Huether,R., Parker,M. et al. (2012) 25. Feng,Q., Yi,P., Wong,J. and O’Malley,B.W. (2006) Signaling within a Somatic histone H3 alterations in pediatric diffuse intrinsic pontine coactivator complex: methylation of SRC-3/AIB1 is a molecular gliomas and non-brainstem glioblastomas. Nat. Genet., 44, 251–253. switch for complex disassembly. Mol. Cell. Biol., 26, 7846–7857. 44. Khuong-Quang,D.A., Buczkowicz,P., Rakopoulos,P., Liu,X.Y., 26. Fujiwara,T., Mori,Y., Chu,D.L., Koyama,Y., Miyata,S., Tanaka,H., Fontebasso,A.M., Bouffet,E., Bartels,U., Albrecht,S., Yachi,K., Kubo,T., Yoshikawa,H. and Tohyama,M. (2006) CARM1 Schwartzentruber,J., Letourneau,L. et al. (2012) K27M mutation in regulates proliferation of PC12 cells by methylating HuD. Mol. Cell. histone H3.3 defines clinically and biologically distinct subgroups of Biol., 26, 2273–2285. pediatric diffuse intrinsic pontine gliomas. Acta Neuropathol., 124, 27. Naeem,H., Cheng,D., Zhao,Q., Underhill,C., Tini,M., Bedford,M.T. 439–447. and Torchia,J. (2007) The activity and stability of the transcriptional 45. Bender,S., Tang,Y., Lindroth,A.M., Hovestadt,V., Jones,D.T., coactivator p/CIP/SRC-3 are regulated by CARM1-dependent Kool,M., Zapatka,M., Northcott,P.A., Sturm,D., Wang,W. et al. methylation. Mol. Cell. Biol., 27, 120–134. (2013) Reduced H3K27me3 and DNA hypomethylation are major 28. Sims,R.J. 3rd, Rojas,L.A., Beck,D., Bonasio,R., Schuller,R., drivers of gene expression in K27M mutant pediatric high-grade Drury,W.J. 3rd, Eick,D. and Reinberg,D. (2011) The C-terminal gliomas. Cancer Cell, 24, 660–672. domain of RNA polymerase II is modified by site-specific 46. Butler,J.S. and Dent,S.Y. (2013) The role of chromatin modifiers in methylation. Science, 332, 99–103. normal and malignant hematopoiesis. Blood, 121, 3076–3084. 29. Wei,Y., Horng,J.C., Vendel,A.C., Raleigh,D.P. and Lumb,K.J. (2003) 47. Tahirov,T.H., Babayeva,N.D., Varzavand,K., Cooper,J.J., Sedore,S.C. Contribution to stability and folding of a buried polar residue at the and Price,D.H. (2010) Crystal structure of HIV-1 Tat complexed with CARM1 methylation site of the KIX domain of CBP. Biochemistry, human P-TEFb. Nature, 465, 747–751. 42, 7044–7049. 48. Ott,M., Geyer,M. and Zhou,Q. (2011) The control of HIV 30. Wang,L., Zeng,H., Wang,Q., Zhao,Z., Boyer,T.G., Bian,X. and transcription: keeping RNA polymerase II on track. Cell Host Xu,W. (2015) MED12 methylation by CARM1 sensitizes human Microbe, 10, 426–435. breast cancer cells to chemotherapy drugs. Sci. Adv., 1, e1500463. 49. Pearson,R., Kim,Y.K., Hokello,J., Lassen,K., Friedman,J., Tyagi,M. 31. Bauer,U.M., Daujat,S., Nielsen,S.J., Nightingale,K. and and Karn,J. (2008) Epigenetic silencing of human immunodeficiency Kouzarides,T. (2002) Methylation at arginine 17 of histone H3 is virus (HIV) transcription by formation of restrictive chromatin linked to gene activation. EMBO Rep., 3, 39–44. structures at the viral long terminal repeat drives the progressive entry 32. Casadio,F., Lu,X., Pollock,S.B., LeRoy,G., Garcia,B.A., Muir,T.W., of HIV into latency. J. Virol., 82, 12291–12303. Roeder,R.G. and Allis,C.D. (2013) H3R42me2a is a histone 50. Cheng,D., Valente,S., Castellano,S., Sbardella,G., Di Santo,R., modification with positive transcriptional effects. Proc. Natl. Acad. Costi,R., Bedford,M.T. and Mai,A. (2011) Novel Sci. U.S.A., 110, 14894–14899. 3,5-bis(bromohydroxybenzylidene)piperidin-4-ones as 33. Yi,P., Wang,Z., Feng,Q., Pintilie,G.D., Foulds,C.E., Lanz,R.B., coactivator-associated arginine methyltransferase 1 inhibitors: Ludtke,S.J., Schmid,M.F., Chiu,W. and O’Malley,B.W. (2015) enzyme selectivity and cellular activity. J. Med. Chem., 54, 4928–4932. Structure of a biologically active estrogen receptor-coactivator 51. Li,Y., Wen,H., Xi,Y., Tanaka,K., Wang,H., Peng,D., Ren,Y., Jin,Q., complex on DNA. Mol. Cell, 57, 1047–1058. Dent,S.Y., Li,W. et al. (2014) AF9 YEATS domain links histone 34. Meerbrey,K.L., Hu,G., Kessler,J.D., Roarty,K., Li,M.Z., Fang,J.E., acetylation to DOT1L-mediated H3K79 methylation. Cell, 159, Herschkowitz,J.I., Burrows,A.E., Ciccia,A., Sun,T. et al. (2011) The 558–571. pINDUCER lentiviral toolkit for inducible RNA interference in vitro 52. Yang,Y., Lu,Y., Espejo,A., Wu,J., Xu,W., Liang,S. and Bedford,M.T. and in vivo. Proc. Natl. Acad. Sci. U.S.A., 108, 3665–3670. (2010) TDRD3 is an effector molecule for arginine-methylated 35. Herrmann,C.H. and Rice,A.P. (1995) Lentivirus Tat proteins histone marks. Mol. Cell, 40, 1016–1023. specifically associate with a cellular protein kinase, TAK, that 53. Yang,Y., McBride,K.M., Hensley,S., Lu,Y., Chedin,F. and hyperphosphorylates the carboxyl-terminal domain of the large Bedford,M.T. (2014) Arginine methylation facilitates the recruitment subunit of RNA polymerase II: candidate for a Tat cofactor. J. Virol., of TOP3B to chromatin to prevent R loop accumulation. Mol. Cell, 69, 1612–1620. 53, 484–497. 36. Malovannaya,A., Lanz,R.B., Jung,S.Y., Bulynko,Y., Le,N.T., 54. Wu,J. and Xu,W. (2012) Histone H3R17me2a mark recruits human Chan,D.W., Ding,C., Shi,Y., Yucer,N., Krenciute,G. et al. (2011) RNA polymerase-associated factor 1 complex to activate Analysis of the human endogenous coregulator complexome. Cell, transcription. Proc. Natl. Acad. Sci. U.S.A., 109, 5675–5680. 145, 787–799. 55. Archin,N.M., Liberty,A.L., Kashuba,A.D., Choudhary,S.K., Kuruc,J.D., Crooks,A.M., Parker,D.C., Anderson,E.M., Kearney,M.F., Strain,M.C. et al. (2012) Administration of vorinostat 9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 disrupts HIV-1 latency in patients on antiretroviral therapy. Nature, 59. Bartholomeeusen,K., Xiang,Y., Fujinaga,K. and Peterlin,B.M. (2012) 487, 482–485. Bromodomain and extra-terminal (BET) bromodomain inhibition 56. Archin,N.M., Bateson,R., Tripathy,M.K., Crooks,A.M., Yang,K.H., activate transcription via transient release of positive transcription Dahl,N.P., Kearney,M.F., Anderson,E.M., Coffin,J.M., Strain,M.C. elongation factor b (P-TEFb) from 7SK small nuclear et al. (2014) HIV-1 expression within resting CD4+ T cells after ribonucleoprotein. J. Biol. Chem., 287, 36609–36616. multiple doses of vorinostat. J. Infect. Dis., 210, 728–735. 60. Li,Z., Guo,J., Wu,Y. and Zhou,Q. (2013) The BET bromodomain 57. Elliott,J.H., Wightman,F., Solomon,A., Ghneim,K., Ahlers,J., inhibitor JQ1 activates HIV latency through antagonizing Brd4 Cameron,M.J., Smith,M.Z., Spelman,T., McMahon,J., inhibition of Tat-transactivation. Nucleic Acids Res., 41, 277–287. Velayudham,P. et al. (2014) Activation of HIV transcription with 61. Boehm,D., Calvanese,V., Dar,R.D., Xing,S., Schroeder,S., short-course vorinostat in HIV-infected patients on suppressive Martins,L., Aull,K., Li,P.C., Planelles,V., Bradner,J.E. et al. (2013) antiretroviral therapy. PLoS Pathogens, 10, e1004473. BET bromodomain-targeting compounds reactivate HIV from 58. Sogaard,O.S., Graversen,M.E., Leth,S., Olesen,R., Brinkmann,C.R., latency via a Tat-independent mechanism. Cell Cycle, 12, 452–462. Nissen,S.K., Kjaer,A.S., Schleimann,M.H., Denton,P.W., 62. Li,Z., Lu,H. and Zhou,Q. (2016) A minor subset of super elongation Hey-Cunningham,W.J. et al. (2015) The depsipeptide romidepsin complexes plays a predominant role in reversing HIV-1 latency. Mol. reverses HIV-1 latency in vivo. PLoS Pathogens, 11, e1005142. Cell. Biol., 36, 1194–1205.

Journal

Nucleic Acids Research – Oxford University Press

Published: Sep 19, 2017

There are no references for this article.