Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/unpaywall/puckered-encodes-a-phosphatase-that-mediates-a-feedback-loop-fVTb2D9Zj0
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Unpaywall
- ISSN
- 0890-9369
- DOI
- 10.1101/gad.12.4.557
- Publisher site
- See Article on Publisher Site
Abstract
Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila 1 1,4 1 2 3 Enrique Martı ´n-Blanco, Alexandra Gampel, Jenny Ring, Kanwar Virdee, Nikolai Kirov, 2 1,5 Aviva M. Tolkovsky, and Alfonso Martinez-Arias 1 2 3 Department of Zoology and Department of Biochemistry, University of Cambridge, Cambridge CB2 3EJ, UK; Department of Biology, New York University, New York, New York 10003 USA The activation of MAPKs is controlled by the balance between MAPK kinase and MAPK phosphatase activities. The latter is mediated by a subset of phosphatases with dual specificity (VH-1 family). Here, we describe a new member of this family encoded by the puckered gene of Drosophila. Mutations in this gene lead to cytoskeletal defects that result in a failure in dorsal closure related to those associated with mutations in basket, the Drosophila JNK homolog. We show that puckered mutations result in the hyperactivation of DJNK, and that overexpression of puc mimics basket mutant phenotypes. We also show that puckered expression is itself a consequence of the activity of the JNK pathway and that during dorsal closure, JNK signaling has a dual role: to activate an effector, encoded by decapentaplegic, and an element of negative feedback regulation encoded by puckered. [Key Words: puckered; JNK; Drosophila; dpp; Phosphatase; Signal transduction; dorsal closure] Received September 26, 1997; revised version accepted November 18, 1997. In many cases, cell differentiation represents a transition by the balance of MAPK kinase and MAPK phosphatase between two states of cellular activity—one in which activities. cells proliferate and acquire information about their The dorsal closure of the Drosophila embryo provides fates and identities, and another in which cells stop di- an example of cell differentiation and how this is usually viding and manifest the information gathered earlier. coupled to morphogenetic events and movements that Many of the signaling pathways leading to cell differen- shape late stages in development. Half way through em- tiation depend on phosphorylation cascades. Mounting bryogenesis, the dorsal surface of the embryo is covered evidence points to signaling through MAP kinase by an extraembryonic membrane, the amnioserosa, (MAPK) pathways as a key component in this transition. which contacts the epidermis. After proliferation stops, Three distinct types of MAPK pathways have been iden- the epidermis stretches dorsally and, as it encroaches the tified: p42–p44 ERKs (extracellular signal-related ki- amnioserosa, closes the existing gap. Three phases lead nases), p38 kinases, and p46–p54 JNKs (Jun N (amino)- to the successful completion of this event. The dorsal- terminal kinases). These major subfamilies transduce ward movement of the epidermal cells, an anteroposte- signals from different stimuli. The ERKs respond pre- rior stretching of the embryo and the seaming of the dorsal epidermis (Martinez-Arias 1993). The completion dominantly to growth factors and hormones and are ac- of this process takes several hours and is associated with tivated in a Ras-dependent manner. The p38 and JNKs respond to different environmental stresses and are acti- specialized behavior of the dorsal-most epidermal cells. vated preferentially downstream of Rac1 and Cdc42 These cells display planar polarity reflected in the ar- small G proteins (for review, see Canman and Kastan rangement of the cytoskeleton, which is essential for the 1996). In most cases, MAPK activation is a transient normal process of dorsal closure (Ring and Martinez- event, even in the continuing presence of the stimulus Arias 1993; Young et al. 1993). that leads to its activation. MAPK activity is controlled There are several mutations that disrupt the process of dorsal closure. In basket (bsk) and hemipterous (hep) mutants, dorsal closure fails and the embryo exhibits a Present address: Department of Human Anatomy, University of Oxford, hole in the dorsal cuticle. hep encodes a Drosophila ho- Oxford, UK. molog of MKK7, a kinase that regulates JNK MAPKs Corresponding author. E-MAIL [email protected]; FAX 44-1223-336676. (Holland et al. 1997; Tournier et al. 1997) and bsk en- GENES & DEVELOPMENT 12:557–570 © 1998 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/98 $5.00; www.genesdev.org 557 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. codes a Drosophila homolog of JNK (Riesgo-Escovar et single embryos detects puc transcripts in wild type, but B48 B48R23 al. 1996; Sluss et al. 1996). The involvement of the JNK not in extracts from homozygous puc or puc , a B48 pathway in dorsal closure is further emphasized by the lethal revertant of puc that removes the genomic re- observation that mutants for Djun, a target of DJNK sig- gion adjacent to the insertion (data not shown). naling, fail to close dorsally (Hou et al. 1997; Kockel et The Puc ORF encodes a protein tyrosine phosphatase, al. 1997; Riesgo-Escovar and Hafen 1997), and that ecto- with a catalytic domain between amino acids 214 and pic expression of a dominant-negative form of Drac1 226 that includes the invariant cysteine known to be (DN–Drac1), the Drosophila homolog of Rac1, also leads required for phosphatase activity (Guan et al. 1991). The to the same dorsal closure defects (Harden et al. 1995). protein contains eight putative sites for phosphorylation Here, we describe the molecular characterization of by MAPK, distributed throughout the carboxy-terminal the puckered (puc) gene. In puc mutants, dorsal closure part of the protein (Fig. 1B). The predicted protein con- takes place, but an abnormal organization of the cells at tains no clear hydrophobic sequences indicative of either the leading edge of the epidermis results in a defective signal sequence or transmembrane domain, which sug- process and puckering, which provides the name of the gests that the Puc protein is neither a secreted nor an mutant (Ring and Martinez-Arias 1993). We show that integral membrane protein (Fig. 1B). puc encodes a member of the MAPK subfamily (MKPs) of The phosphatase encoded by puc has high similarity to the VH1 like dual specificity phosphatases. Our results nonreceptor dual specificity phosphatases of the VH-1 indicate that puc regulates signaling through the JNK subfamily (Fig. 2A). Phylogenetic analysis (see Materials pathway and participates in a negative feedback loop and Methods), indicates that its closest relative is the leading to a transient activity of the JNK signal during protein encoded by the Caenorhabditis elegans CEL- dorsal closure. F08B1 ORF (Wilson et al. 1994) that has 38% identical residues over 158 amino acid overlap. When conserva- tive residues are taken into account, the comparison Results yields 59.5% similarity between the two sequences. Very high similarities with other proteins of this family Molecular characterization of puc (see Fig. 2) highlight the conservation of their catalytic The puc gene was identified through a P(lacZ) inser- sites, which are identical at 9–11 of 13 amino acids. In- tional mutation that highlights the most dorsal epider- terestingly, Puc, like yeast MSG-5, lacks the amino-ter- mal cells as they finish proliferation, and causes defects minal domains with homology to the cdc25 proteins that during dorsal closure (Ring and Martinez-Arias 1993). are present in all the mammalian MKPs (Keyse and Gins- E69 The puc allele is caused by a single insertion at 84E. burg 1993). A single copy of an internally repeated do- Genomic DNA from the region around the insertion main of unknown function (amino acids 238–312; amino point was isolated with a probe for lacZ against a l li- acids 386–460) (Fig. 2B) is present in all VH-1 family E69 brary constructed with puc genomic DNA. A frag- phosphatases. ment of the resultant l clone, containing only genomic DNA sequences, was then used as a probe to screen a wild-type genomic library to isolate DNA from a larger Puckered encodes a Drosophila JNK phosphatase genomic region. The isolated clones were aligned and mapped by restriction analysis (Fig. 1A; Materials and To establish whether Puc is a phosphatase, we first de- Methods). termined its enzymatic activity towards p-nitrophenyl A 3.7-kb genomic DNA fragment close to the P-ele- phosphate (PNPP), a chromogenic substrate structurally E69 ment insertion site in puc was used to screen a 12–24 related to phosphotyrosine (Keyse and Emslie 1992). The hr embryonic cDNA library (Brown and Kafatos 1988). first 424 amino acids of Puc, including the phosphatase Three cDNA clones were isolated and mapped onto the domain, were fused in-frame to GST. Variable amounts genomic region (Fig. 1A; Material and Methods). The of the GST–Puc protein were added to reactions contain- ing PNPP and cleavage was analyzed spectrophotometri- longest, cDNA12, is 2.3 kb long and contains an ORF cally (Fig. 3A). PNPP cleavage was dependent on the ad- capable of encoding a protein of 496 amino acids with a dition of the GST–Puc fusion protein and increased lin- predicted molecular mass of 57.6 kD (Fig. 1B). Northern blot analysis of embryonic RNA detects a 2.9-kb RNA early with the added protein. These results indicate that present throughout embryogenesis (see Fig. 4A, below). Puc functions as a protein phosphatase. E69 The puc insertion and three additional lethal P-el- Members of the VH-1 family of phosphatases have 320 A251.1 B48 ements insertions, puc , puc , and puc , which been implicated in the down regulation of MAPK activ- E69 320 do not complement puc , have been identified. puc , ity (for review, see Keyse 1995). To study if Puc could A251.1 E69 puc , and puc map to the second intron of the have such function, we measured the endogenous MAPK E69 cDNA (Fig. 1A). The mutations caused by puc and activity of embryo extracts, prepared in the presence of puc insertions have been reverted to wild type with phosphatase inhibitors (see Materials and Methods). Ex- loss of the resident P element, which suggests that these tracts prepared from puc mutant embryos showed a two- P elements are the cause of the puc mutation (Ring fold increase in JNK activity relative to wild type by use B48 1993). The puc P-element insertion site has been se- of (1–86) cJun–GST captured on glutathione–Sepharose quenced and maps to the first intron of puc. RT–PCR of beads, whereas ERK activity on myelin basic protein 558 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase Figure 1. Characterization of the puc gene and predicted protein. (A) Genomic organization of the puc locus. Structure of cDNA exons (shaded boxes) and introns (broken lines) is shown below the genomic map. Exon/intron boundaries are approximate to within the B48 E69 A251.1 restriction fragment indicated. The P-element integration site of puc is located in the first intron of cDNA12, puc , puc , and puc are located within the second intron of cDNA12. (E) EcoRI; (H) HindIII; (B) BamHI; (S) SalI; (X) XhoI. (B) DNA sequence of puc cDNA12 and predicted amino acid sequence. Identified motifs are the signature sequence for PTPases (boxed) and potential MAPK phosphorylation sites (P/L-X-S/T-P; circled letters). (MBP) was unaffected (Fig. 3B). We also examined the hibit activated JNK that was affinity purified from any- ability of extracts without phosphatase inhibitors to in- somicin-treated HeLa cells (see Materials and Methods). GENES & DEVELOPMENT 559 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. Figure 2. Homology of Puc to VH-1 fam- ily phosphatases. (A) Sequence alignment (ClustalV) of Puc and other VH-1 family phosphatases [Drosophila Puc; human CL100 (Keyse and Emslie 1992); human Pac1 (Rohan et al. 1993); human HVH-2 (Guan and Butch 1995); human HVH-3 (Ishibashi et al. 1994; Kwak and Dixon 1995); human HVH-5 (Martell et al. 1995); human Pyst1 (Groom et al. 1996); human Pyst2 (Groom et al. 1996); human MKP-4 (Muda et al. 1997); C. elegans CEL-F08B1 (Wilson et al. 1994) and Saccharomyces cerevisiae MSG5 (Doi et al. 1994)]. Identi- cal residues are in black, conservative changes in blue. CEL-F08B1, Pyst1 and ho- mologs, Pyst2, and HVH-5 gave the high- est homology scores to Puc in BLAST/ BEAUTY searches (BCM Launcher). The other enzymes complete the whole series of distinct human dual phosphatases iso- lated so far. Yeast MSG-5, which share some characteristics with Puc, is also in- cluded. Phylogenetic trees (DNAstar pro- gram) point to the C. elegans CEL-F08B1 as the closest relative of Puc in the data- bases. CEL-F08B1 has been identified re- cently in the C. elegans Genome Project, but its function is unknown. Residues in the alignment highlighted in red represent putative MAPK phosphorylation sites. In- terestingly, they seem to cluster for al- most every protein in a low homology re- gion at the carboxy-terminal end of the catalytic domain (double underlined), which suggest a possible functional ho- mology. (B) Matrix alignment of Puc with itself shows the existence of an internal repeat in the protein. These domains cor- respond to the putative MAPK phosphory- lated region and a further sequence close to the carboxy-terminal end of the mol- ecule. Again, in the second repeat, several tentative phosphorylation sites can be identified. 560 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase Figure 3. puc encodes a JNK phosphatase. (A) In vitro phosphatase activity of a GST–Puc fusion protein. Results of PNPP assay in which cleavage of PNPP was measured by change in absorbance at 410 nm as a function of added protein. (d) Purified GST–Puc protein; (s) control points from extracts obtained from untransformed bacteria following similar protocols. (Bottom) Schematic representation of the fusion protein. The phosphatase catalytic domain is highlighted in black (residues 214–222). (B) Endogenous JNK and ERK E69 E69 1 1 activity of wild-type (wt), puc /puc (puc) and hep /hep (hep) embryos. (Top) JNK assays were performed with normalized amounts of embryo extracts (1 embryo/μl) prepared in the presence of phosphatase inhibitors (as indicated in Materials and Methods). Kinase activity is measured in arbitrary units from imaging analysis. (Solid circles) Wild-type (wt) extracts; (shaded triangles) puc embryo extracts; (shaded squares) hep embryos. JNK activity increases twofold in puc mutants and reduced threefold in hep. (Bottom) ERK assays were performed by in-gel kinase assay with a normalized amount of extract, in the linear range for JNK, equivalent to five embryos. Histograms represent quantitation of kinase activity (arbitrary units). Wild-type, puc, and hep extracts have equivalent levels of ERK activity. (C) Puc phosphatase activity on heterologous JNK and ERK. (Top) JNK activity induced in HeLa cells was measured in the absence of any extract to deduce the basal level of activity (100% JNK activity—broken line). Equivalent amounts were incubated with normalized embryo extracts (1 embryo/μl) prepared in the absence of phosphatase inhibitors. The results are expressed in percentage of JNK activity. (Solid circles) Wild-type extracts; (shaded triangles) puc embryo extracts; (shaded squares) hep embryos. Wild-type embryos have high levels of JNK phosphatase activity (HeLa JNK activity is reduced fivefold). Puc extracts do not show JNK phosphatase activity, indeed HeLa JNK activity gets increased because of the high levels of JNK activity of puc extracts (it can be brought back to basal levels by previous heat inactivation; see also Discussion). In hep extracts, JNK phosphatase activity is reduced to 50% of that of wild-type embryos. (Bottom) ERK activity of preactivated human ERK (hERK*) was assayed as indicated in Materials and Methods. Extracts (5 embryos) from wild-type, puc, and hep embryos display the same level of ERK phosphatase activity, reducing hERK* activity by 40%. Histograms represent quantitation of kinase activity (arbitrary units). Positive controls were performed with purified CL100 phosphatase (50 μg/ml) (data not shown). Extracts derived from wild-type Drosophila embryos Puc act as a JNK phosphatase in vivo and might play a were able to inhibit HeLa JNK activity up to 80%. In role in the regulation of the activity of JNK signaling contrast, extracts from puc mutants were unable to re- during dorsal closure. press exogenous JNK and a gain of kinase activity was observed (Fig. 3C), probably caused by a feedback loop The expression and activity of Puc during embryonic between JNK and puc (see below). ERK phosphatase ac- development are regulated by the Drosophila JNK tivity measured in these extracts was unaffected in puc pathway mutants (Fig. 3C). These results strongly suggest that puc encodes a protein capable of regulating JNK, but not The temporal pattern of puc expression during embryo- ERK, activity through dephosphorylation. genesis was determined by use of a puc cDNA probe. If puc encodes a JNK phosphatase activity, then it Northern analysis detects a 2.9-kb RNA present should inactivate JNK in vivo. To test if this is the case, throughout embryogenesis (Fig. 4A). This RNA was ap- we placed the puc cDNA under the control of Gal4/UAS parent in early embryos (0–4 hr AEL) suggesting the pres- to target its expression during development (see Materi- ence of maternal transcripts. Minor transcripts of 2.6 and als and Methods). Ubiquitous expression of Puc results 2.4 kb are also detected. in a dorsal hole during embryogenesis (see Fig. 5, below) The spatial distribution of puc was determined by reminiscent of the phenotype of mutations in hep and whole mount in situ hybridization. puc expression was bsk that encode a JNKK and a JNK, respectively. detected, by use of a variety of genomic and cDNA de- These results suggest that the phosphatase encoded by rived probes, only in a small number of the experiments, GENES & DEVELOPMENT 561 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. the amnioserosa, the ectoderm, and the nervous system (puc ; Fig. 4D,E). The requirement for the DJNK pathway to activate puc expression was also mirrored in the reduction of JNK phosphatase activity in mutants for hep: JNK activity is reduced threefold in hep mutants extracts, as expected for a loss of function in a JNK activator (Fig. 3B). In ad- dition, extracts from hep mutants show less phospha- tase activity on exogenous JNK (a 50% reduction), but identical levels of ERK phosphatase function, compared with wild-type embryo extracts (Fig. 3C). Altogether, these results support a role for the Dro- sophila JNK pathway in the control of puc expression. Loss and overexpression of puc have different effects in dorsal closure Embryos mutant for puc develop defects along the dorsal midline of the larval cuticle during dorsal closure. These Figure 4. puc expression: Its modulation by puc activity. (A) defects manifest as misaligned segments in the weakest Northern analysis of puc RNA expression in embryos at various Eh allele, puc (Ring and Martinez-Arias 1993) (Fig. 5A), times during development. (A) 0–4 hr; (B) 4–8 hr; (C) 8–12 hr; (D) and become more pronounced in stronger alleles. For ex- 12–16 hr; and (E) 16–20 hr. The 2.9-kb puc transcript is apparent. E69 ample, in embryos carrying the puc allele (Fig. 5B), (B) puc RNA detected in stage 13 by whole mount in situ hy- dorsal hairs are absent along the midline, leaving a strip bridization. The expression in the dorsal-most epidermal cells is E69 of naked cuticle along most of the midline; these em- indicated. (C) stage 13 puc heterozygous embryos stained with an antibody against b-galactosidase. The arrowhead points bryos display strong puckering of the epidermis (Ring to the cells of the leading edge of the epidermis expressing b-gal. and Martinez-Arias 1993). Notice that these are the same cells as in B. At early stages, To study if puc restrains JNK activity during the dif- evident puc expression is present in amnioserosa cells. (D) b- ferent steps of dorsal closure, we analyzed the phenotype galactosidase expression of puc heterozygous embryos (stage of embryos in which we had expressed puc ectopically 14). (F) A considerably higher number of cells, and at higher using hsGal4 and a UASpuc line (Fig. 5). Embryos heat- 320 320 levels, express b-galactosidase in puc /puc stage 15 em- shocked very early [between 4 and 5 hr after egg laying bryos (arrowhead). (AEL)] failed to achieve dorsal closure and exhibit a large dorsal opening (Fig. 5F). Most of the embryos heat which suggests a very low level of expression or tran- shocked between 5 and 7 hr AEL displayed dorsal holes script instability. We were able to observe expression of (Fig. 5E) or phenotypes similar to puc loss of function puc in the dorsal-most cells at the leading edge of the alleles (Fig. 5D). Heat-shocking embryos after 7 hr AEL epidermis (Fig. 4B). This pattern was identical to that produced a puc loss-of-function phenotype, and occa- described previously for the early expression of b-galac- sionally a dorsal hole that, on average, was smaller than tosidase in the insertional alleles (cf. Fig. 4B and C). After that of embryos heat-shocked earlier. stage 11, puc mRNA expression slowly decays on the In these experiments, early overexpression of Puc leading edge, whereas b-galactosidase is found up to mimics the phenotype of bsk mutants and the complete completion of dorsal closure (Ring and Martinez-Arias inactivation of DJNK signaling. Late expression of Puc 1993). affects the ability of the dorsal-most cells to differentiate It has been shown previously that b-galactosidase ex- properly and induces the same defects as puc loss-of- E69 pression by the puc insertion is abolished in hep and function alleles. Furthermore, puc in heterozygous con- bsk mutants (Glise et al. 1995; Riesgo-Escovar et al. dition can rescue the dorsal open characteristic of low JNK signaling: Hemizygous hep 1996). Furthermore, b-galactosidase activity is enhanced embryos develop a dor- after overexpression of activated forms of Drac1 sal open phenotype (Fig. 5G), which is partially rescued E69 A251.1 (DRac1V12) and Dcdc42 (Dcdc42V12) (Glise and Noselli by puc (Fig. 5H) or puc (data not shown) in het- 1997) that activate JNK signaling. As puc encodes a JNK erozygous condition. phosphatase that appears to down-regulate the JNK path- These results support a role of puc in limiting DJNK way, we studied the expression of puc (b-galactosidase) activity during dorsal closure and suggest the existence in puc mutants, in which we have shown that JNK ac- of a feedback loop through which JNK dependent expres- E69 tivity is enhanced. The misregulation of puc LacZ ac- sion of puc regulates JNK activity (see Discussion). tivity had been reported previously (Ring and Martinez- Arias 1993; Glise and Noselli 1997). We found that for all puckered alters actin and nonmuscle myosin puc insertional alleles, mutant embryos show higher lev- localization and affects epidermal morphogenesis els and more cells expressing b-galactosidase than wild type, for example, in the leading edge of the epidermis, During dorsal closure, the shape of the epidermal cells in 562 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase in the control of the cell cytoskeleton. In wild-type em- bryos, the onset of dorsal closure coincides with a spe- cific subplasmalemmal accumulation of nonmuscle myosin at the leading edge of the dorsal-most epidermal cells (Fig. 6A,B; Young et al. 1993). It is likely that non- muscle myosin (NMM) probably contributes to the elon- gation of these cells by participating with actin in form- ing a dorsal constriction. In DN–Drac1 embryos, NMM and actin in epidermal cells are strongly reduced (Harden et al. 1995). These changes in the cytoskeleton are also evident in Djun mutant embryos (Hou et al. 1997). E69 We compared the effects of the absence of puc (puc ) and its overexpression (ArmGal4/UASpuc) in the levels and organization of the actin cytoskeleton and NMM. E69 We find that in puc both myosin and actin do not change dramatically their expression in the periphery of the cells in lateral regions of the embryo, but fail to ac- cumulate along the leading edge of the epidermis (Fig. 6D–F). Cell shape changes proceed almost normal. In contrast, epidermal cells of ArmGal4/UASpuc embryos fail to change their shapes and accumulate low levels of Figure 5. Cuticle phenotypes of puc mutants and those gener- ated by ectopic expression of puc and dpp. Rescue of hep phe- notype by puc in heterozygous condition. (A) Dorsal view of Eh Eh E69 E69 puc /puc embryo. (B) Dorsolateral view of puc /puc mutant embryos. (C) Dorsolateral view of ArmGal4/UASdpp embryo. Arrowheads point to defects, puckering, and naked cu- ticle, along the dorsal midline. (D–E) Embryos from a cross of flies carrying the UASpuc with flies carrying a hsGal4 insert that were exposed to a 30 min heat shock at various times during development. Cuticle preparations revealed three classes of phenotype depending on the age of the embryo at the time of heat shock. (D) puc loss of function-like; (E) dorsal hole; (F) dorsal open. Arrowheads indicate dorsal cuticle defects. Dorsal open embryos are observed more frequently after early heat shocks. Dorsal hole phenotypes appear at intermediate times and puc loss-of-function-like embryos are present mainly after late heat shocks (see columns at the right). (G) hep hemizygous embryo, note the dorsal open phenotype. (H) hep hemizygous, E69 puc heterozygous embryo. A partial rescue of the dorsal open phenotype leads to small dorsal holes (arrowhead). the dorsal region of the embryo changes dramatically. Beginning with cells immediately flanking the amniose- Figure 6. puc controls the accumulation of actin and myosin rosa, there is an elongation along the dorsoventral axis in the leading edge of the epidermis during dorsal closure. Con- that gradually spreads ventrally through the epidermis. focal fluorescent micrographs of the boundary between the am- These cell shape changes stretch the opposing sides of nioserosa and the epidermis in stage 13 embryos. The distribu- the lateral epidermis until they meet along the dorsal tion of nonmuscle myosin (A,B,D,E,G,H) and filamentous actin E69 midline. (C,F,I) are shown in wild-type embryos (A–C), puc embryos (D–F) and ArmGal4/UASpuc embryos (G–I). Embryos were Dorsal cuticle puckering and dorsal holes are indica- stained for filamentous actin with phalloidin or for nonmuscle tive of a defect in dorsal closure, probably dependent on myosin with antibodies. Whereas actin and NMM are accumu- cell shape changes (for review, see Martinez-Arias 1993). lated along the leading edge in wild-type embryos (arrowheads In bsk, hep, and Djun mutants, cell shape changes are in B and C), in puc mutants their level decreases and it is pos- disrupted (Glise et al. 1995; Riesgo-Escovar et al. 1996; sible to observe gaps (arrowheads in E and F) between the am- Riesgo-Escovar and Hafen 1997; Hou et al. 1997; Kockel nioserosa and the epidermis. After Puc overexpression, NMM is et al. 1997). It is interesting that expression of DN–Drac1 maintained in the amnioserosa (arrowhead in H) but the level of displays phenotypes that are similar to that of hep and expression in the epidermis is severely reduced. Actin ceases to bsk mutants, suggesting that Drac1 might initiate sig- be expressed in the amnioserosa and it appears on patchy spots naling through this cascade. Drac1 seems to be involved in the epidermis (arrowhead in I). GENES & DEVELOPMENT 563 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. spatially disorganized myosin at the leading edge (Fig. epidermal cells expressing dpp than in wild type, but this 6G,H). In these embryos, actin fails to be expressed in expression is still mainly limited to dorsal cells (cf. Fig. the amnioserosa and its levels are reduced in the epider- 7E and H with F and I). In contrast, ubiquitous expres- mis (Fig. 6I). Actin and myosin tend to form clumps in sion of Puc leads to a decrease in the expression of dpp in these epidermal cells. those cells during stage 11 (Fig. 7A) and the complete Our data indicate that puc is an essential component absence at stages 12 and 13 (Fig. 7D,G). Puc overexpre- in the control of the different steps of dorsal closure pro- sion does not affect the levels of dpp on the visceral gression by modulating the apical accumulation of actin mesoderm or the ventral epidermis. These results sug- and myosin at the leading edge and directing cell shape gest a role for puc in the control of dpp expression, which changes. These results correlate with those of the effects could be mediated by Puc activity on JNK signaling (See of overexpression of DN–Drac1 and Djun mutants, and Discussion). further suggest a role for Puc in the control of JNK ac- The null phenotype for dpp, a completely ventralized tivity over the cytoskeleton. embryo, reflects its initial role over the dorsal epidermis and might obscure the function of later patterns of ex- pression (Wharton et al. 1993). Mutants for thick veins, dpp in the leading edge is regulated by puc and its however, which encodes a dpp receptor, display dorsal overexpression disrupts completion of dorsal closure holes similar to those of hep or bsk mutants (Affolter et The gene dpp encodes a member of the TGFb superfam- al. 1994). To test if the higher levels of dpp present in puc ily and has been identified as a secreted signaling mol- mutants could be involved in puckering phenotypes, we ecule that mediates inductive interactions during Dro- overexpressed dpp using ArmGal4 as the driving system. sophila development (Wharton et al. 1993). During the ArmGal4/UAS dpp embryos undergo an extreme dorsal- second half of embryogenesis, dpp is expressed in spe- ization of the epidermis, but they still have a dorsal mid- cific regions in the embryo, particularly in the dorsal- line, in which, in many cases, we observed phenotypes E69 most epidermal cells that express puc (Fig. 7B). It has (Fig. 5C) very similar to those observed in puc mu- been shown recently that the maintenance of dpp ex- tants (cf. Fig. 5C with B). This indicates that, besides an pression along the leading edge of the epidermis depends early function of dpp in epidermal cell stretching, the on the activity of the DJNK pathway (Glise and Noselli downregulation of dpp in the dorsal-most epidermal 1997; Hou et al. 1997; Riesgo-Escovar and Hafen 1997). cells is necessary for completion of dorsal closure. E69 In puc mutant embryos, the expression of dpp in the dorsal-most epidermal cells is enhanced from stage Discussion 11 (cf. Fig. 7B with C; see also Glise and Noselli 1997). Furthermore, after germ-band shortening there are more Two different MAPKs, encoded by the bsk and rolled (rl) E69 Figure 7. Effects of wild-type, mutant puc and Puc expressed under the control of the Armadillo promoter on dpp transcription. (A,D,G) dpp RNA expression in ArmGal4/UASpuc embryos. (B,E,H) dpp RNA expression in wild-type embryos. (C,F,I) dpp RNA E69 expression in puc embryos. (A–C) lateral views of stage 11 embryos. Anterior is to the left; dorsal is up. At this early stage, it is possible to observe a reduction in dpp expression after ectopic expression of Puc and new cells expressing dpp along the epidermal border in puc mutants (arrowheads). (D–F) lateral views of stage 13 embryos. (G–I) dorsal views of stage 13 embryos. At this stage, dpp disappears from the dorsal-most epidermal cells after ectopic Puc expression and it is present in at least two rows of cells at the leading edge of each lateral hemisegment in puc mutants (arrowheads). The expression of dpp in the visceral mesoderm is unaffected. 564 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase genes, have been identified so far in Drosophila. The embryo (Ring and Martinez-Arias 1993) and the adult (E. phenotype of mutations in these genes suggests that they Martin-Blanco, unpubl.). play different roles during development. The MAPK en- During and after germ band shortening, puc is ex- coded by rl has been implicated downstream of multiple pressed in the dorsal-most epidermal cells that play a RTK signal transduction pathways during cell fate deter- leading role in the process of dorsal closure. In embryos mination (Diaz-Benjumea and Hafen 1994). On the other mutant for the JNKK encoded by hep or for the JNK encoded by bsk, there is no puc expression in these cells hand, the MAPK encoded by bsk behaves as a homolog of mammalian JNK and is involved in the process of dorsal and dorsal closure fails in a manner similar to that pro- closure (Riesgo-Escovar et al. 1996; Sluss et al. 1996). duced by overexpression of puc (Glise et al. 1995; Riesgo- Down-regulation of the activity of MAPK proteins Escovar et al. 1996). These results suggest a model in through a feedback mechanism that is dependent on which signaling through Hep and Bsk leads to the ex- their own signaling ability has been suggested as a way of pression of effectors of dorsal closure and a regulator en- regulating the activity of MAPK pathways (Sun et al. coded by puc. The function of the latter is to exert a 1993). Here, we have identified a novel member of the negative feedback on the signaling cascade of hep and MKP subfamily of VH-1 protein tyrosine phosphatase bsk. Interestingly, in mutants for Djun, a likely target of (PTPs), which is involved in the regulation of JNK ac- JNK activity, puc expression is absent at the leading edge tivities during dorsal closure in Drosophila. This phos- of the epidermis (N. Perrimon, pers. comm.), suggesting phatase is associated with insertional mutations in the a transcriptional link between the activity of the JNK puc gene (Ring and Martinez-Arias 1993). encoded by bsk and the expression of puc. The pheno- Three arguments lead us to the conclusion that the types of gain and loss of function of puc, together with PTP that we have cloned is encoded by the puc gene. the levels of JNK and JNK phosphatase activities of ex- First, four independent P-element insertions cause puc tracts from puc embryos support this model. mutant phenotypes and map to two different introns of Expression of a dominant-negative Drac1 protein re- the gene that we have cloned. Two of these mutations sults in defects in the dorsal epidermis that are similar to have been reverted to wild type with loss of the resident those of hep and bsk mutants and, occasionally, pro- P element. Also, transcripts for this gene are not present duces defects that resemble weak puc mutant pheno- in embryos of one of these mutants and one lethal rever- types (Harden et al. 1995). A similar situation can be tant. Second, extracts from puc mutants have more JNK observed when Puc is overexpressed at different times in activity than wild type. And third, whereas loss of func- embryogenesis: Whereas early overexpression leads to a tion of puc leads to ectopic expression of dpp in the dor- hep/bsk mutant phenotype, overexpression during dor- sal epidermis, ubiquitous expression of the Puc protein sal closure leads to phenotypes that resemble puc. The leads to the loss of dpp expression. function of puc in a negative feedback loop can account We noticed the presence of maternally contributed for these observations. Early overexpression of Puc or RNA in early embryos. Consistent with a function of dominant-negative Drac1 would inactivate signaling Eh this RNA, the phenotype of puc /Df(3R)dsx10 embryos through JNK and thus inhibit the expression not only of derived from Df(3R)dsx10 females was stronger than puc, but also of the effectors of the pathway. On the Eh that of embryos derived from puc females (Ring 1993). other hand, overexpression of puc later would have al- Similar differences were also observed in reciprocal lowed for some expression of the effectors but would crosses between strong and weak alleles. The function of result in the late inhibition of the feedback loop by sup- this maternal RNA during oogenesis and early embryo- pression of puc expression. Therefore, the phenotype of genesis is currently under study. puc mutants represents a failure in the negative regula- Evidence that Puc is a JNK-specific phosphatase is pro- tion of signaling after the process has been initiated. vided by biochemical assays. When extracts from wild- A similar feedback has been proposed as a mechanism type and puc mutant embryos are assayed for their en- by which a rapid and transient response to extracellular signals may occur. Erp, another member of the VH-1 dogenous JNK activity, puc mutants show a significant phosphatase family, is expressed as an early event in the increase in JNK activity compared with wild type. When proliferative response of fibroblasts to serum and yet, similar extracts are tested for their ability to inactivate constitutive expression of Erp in fibroblasts suppresses preactivated JNK, up to 50% inhibition was obtained after 30 min from wild-type embryos compared with proliferation, suggesting this same negative feedback abolition of activity in extracts from puc mutants. In mechanism (Noguchi et al. 1993). similar assays, we never observed changes in ERK and ERK phosphatase activities. puc, signaling, and dorsal closure During the first half of embryogenesis, the dorsal side of A feedback loop between the Puc phosphatase the Drosophila embryo is covered by an extraembryonic and JNK signaling membrane, the amnioserosa, which bridges the two The expression of most members of the VH-1 family of edges of the open epidermal sheet. The process of dorsal PTPs is subject to tight transcriptional regulation (i.e., closure closes the gap by bringing these two epidermal Charles et al. 1993). The same is likely to be true for puc edges together and intruding the amnioserosa into the because it displays dynamic patterns of expression in the embryo (Ring and Martinez-Arias 1993; Young et al. 1993). GENES & DEVELOPMENT 565 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. The cell shape changes that accompany this process suggest that cytoskeletal rearrangements play an impor- tant role. Consistent with this, zipper mutant embryos (Nu ¨ sslein-Volhard et al. 1984), which lack the cytoplas- mic myosin heavy chain (Young et al. 1993), display de- fective cell shape changes that lead to an abnormal dor- sal closure. On this basis, a model for dorsal closure has been suggested in which myosin plays an active role in producing force for cell shape change and as a mechani- cally contractile band at the leading edge that powers the epidermal movements during dorsal closure (Young et al. 1993). In puc mutants, the dorsal-most epidermal cells retain nonmuscle myosin and actin expression, albeit at re- duced levels. In contrast, after Puc overexpression, the polarized localization of nonmuscle myosin is lost and a strong reduction in both myosin and actin levels is ob- served, correlating with an extreme lack of cell shape change. These defects are very reminiscent of the effects of dominant-negative Drac and Djun mutations on these cytoskeletal elements (Harden et al. 1995; Hou et al. Figure 8. A model for the role of puc in JNK signaling during 1997). In all these cases, actin became excluded from the dorsal closure. Halfway during embryogenesis, in the cells at amnioserosa. This disruption of the cytoskeleton is prob- the leading edge of the epidermis, the hep/bsk pathway be- comes activated, probably by Drac. As a consequence, DJun is ably the cause of the absence of dorsoventral elongation itself activated and gets involved in the maintenance of dpp and of the epidermal cells associated with dorsal holes. puc expression. Puc will drive its own down regulation through It is possible that independently of its effects on hep inactivation of bsk, and it will control the level of expression of and bsk, DRac1 could be controlling the process of dorsal dorsal closure effectors as dpp. dpp might have two different closure by direct effects on the cytoskeleton. The fact roles: to induce the cellular events required for dorsal closure in that mutations in hep supress the effects of the expres- the lateral cells and to participate in the specializations in the sion of an activated form of Drac1 (Drac1V12) (Glise and dorsal-most cells required for the last steps of closure. In puc Noselli 1997), and that the inhibition of DJNK activity mutants, JNK signaling becomes hyperactivated in the leading by puc seems to produce equivalent cytoskeletal and edge, the dorsal-ward stretching of the lateral cells proceeds morphogenetic defects as the expression of DN-Drac, normally, but the excess of dpp interferes with proper cell dif- ferentiation and affects midline alignment. When puc is ecto- however, suggest that during dorsal closure, the outcome pically expressed early throughout the epidermis, it blocks sig- of Drac1 signaling is the activation of DJNK. naling through the bsk pathway leading to the disappearance of dpp from the dorsal-most cells and to a failure in dorsal closure. puc control of Dpp expression and cellular Late Puc overexpression it affects only the cellular differentia- morphogenesis tion of the leading edge cells. The control of DJNK activity by Puc affects the mainte- nance and modulation of dpp, which might mediate expression via DJun of puc and dpp in the dorsal-most many of the requirements for dorsal closure (Fig. 8). In cells of the epidermis. Whereas dpp provides an effector hep (Glise and Noselli 1997) and Djun (Hou et al. 1997; of dorsal closure, puc encodes the regulatory element Riesgo-Escovar and Hafen 1997) mutants, the expression that controls the amount of signaling through the path- of dpp is abolished in the dorsal epidermal cells and dor- way. Experiments in tissue culture in vertebrates have sal closure is never initiated. On the other hand, dpp suggested the possibility of such feedback loops on sig- expression along the leading edge is augmented in puc naling cascades, and we have shown here one case in mutants and is abolished after Puc overexpression. which it occurs in vivo. The existence of this feedback Mutants for the dpp receptor thick veins have a promi- mechanism provides a sensitive way of regulating and nent dorsal hole similar to that of hep and bsk mutants controlling signaling through the pathway, something (Affolter et al. 1994). It is therefore interesting that, as we that might be important during morphogenetic events have shown here, overexpression of Dpp leads to similar like the one of dorsal closure that requires coordinated problems during dorsal closure as does loss of puc func- fine tuning of cellular behavior. tion. dpp would affect first the morphogenetic changes of the lateral epidermal cells during closure progression (Riesgo-Escovar and Hafen 1997), and second, the proper Materials and methods recognition and adhesion of the leading edge cells at clo- Drosophila strains and culture sure completion. Taken together, the existing results suggest that the All flies were maintained at 25°C on standard medium. The + E69 outcome of JNK signaling during dorsal closure is the P[ry , lacZ]E69 line (renamed puc ) was generated from the 566 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase 506 + E69 320 starter strain that carried the ry P[ry , lacZ]C49 chromo- genomic clones. Resident P elements in puc , puc , and A251.1 some, kindly provided by C. O’Kane, as described in Ring and puc (Ring 1993) were localized by Southern hybridization + 320 B48 Martinez-Arias (1993). P[w , lacZ]320c (renamed puc ) was a by standard techniques (Sambrook et al. 1989). puc was gift from J. Campos-Ortega (University of Koln, Germany). mapped by sequencing of a rescued plasmid. Eh l(3)84EhK19 (renamed puc ) was supplied by B. Baker (Stanford + A251.1 University, CA). P[w , lacZ]A251.1 (renamed puc ) was a Cloning and sequencing of puc cDNA gift from W. Gehring (Biozentrum, University of Basel, Switzer- + B48 land). The P[w , lacZ]B48 (renamed puc ) and the revertant A 12- to 24-hr embryonic cDNA library in pNB40, kindly pro- B48R23 puc were a gift from C. Ruhslow and A. Pai (New York vided by N. Brown (Brown and Kafatos 1988) was screened by University, NY). The hep mutant stock was a gift of S. Noselli use of the 3.7-kb EcoRI puc genomic fragment. Filters for hy- (Centre de Biologie du Developpement, CNRS, Toulouse, bridization were prepared with the added step of washing nitro- France). The UASdpp line was a generous gift of F. M. Hoffmann cellulose filters in CHCl for 2 min before baking. Hybridiza- (University of Wisconsin, Madison). The HsGal4 line was from tion and probe preparation were performed by standard tech- A. Brand (Wellcome/CRC Institute, University of Cambridge, nique (Sambrook et al. 1989). Restriction fragments of cDNAs UK). The ArmGal4 is expressed ubiquitously during embryonic were subcloned and sequenced in both directions by automatic development and is a gift of J.P. Vincent (NIMR, Medical Re- sequencing. search Council, London, UK). Embryo cuticle preparations were done according to Wie- Northern hybridization and RT–PCR schaus and Nu ¨ sslein-Volhard (1986) except that embryos were not fixed before mounting. RNA purification from Drosophila embryos was performed by the hot phenol/chloroform method (Jowett 1986). Northern blot Immunocytochemistry and whole mount in situ analysis was done by standard techniques (Sambrook et al. hybridization 1989). The Northern was probed with the 1037-bp BglII–EagI fragment of puc cDNA12 that had been labeled with Pby For all procedures, embryos were dechorionated, fixed for 20 random priming. min at room temperature in heptane/4% paraformaldehyde, RT–PCR was performed from single embryos as follows: Ex- and devitellinized with methanol. mRNAs were detected by in tracts from embryos (stage 13–14) were made in the cold in 10 μl situ hybridizations with DIG-labeled DNA probes following of PCR buffer [10 mM Tris (pH 8.2), 1.2 mM EDTA, 25 mM NaCl, standard protocols (Tautz and Pfeiffle 1989). Two puc probes 0.1% Tween 20, 0.1% gelatin] supplemented with 5 units of were used, a probe generated by PCR with primers flanking the RNAsin/ml. The extracts were mixed with 10 μl of proteinase second exon of cDNA12 and a probe generated from a HindII– K (50 μg/ml) in RNAsin–PCR buffer and incubated for 1 hr at BglII fragment of cDNA12 that includes 73 nucleotides from the 50°C, followed by denaturation at 94°C for 10 min. Five micro- pNB40 plasmid and 114 nucleotides from the 58 end of cDNA12 liters was taken into a 20-μl reverse transcriptase reaction [1 located within the 58 untranslated region. The dpp probe was unit of RT, 0.5 μM dNTPs, 5 units of RNAsin, 0.1 μg of a reverse generated from a 2-kb EcoRI fragment from a dpp cDNA clone primer from the third exon of puc (3.3REV; GAGGTCAATC- (St. Johnston et al. 1990). TGGATGAGCAG)] at 42°C, for 30 min. After heat inactiva- Antibody staining was performed by standard techniques tion, the transcription reactions were subjected to PCR ampli- (Ashburner 1989). The primary antibodies were commercial fication after the addition of a forward primer from the first rabbit anti-b-galactosidase and rabbit anti-non muscle myosin exon of puc (1.1ATG) (GTGCATATGTGTGTGAATCGAG) antibody (Kiehart and Feghali 1986). Biotinylated secondary an- and Taq polymerase. tibodies and streptavidin conjugated to horseradish peroxidase or Texas Red (Jackson laboratories) were used. F-actin staining was performed with rhodamine–phalloidin on embryos devitel- Construction of recombinant expression plasmids linized with 80% ethanol as described previously (Harden et al. The Puc fusion construct (pGST–PucT1) contains the NdeI 1995). (blunt-ended)–EcoRI fragment of pNB40/cDNA12 ligated to the expression plasmid PGEX-2T (Smith and Johnson 1988) digested Analysis of genomic DNA at the puc locus with SmaI and EcoRI. This recombinant plasmid encodes the E69 first 424 amino acids of Puc, including the phosphatase catalytic Genomic DNA was isolated from puc /TM3sb flies, partially domain, fused in frame to the carboxy-terminal end of GST. digested with Sau3A and size selected on 0.75% low melting The UASpuc construct was made by directional cloning of the point agarose following the protocol described by Kaiser and BglII–NotI fragment of PNB40/cDNA12 in the vector pUAST Murray (1985). Fragments were subcloned into lEMBL3 with (Brand and Perrimon 1993). Embryo injection and selection of the Stratagene cloning kit. Recombinants were packaged into recombinants were performed by standard procedures. phage particles by use of the Stratagene Gigapack II Plus Pack- aging Extract and transformed into Escherichia coli strain E69 P2392 (Stratagene). The puc genomic library was screened Protein purification and in vitro phosphatase activity assay with a probe against lacZ sequences. Genomic DNA from the resultant 12-kb clone was then used to probe a wild-type Dro- One-liter cultures grown to mid-log phase from freshly trans- sophila genomic library (gift from J. Tamkin, University of Col- formed cells were induced by IPTG (1 mM) and harvested after 3 orado, Boulder) to isolate wild-type genomic DNA from the puc hr. Harvested cells were frozen in dry ice for at least 30 min and locus. Library screening was done by standard techniques (Sam- thawed at 0°C. Two microliters of HKEDN buffer [25 mM brook et al. 1989). DNA probes were radioactively labeled with HEPES (pH 7.6), 0.1 M KCl, 0.1 mM EDTA, 0.5 mM DTT, 0.1% [a- P]ATP (Amersham) by random priming with hexadeoxy- NP-40, 10 mg/ml of leupeptin, 0.1 mM benzamidin, 10 mg/ml nucleotides (Pharmacia) according to the protocol described by of pepstatin A, 1 mM PMSF, 10 mg/ml of aprotinin, 1 mg/ml of Feinberg and Vogelstein (1984). The genomic map shown in phenanthroline] was added, and aliquots of 1 ml were sonicated. Figure 2 was generated by restriction mapping of overlapping Recombinant protein was insoluble and went to the pellet by GENES & DEVELOPMENT 567 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. centrifugation (TL100 rotor, 68,000 rpm for 45 min at 4°C). The was Coomassie stained, dried, and exposed to PhosphorImager pellet fraction was frozen in dry ice. The fusion protein was screens. recovered in a denatured form, dissolved in 6 M guanidine-HCl In experiments designed to measure ERK- and JNK-specific in HKEDN and refolded by gradual removal of the denaturant by phosphatase activity, embryonic extracts were prepared in the dialysis (Claasen et al. 1991). manner described above but with the exclusion of phosphatase Hydrolysis of PNPP was in a reaction volume of 200 μl con- inhibitors in all buffers. ERK phosphatase activity was mea- taining 50 mM imidazole at pH 7.5, 0.1% b-mercaptoethanol, 20 sured by the ability of clarified extracts to inhibit the phos- mM PNPP, and different concentrations of recombinant protein photransferase activity of activated human ERK toward myelin or control extracts at 30°C for 30 min. The reaction was stopped basic protein. Clarified extracts (10 μL) were mixed with kinase by addition of 800 μl of 0.25 M NaOH, and the absorbance at 410 buffer containing activated human ERK and MBP (10 μg) in a nm (A ) was measured (Keyse and Emslie 1992). final volume of 50 μL. Kinase reactions were initiated by the addition of [a- P]ATP (2.5 μCi/reaction) and the reaction al- lowed to proceed at 35°C for 15 min before termination by Kinase assays and measurement of JNK/ERK–phosphatase EDTA (20 mM). The entire reaction volume was then spotted to activity P81 phosphocellulose paper. After several washes in phosphoric For assessment of endogenous ERK and JNK activity, 50 decho- acid (1%) and a rinse in acetone, the P81 paper was air dried and rionated embryos at stage 13, identified under the microscope exposed to PhosphorImager screens for quantitation. by their mutant phenotypes, were homogenized in 50 μl of ice- To measure JNK–phosphatase activity, clarified extracts were cold extraction buffer (25 mM HEPES at pH 7.7, 0.3 M NaCl, 1.5 preincubated (30 min at 35°C) with GST–cJun (1–86) coupled to mM MgCl , 0.2 mM EDTA, 0.1% Triton X-100, 0.5 mM DTT, 20 glutathione–agarose beads with prebound activated JNK derived mM b-glycerophosphate, 0.1 mM Na VO , 10 μg/ml each of leu- from anisomycin-treated HeLa cells. Kinase reactions were ini- 3 4 peptin and aprotinin). The extracts were clarified by centrifuga- tiated by the addition of kinase buffer (20 mM HEPES at pH 7.6, tion (12,000g, 4°C for 20 min). 20 mM MgCl ,2mM DTT, 20 mM ATP, 10 μCi [g- P]ATP) and For measurement of endogenous ERK activities, an in-gel ki- allowed to proceed for 1 hr at 35°C. Control reactions were nase assay was performed according to the procedure of Ka- performed in kinase buffer (lacking phosphatase inhibitors) ei- meshita and Fujisawa (1989) by use of myelin basic protein ther in the absence of any extract or kinase buffer containing (MBP) as the substrate. Extracts prepared in the manner de- CL100 (kindly provided by S. Keyse, ICRF, Ninewells Hospital, scribed above were fractionated on a SDS/10% polyacrylamide Dundee, UK). Reactions were terminated as described above and gel containing 500 μg/ml of MBP. The gel was then washed fractionated on a SDS/10% polyacrylamide gel. The intensity of twice in Tris-HCl buffer (50 mM at pH 8) containing 20% (vol/ phosphorylated GST–cJun (1–86) protein was quantitated by vol) isopropanol, followed by washes in Tris-HCl buffer supple- PhosphorImaging. mented with 5 mM b-mercaptoethanol (buffer A). The proteins Loading controls for all the extracts (in the presence or ab- were then denatured for 1 hr with two changes of buffer A sence of phosphatase inhibitors) were performed by Western containing 6 M guanidine-HCl and finally renatured for 16–20 hr blotting. Western blots were tested with an anti-Drosophila at 4°C by incubating the gel in buffer A containing 0.04% (vol/ ERK (Rolled) antibody kindly provided by L. Zipursky (HHMI, vol) Tween 40. Renatured MBP kinase activity was detected by University of California, Los Angeles). This antibody recognizes incubating the gel for 30–45 min at 30°C in kinase buffer (50 mM a single 45-kD band. The results were quantified by densitomet- Tris-HCl at pH 8, 5 mM DTT, 5 mM MgCl ,1mM EGTA, 50 μM ric scanning of ECL films, and the results of kinase and phos- ATP, 20 μCi/ml [a- P]ATP). Unincorporated radioactivity was phatase assays were normalized to these values. removed by extensive washing of the gel in 5% (wt/vol) TCA solution containing 1% (wt/vol) tetrasodium pyrophosphate, dried, and analyzed by phosphorimaging. Intensity of bands was measured by the ImageQuant (Molecular Dynamics, Kent, UK) Acknowledgments software. For measurement of endogenous JNK activity, an aliquot of We thank C. O’Kane, W. Gehring, B. Baker, J. Campos-Ortega, the clarified total extract was diluted so that the final concen- J.P. Vincent, F.M. Hoffman, J. Pradel, A. Brand, C. Ruhslow, A. tration of the buffer was modified to 20 mM HEPES (pH 7.7), 75 Pia, and the Bloomington Stock center for generously providing mM NaCl, 2.5 mM MgCl , 0.1 mM EDTA, 0.05% Triton X-100, Drosophila stocks; L. Zipursky for the anti-Rolled antibody; S. 0.5 mM DTT, 20 mM b-glycerophosphate, 0.1 mM Na VO , and 3 4 Keyse for the CL100 protein; C.M. Marshall for the activated 10 μg/ml each of leupeptin and aprotinin. The diluted extracts human ERK; and E. Hafen, S. Noselli, and N. Perrimon for help- were then precleared by mixing with 10 μl of glutathione ful discussions and communication of data prior to publication. (GSH)–agarose for 3–4 hr at 4°C. After this time, GSH–agarose We are grateful to S. Keyse, M. Freeman, and A. Prokop for was pelleted and the supernatants were transferred into new comments on the manuscript, and S. Rolfe for technical assis- tubes and tumbled overnight at 4°C in the presence of GST– tance. E.M.-B. was supported by The Wellcome Trust and the cJun (1–86) coupled to glutathione–agarose beads. The beads European Union. A.G. and J.R. were supported by a Jane Coffin were finally pelleted and washed extensively (5 × 1 ml) in ice- Child fellowship and a Commonwealth studentship respec- cold HEPES-binding buffer (20 mM HEPES at pH 7.7, 50 mM tively. K.V. and A.M.T. are supported by the Wellcome Trust. NaCl. 2.5 mM MgCl , 0.1 mM EDTA, 0.05% Triton X-100). The A.M.-A. is a Senior Fellow of The Wellcome Trust. beads were then resuspended in 35 μl of kinase buffer (20 mM HEPES at pH 7.6, 20 mM MgCl ,20mM b-glycerophosphate, 0.1 mM Na VO ,2mM DTT, 20 μM ATP, 10 μCi [a- P]ATP), and 3 4 the reaction was allowed to continue for 1 hr at 30°C. The Note reactions were terminated by washing the beads twice with ice-cold HEPES-binding buffer and the phosphorylated proteins The cDNA sequence data reported in this paper have been sub- were eluted by the addition of Laemmli buffer. The proteins mitted to the GenBank/EMBL library under accession no. were then resolved on a SDS/10% polyacrylamide gel. The gel AJ223360. 568 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered, a Drosophila JNK phosphatase Aaronson. 1994. A novel dual-specificity phosphatase in- References duced by serum stimulation and heat-shock. J. Biol. Chem. Affolter, M., D. Nellen, U. Nussbaumer, and K. Basler. 1994. 269: 29897–29902. Multiple requirements for the receptor serine/threonine ki- Jowett, T. 1996. Preparation of nucleic acids. In Drosophila: A nase thickveins reveal novel functions of TGFb homologs practical approach (ed. D.B. Roberts), pp. 275–286. IRL Press, during Drosophila embryogenesis. Development 120: 3105– Oxford, UK. 3117. Kaiser, K. and N.E. Murray. 1985. The use of phage l replace- Ashburner, M. 1989. Drosophila, A laboratory handbook. Cold ment vectors in the construction of representative genomic Spring Harbor Laboratory, Cold Spring Harbor, NY. DNA libraries. In DNA cloning: A practical approach (ed. Brand, A.H. and N. Perrimon. 1993. Targeted gene expression as D.M. Glover), pp. 1–47. IRL Press, Oxford, UK. a means of altering cell fates and generating dominant phe- Kameshita, I. and H. Fujisawa. 1989. A sensitive method for notypes. Development 118: 401–415 detection of Calmodulin-dependent Protein Kinase-II activ- Brown, N.H. and F.C. Kafatos. 1988. Functional cDNA libraries ity in sodium dodecyl sulfate-polyacrylamide gel. Anal. Bio- from Drosophila embryos. J. Mol. Biol. 203: 425–437. chem. 183: 139–143. Canman, C.E. and M.B. Kastan. 1996. Signal transduction—3 Keyse, S.M. 1995. An emerging family of dual-specificity MAP paths to stress relief. Nature 384: 213–214. kinase phosphatases. Biochim. Biophys. Acta 1265: 152– Charles, C.H., H. Sun, L.F. Lau, and N.K. Tonks. 1993. The 160. growth factor-inducible immediate-early gene 3CH134 en- Keyse, S.M. and E.A. Emslie. 1992. Oxidative stress and heat- codes a protein-tyrosine-phosphatase. Proc. Natl. Acad. Sci. shock induce a human gene encoding a protein-tyrosine 90: 5292–5296. phosphatase. Nature 359: 644–647. Claasen, L.A., B. Ahn, H.S. Koo, and L. Grossman. 1991. Con- Keyse, S.M. and M. Ginsburg. 1993. Amino-acid-sequence simi- struction of deletion mutants of the Escherichia coli UvrA larity between CL100, a dual-specificity MAP kinase phos- protein and their purification from inclusion bodies. J. Biol. phatase and cdc25. Trends Biochem. Sci. 18: 377–378. Chem. 266: 11380–11387. Kiehart, D.P. and R. Feghali. 1986. Drosophila cytoplasmic Diaz-Benjumea, F.J. and E. Hafen. 1994. The sevenless signaling myosin. Biophys. J. 49: A186. cassette mediates Drosophila EGF receptor function during Kockel, S., J. Zeitlinger, L.M. Staszewski, M. Mlodzik, and D. epidermal development. Development 120: 569–578. Bohmann. 1997. Jun in Drosophila development: Redundant Doi, K., A. Gartner, G. Ammerer, B. Errede, H. Shinkawa, K. and non redundant functions and regulation by two MAPK Sugimoto, and K. Matsumoto. 1994. MSG5, A novel protein signal transduction pathways. Genes & Dev. 11: 1748–1758. phosphatase promotes adaptation to pheromone response in Kwak, S.P. and J.E. Dixon. 1995. Multiple dual-specificity pro- Saccharomyces cerevisiae. EMBO J. 13: 61–70. tein-tyrosine phosphatases are expressed and regulated dif- Feinberg, A.P. and B. Vogelstein. 1984. A technique for radiola- ferentially in liver-cell lines. J. Biol. Chem. 270: 1156–1160. beling DNA restriction endonuclease fragments to high spe- Martell, K.J., A.F. Seasholtz, S.P. Kwak, K.K. Clemens, and J.E. cific activity. Anal. Biochem. 137: 266–267. Dixon. 1995. HVH-5—A protein-tyrosine-phosphatase abun- Glise, B. and S. Noselli. 1997. Coupling of Jun amino-terminal dant in brain that inactivates Mitogen-Activated Protein- kinase and Decapentaplegic signaling pathways in Dro- kinase. J. Neurochem. 65: 1823–1833. sophila morphogenesis. Genes & Dev. 11: 1738–1747. Martinez-Arias, A. 1993. Development and patterning of the Glise, B., H. Bourbon, and S. Noselli. 1995. hemipterous en- larval epidermis of Drosophila. In The development of Dro- codes a novel Drosophila MAP kinase kinase, required for sophila melanogaster. (ed. C.M. Bate and A. Martinez-Arias), epithelial cell sheet movement. Cell 83: 451–461. pp. 517–608. Cold Spring Harbor Laboratory Press, Cold Groom, L.A., A.A. Sneddon, D.R. Alessi, S. Dowd, and S.M. Spring Harbor, NY. Keyse. 1996. Differential regulation of the MAP, SAP and Muda, M., U. Boschert, A. Smith, B. Antonsson, C. Gillieron, C. RK/P38 kinases by Pyst1, a novel cytosolic dual-specificity Chabert, M. Camps, I. Martinou, A. Ashworth, and S. Ar- phosphatase EMBO J. 15: 3621–3632. kinstall. 1997. Molecular cloning and functional character- Guan, K.L. and E. Butch. 1995. Isolation and characterization of ization of a novel Mitogen-Activated Protein kinase phos- a novel dual specific phosphatase, HVH2, which selectively phatase, MKP-4. J. Biol. Chem. 272: 5141–5151. dephosphorylates the mitogen-activated protein-kinase. J. Noguchi, T., R. Metz, L. Chen, M.G. Mattei, and R. Bravo. 1993. Biol. Chem. 270: 7197–7203. Structure, mapping and expression of erp, a growth factor- Guan, K., S.S. Broyles, and J.E. Dixon. 1991. A Tyr/Ser protein inducible gene encoding a nontransmembrane protein tyro- phosphatase encoded by vaccinia virus. Nature 350: 359– sine phosphatase, and effect of ERP on cell growth. Mol. 362. Cell. Biol. 13: 5195–5205. Harden, N., H.Y. Loh, W. Chia, and L. Lim. 1995. A dominant Nusslein-Volhard, C., E. Wieschaus, and H. Kluding. 1984. Mu- inhibitory version of the small GTP-binding protein Rac dis- tations affecting the pattern of the larval cuticle in Dro- rupts cytoskeletal structures and inhibits developmental sophila melanogaster. 1. Zygotic loci on the 2nd chromo- cell shape changes in Drosophila. Development 121: 903– some. Roux’s Arch. Dev. Biol. 193: 267–282. 914. Riesgo-Escovar, J.R. and E. Hafen. 1997. Drosophila Jun kinase Holland, P.M., M. Suzanne, J.S. Campbell, S. Noselli, and J.A. regulates expression of decapentaplegic via the ETS-domain Cooper. 1997. MKK7 is a stress-activated mitogen-activated protein Aop and the AP-1 transcription factor DJun during protein kinase kinase functionally related to hemipterous. J. dorsal closure. Genes & Dev. 11: 1717–1727. Biol. Chem. 272: 24994–24998. Riesgo-Escovar, J.R., M. Jenni, A. Fritz, and E. Hafen. 1996. The Hou, X.S., E.S. Goldstein, and N. Perrimon. 1997. Drosophila Drosophila Jun-N-terminal kinase is required for cell mor- Jun relays the Jun amino-terminal kinase signal transduction phogenesis but not for Djun-dependent cell fate specification pathway to the Decapentaplegic signal transduction path- in the eye. Genes & Dev. 10: 2759–2768. way in regulating epithelial cell sheet movement. Genes & Ring, J.M. 1993. Identification and characterization of the velcro Dev. 11: 1728–1737. locus of Drosophila melanogaster. Ph.D. thesis, University Ishibashi, T., D.P. Bottaro, P. Michieli, C.A. Kelley, and S.A. of Cambridge, Cambridge, UK. GENES & DEVELOPMENT 569 Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press Martı ´n-Blanco et al. Ring, J.M. and A. Martinez-Arias. 1993. puckered, a gene in- volved in position-specific cell differentiation in the dorsal epidermis of the Drosophila larva. Development (Suppl.) 121: 251–259. Rohan, P.J., P. Davis, C.A. Moskaluk, M. Kearns, H. Krutzsch, U. Siebenlist, and K. Kelly. 1993. Pac-1—a mitogen-induced nuclear protein tyrosine phosphatase. Science 259: 1763– Sambrook, J., E.F. Gritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Labora- tory Press, Cold Spring Harbor, NY. Sluss, H.K., Z.K. Han, T. Barrett, D.C.I. Goberdhan, C. Wilson, R.J. Davis, and Y.T. Ip. 1996. A JNK signal transduction pathway that mediates morphogenesis and an immune re- sponse in Drosophila. Genes & Dev. 10: 2745–2758. Smith, D.B. and K.S. Johnson. 1988. The single-step purification of polypeptides expressed in Escherichia coli as fusion pro- teins with Glutathione S-transferase. Gene 67: 31–40. St. Johnston, R.D., F.M. Hoffmann, R.K. Blackman, D. Segal, R. Grimaila, R.W. Padgett, H.A. Irick, and W.M. Gelbart. 1990. Molecular organization of the decapentaplegic gene in Dro- sophila melanogaster. Genes & Dev. 4: 1114–1127. Sun, H., C.H. Charles, L.F. Lau, and N.K. Tonks. 1993. MKP-1 (3CH134), an immediate early gene product, is a dual speci- ficity phosphatase that dephosphorylates MAP kinase in vivo. Cell 75: 487–493. Tautz, D. and C. Pfeifle. 1989. A non-radioactive in situ hybrid- ization method for the localization of specific RNAs in Dro- sophila embryos reveals translational control of the segmen- tation gene hunchback. Chromosoma 98: 81–85 Tournier, C., A.J. Whitmarsh, J. Cavanagh, T. Barret, and R.J. Davis. 1997. Mitogen-Activated Protein Kinase Kinase 7 is an activator of the c-Jun NH2-terminal Kinase. Proc. Natl. Acad. Sci. 94: 7337–7342. Wharton, K.A., R.P. Ray, and W.M. Gelbart. 1993. An activity gradient of decapentaplegic is necessary for the specification of dorsal pattern elements in the Drosophila embryo. Devel- opment 117: 807–822. Wieschaus, E. and C. Nusslein-Volhard. 1986. Looking at em- bryos. In Drosophila, a practical approach. (ed. D.B. Rob- erts), IRL Press, Oxford, Washington, D.C. Wilson, R., R. Ainscough, K. Anderson, C. Baynes, M. Berks et al. 1994. 2.2 Mb of contiguous nucleotide-sequence from chromosome-III of C. elegans. Nature 368: 32–38. Young, P.E., A.M. Richman, A.S. Ketchum, and D.P. Kiehart. 1993. Morphogenesis in Drosophila requires nonmuscle myosin heavy chain function. Genes & Dev. 7: 29–41. 570 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 7, 2021 - Published by Cold Spring Harbor Laboratory Press puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila Enrique Martín-Blanco, Alexandra Gampel, Jenny Ring, et al. Genes Dev. 1998, 12: This article cites 41 articles, 23 of which can be accessed free at: References http://genesdev.cshlp.org/content/12/4/557.full.html#ref-list-1 License Receive free email alerts when new articles cite this article - sign up in the box at the top Email Alerting right corner of the article or click here. Service Cold Spring Harbor Laboratory Press
Journal
Genes & Development – Unpaywall
Published: Feb 15, 1998