Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The splicing of U12‐type introns can be a rate‐limiting step in gene expression

The splicing of U12‐type introns can be a rate‐limiting step in gene expression The EMBO Journal Vol. 21 No. 14 pp. 3804-3815, 2002 The splicing of U 12-type introns can be a rate-limiting step in gene expression class introns, mutation to GU-AG termini does not Abhijit A.Patel, Matthew McCarthy and interfere with splicing via the Ul2-dependent pathway Joan A.Steitz (Dietrich et al., 1997). In fact, surveys of genomic Department of Molecular Biophysics and Biochemistry, databases have shown that the majority of naturally Howard Hughes Medical Institute, Yale University School of occurring Ul2-type introns possess GU-AG termini Medicine, New Haven, CT 06536, USA (Sharp and Burge, 1997; Burge et al., 1998). Corresponding author Examples of U12-type introns are found in virtually all e-mail: [email protected] metazoan taxa, including vertebrates, insects, plants and cnidarians, but are absent from Caenorhabditis elegans, Some protein-coding genes in metazoan genomes con­ Saccharomyces cerevisiae, Schizasaccharomyces pombe tain a minor class of introns that are excised by a dis­ and protists (Burge et al., 1998). A total of 60 non­ tinct, low-abundance spliceosome. We have developed redundant Ul2-type introns were identified in a search of a quantitative RT-PCR assay that allows comparison all available genomic sequences in 1998 (Burge et al., of the relative rates of intron removal from the tran­ 1998), and a more recent search of the human genome scripts present in a pre-mRNA population. We show yielded 404 examples (Levine and Durbin, 2001). Thus, that the 012-type introns are more slowly spliced than the frequency of occurrence ofU12-type introns relative to the major-class (U2-type) introns from three endo­ U2-type introns is in the range of 0.15 to 0.34% in genous pre-mRNAs in human tissue culture cells. In vertebrates, and lower in other taxa (Burge et al., 1998; Drosophila melanogaster S2 cells, using minigene con­ Levine and Durbin, 2001). U12-type introns can be found structs designed to produce nearly identical mRNAs, at any position and almost always co-exist with U2-type we observe increased expression of fluorescent protein introns within the same gene. In humans, the mean length and mature mRNA upon mutation of a 012-type to a of U12-type introns (3600 bp) is similar to that of U2-type U2-type intron. These results provide evidence that introns (4130 bp) (Levine and Durbin, 2001), but does not the level of gene expression in vivo is lowered by the yet include introns exceeding 20 kb. presence of a 012-type intron and implicate the 012- By comparing introns at homologous positions (in terms type spliceosome as a target in the post-transcriptional of codon location and phase) in homologous genes from regulation of gene expression. different species, Burge et al. (1998) concluded that Ul2- Keywords: pre-mRNA/regulation of gene expression/ type introns occurred much more frequently in early spliceosome/splicing rate/Ul2-type intron evolutionary history and were either lost or converted to U2-type introns over time. Yet, Burge et al. (1998) identified several U12-type introns that are remarkably Introduction conserved, one example being the second intron of the sodium channel ex. subunit gene in humans and jellyfish, A rare, divergent class of introns was identified by Jackson organisms that diverged at least 600-800 million years ago (1991) and Hall and Padgett (1994); they noticed a few (Spafford et al., 1998). Perhaps even more surprising is the introns with unusual AU and AC dinucleotides at their 5' finding of Ul2-type introns at non-homologous positions and 3' termini, differing from the nearly invariant GU and in several paralogous genes (Burge et al., 1998). AG termini of canonical introns. These minor-class introns were further distinguishable from major-class introns These observations suggest that the few Ul2-type based on highly conserved sequences at their 5' splice introns that have resisted conversion or loss may have site and branch site, as well as by the lack of a poly­ been retained over evolutionary time because their pyrimidine tract upstream of the 3' splice site (Hall and presence is important to the genes that harbor them. Padgett, 1994). Sequence complementarity suggested that Might they play an indispensable role in the regulation of the 5' splice sites and branch sites of these introns might gene expression? More specifically, if Ul2-type introns interact with Ul 1 and U12 snRNPs, respectively (Hall and are spliced more slowly than neighboring U2-type Padgett, 1994). It was subsequently shown that the introns in the same pre-mRNA, then their removal could excision of minor-class introns is indeed mediated by represent the rate-determining step in the expression of a distinct low-abundance spliceosome. The Ul2-type that gene. spliceosome contains U11, U12, U4atac and U6atac Here, we have directly tested the hypothesis that Ul2- snRNPs, which are the functional analogues of the type introns are excised more slowly than U2-type introns. major-class Ul, U2, U4 and U6 snRNPs, while the US We first developed a quantitative RT-PCR assay to assess snRNP participates in the splicing of both Ul2-type and relative splicing rates by measuring the levels ofunspliced classical (U2-type) introns (Hall and Padgett, 1996; Tarn introns in the endogenous population of cellular pre­ and Steitz, 1996a,b). Whereas AU-AC termini were mRNAs. We examined the pre-mRNAs of three human initially considered to be a defining feature of minor- genes, and observed that the Ul2-type intron was the most 3804 © European Molecular Biology Organization Slower excision of U12-type introns l l !p; §I r 7 3 ,U i4 � 3 IR ,il: 1 7 3 2B. I "t 1Ca� (' � IOnt Tnmcated in viuo-transcribed control RN As Primers lIIT, lF,and lR Prlmen lRT, 211, and :2R Fi g . 1. Assessing in vivo splicing rates by quantitative RT-PCR. Quantitation of unspliced introns from total cellular RNA containing pre-mRNAs of a hypothetical two intron-containing gene is schematized. In vitro-transcribed control RNA standards, truncated relative to the cellular RNA sequence by 10 nt, are added in equal amounts to separate reaction tubes containing a fixed amount of total cellular RNA. Reverse transcription is performed using short primers complementary to intronic sequences (lRT or 2RT). cDNAs are then PCR amplified using primer pairs that only amplify unspliced sequences (lF/lR or 2F/2R). The cellular and control RNA amplicons are then electrophoretically separated, and the quantity of each unspliced intron is inferred from the ratio of the amplicons produced. slowly spliced in each case. Secondly, we asked whether As schematized in Figure 1, reverse transcription was replacing the consensus sequences of a naturally occurring carried out using a sequence-specific primer for each U12-type intron with those of a U2-type intron would intron. PCR was then performed using primer pairs that affect the efficiency of gene expression. Using transiently amplify only unspliced sequences: each forward primer transfected reporter constructs that monitor splicing by the was complementary to 5' exonic sequences and each production of different colored fluorescent proteins in reverse primer was complementary to downstream intro­ Drosophila melanogaster tissue culture cells, we observed nic sequences. For each intron, a control RNA standard that mutational conversion of a U12-type intron to a U2- that possessed RT and PCR amplification efficiencies type intron does dramatically increase protein and mRNA closely matched to those of the cellular RNA being levels. analyzed was created. These control RNAs were identical to the target cellular sequences with the exception of an internal 10-nucleotide deletion. Because amplification Results variability can arise at the reverse transcription step due to RNA secondary structure impeding the polymerase A quantitative RT-PCR method to assess relative (Freeman et al., 1999), we designed the RNA standards to rates of intron removal mimic the local secondary structure of each target by We devised a method for evaluating the relative rates of including sequences from most of the upstream exon and intron removal from a particular transcript by determining > 195 nt of the intron. Co-amplification of the cellular RNA the abundance of intron sequences within a steady-state population with a known quantity of each RNA standard population of partially processed cellular pre-mRNAs. If therefore yielded amplicons that differed in size by 10 nt. the excision of a Ul2-type intron occurs more slowly than By comparing their production after separation on a that of major-class introns in the same pre-mRNA, then the polyacrylamide gel, the amount of the cellular RNA amount of unspliced Ul2-type sequences should be higher sequence present was quantitated. than each of the other intron sequences. Indeed, it can be For each gene studied, the concentration of unspliced mathematically demonstrated that the amount of each U12-type intron within a fixed amount of total cellular unspliced intron within a steady-state pre-mRNA popula­ RNA was determined by titration with varying amounts tion is inversely proportional to the relative rate of removal of RNA standard (data not shown). Then, that amount of of that intron (see Supplementary data available at The RNA standard for each of the gene's introns was added to EMBO Journal Online). Because the cellular levels of separate tubes containing identical amounts of total RNA unspliced pre-mRNAs were expected to be very low, the extreme sensitivity of quantitative RT-PCR was exploited (Figure 1). If the U2-type introns are spliced more rapidly to analyze total RNA isolated from growing human tissue than the U12-type intron, then those unspliced sequences culture cells (HeLa or SK Hep). will be less abundant than the sequences of the corres- 3805 A.A.Patel, M.McCarthy and J.A.Steitz ponding RNA standards, as reflected in the ratio of the efficiencies of the two splicing pathways within trans­ co-amplified RT-PCR products generated in each tube. fected tissue culture cells. The fifth intron of the Drosophila sodium-hydrogen The most slowly spliced introns from three human exchange channel gene, NHE3, was chosen for analysis pre-mRNAs in viva are U12-type because its adjacent exons and introns are small (see The three human Ul2-type intron-containing genes chosen Figure 3A), facilitating the creation of small fusion for study had a relatively small number of total introns, constructs encoding fluorescent reporter proteins. Its making the analysis less cumbersome. These genes were: sequences perfectly match the optimal U12-type consen­ (i) SmE, a member of the core complex of proteins in sus (C.Burge, personal communication). Since coopera­ spliceosomal snRNPs (Stanford et al., 1988; DDBJ/ tivity between adjacent introns has been shown to EMBL/GenBank accession No. AL356980); (ii) E2F2, a influence the rate and fidelity of splicing (Robberson transcription factor involved in cell cycle regulation et al., 1990; Wu and Krainer, 1996), 496 nt of the NHE3 (Ivey-Hoyle et al., 1993; accession No. AL021154); and gene, spanning the 3' portion of the fourth exon to the (iii) INSIGl, a gene of unknown function that may be 5' portion of the sixth exon, were included in the construct. important in liver regeneration (Peng et al., 1997; A start codon with Kozak consensus (Kozak, 1987) was accession No. U96876). These genes contain four, six added to the 5' end of the segment, and the segment was and four total introns, with the U12-type intron as the first, fused, via a short linker, upstream of either YFP or CFP fourth and second intron, respectively (Figure 2A). cDNA (Miller et al., 1999). The fluorescent protein coding sequences were interrupted by insertion of the sixth intron RT-PCR quantitation of the unspliced introns from from the NHE3 gene. Therefore, the Ul2-type intron in the these three genes in the cellular RNA population is presented in Figure 2B. The upper band in each lane is the construct was flanked by native exons and U2-type introns amplicon from the cellular RNA, while the lower band is on both sides. that produced from the added RNA standard. Although the The consensus sequences within the Ul2-type intron absolute intensities of the bands can vary from lane to lane were then mutated to U2-type consensus sequences depending on the amplification efficiencies of specific derived from the first intron of the adenovirus major late primer pairs, the ratio of intensities within any given lane transcription unit, an intron whose splicing has been well provides an accurate measure of initial RNA quantities. characterized (Solnick, 1985). Replacement with these Controls without reverse transcriptase added ( data not particular sequences is reasonable since the adenovirus shown) established that no undigested genomic DNA U2-type splice site sequences closely match the contributed to the amplicon intensity. Since equal amounts Drosophila U2-type consensus sequences (Mount et al., of the RNA standards are used in each reaction for a given 1992). Changes were limited to mutations at the 5' splice gene, comparing the ratios across lanes provides a direct site, branch site, 3' splice site and the insertion of a 3' comparison of the relative amounts of each unspliced polypyrimidine tract (Figure 3A). The overall length of the intron. intron was preserved, as were the internal, non-consensus Graphical presentation of these intensity ratios sequences. Consequently, the mRNAs produced by splic­ (Figure 2B) shows that the unspliced U12-type intron ing of the converted U2-type intron and the original sequences are two- to nine-fold more abundant than the construct containing the U12-type intron were identical, neighboring U2-type intron sequences for all three pre­ except for the nine codons that differ between YFP and mRNAs analyzed. To confirm that the amplification CFP (Figure 3B). efficiencies for each intron and its corresponding 10-nt Synthesis of pre-mRNA was driven by a Gal4-respon­ deleted RNA standard were equivalent, equal amounts of sive promoter, so that expression could be induced by in vitro transcribed full-length and truncated RNAs producing Gal4 protein from either a copper-responsive corresponding to each intron were co-amplified. The metallothionein or a heat shock promoter on a separate, co­ appearance of pairs of amplicons of approximately equal transfected plasmid. Versions of YFP and CFP containing intensity in each lane (Figure 2C) allows us to conclude protein destabilizing 'PEST' sequences, which reduced that the U12-type introns within the in vivo transcripts of the half-life of the fluorescent proteins from ~24 to 2 h three human genes are indeed spliced more slowly than (Clontech product literature), were used so that the their U2-type neighbors. fluorescence signal would reflect differences in the rate of splicing rather than in protein accumulation. Also, eight Replacement of natural U12-type intron sequences hydrophobic amino acids within the predicted transmem­ with U2-type consensus sequences increases brane region (exon 5) of NHE3 were mutated (shown in protein expression in viva bold in Figure 3B) to avoid possible membrane-targeting We next asked whether a Ul2- versus a U2-type intron in of the fusion protein. Finally, to guarantee that each cell the same genetic context would lead to differential was transfected with equal amounts of each fluorescent expression of the encoded protein. We designed plasmid protein gene, the two constructs were cloned in tandem constructs that would permit unambiguous correlation of into a single plasmid (Figure 3C). To normalize for reporter protein production with splicing efficiency. The inherent differences in the fluorescence intensities of YFP constructs (Figure 3A) express either cyan (C) or yellow and CFP, a reciprocal construct was made with the (Y) fluorescent protein (FP) only when completely spliced, reversed color scheme (Figure 3C). dependent on removal of a U12-type versus a U2-type To confirm that the fluorescent signals from YFP and intron. Since the spliced mRNAs are nearly identical in CFP were completely distinguishable (Miller et al., 1999), sequence (Figure 3B), the relative intensity of the two U2Y and U2C constructs (named on the basis of the fluorescent signals provides a readout of the relative middle intron and the fluorescent color) were separately 3806 10 2 8 � --� .8� ____ _____ . �---- - ===:::::J Slower excision of U12-type introns A SmE Gene (8.5kb) 4 1.44 1.30 4.75 E2F2 Gene {21.4kb) os 2 3 2.49 6 1 c:::J -----6"'."' a 1----' "". 3;;;; '---1o,Q,77o I l§ a □ ."- '- ---1 □ INSIGl Gene (10.7kb) C===::J f-- _: !::: 40 --{ - = U12-type intron SmE E2F2 INSIGl IntronNumber Intron Number Intron Number 1 2 3 4 1 2 3 4 1 2 3 4 S 6 Cellular ampllcoil IClnt /J. ampllcon 5 1.2 so 1 40 0.8 �)J 0.6 "s 'g 2 20 0.4 ii X. 0.2 - 0 0 2 3 4 l 2 3 4 lntron Num. ber Intron Number ltron Number 1 2 3 4 I 2 3 4 5 6 l Ful ampllcoa IOnt /J. ampUcon Ratio of D.87 0.94 0.95 0.91 OJIJ 1.0S 0.79 0.9' 0.83 0.8S o.96 1.03 0. 99 0.77 Full:6 Fig. 2. U12-type introns are excised most slowly from three endogenous human pre-mRNAs. (A) The intron-exon structure is depicted for the three human genes, SmE, E2F2 and INSIG I. Shaded boxes represent exons, thin lines represent U2-type introns and thick lines represent U12-type introns, with intron lengths (in kb) indicated above. (B) Above are shown the gels from which the ratios of cellular to control amplicons (105-164 nt long with controls being 10 nt shorter) were measured. The amounts of each unspliced intron within the pre-mRNA population from growing HeLa cells (for SmE and E2F2) or SK Hep cells (for INSIGl) are shown graphically below. Solid bars represent U2-type introns and hatched bars represent U12- 19 19 18 type introns, with error bars indicating the standard deviation of two experiments. 4.56 X 10-- moles, 1.01 X 10-- moles and 4.47 X 10-- moles of control RNA standards were added per microgram of total cellular RNA for the analysis of introns from SmE, E2F2 and INSIGl, respectively. (C) Control co-amplification of equal amounts of in vitro-transcribed full-length and 10-nt truncated RNAs shows approximately equal production of amplicons (ratio of 0.91 ± 0.08). 10-- moles of each RNA species were RT-PCR amplified. transfected into Drosophila S2 cells with a metallo­ detected with either the cyan or the yellow filter set, but thionein-Gal4 plasmid. Expression was induced 24 h later never with both (Figure 4A-C). Fluorescence from cells by adding cupric sulfate, and cells were viewed after 12 h. transfected with either the U2Y or U2C construct was, on As expected, fluorescence from any single cell was average, quite robust, whereas fluorescence from cells -- -- - 1-----""' '------ A.A.Patel, M.McCarthy and J.A.Steitz transfected with the U12Y or U12C construct appeared pattern: each transfected cell exhibited at least 5-fold more much weaker (data not shown). yellow fluorescence than cyan fluorescence (Figure 4G-I). Next, the tandem U2C-U12Y plasmid (Figure 3C) was Because all other differences between the constructs are co-transfected with a metallothionein-Gal4 plasmid, and controlled by the use of reciprocal plasmids, the altered gene expression induced. While different cells within the expression levels can be ascribed to the identity of the transfected population exhibited different fluorescence middle intron. intensities, any particular cell consistently showed at least To confirm that the fifth intron of the NHE3 gene is in a 5-fold higher fluorescent signal with the cyan filter than fact spliced by the U12-type splicing machinery, excision with the yellow filter (based on comparison of integrated of this intron was examined in endogenous pre-mRNA pixel intensities from CCD-captured digital images) prepared from Droso phila larvae that were either homo­ (Figure 4D-F). Transfection of the reciprocal tandem or heterozygous for a P-element disruption of U6atac U12C-U2Y plasmid (Figure 3C) yielded the opposite (characterized by Otake et al., 2002). The homozygous U12Y: Segment o f Dro • ophila NHE3 Geoe ------- A- -------- U2- 170 73 ■1o !■� � .. 1o1w ,1w . . • • • • • • • • • • ■■1�a.c.Jai;!i2.2..li.H H� • �Ci •c1cxric:&c: D Native 12-Type Sequences Converted t o 02-Type D 'i ATTCAAC TCTT AAACCTATATGC GC TAGTCTTGGGCGAATCTGTGC lA TGGTGGCCA GA_ J 70 J' � egtttqcta c ttttt tt tcgttggq e.�t� gt g 1 C 'l'Q(,$GTOOC CAT tfcMcaA _ _ _ _ ca.tcattto ttt ta @ ATTCAAAA A£CGGGGAA T'l'CGMAC T f � AAJ AJ 210 2 a o p.ocTI'T'l'CT -ft CGC'J'C G'l".lW- �� cjTGATGA�'J1 �TTGACAGCA: tgtgaa tggtaaaat tt ga tt.aa tt. t. t. t. ttacc tca gtggca ttg a11at gta t. a tcta t.l:; ocgc 420 � _g j1 ¥ :i 0 . . attaatt. agaaaacacc tatgc 490 . . . TGGA TC GGCTOGATCGGCTGGACCGG'l'CGCCAC TGGTGAGCAAGGGCO 560 . . AGO AGC TGT'l'CA CCGG GGTGG TGCCCA TCCTGGTC GAG CTGGACGGCGA CGTAAAC GGCCACMGTTCAG 630 • • • • • • <Ii .. .CGTGTc CGGq,AGGGCGA Gg.. taa gttatt: t: .t: c ag cac ag a_aat a ct.ta a apagg cgttcc.caaa ca gaa a . S1t.tai:.t.t.t.t.c,t.t.tt. t.cacp. gGGCGA TGC .f.'.:A CCT ACGGCf.AGC:I'GA _:_ CCC;rG AAG TT CA.'l � TGCA CCACC 770 pGCAAGC TGC � CG'l.'GCCC � CCA CCCTC � TGACCA C•Cfal�- :-Ii i.P(:.s:t. � CA 0G TG9, GC T_ 840 ACCCCGACCACA'l'GAAGCAGCA CGAC'l"I'CTTCAAGTCCGCCA'l'GCCC GAA GGCTAC'G TCCAGGAGCGCAC 910 . . . . . . . . .�'J"CT'l' CTTCfJI GG ACGACGpCM CT ACU�A CCCGCGCC9MG'I'GAAG 'ry'C GAGGG "CGA_ C CCCTOOTG 980 MCCOCA TCG MGGG OO A GGAC G AACA 'l'C AC GTACA 1050 [\GCTG 9' q.A 9C � AAGF'J'OOA CS:CACMCG CJATA C'M'CMGAT • 1120 • co::.ccACMC f. TC GA GGA C��TC GCCG ACFACT ACCACC.AGAACACC:CC CATCCGCGAC. 1190 GGCCCOG'l'GCTGC'l'GCCCGACAACACTACCTG CAG'l'CCGCCCTGAGCAAAGACCCCAACGAGA 1.260 11 .. • • • t • • ATGGTC C TGGA GTTCG ACCGCC GC GOOA TCA TCGQCA 'ro CGAGCTGTA 13 3 a f � TGF ,'.l'G f � G." CMGAA OCTT A CA CCOCCGGAGG GT 1400 . . GCGCGA'.I'CA TCGAC'l"l' GCQATGTC Slower excision of U1 2-type introns U6atac-disrupted larvae die at the third instar because of a expression of the protein from the mRNA generated by deficiency in U12-type splicing. Analysis of total RNA by U2-dependent splicing only. The relative difference in RT-PCR revealed that the U6atac-deficient larvae (at expression can be calculated from the slopes of the two ~60 h post egg-laying) accumulated substantially higher lines, taking into account the decreased CFP detection amounts of unspliced intron S as compared with the sensitivity and assuming that the nine amino acids that control heterozygous larvae (data not shown), demonstrat­ change the color of the fluorescent protein do not affect ing excision of this intron by the Ul2-type spliceosome. protein expression or stability. We conclude that the expression of fluorescent protein increases 6-to 8-fold when the U12-type intron is converted to a U2-type The 6- to 8-fold diff erence in fluorescent protein intron. expression is not induced by saturation of the U12-type splicing machinery The linearity of the data points in Figure SD and E also The results from fluorescence microscopy, showing a excludes the possibility that the observed differences consistent and significant difference in the levels of YFP result artificially from saturation of the U12-type splicing and CFP from the reciprocal constructs containing Ul2- machinery by high levels of pre-mRNA expressed from type and U2-type introns (Figure 4D-1), were extended by the transfected constructs. Because the scale of the axes fluorescence-activated cell sorting (FACS). We first are logarithmic, the fluorescence emitted by individual verified that cyan and yellow fluorescence signals can be cells in the population differed by several orders of detected independently by FACS. Compared with mock­ magnitude. Over this entire range, the proportion of yellow transfected cells, which exhibit minimal intensity on each to cyan fluorescence was roughly constant. For example, a channel (Figure SA), S2 cells transfected with U2C or strongly fluorescent cell making SO-fold more U2-type U2Y (and metallothionein-Gal4, induced as above) reporter protein also made ~SO-fold more U12-type reporter protein compared with a weakly fluorescent cell. showed significant fluorescence on the cyan or yellow This would not be the case if the capacity of the U12-type channel, respectively, and negligible fluorescence on the splicing machinery were saturated by high expression of other channel (Figure SB and C). The large range of the fluorescent protein pre-mRNA. Likewise, when dif­ fluorescence intensities seen (note the logarithmically ferent amounts of U2C-U12Y or U12C-U2Y were scaled axes) probably resulted from cells being transfected deliberately transfected into S2 cells (over a 20-fold with different numbers of plasmids or in different physio­ range), the ratio of cyan to yellow fluorescence in each cell logical states. remained approximately constant (within detection limits) Cells transfected with the tandem U2C-U12Y or despite great differences in the absolute fluorescence Ul 2C-U2Y plasmid displayed the same patterns of intensity (data not shown). fluorescence as previously observed by microscopy: the intensity of the protein expressed from the U2-type intron containing gene was always several-fold greater than from Presence of a U12-type intron hinders production that containing the U12-type intron (Figure SD and E). of mature mRNA This pattern manifests itself on the FACS plot as a roughly To confirm that the observed differences in fluorescent linear set of points through which a best-fit line can be protein expression were caused by differences in the drawn. As expected, the slope of the line for the efficiency of U2-type versus U12-type splicing, the effects U12C-U2Y transfected cells is greater than that for the of intron conversion were examined directly at the RNA U2C-U12Y transfected cells, because of increased relative level. S2 cells were co-transfected with metallothionein- U2C-U1 2Y: U1 2C-U2Y : U12 Fi. 3. Plasmids that report the efficiency of Ul2-type versus U2-type splicing. (A) A segment of the D.melanogaster NHE3 gene including introns 4 (U2-type) and 5 (U12 -type) and their flanking exons was fused, via a linker, to a yellow (Y) or cyan (C) fluorescent protein coc1ing sequence contain­ ing destabilizing 'PEST' sequences to form U12 Y or U12 C. Intron 6 (U2-type) of NHE3 was inserted into the CFP or YFP coc1ing sequences. A Gal4- responsive promoter and a Kozak consensus translation start site were directly upstream of the fusion protein. Exon and intron lengths are indicated above and below (not drawn to scale). To form U2Y (or U2C), consensus splicing sequences of the U1 2-type intron were mutated to U2-type sequen­ ces derived from an adenovirus intron, keeping the intron length constant. (B) The sequences of the protein-coc1ing regions of the fusion constructs are shown, with exon sequences in uppercase and intron sequences in lowercase and alternative sequences indicated. Red, Ul2-type consensus sequences; green, converted U2-type sequences; gray, NHE3 exon sequences; brown, linker sequences; orange, PEST sequences. The mutations converting cyan to yellow fluorescence are highlighted in cyan and yellow, respectively. The mutations introduced to change hydrophobic amino acids in the prec1icted transmembrane domain of exon 5 are in bold. (C) A plasmid containing the U2C and U12 Y constructs in tandem (named U2C-U 12 Y) was created to ensure equal transfection of both constructs. The reciprocal plasmid (U1 2C-U2Y) with a reversed color scheme controlled for inherent c1iffere nces in CFP and YFP fluorescence yield. 3809 A.A.Patel, M.McCarthy and J.A.Steitz YFP Filter Pha e CFP Filter Fig. 4. U2-dependent splicing produces brighter fluorescence than Ul2-dependent splicing in Drosophila S2 cells. (A-C) CFP and YFP fusion proteins are distinguishable. Drosophila S2 cells were separately co-transfected with either U2C or U2Y and metallothionein-Gal4, mixed and viewed 12 h after cupric sulfate induction using a YFP filter (A), phase contrast (B) or a CFP filter (C). (D-1) S2 cells co-transfected with U2C-Ul2Y (panels D-F) or U12C-U2Y (panels G-1) and metallothionein-Gal4 were similarly induced and viewed using a YFP filter (D and G), phase contrast (E and H) or a CFP filter (F and I). Similar results were obtained with constructs lacking 'PEST' sequences (data not shown). Gal4 and either U2Y or U12Y, expression was induced below the full-length bands (Figure 6A), suggesting that after 24 h, and total RNA at various times after induction the pre-mRNA is prone to degradation if not efficiently was analyzed by northern blot. Cells transfected with the spliced (Bousquet-Antonelli et al., 2000). U2Y construct showed rapid accumulation of mature Finally, to examine differences in the splicing rate of the mRNA, whereas cells transfected with the U12Y construct middle intron relative to its neighboring introns for both accumulated less mature mRNA (Figure 6A). Also, a more the U2Y and U12Y constructs, we carried out quantitative slowly migrating band was observed in the U12Y­ RT-PCR experiments, as described for the endogenous transfected cells. Hybridization of this band with a probe human pre-mRNAs (Figure 1). S2 cellular RNA prepared specific for the middle intron (data not shown) and further 12 h after induction of expression was RT-PCR amplified analysis by RT-PCR (see below) indicate that it consists of in the presence of a single in vitro transcribed RNA partially unspliced species predominantly containing the standard containing three separate 10-nt deletions, allow­ Ul2-type intron. Lanes corresponding to the U12Y­ ing quantitation of all three introns. The levels of unspliced transfected cells also reproducibly showed a smear introns from the U12Y construct indicate that the 3810 Slower excision of U12-type introns Mock Transfecte d ' '' "" 1 o> ' '" " ,oi� ' T'" " 10' CFP lntiensly U2Y Transfected . U2C Transfecte d ... 1 02 CFP lnlan1ly D � U2C-012Y T ra ns fected E � U1 2C-UlY Transfect ed Fi g . 5. FACS analysis of transfe cted S2 celJs. Density plots of yellow versus cyan fluorescence intensity for S2 cells co-transfe cted with metallothio­ nein-Gal4 and various plasmids, obtained 12 h after cupric sulfate induction. The flow cytometer detection optics are inherently less sensitive for CFP than for YFP. 50 000 cells were observed on each plot. (A) Mock-transfe cted S2 cells show minimal cyan or yellow fluorescence. (B) U2Y-transfe cted celJs show only yelJow fluorescence. (C) U2C-trans fe cted celJs show only cyan fluorescence. (D) U2C-U12Y-transfected celJs show greater cyan than yellow fluorescence (correcting for low CFP detection sensitivity). (E) U12C-U2Y-trans fe cted cells show greater yellow than cyan fluorescence. U12-type middle intron was more abundant than its U2- as evidenced by the lower relative abundance of its type neighbors, confirming that it is spliced more slowly unspliced form (Figure 6C). Interestingly, conversion to (Figure 6B). Conversion of the consensus sequences to U2-type sequences also appeared to increase the splicing U2-type dramatically increased the splicing of that intron rate of the two adjacent introns, suggesting cooperativity 38 1 1 Hours after O 6 12 18 24 Ul2Y Transfected U2Y Transfected A.A. Patel, M.McCarthy and J.A.Steitz 0 6 12 18 24 inductio n pr e-mRN A �mature mRNA .!l 2 3 4 5 6 7 8 9 10 Ul 2Y Transf ected C U2Y Transf ected lntron Number lntron Number 1, �----....------, ) � 12 -I----_,,. i l 10 -I---� � ; ij 8 +--- ....J/ e l 4 7:, - - - .. .s 0 l l 2 3 lntron Nu mber Intron Number Fi g . 6. mRNA production is slowed by inefficient splicing of a Ul2 -type intron. (A) Northern blot of total RNA isolated from S2 cells co-transfected with U2Y (lanes 1-5) or Ul2 Y (lanes 6--10 ) and metallothionein-Gal4 at the indicated times after induction of expression. The blot was successively hybridized with random-primed DNA probes complementary to the YFP coding sequence (top panel) and to a loading control, ribosomal protein 49 (bottom panel). The identity of the slowly migrating band as partially spliced pre-mRNA, was confirmed by hybridization to a probe specific for the middle intron (data not shown). (B) Quantitative RT-PCR analysis of unspliced introns (similar to Figure 2B) from total RNA prepared 12 h after induction of Ul2Y-transfected cells and amplified in the presence of a single in vitro transcribed RNA standard containing three separate 10 -nt dele­ tions, allowing quantitation of all three introns. 1. 33 X 10 -- moles of control RNA standard was added per µg of total cellular RNA. Hatched bar, Ul2-type intron; solid bars, U2 type introns; error bars, standard deviation of two experiments. (C) Similar analysis of U2Y-transfected cells. Note that JO-fold less control RNA standard (1 .33 X 10 -- moles per µg of total RNA) was used. (D) Confirmation of equal amplification efficiency of in vitro transcribed full-length and 10 -nt truncated RNAs (amplicon ratio of 1. 02 ± 0.02) (as in Figure 2C). 10 -- moles of each RNA species were RT-PCR amplified. --I -< 14 +--- Slower excision of U12-type introns in the excision of these introns. As before, to verify that the (Cafarelli et al., 1994) , within several RPL la introns amplification efficiencies of the full-length and truncated (including the Ul 2-type intron), and (ii) potential ampli­ RNAs were equal, equimolar amounts of full-length and fication of transcript sequences from both gene copies in truncated in vitro generated transcripts were co-amplified the pseudo-t etraploid genome of X. laevis. Thus, human and observed to produce amplicons of equal intensity genes were chosen for subsequent analyses. (Figure 6D) . For the three human genes analyzed, there is no obvious correlation of intron position or length with rate of excision (Figure 2). While the Ul 2-type introns are, on Discussion average, shorter than the U2-type introns , in two out of Our data support the hypothesis that Ul 2-type introns are three genes they are not the shortest intron. Also, we did excised from pre-mRNA transcripts more slowly than not observe slower splicing rates for the longer U2-type canonical U2-type introns. We demonstrate that this is the introns within these genes, consistent with previous case for the transcripts of three human genes. Additionally, findings (Gardner et al., 1988; Gudas et al., 1990; mutation of native U1 2-type to U2-type intron consensus Kessler et al., 1993; Wetterberg et al., 1996). sequences within a D.melanogaster minigene results in Our D.melanogaster splicing constructs produced signific antly increased levels of mRNA and protein mRNAs differing by only nine codons for CFP versus expression. Together, these observations suggest that YFP. It was possible that these changes affect the persistence of Ul 2-type introns over evolutionary time efficiency of either splicing, polyadenylation, export or could result from their importance as post-transcriptional translation. Therefore, the reciprocal constructs with reversed color schemes were important to control for regulators of the genes that harbor them. diff erences not only in fluorescence yield, but also Although we analyzed endogenous splicing rates for the transcripts of only three human genes, we argue that expression. Their use confirmed that the differ ences in our results are generalizable. These genes were chosen fluorescent protein expression are attributable to the because they had a small number of total intron s, whereas changed intron type. the average number of introns in Ul 2-type intron Why should U1 2-type introns be excised more slowly containing genes is ~15 (Burge et al., 1998). However, than U2-type introns? In vitro, the splicing of U1 2-type approximately one-third of these genes have <10 introns, introns has consistently been reported to be extremely and there is no obvious reason why Ul 2-type introns slow, even for several different splicing substrates (Tarn would be selectively spliced more slowly from genes with and Steitz, 1996b ; Wu and Krainer, 1996) . The ~1 00-fold only a few introns. Extrapolation to other U1 2-type intron lower abundance of the minor-class snRNPs relative to the containing genes is warranted if coincidental observation major-class snRNPs in mammalian cell nuclei and nuclear of the same pattern within the studied sample is highly extracts (Montzka and Steitz, 1988; Tarn and Steitz, improbable. The likelihood of finding by random chance 1996a) may well reduce the rate of assembly of the U12- that the Ul 2-type intron is spliced most slowly from genes dependent spliceosome. However, since splicing com­ containing 4, 4 and 6 total introns is 1/4, 1/4 and 1/6, ponents are thought to be assembled co-t ranscriptionally respectively. However, the probability of independently in vivo (Misteli and Spector, 1999; reviewed in Hirose finding this pattern for all three genes is the product of the and Manley, 2000) , the effects of snRNP concentrations individual probabilities, 1/96. Therefore, the consistency on in vivo splicing rates are not easily predictable. we observe is unlikely to occur randomly and is thus Alternatively, it is possible that slower catalysis of one probably representative of other genes containing U12- or both splicing reactions by the spliceosome underlies the type introns. It is even conceivable that if the introns we lower rate of excision of Ul 2-type introns. It will be analyzed had been those that are extremely highly interesting to explore whether the low abundance of minor-class splicing components might cause RNA conserved through evolution, more dramatic differ ences polymerase II to stall at Ul 2-type introns . in excision rates might have been observed. The existence of genes whose expression might be Indeed, another Ul 2-type intron in the ribosomal protein Lla gene of Xenopus laevis was initially regulated by the presence of inefficiently spliced introns characterized as the 'regulated third intron' (Bozzoni hints at a commonality among these genes. Burge et al. et al., 1984; Caffarelli et al., 1987, 1992; Pierandrei­ (1998) note that a large proportion of U1 2-type intron­ Amaldi et al., 1988; Fragapane et al., 1992) because of its containing genes can be categorized as 'information low efficiency of splicing. Not only did partially spliced processing', including genes involved in DNA replic­ pre-mRNAs containing this intron (and to a lesser extent, ation/repair, transcription, RNA processing and transla­ the second intron) accumulate and produce little extra tion; only a few perform operational functions such as protein upon microinjection of cloned RPL la genomic energy metabolism or biosynthesis. Could Ul 2-type sequences into Xenopus oocytes, but endogenous partially introns in these genes be acting as post-t ranscriptional spliced RPLla pre-mRNAs were detected at low levels in bottlenecks, preventing overexpression that might be uninjected oocytes (Bozzoni et al., 1984). Using our harmful to the organism? Alternatively, since expression sensitive RT-PCR assay, we have confirmed that un­ of such genes is upregulated in proliferating compared spliced Ul 2-type intron sequences are indeed present at with quiescent cells, the activity of the Ul 2-type spliceo­ higher levels than those of the other eight RPLla U2-type some may increase during proliferation. It is also possible introns in total RNA prepared from oocytes (data not that Ul 2-type splicing activity is modulated in a tissue-or shown). However, interpretation of these experiments is a developmental stage-specific manner. This could occur complicated by (i) the presence of snoRNAs, which can be through up-( or down-) regulation of any snRNA or protein removed via a pathway that competes with splicing component specific to the Ul 2-type spliceosome. The 3813 A.A.Patel, M.McCarthy and J.A.Steitz using BamHI and Bgill sites, and was inserted within a BamHI site fluorescent protein-coding constructs described here upstream of the NHE3 gene segment. Finally, tandem constructs were provide a means of investigating these questions in the created by inserting sequences from one plasmid, cut with Xhol and developmentally well-studied organism, D.melanogaster. NgoMIV, into the Xhol and Xmal sites of the second plasmid. Transfection of Drosophila 52 cells S2 cells were grown at 25 C in Shields and Sang M3 medium (Sigma) Materials and methods containing 12.5% FB S (Gibco-BRL) in 35 mm dishes and transiently Preparation of RNA standards transfected using 25 µl of Lipofectin reagent (Gibco-BRL) per dish, Segments of genomic sequences from human E2F2, SmE and INSIG 1 according to the manufacturer 's directions. For most experiments, 0.5 µg were PCR-amplified from genomic clones RPCi l-1 5005 (Sanger Centre, of reporter plasmids were co-transfected with 1.5 µg of either pmt-Gal4 Hirn:ton, Cambs, UK), RPC I11- 397 P13 (Sanger Centre), and HP-5 (Peng (metallothionein expression, gift of S.A rtavanis-Tsakonas) or heat-shock­ et al., 19 97), respectively. The segments (between 301 and 853 nt) Gal4 plasmid (gift of T.Xu). Experiments to investigate splicing included most of the upstream exon and >19 5 nt of intronic sequence saturation used between 1 µg and 0.0 5 µg reporter plasmid, supplement­ surrounding each 5' splice site. To create an RNA standard for the ing with unrelated plasmid to keep the total transfected DNA constant. Drosophila constructs, a single 872-nt segment including all three introns Expression was induced 24 h after transfection either by adding 0.7 mM was PCR-amplified from the Ul2 Y plasmid (construction of Ul2 Y cupric sulfate (Sigma) or by heat shock at 37C for 30 min. described below). Xhol and Not! restriction sites, introduced by the PCR primers, were used to insert the amplified segments into pBluescript SK+ Fluorescence microscopy vectors (Stratagene) downstream of a T7 promoter. Ten-nucleotide Cells were visualized 12 -24 h after induction using a Zeiss Axiophot II deletions were introduced by either PCR mutagenesis or using the fluorescence microscope with CFP (Ex: D436/20; Em: D480/40; BS: QuickChange Mutagenesis system (Stratagene). Oligonucleotides for 455d clp) and YFP (Ex: HQ500/20; Em: HQ5 35/30; BS: Q5 1 5lp) filter PCR cloning and mutagenesis are listed in the Supplementary data. RNA sets (Chroma). Images were captured using a Quantix CCD camera standards were prepared by in vitro transcription from the T7 promoter (Photometr ics) and analyzed with IP Lab software (Scanaly tics). essentially as described by Tarn and Steitz (1 996b), internally trace­ labelling with [cx- P]UTP. Gel-purified transcripts were quantified by FA CS analysis liquid scintillation counting and stored at -70C in aqueous solution Cells were analyzed 12 -24 h after induction with a FACS Vantage dual laser flow cytometer (Becton-Dickinson). CFP was excited at 457 nm with containing 20 µg/ml yeast total carrier RNA. a Spectra-Physics 2025 argon laser and the fluorescence emission was Quantitative RT-PCR analysis collected through a 480/30 nm band pass filter. YFP was excited at 514 nm RNA for analysis of E2F2 and SmE was prepared, using Trizol (Gibco­ using a Coherent Innova 70 argon-krypton laser and the fluorescence BRL) according to the manufacturer 's directions, from log-phase HeLa collected through a 550/30 nm band pass filter. Fifty thousand cells were cells grown in suspension in RPM! (Gibco-BRL) containing 10% fetal observed for each sample. Statistical analysis was performed using bovine serum (F BS; Gibco-BRL). RNA for analysis of INSIGl was WINMIDI software (Joseph Trotter, Scripps Clinic, CA). similarly prepared from ~ 70% confluent SK Hep cells grown in 35 mm dishes in Dulbec co's modified Eagl e's medium (Gibco-BRL) with 10% Northern blot analysis FB S. RNA for analysis of Ul2 Y and U2Y was isolated from transiently Growth medium was removed from S2 cells at various times after transfected Drosophila S2 cells 12 h after induction of expression as induction, and cells were disrupted in 1 ml of Trizol (Gibco-BRL) for described below. Contaminating genomic DNA was removed by treating RNA isolation according to the manufacturer 's instructions. Total RNA with RQl DNase (Promega) in 5 mM MgCh and 50 mM Tris pH 8.0 at (~ 10 µg) was run per lane on a formaldehyde--agarose gel for northern ° ° 37C for 1 h, followed by heat inactivation at 65 C for 10 min. Reverse blotting and was probed with internally P-labelled DNA probes transcription was then performed using Thermoscript RT (Invitrogen) covering either the entire open reading frame of YFP, or ribosomal according to the manufactur er 's directions, with 0.5 µM gene-specific protein 49 (gift of L.Cooley), or the non-consensus internal sequences primers (see Supplementary data), 7 .5 ng/µl (for SmE, E2F2 and INSIG 1) (nucleotides 319 -436, Figure 3B) of NHE3 intron 5. or 0. 188 ng/µl (for U12 Y and U2Y) total cellular RNA, and various 2 22 concentrations (between 3.36 X 10 - 0 and 7.6 0 X 10 - moles/µl) of Supplementary data in vitro transcribed RNA standard s. RT reactions were incubated at 37C Supplementary data are available at The EMB O Journal Online. ° ° ° for 15 min, then 55 C for 30 min, then 65 C for 30 min and finally 85C for 10 min. Escherichia coli RNase H (0. 1 U/µl; Invitrogen) were added and the samples incubated at 37C for 30 min. PCR was then performed Acknowledgements using Platinum Tag polymerase (Invitrogen) in the buffer supplied with 1. 5 mM MgC1 , 0.4 mM dNTPs, 250 nM unlabelled primers (see We thank Chris Burge for communicating unpublished findings which Supplementary data) doped with 5' -radiolabelled forward primer (to label identified the Drosophila NHE3 gene for incorporation into our reporter only one strand of amplicon), and 10% (by volume) of reverse-transcribed plasmids. We are also grateful to Rocco Carbone for assistance with the cDNA. Between 24 and 28 cycles of PCR were performed with 2 min FACS experiments, and to Kazio Tycowski, Michael Koelle and Carl C for extension times and annealing temperatures of 62.5, 60, 61. 5 and 61 Hashimoto for critical reading of the manuscript. This work was the E2F2, SmE, INSIGl and Ul2Y/U2Y samples, respectively (based on supported by grant GM 26 154 from the National Institutes of Health to lowest predicted T .J . Amplicons were separated on a 10% polyacryl­ J.A .S., who is an investigator at the Howard Hughes Medical Institute. arnide sequencing gel, and quantitated using a Molecular Dynamics Phosphorlmager. Construction of Drosophila splicing reporter plasmids References Reporter plasmids contained a Drosophila NHE3 gene segment fused to Bousq uet-Antonelli ,C., Presutti ,C. and Tollervey ,D. (2000) Identification CFP or YFP coding sequences (destabilized with 'PEST' sequences) of a regulated pathway for nuclear pre-mRNA turnover. Cell, 102, (Clontech) with modifications as schematized in Figure 3 (sequences 765-775. available upon request). The NHE3 segment spanning exon 4 through exon 6 was PCR-amplified from genomic clone DS07 13 4 (Berkeley Bozzoni,I., Fragapa ne,P ., Annesi,F., Pierandrei-Amaldi ,P., Amaldi,F. Drosophila Genome Database) with primers that introduced an upstream and Beccari,E. (198 4) Expression of two Xenopus laevis ribosomal protein genes in in jected frog oocytes. A specific splicing block translation start site, a downstream linker sequence and mutations to interferes with the L1 RNA maturati on. J. Mol. Biol. , 180, 987 -10 05. remove hydrophobic amino acids from the predicted transmembrane domain (see Supplementary data). Alternative primers were used to Brand,A.H. and Perrimon,N. (19 93) Targeted gene expression as a mutate Ul2-type consensus sequences to U2-type sequences. PCR means of altering cell fates and generating dominant phenotypes. products were inserted between the Bgill and Agel sites of pd2-ECFP-Nl Development, 118, 40 1-415. and pd2-EYFP-Nl plasmids (Clontech). Synthetic DNA including the Burg e,C.B ., Padget t,R.A. and Sharp,P.A. (19 98) Evolutionary fates and entire NHE3 intron 6 sequence (see Supplementary data) was inserted origins of Ul2-type introns. Mol. Cell, 2, 773- 785. into CFP and YFP coding sequences via a Beg! site. A Gal4-responsive Caffare lli,E., Fragapa ne,P ., Gehring ,C. and Bozzoni,I. (1 987) The UAS promoter was excised from pUAST (Brand and Perrimon, 19 93) accumulation of mature RNA for the Xenopus laevis ribosomal 38 14 Sl ower excision of U12-type introns protein L 1 is controlled at the level of splicing and turnover of the jellyfish, Polyorchis penicillatus: structural comparisons and precursor RNA. EMBO J. , 6, 3493-3498. evolutionary considerations. Biochem. Biophys. Res. Com mun. , 244, Caff arelli,E., Fragapane,P. and Bozzoni,I. (1992) Inefficient in vitro 772-780. splicing of the regulatory intron of the L1 ribosomal protein gene of Stanford,D.R., Perry,C.A., Holicky,E.L., Rohleder,A.M. and Wieben, X.laevis depends on suboptimal splice site sequences. Biochem. E.D. (1988) The small nuclear ribonucleoprotein E protein gene Biophys. Res. Commu n. , 183, 680-687. contains four introns and has upstream similarities to genes for Caff arelli,E., Arese,M., Santoro,B., Fragapane,P. and Bozzoni,I. (1994) ribosomal proteins. J. Biol. Chem., 263, 17772-17779. In vitro study of processing of the intron-encoded Ul6 small nucleolar Tarn,W.Y. and Steitz,J.A. (1996a) Highly diverged U4 and U6 small RNA in Xenopus laevis. Mol. Cell. Biol. , 14, 2966-2974. nuclear RNAs required for splicing rare AT-AC introns. Science, 273, Dietrich,R.C., Incorvaia,R. and Padgett,R.A. (1997) Terminal intron 1824-1832. dinucleotide sequences do not distinguish between U2- and U12- Tarn,W.Y. and Steitz,J.A. (1996b) A novel spliceosome containing Ul 1, dependent introns. Mol. Cell, 1, 151-160. Ul2 and US snRNPs excises a minor class (AT-AC) intron in vitro. Fragapane,P., Caff arelli,E., Lener,M., Prislei,S., Santoro,B. and Cell, 84, 801-811. Bozzoni,I. (1992) Identification of the sequences responsible for the Wetterberg,I., Bauren,G. and Wieslander,L. (1996) The intranuclear site splicing phenotype of the regulatory intron of the L1 ribosomal protein of excision of each intron in Balbiani ring 3 pre-mRNA is influenced gene of Xenopus laevis. Mol. Cell. Biol. , 12, 1117-1125. by the time remaining to transcription termination and different Freeman,W.M., Walker,S.J. and Vrana,K.E. (1999) Quantitative excision efficiencies for the various introns. RNA, 2, 641---651. RT-PCR: pitfalls and potential. Biotechniques, 26, 112-122. Wu,Q. and Krainer,A.R. (1996) Ul-mediated exon definition Gardner,D.G., Cathala,G., Lan,N.Y., David-Inouye,Y. and Baxter,J.D. interactions between AT-AC and GT-AG introns. Science, 274, (1988) Processing of the primary transcript for the rat growth hormone 1005-1008. gene in vivo. DNA, 1, 537-544. Gudas,J.M., Knight,G.B. and Pardee,A.B. (1990) Ordered splicing of Received March 6, 2002; revised April 16, 2002; thymidine kinase pre-mRNA during the S phase of the cell cycle. Mol. accepted April 22, 2002 Cell. Biol. , 10, 5591-5595. Hall,S.L. and Padgett,R.A. (1994) Conserved sequences in a class of rare eukaryotic nuclear introns with non-consensus splice sites. J. Mol. Biol. , 239, 357-365. Hall,S.L. and Padgett,R.A. (1996) Requirement of U12 snRNA for in vivo splicing of a minor class of eukaryotic nuclear pre-mRNA introns. Science, 271, 1716-1718. Hirose,Y. and Manley,J.L. (2000) RNA polymerase II and the integration of nuclear events. Genes Dev., 14, 1415-1429. Ivey-Hoyle,M., Conroy,R., Huber,H.E., Goodhart,P.J., Oliff,A. and Heimbrook,D.C. (1993) Cloning and characterization of E2F-2, a novel protein with the biochemical properties of transcription factor E2F. Mol. Cell. Biol. , 13, 7802-7812. Jackson,I.J. (1991) A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res. , 19, 3795-3798. Kessler,O., Jiang,Y. and Chasin,L.A. (1993) Order of intron removal during splicing of endogenous adenine phosphoribosyltransferase and dihydrofolate reductase pre-mRNA. Mol. Cell. Biol. , 13, 6211---6222. Kozak,M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. , 196, 947-950. Levine,A. and Durbin,R. (2001) A computational scan for U12- dependent introns in the human genome sequence. Nucleic Acids Res. , 29, 4006-4013. Miller,D.M.,3rd, Desai,N.S., Hardin,D.C., Piston,D.W., Patterson,G.H., Fleenor,J., Xu,S. and Fire,A. (1999) Two-color GFP expression system for C.elegans. Biotechniques, 26, 914-918. Misteli,T. and Spector,D.L. (1999) RNA polymerase II targets pre­ mRNA splicing factors to transcription sites in vivo. Mol. Cell, 3, 697-705. Montzka,K.A. and Steitz,J.A. (1988) Additional low-abundance human small nuclear ribonucleoproteins: Ul 1, U12, etc. Proc. Natl Acad. Sci. USA, 85, 8885-8889. Mount,S.M., Burks,C., Hertz,G., Stormo,G.D., White,O. and Fields,C. (1992) Splicing signals in Droso phila: intron size, information content and consensus sequences. Nucleic Acids Res. , 20, 4255-4262. Otake,L.R., Scamborova,P., Hashimoto,C. and Steitz,J.A. (2002) The divergent U12-type spliceosome is required for pre-mRNA splicing and is essential for development in Drosophila. Mol. Cell, 9, 439-446. Peng,Y., Schwarz,E.J., Lazar,M.A., Genin,A., Spinner,N.B. and Taub,R. (1997) Cloning, human chromosomal assignment and adipose and hepatic expression of the CL-6/INSIG 1 gene. Genomics, 43, 278-284. Pierandrei-Amaldi,P., Bozzoni,I. and Cardinali,B. (1988) Expression of the gene for ribosomal protein Ll in Xenopus embryos: alteration of gene dosage by microinj ection. Genes Dev., 2, 23-31. Robberson,B.L., Cote,G.J. and Berget,S.M. (1990) Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. , 10, 84-94. Sharp,P.A. and Burge,C.B. (1997) Classification of introns: U2-type or U12-type. Cell, 91, 875-879. Solnick,D. (1985) Trans splicing of mRNA precursors. Cell, 42, 157-164. Spafford,J.D., Spencer,A.N. and Gallin,W.J. (1998) A putative voltage­ gated sodium channel a subunit (PpSCNl) from the hydrozoan 38 15 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

The splicing of U12‐type introns can be a rate‐limiting step in gene expression

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/the-splicing-of-u12-type-introns-can-be-a-rate-limiting-step-in-gene-iStHHc00ZE

References (47)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 2002
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1093/emboj/cdf297
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal Vol. 21 No. 14 pp. 3804-3815, 2002 The splicing of U 12-type introns can be a rate-limiting step in gene expression class introns, mutation to GU-AG termini does not Abhijit A.Patel, Matthew McCarthy and interfere with splicing via the Ul2-dependent pathway Joan A.Steitz (Dietrich et al., 1997). In fact, surveys of genomic Department of Molecular Biophysics and Biochemistry, databases have shown that the majority of naturally Howard Hughes Medical Institute, Yale University School of occurring Ul2-type introns possess GU-AG termini Medicine, New Haven, CT 06536, USA (Sharp and Burge, 1997; Burge et al., 1998). Corresponding author Examples of U12-type introns are found in virtually all e-mail: [email protected] metazoan taxa, including vertebrates, insects, plants and cnidarians, but are absent from Caenorhabditis elegans, Some protein-coding genes in metazoan genomes con­ Saccharomyces cerevisiae, Schizasaccharomyces pombe tain a minor class of introns that are excised by a dis­ and protists (Burge et al., 1998). A total of 60 non­ tinct, low-abundance spliceosome. We have developed redundant Ul2-type introns were identified in a search of a quantitative RT-PCR assay that allows comparison all available genomic sequences in 1998 (Burge et al., of the relative rates of intron removal from the tran­ 1998), and a more recent search of the human genome scripts present in a pre-mRNA population. We show yielded 404 examples (Levine and Durbin, 2001). Thus, that the 012-type introns are more slowly spliced than the frequency of occurrence ofU12-type introns relative to the major-class (U2-type) introns from three endo­ U2-type introns is in the range of 0.15 to 0.34% in genous pre-mRNAs in human tissue culture cells. In vertebrates, and lower in other taxa (Burge et al., 1998; Drosophila melanogaster S2 cells, using minigene con­ Levine and Durbin, 2001). U12-type introns can be found structs designed to produce nearly identical mRNAs, at any position and almost always co-exist with U2-type we observe increased expression of fluorescent protein introns within the same gene. In humans, the mean length and mature mRNA upon mutation of a 012-type to a of U12-type introns (3600 bp) is similar to that of U2-type U2-type intron. These results provide evidence that introns (4130 bp) (Levine and Durbin, 2001), but does not the level of gene expression in vivo is lowered by the yet include introns exceeding 20 kb. presence of a 012-type intron and implicate the 012- By comparing introns at homologous positions (in terms type spliceosome as a target in the post-transcriptional of codon location and phase) in homologous genes from regulation of gene expression. different species, Burge et al. (1998) concluded that Ul2- Keywords: pre-mRNA/regulation of gene expression/ type introns occurred much more frequently in early spliceosome/splicing rate/Ul2-type intron evolutionary history and were either lost or converted to U2-type introns over time. Yet, Burge et al. (1998) identified several U12-type introns that are remarkably Introduction conserved, one example being the second intron of the sodium channel ex. subunit gene in humans and jellyfish, A rare, divergent class of introns was identified by Jackson organisms that diverged at least 600-800 million years ago (1991) and Hall and Padgett (1994); they noticed a few (Spafford et al., 1998). Perhaps even more surprising is the introns with unusual AU and AC dinucleotides at their 5' finding of Ul2-type introns at non-homologous positions and 3' termini, differing from the nearly invariant GU and in several paralogous genes (Burge et al., 1998). AG termini of canonical introns. These minor-class introns were further distinguishable from major-class introns These observations suggest that the few Ul2-type based on highly conserved sequences at their 5' splice introns that have resisted conversion or loss may have site and branch site, as well as by the lack of a poly­ been retained over evolutionary time because their pyrimidine tract upstream of the 3' splice site (Hall and presence is important to the genes that harbor them. Padgett, 1994). Sequence complementarity suggested that Might they play an indispensable role in the regulation of the 5' splice sites and branch sites of these introns might gene expression? More specifically, if Ul2-type introns interact with Ul 1 and U12 snRNPs, respectively (Hall and are spliced more slowly than neighboring U2-type Padgett, 1994). It was subsequently shown that the introns in the same pre-mRNA, then their removal could excision of minor-class introns is indeed mediated by represent the rate-determining step in the expression of a distinct low-abundance spliceosome. The Ul2-type that gene. spliceosome contains U11, U12, U4atac and U6atac Here, we have directly tested the hypothesis that Ul2- snRNPs, which are the functional analogues of the type introns are excised more slowly than U2-type introns. major-class Ul, U2, U4 and U6 snRNPs, while the US We first developed a quantitative RT-PCR assay to assess snRNP participates in the splicing of both Ul2-type and relative splicing rates by measuring the levels ofunspliced classical (U2-type) introns (Hall and Padgett, 1996; Tarn introns in the endogenous population of cellular pre­ and Steitz, 1996a,b). Whereas AU-AC termini were mRNAs. We examined the pre-mRNAs of three human initially considered to be a defining feature of minor- genes, and observed that the Ul2-type intron was the most 3804 © European Molecular Biology Organization Slower excision of U12-type introns l l !p; §I r 7 3 ,U i4 � 3 IR ,il: 1 7 3 2B. I "t 1Ca� (' � IOnt Tnmcated in viuo-transcribed control RN As Primers lIIT, lF,and lR Prlmen lRT, 211, and :2R Fi g . 1. Assessing in vivo splicing rates by quantitative RT-PCR. Quantitation of unspliced introns from total cellular RNA containing pre-mRNAs of a hypothetical two intron-containing gene is schematized. In vitro-transcribed control RNA standards, truncated relative to the cellular RNA sequence by 10 nt, are added in equal amounts to separate reaction tubes containing a fixed amount of total cellular RNA. Reverse transcription is performed using short primers complementary to intronic sequences (lRT or 2RT). cDNAs are then PCR amplified using primer pairs that only amplify unspliced sequences (lF/lR or 2F/2R). The cellular and control RNA amplicons are then electrophoretically separated, and the quantity of each unspliced intron is inferred from the ratio of the amplicons produced. slowly spliced in each case. Secondly, we asked whether As schematized in Figure 1, reverse transcription was replacing the consensus sequences of a naturally occurring carried out using a sequence-specific primer for each U12-type intron with those of a U2-type intron would intron. PCR was then performed using primer pairs that affect the efficiency of gene expression. Using transiently amplify only unspliced sequences: each forward primer transfected reporter constructs that monitor splicing by the was complementary to 5' exonic sequences and each production of different colored fluorescent proteins in reverse primer was complementary to downstream intro­ Drosophila melanogaster tissue culture cells, we observed nic sequences. For each intron, a control RNA standard that mutational conversion of a U12-type intron to a U2- that possessed RT and PCR amplification efficiencies type intron does dramatically increase protein and mRNA closely matched to those of the cellular RNA being levels. analyzed was created. These control RNAs were identical to the target cellular sequences with the exception of an internal 10-nucleotide deletion. Because amplification Results variability can arise at the reverse transcription step due to RNA secondary structure impeding the polymerase A quantitative RT-PCR method to assess relative (Freeman et al., 1999), we designed the RNA standards to rates of intron removal mimic the local secondary structure of each target by We devised a method for evaluating the relative rates of including sequences from most of the upstream exon and intron removal from a particular transcript by determining > 195 nt of the intron. Co-amplification of the cellular RNA the abundance of intron sequences within a steady-state population with a known quantity of each RNA standard population of partially processed cellular pre-mRNAs. If therefore yielded amplicons that differed in size by 10 nt. the excision of a Ul2-type intron occurs more slowly than By comparing their production after separation on a that of major-class introns in the same pre-mRNA, then the polyacrylamide gel, the amount of the cellular RNA amount of unspliced Ul2-type sequences should be higher sequence present was quantitated. than each of the other intron sequences. Indeed, it can be For each gene studied, the concentration of unspliced mathematically demonstrated that the amount of each U12-type intron within a fixed amount of total cellular unspliced intron within a steady-state pre-mRNA popula­ RNA was determined by titration with varying amounts tion is inversely proportional to the relative rate of removal of RNA standard (data not shown). Then, that amount of of that intron (see Supplementary data available at The RNA standard for each of the gene's introns was added to EMBO Journal Online). Because the cellular levels of separate tubes containing identical amounts of total RNA unspliced pre-mRNAs were expected to be very low, the extreme sensitivity of quantitative RT-PCR was exploited (Figure 1). If the U2-type introns are spliced more rapidly to analyze total RNA isolated from growing human tissue than the U12-type intron, then those unspliced sequences culture cells (HeLa or SK Hep). will be less abundant than the sequences of the corres- 3805 A.A.Patel, M.McCarthy and J.A.Steitz ponding RNA standards, as reflected in the ratio of the efficiencies of the two splicing pathways within trans­ co-amplified RT-PCR products generated in each tube. fected tissue culture cells. The fifth intron of the Drosophila sodium-hydrogen The most slowly spliced introns from three human exchange channel gene, NHE3, was chosen for analysis pre-mRNAs in viva are U12-type because its adjacent exons and introns are small (see The three human Ul2-type intron-containing genes chosen Figure 3A), facilitating the creation of small fusion for study had a relatively small number of total introns, constructs encoding fluorescent reporter proteins. Its making the analysis less cumbersome. These genes were: sequences perfectly match the optimal U12-type consen­ (i) SmE, a member of the core complex of proteins in sus (C.Burge, personal communication). Since coopera­ spliceosomal snRNPs (Stanford et al., 1988; DDBJ/ tivity between adjacent introns has been shown to EMBL/GenBank accession No. AL356980); (ii) E2F2, a influence the rate and fidelity of splicing (Robberson transcription factor involved in cell cycle regulation et al., 1990; Wu and Krainer, 1996), 496 nt of the NHE3 (Ivey-Hoyle et al., 1993; accession No. AL021154); and gene, spanning the 3' portion of the fourth exon to the (iii) INSIGl, a gene of unknown function that may be 5' portion of the sixth exon, were included in the construct. important in liver regeneration (Peng et al., 1997; A start codon with Kozak consensus (Kozak, 1987) was accession No. U96876). These genes contain four, six added to the 5' end of the segment, and the segment was and four total introns, with the U12-type intron as the first, fused, via a short linker, upstream of either YFP or CFP fourth and second intron, respectively (Figure 2A). cDNA (Miller et al., 1999). The fluorescent protein coding sequences were interrupted by insertion of the sixth intron RT-PCR quantitation of the unspliced introns from from the NHE3 gene. Therefore, the Ul2-type intron in the these three genes in the cellular RNA population is presented in Figure 2B. The upper band in each lane is the construct was flanked by native exons and U2-type introns amplicon from the cellular RNA, while the lower band is on both sides. that produced from the added RNA standard. Although the The consensus sequences within the Ul2-type intron absolute intensities of the bands can vary from lane to lane were then mutated to U2-type consensus sequences depending on the amplification efficiencies of specific derived from the first intron of the adenovirus major late primer pairs, the ratio of intensities within any given lane transcription unit, an intron whose splicing has been well provides an accurate measure of initial RNA quantities. characterized (Solnick, 1985). Replacement with these Controls without reverse transcriptase added ( data not particular sequences is reasonable since the adenovirus shown) established that no undigested genomic DNA U2-type splice site sequences closely match the contributed to the amplicon intensity. Since equal amounts Drosophila U2-type consensus sequences (Mount et al., of the RNA standards are used in each reaction for a given 1992). Changes were limited to mutations at the 5' splice gene, comparing the ratios across lanes provides a direct site, branch site, 3' splice site and the insertion of a 3' comparison of the relative amounts of each unspliced polypyrimidine tract (Figure 3A). The overall length of the intron. intron was preserved, as were the internal, non-consensus Graphical presentation of these intensity ratios sequences. Consequently, the mRNAs produced by splic­ (Figure 2B) shows that the unspliced U12-type intron ing of the converted U2-type intron and the original sequences are two- to nine-fold more abundant than the construct containing the U12-type intron were identical, neighboring U2-type intron sequences for all three pre­ except for the nine codons that differ between YFP and mRNAs analyzed. To confirm that the amplification CFP (Figure 3B). efficiencies for each intron and its corresponding 10-nt Synthesis of pre-mRNA was driven by a Gal4-respon­ deleted RNA standard were equivalent, equal amounts of sive promoter, so that expression could be induced by in vitro transcribed full-length and truncated RNAs producing Gal4 protein from either a copper-responsive corresponding to each intron were co-amplified. The metallothionein or a heat shock promoter on a separate, co­ appearance of pairs of amplicons of approximately equal transfected plasmid. Versions of YFP and CFP containing intensity in each lane (Figure 2C) allows us to conclude protein destabilizing 'PEST' sequences, which reduced that the U12-type introns within the in vivo transcripts of the half-life of the fluorescent proteins from ~24 to 2 h three human genes are indeed spliced more slowly than (Clontech product literature), were used so that the their U2-type neighbors. fluorescence signal would reflect differences in the rate of splicing rather than in protein accumulation. Also, eight Replacement of natural U12-type intron sequences hydrophobic amino acids within the predicted transmem­ with U2-type consensus sequences increases brane region (exon 5) of NHE3 were mutated (shown in protein expression in viva bold in Figure 3B) to avoid possible membrane-targeting We next asked whether a Ul2- versus a U2-type intron in of the fusion protein. Finally, to guarantee that each cell the same genetic context would lead to differential was transfected with equal amounts of each fluorescent expression of the encoded protein. We designed plasmid protein gene, the two constructs were cloned in tandem constructs that would permit unambiguous correlation of into a single plasmid (Figure 3C). To normalize for reporter protein production with splicing efficiency. The inherent differences in the fluorescence intensities of YFP constructs (Figure 3A) express either cyan (C) or yellow and CFP, a reciprocal construct was made with the (Y) fluorescent protein (FP) only when completely spliced, reversed color scheme (Figure 3C). dependent on removal of a U12-type versus a U2-type To confirm that the fluorescent signals from YFP and intron. Since the spliced mRNAs are nearly identical in CFP were completely distinguishable (Miller et al., 1999), sequence (Figure 3B), the relative intensity of the two U2Y and U2C constructs (named on the basis of the fluorescent signals provides a readout of the relative middle intron and the fluorescent color) were separately 3806 10 2 8 � --� .8� ____ _____ . �---- - ===:::::J Slower excision of U12-type introns A SmE Gene (8.5kb) 4 1.44 1.30 4.75 E2F2 Gene {21.4kb) os 2 3 2.49 6 1 c:::J -----6"'."' a 1----' "". 3;;;; '---1o,Q,77o I l§ a □ ."- '- ---1 □ INSIGl Gene (10.7kb) C===::J f-- _: !::: 40 --{ - = U12-type intron SmE E2F2 INSIGl IntronNumber Intron Number Intron Number 1 2 3 4 1 2 3 4 1 2 3 4 S 6 Cellular ampllcoil IClnt /J. ampllcon 5 1.2 so 1 40 0.8 �)J 0.6 "s 'g 2 20 0.4 ii X. 0.2 - 0 0 2 3 4 l 2 3 4 lntron Num. ber Intron Number ltron Number 1 2 3 4 I 2 3 4 5 6 l Ful ampllcoa IOnt /J. ampUcon Ratio of D.87 0.94 0.95 0.91 OJIJ 1.0S 0.79 0.9' 0.83 0.8S o.96 1.03 0. 99 0.77 Full:6 Fig. 2. U12-type introns are excised most slowly from three endogenous human pre-mRNAs. (A) The intron-exon structure is depicted for the three human genes, SmE, E2F2 and INSIG I. Shaded boxes represent exons, thin lines represent U2-type introns and thick lines represent U12-type introns, with intron lengths (in kb) indicated above. (B) Above are shown the gels from which the ratios of cellular to control amplicons (105-164 nt long with controls being 10 nt shorter) were measured. The amounts of each unspliced intron within the pre-mRNA population from growing HeLa cells (for SmE and E2F2) or SK Hep cells (for INSIGl) are shown graphically below. Solid bars represent U2-type introns and hatched bars represent U12- 19 19 18 type introns, with error bars indicating the standard deviation of two experiments. 4.56 X 10-- moles, 1.01 X 10-- moles and 4.47 X 10-- moles of control RNA standards were added per microgram of total cellular RNA for the analysis of introns from SmE, E2F2 and INSIGl, respectively. (C) Control co-amplification of equal amounts of in vitro-transcribed full-length and 10-nt truncated RNAs shows approximately equal production of amplicons (ratio of 0.91 ± 0.08). 10-- moles of each RNA species were RT-PCR amplified. transfected into Drosophila S2 cells with a metallo­ detected with either the cyan or the yellow filter set, but thionein-Gal4 plasmid. Expression was induced 24 h later never with both (Figure 4A-C). Fluorescence from cells by adding cupric sulfate, and cells were viewed after 12 h. transfected with either the U2Y or U2C construct was, on As expected, fluorescence from any single cell was average, quite robust, whereas fluorescence from cells -- -- - 1-----""' '------ A.A.Patel, M.McCarthy and J.A.Steitz transfected with the U12Y or U12C construct appeared pattern: each transfected cell exhibited at least 5-fold more much weaker (data not shown). yellow fluorescence than cyan fluorescence (Figure 4G-I). Next, the tandem U2C-U12Y plasmid (Figure 3C) was Because all other differences between the constructs are co-transfected with a metallothionein-Gal4 plasmid, and controlled by the use of reciprocal plasmids, the altered gene expression induced. While different cells within the expression levels can be ascribed to the identity of the transfected population exhibited different fluorescence middle intron. intensities, any particular cell consistently showed at least To confirm that the fifth intron of the NHE3 gene is in a 5-fold higher fluorescent signal with the cyan filter than fact spliced by the U12-type splicing machinery, excision with the yellow filter (based on comparison of integrated of this intron was examined in endogenous pre-mRNA pixel intensities from CCD-captured digital images) prepared from Droso phila larvae that were either homo­ (Figure 4D-F). Transfection of the reciprocal tandem or heterozygous for a P-element disruption of U6atac U12C-U2Y plasmid (Figure 3C) yielded the opposite (characterized by Otake et al., 2002). The homozygous U12Y: Segment o f Dro • ophila NHE3 Geoe ------- A- -------- U2- 170 73 ■1o !■� � .. 1o1w ,1w . . • • • • • • • • • • ■■1�a.c.Jai;!i2.2..li.H H� • �Ci •c1cxric:&c: D Native 12-Type Sequences Converted t o 02-Type D 'i ATTCAAC TCTT AAACCTATATGC GC TAGTCTTGGGCGAATCTGTGC lA TGGTGGCCA GA_ J 70 J' � egtttqcta c ttttt tt tcgttggq e.�t� gt g 1 C 'l'Q(,$GTOOC CAT tfcMcaA _ _ _ _ ca.tcattto ttt ta @ ATTCAAAA A£CGGGGAA T'l'CGMAC T f � AAJ AJ 210 2 a o p.ocTI'T'l'CT -ft CGC'J'C G'l".lW- �� cjTGATGA�'J1 �TTGACAGCA: tgtgaa tggtaaaat tt ga tt.aa tt. t. t. t. ttacc tca gtggca ttg a11at gta t. a tcta t.l:; ocgc 420 � _g j1 ¥ :i 0 . . attaatt. agaaaacacc tatgc 490 . . . TGGA TC GGCTOGATCGGCTGGACCGG'l'CGCCAC TGGTGAGCAAGGGCO 560 . . AGO AGC TGT'l'CA CCGG GGTGG TGCCCA TCCTGGTC GAG CTGGACGGCGA CGTAAAC GGCCACMGTTCAG 630 • • • • • • <Ii .. .CGTGTc CGGq,AGGGCGA Gg.. taa gttatt: t: .t: c ag cac ag a_aat a ct.ta a apagg cgttcc.caaa ca gaa a . S1t.tai:.t.t.t.t.c,t.t.tt. t.cacp. gGGCGA TGC .f.'.:A CCT ACGGCf.AGC:I'GA _:_ CCC;rG AAG TT CA.'l � TGCA CCACC 770 pGCAAGC TGC � CG'l.'GCCC � CCA CCCTC � TGACCA C•Cfal�- :-Ii i.P(:.s:t. � CA 0G TG9, GC T_ 840 ACCCCGACCACA'l'GAAGCAGCA CGAC'l"I'CTTCAAGTCCGCCA'l'GCCC GAA GGCTAC'G TCCAGGAGCGCAC 910 . . . . . . . . .�'J"CT'l' CTTCfJI GG ACGACGpCM CT ACU�A CCCGCGCC9MG'I'GAAG 'ry'C GAGGG "CGA_ C CCCTOOTG 980 MCCOCA TCG MGGG OO A GGAC G AACA 'l'C AC GTACA 1050 [\GCTG 9' q.A 9C � AAGF'J'OOA CS:CACMCG CJATA C'M'CMGAT • 1120 • co::.ccACMC f. TC GA GGA C��TC GCCG ACFACT ACCACC.AGAACACC:CC CATCCGCGAC. 1190 GGCCCOG'l'GCTGC'l'GCCCGACAACACTACCTG CAG'l'CCGCCCTGAGCAAAGACCCCAACGAGA 1.260 11 .. • • • t • • ATGGTC C TGGA GTTCG ACCGCC GC GOOA TCA TCGQCA 'ro CGAGCTGTA 13 3 a f � TGF ,'.l'G f � G." CMGAA OCTT A CA CCOCCGGAGG GT 1400 . . GCGCGA'.I'CA TCGAC'l"l' GCQATGTC Slower excision of U1 2-type introns U6atac-disrupted larvae die at the third instar because of a expression of the protein from the mRNA generated by deficiency in U12-type splicing. Analysis of total RNA by U2-dependent splicing only. The relative difference in RT-PCR revealed that the U6atac-deficient larvae (at expression can be calculated from the slopes of the two ~60 h post egg-laying) accumulated substantially higher lines, taking into account the decreased CFP detection amounts of unspliced intron S as compared with the sensitivity and assuming that the nine amino acids that control heterozygous larvae (data not shown), demonstrat­ change the color of the fluorescent protein do not affect ing excision of this intron by the Ul2-type spliceosome. protein expression or stability. We conclude that the expression of fluorescent protein increases 6-to 8-fold when the U12-type intron is converted to a U2-type The 6- to 8-fold diff erence in fluorescent protein intron. expression is not induced by saturation of the U12-type splicing machinery The linearity of the data points in Figure SD and E also The results from fluorescence microscopy, showing a excludes the possibility that the observed differences consistent and significant difference in the levels of YFP result artificially from saturation of the U12-type splicing and CFP from the reciprocal constructs containing Ul2- machinery by high levels of pre-mRNA expressed from type and U2-type introns (Figure 4D-1), were extended by the transfected constructs. Because the scale of the axes fluorescence-activated cell sorting (FACS). We first are logarithmic, the fluorescence emitted by individual verified that cyan and yellow fluorescence signals can be cells in the population differed by several orders of detected independently by FACS. Compared with mock­ magnitude. Over this entire range, the proportion of yellow transfected cells, which exhibit minimal intensity on each to cyan fluorescence was roughly constant. For example, a channel (Figure SA), S2 cells transfected with U2C or strongly fluorescent cell making SO-fold more U2-type U2Y (and metallothionein-Gal4, induced as above) reporter protein also made ~SO-fold more U12-type reporter protein compared with a weakly fluorescent cell. showed significant fluorescence on the cyan or yellow This would not be the case if the capacity of the U12-type channel, respectively, and negligible fluorescence on the splicing machinery were saturated by high expression of other channel (Figure SB and C). The large range of the fluorescent protein pre-mRNA. Likewise, when dif­ fluorescence intensities seen (note the logarithmically ferent amounts of U2C-U12Y or U12C-U2Y were scaled axes) probably resulted from cells being transfected deliberately transfected into S2 cells (over a 20-fold with different numbers of plasmids or in different physio­ range), the ratio of cyan to yellow fluorescence in each cell logical states. remained approximately constant (within detection limits) Cells transfected with the tandem U2C-U12Y or despite great differences in the absolute fluorescence Ul 2C-U2Y plasmid displayed the same patterns of intensity (data not shown). fluorescence as previously observed by microscopy: the intensity of the protein expressed from the U2-type intron containing gene was always several-fold greater than from Presence of a U12-type intron hinders production that containing the U12-type intron (Figure SD and E). of mature mRNA This pattern manifests itself on the FACS plot as a roughly To confirm that the observed differences in fluorescent linear set of points through which a best-fit line can be protein expression were caused by differences in the drawn. As expected, the slope of the line for the efficiency of U2-type versus U12-type splicing, the effects U12C-U2Y transfected cells is greater than that for the of intron conversion were examined directly at the RNA U2C-U12Y transfected cells, because of increased relative level. S2 cells were co-transfected with metallothionein- U2C-U1 2Y: U1 2C-U2Y : U12 Fi. 3. Plasmids that report the efficiency of Ul2-type versus U2-type splicing. (A) A segment of the D.melanogaster NHE3 gene including introns 4 (U2-type) and 5 (U12 -type) and their flanking exons was fused, via a linker, to a yellow (Y) or cyan (C) fluorescent protein coc1ing sequence contain­ ing destabilizing 'PEST' sequences to form U12 Y or U12 C. Intron 6 (U2-type) of NHE3 was inserted into the CFP or YFP coc1ing sequences. A Gal4- responsive promoter and a Kozak consensus translation start site were directly upstream of the fusion protein. Exon and intron lengths are indicated above and below (not drawn to scale). To form U2Y (or U2C), consensus splicing sequences of the U1 2-type intron were mutated to U2-type sequen­ ces derived from an adenovirus intron, keeping the intron length constant. (B) The sequences of the protein-coc1ing regions of the fusion constructs are shown, with exon sequences in uppercase and intron sequences in lowercase and alternative sequences indicated. Red, Ul2-type consensus sequences; green, converted U2-type sequences; gray, NHE3 exon sequences; brown, linker sequences; orange, PEST sequences. The mutations converting cyan to yellow fluorescence are highlighted in cyan and yellow, respectively. The mutations introduced to change hydrophobic amino acids in the prec1icted transmembrane domain of exon 5 are in bold. (C) A plasmid containing the U2C and U12 Y constructs in tandem (named U2C-U 12 Y) was created to ensure equal transfection of both constructs. The reciprocal plasmid (U1 2C-U2Y) with a reversed color scheme controlled for inherent c1iffere nces in CFP and YFP fluorescence yield. 3809 A.A.Patel, M.McCarthy and J.A.Steitz YFP Filter Pha e CFP Filter Fig. 4. U2-dependent splicing produces brighter fluorescence than Ul2-dependent splicing in Drosophila S2 cells. (A-C) CFP and YFP fusion proteins are distinguishable. Drosophila S2 cells were separately co-transfected with either U2C or U2Y and metallothionein-Gal4, mixed and viewed 12 h after cupric sulfate induction using a YFP filter (A), phase contrast (B) or a CFP filter (C). (D-1) S2 cells co-transfected with U2C-Ul2Y (panels D-F) or U12C-U2Y (panels G-1) and metallothionein-Gal4 were similarly induced and viewed using a YFP filter (D and G), phase contrast (E and H) or a CFP filter (F and I). Similar results were obtained with constructs lacking 'PEST' sequences (data not shown). Gal4 and either U2Y or U12Y, expression was induced below the full-length bands (Figure 6A), suggesting that after 24 h, and total RNA at various times after induction the pre-mRNA is prone to degradation if not efficiently was analyzed by northern blot. Cells transfected with the spliced (Bousquet-Antonelli et al., 2000). U2Y construct showed rapid accumulation of mature Finally, to examine differences in the splicing rate of the mRNA, whereas cells transfected with the U12Y construct middle intron relative to its neighboring introns for both accumulated less mature mRNA (Figure 6A). Also, a more the U2Y and U12Y constructs, we carried out quantitative slowly migrating band was observed in the U12Y­ RT-PCR experiments, as described for the endogenous transfected cells. Hybridization of this band with a probe human pre-mRNAs (Figure 1). S2 cellular RNA prepared specific for the middle intron (data not shown) and further 12 h after induction of expression was RT-PCR amplified analysis by RT-PCR (see below) indicate that it consists of in the presence of a single in vitro transcribed RNA partially unspliced species predominantly containing the standard containing three separate 10-nt deletions, allow­ Ul2-type intron. Lanes corresponding to the U12Y­ ing quantitation of all three introns. The levels of unspliced transfected cells also reproducibly showed a smear introns from the U12Y construct indicate that the 3810 Slower excision of U12-type introns Mock Transfecte d ' '' "" 1 o> ' '" " ,oi� ' T'" " 10' CFP lntiensly U2Y Transfected . U2C Transfecte d ... 1 02 CFP lnlan1ly D � U2C-012Y T ra ns fected E � U1 2C-UlY Transfect ed Fi g . 5. FACS analysis of transfe cted S2 celJs. Density plots of yellow versus cyan fluorescence intensity for S2 cells co-transfe cted with metallothio­ nein-Gal4 and various plasmids, obtained 12 h after cupric sulfate induction. The flow cytometer detection optics are inherently less sensitive for CFP than for YFP. 50 000 cells were observed on each plot. (A) Mock-transfe cted S2 cells show minimal cyan or yellow fluorescence. (B) U2Y-transfe cted celJs show only yelJow fluorescence. (C) U2C-trans fe cted celJs show only cyan fluorescence. (D) U2C-U12Y-transfected celJs show greater cyan than yellow fluorescence (correcting for low CFP detection sensitivity). (E) U12C-U2Y-trans fe cted cells show greater yellow than cyan fluorescence. U12-type middle intron was more abundant than its U2- as evidenced by the lower relative abundance of its type neighbors, confirming that it is spliced more slowly unspliced form (Figure 6C). Interestingly, conversion to (Figure 6B). Conversion of the consensus sequences to U2-type sequences also appeared to increase the splicing U2-type dramatically increased the splicing of that intron rate of the two adjacent introns, suggesting cooperativity 38 1 1 Hours after O 6 12 18 24 Ul2Y Transfected U2Y Transfected A.A. Patel, M.McCarthy and J.A.Steitz 0 6 12 18 24 inductio n pr e-mRN A �mature mRNA .!l 2 3 4 5 6 7 8 9 10 Ul 2Y Transf ected C U2Y Transf ected lntron Number lntron Number 1, �----....------, ) � 12 -I----_,,. i l 10 -I---� � ; ij 8 +--- ....J/ e l 4 7:, - - - .. .s 0 l l 2 3 lntron Nu mber Intron Number Fi g . 6. mRNA production is slowed by inefficient splicing of a Ul2 -type intron. (A) Northern blot of total RNA isolated from S2 cells co-transfected with U2Y (lanes 1-5) or Ul2 Y (lanes 6--10 ) and metallothionein-Gal4 at the indicated times after induction of expression. The blot was successively hybridized with random-primed DNA probes complementary to the YFP coding sequence (top panel) and to a loading control, ribosomal protein 49 (bottom panel). The identity of the slowly migrating band as partially spliced pre-mRNA, was confirmed by hybridization to a probe specific for the middle intron (data not shown). (B) Quantitative RT-PCR analysis of unspliced introns (similar to Figure 2B) from total RNA prepared 12 h after induction of Ul2Y-transfected cells and amplified in the presence of a single in vitro transcribed RNA standard containing three separate 10 -nt dele­ tions, allowing quantitation of all three introns. 1. 33 X 10 -- moles of control RNA standard was added per µg of total cellular RNA. Hatched bar, Ul2-type intron; solid bars, U2 type introns; error bars, standard deviation of two experiments. (C) Similar analysis of U2Y-transfected cells. Note that JO-fold less control RNA standard (1 .33 X 10 -- moles per µg of total RNA) was used. (D) Confirmation of equal amplification efficiency of in vitro transcribed full-length and 10 -nt truncated RNAs (amplicon ratio of 1. 02 ± 0.02) (as in Figure 2C). 10 -- moles of each RNA species were RT-PCR amplified. --I -< 14 +--- Slower excision of U12-type introns in the excision of these introns. As before, to verify that the (Cafarelli et al., 1994) , within several RPL la introns amplification efficiencies of the full-length and truncated (including the Ul 2-type intron), and (ii) potential ampli­ RNAs were equal, equimolar amounts of full-length and fication of transcript sequences from both gene copies in truncated in vitro generated transcripts were co-amplified the pseudo-t etraploid genome of X. laevis. Thus, human and observed to produce amplicons of equal intensity genes were chosen for subsequent analyses. (Figure 6D) . For the three human genes analyzed, there is no obvious correlation of intron position or length with rate of excision (Figure 2). While the Ul 2-type introns are, on Discussion average, shorter than the U2-type introns , in two out of Our data support the hypothesis that Ul 2-type introns are three genes they are not the shortest intron. Also, we did excised from pre-mRNA transcripts more slowly than not observe slower splicing rates for the longer U2-type canonical U2-type introns. We demonstrate that this is the introns within these genes, consistent with previous case for the transcripts of three human genes. Additionally, findings (Gardner et al., 1988; Gudas et al., 1990; mutation of native U1 2-type to U2-type intron consensus Kessler et al., 1993; Wetterberg et al., 1996). sequences within a D.melanogaster minigene results in Our D.melanogaster splicing constructs produced signific antly increased levels of mRNA and protein mRNAs differing by only nine codons for CFP versus expression. Together, these observations suggest that YFP. It was possible that these changes affect the persistence of Ul 2-type introns over evolutionary time efficiency of either splicing, polyadenylation, export or could result from their importance as post-transcriptional translation. Therefore, the reciprocal constructs with reversed color schemes were important to control for regulators of the genes that harbor them. diff erences not only in fluorescence yield, but also Although we analyzed endogenous splicing rates for the transcripts of only three human genes, we argue that expression. Their use confirmed that the differ ences in our results are generalizable. These genes were chosen fluorescent protein expression are attributable to the because they had a small number of total intron s, whereas changed intron type. the average number of introns in Ul 2-type intron Why should U1 2-type introns be excised more slowly containing genes is ~15 (Burge et al., 1998). However, than U2-type introns? In vitro, the splicing of U1 2-type approximately one-third of these genes have <10 introns, introns has consistently been reported to be extremely and there is no obvious reason why Ul 2-type introns slow, even for several different splicing substrates (Tarn would be selectively spliced more slowly from genes with and Steitz, 1996b ; Wu and Krainer, 1996) . The ~1 00-fold only a few introns. Extrapolation to other U1 2-type intron lower abundance of the minor-class snRNPs relative to the containing genes is warranted if coincidental observation major-class snRNPs in mammalian cell nuclei and nuclear of the same pattern within the studied sample is highly extracts (Montzka and Steitz, 1988; Tarn and Steitz, improbable. The likelihood of finding by random chance 1996a) may well reduce the rate of assembly of the U12- that the Ul 2-type intron is spliced most slowly from genes dependent spliceosome. However, since splicing com­ containing 4, 4 and 6 total introns is 1/4, 1/4 and 1/6, ponents are thought to be assembled co-t ranscriptionally respectively. However, the probability of independently in vivo (Misteli and Spector, 1999; reviewed in Hirose finding this pattern for all three genes is the product of the and Manley, 2000) , the effects of snRNP concentrations individual probabilities, 1/96. Therefore, the consistency on in vivo splicing rates are not easily predictable. we observe is unlikely to occur randomly and is thus Alternatively, it is possible that slower catalysis of one probably representative of other genes containing U12- or both splicing reactions by the spliceosome underlies the type introns. It is even conceivable that if the introns we lower rate of excision of Ul 2-type introns. It will be analyzed had been those that are extremely highly interesting to explore whether the low abundance of minor-class splicing components might cause RNA conserved through evolution, more dramatic differ ences polymerase II to stall at Ul 2-type introns . in excision rates might have been observed. The existence of genes whose expression might be Indeed, another Ul 2-type intron in the ribosomal protein Lla gene of Xenopus laevis was initially regulated by the presence of inefficiently spliced introns characterized as the 'regulated third intron' (Bozzoni hints at a commonality among these genes. Burge et al. et al., 1984; Caffarelli et al., 1987, 1992; Pierandrei­ (1998) note that a large proportion of U1 2-type intron­ Amaldi et al., 1988; Fragapane et al., 1992) because of its containing genes can be categorized as 'information low efficiency of splicing. Not only did partially spliced processing', including genes involved in DNA replic­ pre-mRNAs containing this intron (and to a lesser extent, ation/repair, transcription, RNA processing and transla­ the second intron) accumulate and produce little extra tion; only a few perform operational functions such as protein upon microinjection of cloned RPL la genomic energy metabolism or biosynthesis. Could Ul 2-type sequences into Xenopus oocytes, but endogenous partially introns in these genes be acting as post-t ranscriptional spliced RPLla pre-mRNAs were detected at low levels in bottlenecks, preventing overexpression that might be uninjected oocytes (Bozzoni et al., 1984). Using our harmful to the organism? Alternatively, since expression sensitive RT-PCR assay, we have confirmed that un­ of such genes is upregulated in proliferating compared spliced Ul 2-type intron sequences are indeed present at with quiescent cells, the activity of the Ul 2-type spliceo­ higher levels than those of the other eight RPLla U2-type some may increase during proliferation. It is also possible introns in total RNA prepared from oocytes (data not that Ul 2-type splicing activity is modulated in a tissue-or shown). However, interpretation of these experiments is a developmental stage-specific manner. This could occur complicated by (i) the presence of snoRNAs, which can be through up-( or down-) regulation of any snRNA or protein removed via a pathway that competes with splicing component specific to the Ul 2-type spliceosome. The 3813 A.A.Patel, M.McCarthy and J.A.Steitz using BamHI and Bgill sites, and was inserted within a BamHI site fluorescent protein-coding constructs described here upstream of the NHE3 gene segment. Finally, tandem constructs were provide a means of investigating these questions in the created by inserting sequences from one plasmid, cut with Xhol and developmentally well-studied organism, D.melanogaster. NgoMIV, into the Xhol and Xmal sites of the second plasmid. Transfection of Drosophila 52 cells S2 cells were grown at 25 C in Shields and Sang M3 medium (Sigma) Materials and methods containing 12.5% FB S (Gibco-BRL) in 35 mm dishes and transiently Preparation of RNA standards transfected using 25 µl of Lipofectin reagent (Gibco-BRL) per dish, Segments of genomic sequences from human E2F2, SmE and INSIG 1 according to the manufacturer 's directions. For most experiments, 0.5 µg were PCR-amplified from genomic clones RPCi l-1 5005 (Sanger Centre, of reporter plasmids were co-transfected with 1.5 µg of either pmt-Gal4 Hirn:ton, Cambs, UK), RPC I11- 397 P13 (Sanger Centre), and HP-5 (Peng (metallothionein expression, gift of S.A rtavanis-Tsakonas) or heat-shock­ et al., 19 97), respectively. The segments (between 301 and 853 nt) Gal4 plasmid (gift of T.Xu). Experiments to investigate splicing included most of the upstream exon and >19 5 nt of intronic sequence saturation used between 1 µg and 0.0 5 µg reporter plasmid, supplement­ surrounding each 5' splice site. To create an RNA standard for the ing with unrelated plasmid to keep the total transfected DNA constant. Drosophila constructs, a single 872-nt segment including all three introns Expression was induced 24 h after transfection either by adding 0.7 mM was PCR-amplified from the Ul2 Y plasmid (construction of Ul2 Y cupric sulfate (Sigma) or by heat shock at 37C for 30 min. described below). Xhol and Not! restriction sites, introduced by the PCR primers, were used to insert the amplified segments into pBluescript SK+ Fluorescence microscopy vectors (Stratagene) downstream of a T7 promoter. Ten-nucleotide Cells were visualized 12 -24 h after induction using a Zeiss Axiophot II deletions were introduced by either PCR mutagenesis or using the fluorescence microscope with CFP (Ex: D436/20; Em: D480/40; BS: QuickChange Mutagenesis system (Stratagene). Oligonucleotides for 455d clp) and YFP (Ex: HQ500/20; Em: HQ5 35/30; BS: Q5 1 5lp) filter PCR cloning and mutagenesis are listed in the Supplementary data. RNA sets (Chroma). Images were captured using a Quantix CCD camera standards were prepared by in vitro transcription from the T7 promoter (Photometr ics) and analyzed with IP Lab software (Scanaly tics). essentially as described by Tarn and Steitz (1 996b), internally trace­ labelling with [cx- P]UTP. Gel-purified transcripts were quantified by FA CS analysis liquid scintillation counting and stored at -70C in aqueous solution Cells were analyzed 12 -24 h after induction with a FACS Vantage dual laser flow cytometer (Becton-Dickinson). CFP was excited at 457 nm with containing 20 µg/ml yeast total carrier RNA. a Spectra-Physics 2025 argon laser and the fluorescence emission was Quantitative RT-PCR analysis collected through a 480/30 nm band pass filter. YFP was excited at 514 nm RNA for analysis of E2F2 and SmE was prepared, using Trizol (Gibco­ using a Coherent Innova 70 argon-krypton laser and the fluorescence BRL) according to the manufacturer 's directions, from log-phase HeLa collected through a 550/30 nm band pass filter. Fifty thousand cells were cells grown in suspension in RPM! (Gibco-BRL) containing 10% fetal observed for each sample. Statistical analysis was performed using bovine serum (F BS; Gibco-BRL). RNA for analysis of INSIGl was WINMIDI software (Joseph Trotter, Scripps Clinic, CA). similarly prepared from ~ 70% confluent SK Hep cells grown in 35 mm dishes in Dulbec co's modified Eagl e's medium (Gibco-BRL) with 10% Northern blot analysis FB S. RNA for analysis of Ul2 Y and U2Y was isolated from transiently Growth medium was removed from S2 cells at various times after transfected Drosophila S2 cells 12 h after induction of expression as induction, and cells were disrupted in 1 ml of Trizol (Gibco-BRL) for described below. Contaminating genomic DNA was removed by treating RNA isolation according to the manufacturer 's instructions. Total RNA with RQl DNase (Promega) in 5 mM MgCh and 50 mM Tris pH 8.0 at (~ 10 µg) was run per lane on a formaldehyde--agarose gel for northern ° ° 37C for 1 h, followed by heat inactivation at 65 C for 10 min. Reverse blotting and was probed with internally P-labelled DNA probes transcription was then performed using Thermoscript RT (Invitrogen) covering either the entire open reading frame of YFP, or ribosomal according to the manufactur er 's directions, with 0.5 µM gene-specific protein 49 (gift of L.Cooley), or the non-consensus internal sequences primers (see Supplementary data), 7 .5 ng/µl (for SmE, E2F2 and INSIG 1) (nucleotides 319 -436, Figure 3B) of NHE3 intron 5. or 0. 188 ng/µl (for U12 Y and U2Y) total cellular RNA, and various 2 22 concentrations (between 3.36 X 10 - 0 and 7.6 0 X 10 - moles/µl) of Supplementary data in vitro transcribed RNA standard s. RT reactions were incubated at 37C Supplementary data are available at The EMB O Journal Online. ° ° ° for 15 min, then 55 C for 30 min, then 65 C for 30 min and finally 85C for 10 min. Escherichia coli RNase H (0. 1 U/µl; Invitrogen) were added and the samples incubated at 37C for 30 min. PCR was then performed Acknowledgements using Platinum Tag polymerase (Invitrogen) in the buffer supplied with 1. 5 mM MgC1 , 0.4 mM dNTPs, 250 nM unlabelled primers (see We thank Chris Burge for communicating unpublished findings which Supplementary data) doped with 5' -radiolabelled forward primer (to label identified the Drosophila NHE3 gene for incorporation into our reporter only one strand of amplicon), and 10% (by volume) of reverse-transcribed plasmids. We are also grateful to Rocco Carbone for assistance with the cDNA. Between 24 and 28 cycles of PCR were performed with 2 min FACS experiments, and to Kazio Tycowski, Michael Koelle and Carl C for extension times and annealing temperatures of 62.5, 60, 61. 5 and 61 Hashimoto for critical reading of the manuscript. This work was the E2F2, SmE, INSIGl and Ul2Y/U2Y samples, respectively (based on supported by grant GM 26 154 from the National Institutes of Health to lowest predicted T .J . Amplicons were separated on a 10% polyacryl­ J.A .S., who is an investigator at the Howard Hughes Medical Institute. arnide sequencing gel, and quantitated using a Molecular Dynamics Phosphorlmager. Construction of Drosophila splicing reporter plasmids References Reporter plasmids contained a Drosophila NHE3 gene segment fused to Bousq uet-Antonelli ,C., Presutti ,C. and Tollervey ,D. (2000) Identification CFP or YFP coding sequences (destabilized with 'PEST' sequences) of a regulated pathway for nuclear pre-mRNA turnover. Cell, 102, (Clontech) with modifications as schematized in Figure 3 (sequences 765-775. available upon request). The NHE3 segment spanning exon 4 through exon 6 was PCR-amplified from genomic clone DS07 13 4 (Berkeley Bozzoni,I., Fragapa ne,P ., Annesi,F., Pierandrei-Amaldi ,P., Amaldi,F. Drosophila Genome Database) with primers that introduced an upstream and Beccari,E. (198 4) Expression of two Xenopus laevis ribosomal protein genes in in jected frog oocytes. A specific splicing block translation start site, a downstream linker sequence and mutations to interferes with the L1 RNA maturati on. J. Mol. Biol. , 180, 987 -10 05. remove hydrophobic amino acids from the predicted transmembrane domain (see Supplementary data). Alternative primers were used to Brand,A.H. and Perrimon,N. (19 93) Targeted gene expression as a mutate Ul2-type consensus sequences to U2-type sequences. PCR means of altering cell fates and generating dominant phenotypes. products were inserted between the Bgill and Agel sites of pd2-ECFP-Nl Development, 118, 40 1-415. and pd2-EYFP-Nl plasmids (Clontech). Synthetic DNA including the Burg e,C.B ., Padget t,R.A. and Sharp,P.A. (19 98) Evolutionary fates and entire NHE3 intron 6 sequence (see Supplementary data) was inserted origins of Ul2-type introns. Mol. Cell, 2, 773- 785. into CFP and YFP coding sequences via a Beg! site. A Gal4-responsive Caffare lli,E., Fragapa ne,P ., Gehring ,C. and Bozzoni,I. (1 987) The UAS promoter was excised from pUAST (Brand and Perrimon, 19 93) accumulation of mature RNA for the Xenopus laevis ribosomal 38 14 Sl ower excision of U12-type introns protein L 1 is controlled at the level of splicing and turnover of the jellyfish, Polyorchis penicillatus: structural comparisons and precursor RNA. EMBO J. , 6, 3493-3498. evolutionary considerations. Biochem. Biophys. Res. Com mun. , 244, Caff arelli,E., Fragapane,P. and Bozzoni,I. (1992) Inefficient in vitro 772-780. splicing of the regulatory intron of the L1 ribosomal protein gene of Stanford,D.R., Perry,C.A., Holicky,E.L., Rohleder,A.M. and Wieben, X.laevis depends on suboptimal splice site sequences. Biochem. E.D. (1988) The small nuclear ribonucleoprotein E protein gene Biophys. Res. Commu n. , 183, 680-687. contains four introns and has upstream similarities to genes for Caff arelli,E., Arese,M., Santoro,B., Fragapane,P. and Bozzoni,I. (1994) ribosomal proteins. J. Biol. Chem., 263, 17772-17779. In vitro study of processing of the intron-encoded Ul6 small nucleolar Tarn,W.Y. and Steitz,J.A. (1996a) Highly diverged U4 and U6 small RNA in Xenopus laevis. Mol. Cell. Biol. , 14, 2966-2974. nuclear RNAs required for splicing rare AT-AC introns. Science, 273, Dietrich,R.C., Incorvaia,R. and Padgett,R.A. (1997) Terminal intron 1824-1832. dinucleotide sequences do not distinguish between U2- and U12- Tarn,W.Y. and Steitz,J.A. (1996b) A novel spliceosome containing Ul 1, dependent introns. Mol. Cell, 1, 151-160. Ul2 and US snRNPs excises a minor class (AT-AC) intron in vitro. Fragapane,P., Caff arelli,E., Lener,M., Prislei,S., Santoro,B. and Cell, 84, 801-811. Bozzoni,I. (1992) Identification of the sequences responsible for the Wetterberg,I., Bauren,G. and Wieslander,L. (1996) The intranuclear site splicing phenotype of the regulatory intron of the L1 ribosomal protein of excision of each intron in Balbiani ring 3 pre-mRNA is influenced gene of Xenopus laevis. Mol. Cell. Biol. , 12, 1117-1125. by the time remaining to transcription termination and different Freeman,W.M., Walker,S.J. and Vrana,K.E. (1999) Quantitative excision efficiencies for the various introns. RNA, 2, 641---651. RT-PCR: pitfalls and potential. Biotechniques, 26, 112-122. Wu,Q. and Krainer,A.R. (1996) Ul-mediated exon definition Gardner,D.G., Cathala,G., Lan,N.Y., David-Inouye,Y. and Baxter,J.D. interactions between AT-AC and GT-AG introns. Science, 274, (1988) Processing of the primary transcript for the rat growth hormone 1005-1008. gene in vivo. DNA, 1, 537-544. Gudas,J.M., Knight,G.B. and Pardee,A.B. (1990) Ordered splicing of Received March 6, 2002; revised April 16, 2002; thymidine kinase pre-mRNA during the S phase of the cell cycle. Mol. accepted April 22, 2002 Cell. Biol. , 10, 5591-5595. Hall,S.L. and Padgett,R.A. (1994) Conserved sequences in a class of rare eukaryotic nuclear introns with non-consensus splice sites. J. Mol. Biol. , 239, 357-365. Hall,S.L. and Padgett,R.A. (1996) Requirement of U12 snRNA for in vivo splicing of a minor class of eukaryotic nuclear pre-mRNA introns. Science, 271, 1716-1718. Hirose,Y. and Manley,J.L. (2000) RNA polymerase II and the integration of nuclear events. Genes Dev., 14, 1415-1429. Ivey-Hoyle,M., Conroy,R., Huber,H.E., Goodhart,P.J., Oliff,A. and Heimbrook,D.C. (1993) Cloning and characterization of E2F-2, a novel protein with the biochemical properties of transcription factor E2F. Mol. Cell. Biol. , 13, 7802-7812. Jackson,I.J. (1991) A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res. , 19, 3795-3798. Kessler,O., Jiang,Y. and Chasin,L.A. (1993) Order of intron removal during splicing of endogenous adenine phosphoribosyltransferase and dihydrofolate reductase pre-mRNA. Mol. Cell. Biol. , 13, 6211---6222. Kozak,M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. , 196, 947-950. Levine,A. and Durbin,R. (2001) A computational scan for U12- dependent introns in the human genome sequence. Nucleic Acids Res. , 29, 4006-4013. Miller,D.M.,3rd, Desai,N.S., Hardin,D.C., Piston,D.W., Patterson,G.H., Fleenor,J., Xu,S. and Fire,A. (1999) Two-color GFP expression system for C.elegans. Biotechniques, 26, 914-918. Misteli,T. and Spector,D.L. (1999) RNA polymerase II targets pre­ mRNA splicing factors to transcription sites in vivo. Mol. Cell, 3, 697-705. Montzka,K.A. and Steitz,J.A. (1988) Additional low-abundance human small nuclear ribonucleoproteins: Ul 1, U12, etc. Proc. Natl Acad. Sci. USA, 85, 8885-8889. Mount,S.M., Burks,C., Hertz,G., Stormo,G.D., White,O. and Fields,C. (1992) Splicing signals in Droso phila: intron size, information content and consensus sequences. Nucleic Acids Res. , 20, 4255-4262. Otake,L.R., Scamborova,P., Hashimoto,C. and Steitz,J.A. (2002) The divergent U12-type spliceosome is required for pre-mRNA splicing and is essential for development in Drosophila. Mol. Cell, 9, 439-446. Peng,Y., Schwarz,E.J., Lazar,M.A., Genin,A., Spinner,N.B. and Taub,R. (1997) Cloning, human chromosomal assignment and adipose and hepatic expression of the CL-6/INSIG 1 gene. Genomics, 43, 278-284. Pierandrei-Amaldi,P., Bozzoni,I. and Cardinali,B. (1988) Expression of the gene for ribosomal protein Ll in Xenopus embryos: alteration of gene dosage by microinj ection. Genes Dev., 2, 23-31. Robberson,B.L., Cote,G.J. and Berget,S.M. (1990) Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. , 10, 84-94. Sharp,P.A. and Burge,C.B. (1997) Classification of introns: U2-type or U12-type. Cell, 91, 875-879. Solnick,D. (1985) Trans splicing of mRNA precursors. Cell, 42, 157-164. Spafford,J.D., Spencer,A.N. and Gallin,W.J. (1998) A putative voltage­ gated sodium channel a subunit (PpSCNl) from the hydrozoan 38 15

Journal

The EMBO Journal – Springer Journals

Published: Jul 15, 2002

Keywords: pre‐mRNA; regulation of gene expression; spliceosome; splicing rate; U12‐type intron

There are no references for this article.