Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

A novel ubiquitin‐binding protein ZNF216 functioning in muscle atrophy

A novel ubiquitin‐binding protein ZNF216 functioning in muscle atrophy The EMBO Journal (2006) 25, 554–564 & 2006 European Molecular Biology Organization All Rights Reserved 0261-4189/06 | | THE THE www.embojournal.org EMB EMB EMBO O O JO JOU URN R NAL AL A novel ubiquitin-binding protein ZNF216 functioning in muscle atrophy 1,2 3 or 19S subunits of proteasome and proteolysis in the Akinori Hishiya , Shun-ichiro Iemura , 3 2 proteasome. Tohru Natsume , Shinichi Takayama , 1 1, Many catabolic conditions, such as low-insulin state, hy- Kyoji Ikeda and Ken Watanabe * perthyroidism, sepsis and cancer cachexia lead to enhance- Department of Bone & Joint Disease, National Center for Geriatrics 2 ment of protein breakdown in skeletal muscle known as & Gerontology (NCGG), Obu, Aichi, Japan, Program of Molecular muscle atrophy (Mitch and Goldberg, 1996; Lecker et al, Chaperone Biology, Department of Radiology, Medical College of Georgia, Augusta, GA, USA and Japan Biological Information Research 1999). In muscle atrophy, the UPS plays a pivotal role in Center (JBIRC), National Institute of Advanced Industrial Science protein breakdown (Price et al, 1996; Tawa et al, 1997). & Technology (AIST), Tokyo, Japan Several studies indicate that mRNAs encoding UPS compo- nents are increased in atrophying muscle (Medina et al, 1991; The ubiquitin–proteasome system (UPS) is critical for Wing and Goldberg, 1993; Bailey et al, 1996; Price et al, 1996; specific degradation of cellular proteins and plays a pivotal Jagoe et al, 2002). In particular, the E3 ubiquitin ligases role on protein breakdown in muscle atrophy. Here, we MAFbx/Atrogin-1 and MuRF-1 (muscle RING finger 1) are show that ZNF216 directly binds polyubiquitin chains known to be markers of muscle atrophy (Bodine et al, through its N-terminal A20-type zinc-finger domain and 2001; Gomes et al, 2001). Both are induced in multiple associates with the 26S proteasome. ZNF216 was coloca- models of muscle atrophy including immobilization, dener- lized with the aggresome, which contains ubiquitinylated vation and hindlimb suspension, and mice deficient in proteins and other UPS components. Expression of Znf216 either gene are resistant to denervation-induced muscle was increased in both denervation- and fasting-induced atrophy (Bodine et al, 2001). Goldberg and co-workers pro- muscle atrophy and upregulated by expression of consti- posed that atrophy-related genes, whose expression is in- tutively active FOXO, a master regulator of muscle atrophy. duced in multiple types of muscle atrophy, are called Mice deficient in Znf216 exhibited resistance to denerva- ‘atrogenes’ (Sandri et al, 2004). Recently, it was demon- tion-induced atrophy, and ubiquitinylated proteins mark- strated that the IGF-I/PI3K/Akt pathway is an important edly accumulated in neurectomized muscle compared to regulator of muscle mass in muscle hypertrophy and atrophy wild-type mice. These data suggest that ZNF216 functions (Sacheck et al, 2004; Sandri et al, 2004; Stitt et al, 2004). in protein degradation via the UPS and plays a crucial role In that case, the transcription factor FOXO plays a pivotal in muscle atrophy. role in activating atrogenes such as MAFbx/Atrogin-1 The EMBO Journal (2006) 25, 554–564. doi:10.1038/ (Gomes et al, 2001). sj.emboj.7600945; Published online 19 January 2006 Although many UPS players such as E3 ligases have been Subject Categories: proteins; molecular biology of disease characterized, the mechanism of how ubiquitinylated pro- Keywords: aggresome; muscular atrophy; proteasome; teins are delivered to the proteasome have not been fully ubiquitin; zinc-finger protein elucidated. A component of 19S proteasome, Rpn10/S5a, recognizes the ubiquitinylated proteins (Young et al, 1998; Wilkinson et al, 2000). It has been shown that yeast proteins, Rad23p and Dsk2p, bind to ubiquitinylated substrates and to Introduction the 26S proteasome through their UBA and Ubl domains, respectively, thereby functioning as shuttle proteins that The ubiquitin–proteasome system (UPS) is one of the major present polyubiquitinylated proteins to the proteasome protein degradation pathways in eukaryotic cells. The UPS (Chen et al, 2001; Funakoshi et al, 2002; Elsasser and plays key regulatory roles in many cellular processes, includ- Finley, 2005). Loss-of-function of shuttle proteins results in ing cell cycle control, the regulation of transcription and abnormal accumulation of polyubiquitinylated proteins protein quality control (Hershko and Ciechanover, 1998; (Lambertson et al, 1999; Saeki et al, 2002). However, yeast Pickart and Cohen, 2004). Aberrations of this system lead can survive when both RAD23 and DSK2 genes are mutated, to many forms of pathogenesis, such as malignancies, suggesting that other mechanisms or molecule(s) poss- neurodegenerative disease and inflammatory response essing a shuttle function exist (Saeki et al, 2002). Here, we (Glickman and Ciechanover, 2002). The UPS includes show that ZNF216, a novel ubiquitin-binding protein sequential, multistep reactions: ubiquitin-conjugation of containing an A20-type zinc-finger, is such a factor. Znf216 target proteins by E1, E2 and E3 enzymes, recognition of expression is upregulated in skeletal muscle in experi- ubiquitinylated proteins by ubiquitin-binding proteins mental models of muscle atrophy, and Znf216-deficient mice exhibit resistance to muscle atrophy accompanied by *Corresponding author. Department of Bone & Joint Disease, National Center for Geriatrics & Gerontology (NCGG), Obu, Aichi 474-8522, abnormal accumulation of polyubiquitinylated proteins in Japan. Tel.: þ 81 562 46 2311; Fax: þ 81 562 44 6595; skeletal muscle. Our findings suggest that ZNF216, with its E-mail: [email protected] potential function of anchoring ubiquitinylated proteins to the proteasome, plays a critical role in degrading Received: 6 June 2005; accepted: 14 December 2005; published online: 19 January 2006 muscle proteins. 554 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al nents was monitored by immunoblotting using an antibody Results against Rpn7p (S10a), a non-ATPase subunit of the 19S ZNF216 directly binds to polyubiquitin regulatory subunit. As shown in Figure 2A, this protein We have identified a gene, Znf216 (Za20d2, Mouse Genome efficiently co-precipitated with FLAG-tagged ZNF216. The Informatics), encoding an A20 zinc-finger (Znf-A20) motif- interaction was also observed with truncated or point mu- containing protein, as a RANKL-induced gene upregulated tants of ZnF-A20 (DN or M1), indicating that ubiquitin- upon osteoclast formation using a microarray technique binding ability is dispensable for association with the 26S (Hishiya et al, 2005). Znf216 was originally identified as a proteasome. To determine whether endogenous ZNF216 pro- candidate gene for hearing loss and is expressed in cochlear teins are also associated with the 26S proteasome, we per- and skeletal muscle (Scott et al, 1998; Huang et al, 2004). To formed a GST pull-down assay using the ubiquitin-like (Ubl) determine the function of ZNF216, we searched for molecules domain of hHR23B, a human homologue of Rad23, which is that associate with ZNF216 using yeast two-hybrid screening known to bind to the 26S proteasome. As shown in Figure 2B, and isolated several clones encoding a gene for polyubiquitin GST-Ubl but not GST was pulled down with the endogenous C. To determine whether ZNF216 interacts with ubiquitin in 26S proteasome. Endogenous ZNF216 was also detected mammalian cells, we transfected HEK293 cells with an in the GST-Ubl/26S proteasome complex (upper panels, expression vector for FLAG-tagged ZNF216 and HA-tagged Figure 2B). Furthermore, purified recombinant ZNF216 did ubiquitin and performed co-immunoprecipitation experi- not bind to GST-Ubl (lower panel, Figure 2B), suggesting that ments. ZNF216 possesses A20-type (amino acids 11–35) and endogenous ZNF216 is not directly bound to the Ubl domain AN1-type (amino acids 154–191) zinc-finger domains at its but associates with the 26S proteasome. N- and C-termini, respectively (Figure 1A). Endogenous ubiquitinylated proteins, which appear as smears, were co- Colocalization with the aggresome immunoprecipitated with FLAG-tagged ZNF216 (Figure 1B). Next, we determined the subcellular localization of ZNF216. Notably, N-terminal deletion (DN; amino acids 36–213) or Indirect immunofluorescence of ZNF216 expressed in point mutants (M1 and M3) of the A20-type zinc-finger (ZnF- COS-7 cells showed that the protein was largely cytoplasmic A20) domain abolished ubiquitin-binding ability of ZNF216, but was seen to a lesser extent in the nucleus (Figure 3A). indicating that the ZnF-A20 domain is indispensable for Aggresomes, which are insoluble aggregates of ubiquitiny- binding to ubiquitin (Figures 1A and B). Whereas in non- lated proteins complexed with the proteasome and induced denaturing conditions, ubiquitinylated molecules were pre- by treatment with proteasome inhibitors, are known to mimic sent with FLAG-tagged ZNF216, these molecules completely inclusions seen in pathogenic UPS disorders (Johnston et al, disappear from immunoprecipitates following heat denatura- 1998; Kopito, 2000; Lelouard et al, 2002). As shown in tion, which abolishes noncovalent protein–protein interac- Figures 3D–H, ZNF216 proteins were colocalized with aggre- tions (Figure 1C), suggesting that ZNF216 associates with somes induced by treatment with the proteasome inhibitor ubiquitinylated proteins rather than being ubiquitinylated MG132. ZNF216 itself was not ubiquitinylated as shown in itself. Next, to determine whether ZNF216 binds to ubiquitin Figure 1C. directly, we performed GST pull-down assays using GST- ZNF216 fusion proteins (Figure 1D) and purified polyubiqui- Induction of ZNF216 expression upon muscle atrophy tin. As shown in Figure 1E, GST-ZNF216 but not GST bound Biochemical and cell biological evidence presented here to polyubiquitin chains. As expected, binding of ZNF216 strongly suggests that ZNF216 functions in the UPS. In to polyubiquitin chains was completely abolished by a skeletal muscle, it is generally accepted that the UPS plays point mutation in the ZnF-A20 domain (M1, Figure 1E). a critical role in muscular atrophy, and expression of atrophy- Furthermore, a GST fusion protein containing only the ZnF- related genes including those encoding UPS components is A20 domain (amino acids 2–60) could bind to polyubiquitin induced in atrophying muscle (Jagoe et al, 2002; Lecker et al, chains, suggesting that ZNF216 directly binds to polyubiqui- 2004). As Znf216 was predominantly expressed in brain tin chains, and that the ZnF-A20 domain is required for and skeletal muscle (Scott et al, 1998), we investigated the binding to polyubiquitin. As for other ZnF-A20 containing relationship between ZNF216 and muscle atrophy. To deter- proteins, AWP1 (ZA20D3) also possessed polyubiquitin-bind- mine whether Znf216 expression is induced during muscle ing activity but the ZnF-A20 domain(s) of Rabex-5 (Horiuchi atrophy, an in vitro model of muscle atrophy was utilized. It et al, 1997) and A20/TNFAIP3 (Opipari et al, 1990) proteins has been reported that addition of dexamethasone to cultures did not (Supplementary Figure S1). of differentiated C2C12 myotubes causes formation of myo- tubes exhibiting signs of atrophy, including a reduction in ZNF216 associates with the 26S proteasome myotube diameter (Stitt et al, 2004). Such treatment drama- We also identified molecules associating with ZNF216 by tically induced expression of Znf216 (Figure 4A). proteomic analysis of complexes formed with FLAG-tagged Next, expression of Znf216 was determined in in vivo ZNF216. Molecules expressed in HEK293 cells and that co- experimental models of muscle atrophy. Mice that undergo immunoprecipitated with FLAG-tagged ZNF216 were ana- fasting for 2 days show significant decreases in body weight, lyzed by tandem mass spectrometry. By this analysis, every as well as in the mass of the gastrocnemius muscles (data not subunit of the 26S proteasome complex was identified as shown). In this model, fasting for 2 days results in dramatic associating with FLAG-tagged ZNF216 (data not shown). To increases in Znf216 mRNA (Figure 4B) and protein identify the region of ZNF216 required for association with (Supplementary Figure S3) in muscle. Although there were the 26S proteasome, lysates of cells expressing either FLAG- differences in induction patterns of two differently sized tagged ZNF216 or its mutants were immunoprecipitated with transcripts of Znf216 by atrophy-inducting stimuli, both anti-FLAG antibody. Co-precipitation of proteasomal compo- transcripts encode the same protein (Supplementary Figures &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 555 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Figure 1 ZNF216 binds polyubiquitin directly through the ZnF-A20 domain. (A) Schematic representation of the primary structure of wild-type ZNF216 and its mutants. ZNF216DN (aa 36–213) and ZNF216DC (aa 2–153) constructs lack the ZnF-A20 (aa 11–35) and ZnF-AN1 (aa 154–194) domains, respectively. Cysteine residues at positions 30 and 33 within the ZnF-A20 were substituted with alanines (C30A/C33A) in ZNF216M1, and both cysteines 170 and 175 within the ZnF-AN1 were substituted with alanines (C170A/C175A) in ZNF216M2. Both ZnF-A20 and ZnF-AN1 domains were mutated in ZNF216M3. (B) Co-precipitation of ubiquitinylated proteins and ZNF216. FLAG-tagged ZNF216 or mutants were expressed in HEK293 cells, and cell extracts were immunoprecipitated with anti-FLAG antibody. Ubiquitinylated proteins detected with anti- ubiquitin antibody were precipitated with FLAG-tagged ZNF216 but not with ZnF-A20 mutants. Expression levels of FLAG-tagged ZNF216 constructs are shown at the bottom. Bands corresponding to immunoglobulin chains are marked by an asterisk. (C) ZNF216 is minimally ubiquitinylated. HEK293 cells expressing FLAG-tagged ZNF216 or HA-tagged ubiquitin were lysed and immunoprecipitation was performed using anti-FLAG antibody. Aliquots of precipitated beads were boiled and immunoprecipitated again (re-IP). Each sample was separated on gels and probed with anti-HA (left) or anti-FLAG antibody (right). Bands for immunoglobulin chains are marked by asterisks. (D) Constructs used for in vitro binding assay. ZNF216WT, ZNF216M1 and ZNF216 M2 were as indicated in (A). ZNF216A20 possesses only the A20 domain (aa 2–60). All constructs were produced as GST fusion proteins. (E) In vitro ubiquitin binding assay. Left panel: GST protein fused to the constructs indicated in (D) was incubated with purified K48-linked polyubiquitin chains, followed by precipitation with GSH beads. In all, 10% of purified polyubiquitin chains was separated without pull-down to evaluate protein amount (10% input). Right panel: the membrane was stained with ponceau to evaluate levels of GST fusion protein. S2 and S3). Expression of MuRF-1 (Figure 4B) and MAFbx within the first 7 days postsurgery. As expected, expression of (Gomes et al, 2001) was also induced in fasting. Upregulation Znf216 and MuRF-1 was induced in gastrocnemius muscles of Znf216 was also observed in a model of denervation- by denervation-induced muscle atrophy (Figure 4C). These induced muscle atrophy. Neurectomy promotes significant results suggest that Znf216 expression is associated with reduction (B20%) in the weight of gastrocnemius muscles atrophy in skeletal muscles. 556 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al The transcription factor FOXO has been reported to play a critical role in muscular atrophy by inducing atrophy-related genes, including MAFbx/Atrogin-1 (Sandri et al, 2004; Stitt et al, 2004). Therefore, we asked whether FOXO activation upregulated Znf216 expression. To do so, we employed a Cre- loxP system (Furukawa-Hibi et al, 2002) in which constitu- tively active FOXO4 (AFX-TM) created by mutation of the three Akt phosphorylation sites, T32A, S253A and S315A (Brunet et al, 1999), was expressed in C2C12-AFX-TM cells following infection by Cre recombinase-expressing adeno- virus (Cre) (Figure 4D). Both AFX-TM mRNA and protein were induced 24 h after infection with Cre but not with control adenovirus (Furukawa-Hibi et al, 2002). ZNF216 mRNA was markedly increased in C2C12-AFX-TM cells as a result of infection with Cre but not following infection with control virus (Figure 4E). These results suggest that ZNF216 may function as a downstream effector of FOXO in muscle atrophy. Generation of mice lacking ZNF216 To investigate the in vivo function of ZNF216, mice deficient lex/lex for ZNF216 (Znf216 ) were generated by gene trapping at Omnibank of Lexicon Genetics (Zambrowicz et al, 1998). The structure of the predicted trapped gene is shown in Figure 5A. Figure 2 Interaction of ZNF216 with the 26S proteasome in mam- The trapping vector, VICTR48, was inserted 3.3 kbp upstream malian cells. (A) Co-precipitation of the 26S proteasome and ZNF216. Co-precipitated proteins with FLAG-ZNF216 were resolved of exon 3, which encodes the first methionine of mouse lex/lex by SDS–PAGE and detected by immunoblotting using anti-S10a/ Znf216 (Figure 5A). Znf216 mice were born from in- Rpn7p antibody (anti-S10) or anti-FLAG antibody. Aliquots of þ /lex terbred heterozygous Znf216 mice in Mendelian ratios, cellular extracts were immunoblotted without immunoprecipitation indicating that ZNF216 is dispensable for embryogenesis or to evaluate protein expression in the bottom panels. (B) ZNF216 fetal development. No ZNF216 mRNA or protein was detected was detected in the 26S proteasome fraction. Upper panel, cell lex/lex lysates were incubated with a GST fusion of HHR23B Ubl (HHR23B in Znf216 mice by Northern or immunoblot analyses, Ubl) to isolate the 26S proteasome. Precipitated proteins (P/D) were respectively (Figures 5B and C), indicating that the mice are separated and probed with anti-S10 or anti-ZNF216 antibody. Lower þ /lex ZNF216 nulls. Expression levels of ZNF216 in Znf216 panel: purified recombinant ZNF216 was incubated with a GST fusion of HHR23B Ubl or GST protein. Precipitated (P/D) or not heterozygotes were nearly one-half those of wild-type mice. lex/lex precipitated (Sup) proteins were probed with anti-ZNF216 antibody. Znf216 mice were viable and fertile, without gross No direct binding of ZNF216 to the Ubl domain of HHR23B was abnormalities or apparent pathological alteration, but they detected. weighed less than sex- and age-matched controls (Figure 5D). þ /þ At 45 weeks, the average weights of Znf216 and Figure 3 ZNF216 is localized in ‘aggresomes’ with ubiquitinylated proteins. (A–H) COS cells were transfected with expression vectors for FLAG-tagged ZNF216 and HA-tagged ubiquitin. Fixed cells were subjected to indirect immunofluorescence using (A, E) anti-FLAG (with AlexaFluor 488 anti-mouse IgG, green) and (B, F) anti-HA (with AlexaFluor 546 anti-rat IgG antibodies, red) antibodies. (C, G) Nuclei were stained with DAPI in the same fields of each panel. (E–H) Transfected COS cells were treated with the proteasome inhibitor, MG132 (0.5 mM). Aggresomes formed are indicated by arrowheads. The merged images were shown in (D and H). &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 557 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al LTR SA NEO pA PGK BTK SD LTR Dex C1 C2 F1 F2 F3 AB A Time (h) 0 24 48 72 96 VICTR48 ZNF216 ZNF216 ATG TAA 5′ 3′ Wild-type gene EF1α α E1 E2 E3 E4E5 E6 E7 MuRF-1 GAPDH Transgenic allele 5′ 3′ E1 E2 E3E4 E5 E6 E7 Denervation Sham +/+ +/lex lex/lex +/+ +/lex lex/lex 12 3 4 5 6 7 1 2 3 4 5 6 7 B C ZNF216 ZNF216 ZNF216 Tubulin MuRF-1 EF1α α GAPDH * * D 50 * * * * * CAG EGFP pA Flag-AFX-TM pA * * * 45 * Cre recombinase (Cre Adeno) CAG Flag-AFX-TM pA 30 * * * * * 25 * * * * * * * * * * * * * 012345678 9 101112131415161718 Age (months) ZNF216 Figure 5 Disruption of Znf216 gene in mice. (A) Gene trap strategy of Znf216 gene. The structure of the trapping vector, VICTR48, is EF1α shown in the upper line. The wild-type allele and the trapped, transgenic allele follow the vector. The retroviral vector, VICTR48, Figure 4 Expression of ZNF216 is induced by muscle atrophy. (A) was integrated between exons 1 and 2 of the Znf216 gene and C2C12 myoblast cells were differentiated into myotubes, and treated transcription of downstream exons encoding ZNF216 was dimin- with 100 mM Dex for the indicated times. Northern blotting was ished. Exons are depicted by striped (noncoding exons) or sha- performed to reveal the effect of Dex on ZNF216 expression. The dowed boxes (protein-coding exons) and numbered (E1 and E2). entire coding region of ZNF216 was used as a probe, which LTR, long terminal repeat; SA, splice acceptor site; SD, splice donor recognized 2.4 and 1.5 kb mRNA species arising from alternative site; pA, polyadenylation signal; PGK, PGK promoter. (B) Northern þ /þ splicing and polyadenylation. The loading control was elongation blot analysis. Total RNA was prepared from brains of Znf216 , þ /lex lex/lex factor a (EF1a). (B) Fasting-induced muscle atrophy. Three mice ZnfF216 or Znf216 mice. Full-length mouse ZNF216 cDNA were fasted (F1BF3), and two mice (C1, C2) were fed freely. After 2 was used as a probe. The membrane was re-probed using an EF1a þ /þ days, RNA was purified from gastrocnemius muscle, and Northern probe. (C) Immunoblot analysis. Extracts from brain of Znf216 , þ /lex lex/lex blotting was performed to determine ZNF216 expression. The Znf216 or Znf216 mice were immunoblotted with anti- membrane was re-probed with MuRF-1 and GAPDH. (C) body against ZNF216. The membrane was re-probed using anti- lex/lex Denervation-induced muscle atrophy was induced by cutting the tubulin antibody. (D) Growth curve of Znf216 mice. Body þ /þ lex/lex sciatic nerve of the hindlimb of seven mice (1B7). The opposite weights at each time point of Znf216 and Znf216 mice limb was sham operated as the control. At 7 days after surgery, total were indicated as open square boxes (males) or circles (females) RNA was purified from gastrocnemius muscles, and Northern and closed square boxes (males) or circles (females), respectively. blotting was performed to detect ZNF216 expression. The mem- *Po0.05; **Po0.005. brane was re-probed with MuRF-1 and GAPDH. (D) Cre-loxP- mediated, constitutively active FOXO expression system. cDNA encoding FLAG-tagged constitutively active FOXO4 (AFX-TM) is þ /lex Znf216 mice gained weight as they aged (Figure 5D). separated from the CAG promoter of an expression vector by a lex/lex The size of most organs in Znf216 mice was reduced in loxP-flanked EGFP-poly(A) cassette. Infection with adenovirus ex- pressing Cre recombinase (Cre) results in excision of the DNA proportion with body weight. However, the fat volume of fragment located between the two loxP sequences and expression lex/lex aged (430 weeks of age) Znf216 mice was significantly of FLAG-tagged AFX-TM. (E) ZNF216 is downstream of FOXO. Total decreased, suggesting that the marked difference in body RNAs were prepared from C2C12-AFX-TM cells at the indicated lex/lex times after infection with adenovirus expressing Cre (Cre) or lacZ weight between wild-type and aged Znf216 mice is lex/lex (control) and probed by Znf216 or EF1a. A marked increase in mainly caused by decreased fat mass seen in Znf216 expression of Znf216 was observed only in Cre-infected cells. mice (not shown). Detailed phenotypic characterization of aged mutant mice will be provided elsewhere. lex/lex Znf216 male mice were 42.6677.06 g (n¼ 14) and lex/lex 33.1674.44 g (n¼ 9), respectively. The average weights of Znf216 mice exhibit partial resistance to þ /þ lex/lex female Znf216 and Znf216 mice were 34.4674.21 g denervation-induced muscle atrophy (n¼ 14) and 26.8575.38 g (n¼ 11), respectively. After 30 To further explore the involvement of ZNF216 in muscle lex/lex weeks, both female and male Znf216 mice showed no atrophy, neurectomy of sciatic nerve was undertaken in þ /þ lex/lex or subtle increases in weight, whereas Znf216 or wild-type and Znf216 mice. As shown in Figure 6A, 7 558 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | No infection Cre adeno (24H) Control adeno (24H) Cre adeno (48H) Control adeno (48H) Body weight (g) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al days after denervation, significant muscle weight loss and expression levels of factors involved in muscle atrophy. As reduction in fiber sizes of the gastrocnemius muscle were expected, expression of MAFbx/Atrogin-1 and MuRF-1 was observed in wild-type mice. By contrast, such decreases in dramatically induced by denervation-induced muscle atrophy lex/lex muscle weight were significantly attenuated in Znf216 in gastrocnemius muscle from wild-type mice (Figure 6A). lex/lex mice (Figure 6A). Sections of gastrocnemius muscle also In Znf216 mice, expression of MAFbx/Atrogin-1 and showed larger fibers in muscle from neurectomized MuRF-1 was also induced at levels comparable to those lex/lex Znf216 mice than in control muscle (Figure 6B). seen in wild-type mice. Induction of Pmsa1 and Pmsd11, However, there was no significant difference in fiber area genes encoding the 26S proteasome subunits a6 and Rpn6, lex/lex lex/lex between sham-operated wild-type and Znf216 mice respectively, was also indistinguishable between Znf216 (wild typeþ sham operated, 19887530mm ; wild typeþ de- and wild-type mice (Figure 7A). Furthermore, proteasome nervation, 13797345 mm ; lex/lexþ sham operated, activities in gastrocnemius muscles were comparable 2 2 lex/lex 17767484 mm ; lex/lexþ denervation, 13937344 mm ). As between wild-type and Znf216 mice (Figure 7B). Thus, shown in Figure 6C, the reduction in fiber area was also induction of relevant ubiquitin ligases or proteasome compo- lex/lex lex/lex less apparent in Znf216 mice compared to wild-type nents was not affected in Znf216 mice. It is known that mice. These results suggest that ZNF216 plays a crucial role ubiquitinylated proteins accumulate during muscle atrophy in reduction of muscle mass on denervation-induced muscle (Medina et al, 1991; Wing et al, 1995). As shown in atrophy. Figure 7C, following denervation, ubiquitinylated proteins accumulated in the gastrocnemius muscle of wild-type Abnormal accumulation of ubiquitinylated proteins mice, but higher levels of ubiquitinylated proteins accumu- lex/lex lex/lex lated in muscle derived from Znf216 mice (B2-fold: in muscle from Znf216 mice lex/lex Po0.001 in neurectomized Znf216 versus wild-type To investigate what abnormalities occur during denervation- lex/lex muscle). Similar results were obtained by fasting-induced induced muscle atrophy in Znf216 mice, we examined muscle atrophy, although no difference in the levels of ubiquitinylated proteins from controls (sham-operated or fed) was observed between genotypes (Figure 7C). These A C P < 0.05 P < 0.001 90 results indicate that ZNF216 is a critical regulator of muscle atrophy, most likely functioning to regulate degradation of muscle proteins without altering expression of proteasomal 70 components or known E3 ligases. 15 60 Effect of ZNF216 on UPS-mediated protein degradation Accumulation of ubiquitinylated protein under any circum- stance might be because of loss of inhibition of ubiquitinyla- tion and/or deubiquitinylation (DUB). However, no inhibition or DUB activity was observed (Supplementary Figures S4 and S5). As shown in Figure 7D, association of 0 20 ZNF216 protein to the proteasome was significantly increased +/+ lex/lex +/+ lex/lex when atrophy was induced, suggesting that ZNF216 may be involved in association of ubiquitinylated proteins and the +/+ +/+ Znf216 (Sham) Znf216 (Denervation) proteasome. The biochemical activity of ZNF216 is similar to that of the UPS proteins, hHR23 and hPLIC, both of which have a shuttle function and are known to bind to both polyubiquitinylated proteins and the 26S proteasome (Hartmann-Petersen and Gordon, 2004; Elsasser and Finley, 2005). Interestingly, overexpression of hHR23 and hPLIC results in stabilization of unstable proteins such as p53 lex/lex lex/lex Znf216 (Sham) Znf216 (Denervation) (Kleijnen et al, 2000; Glockzin et al, 2003). To determine if ZNF216 functioned similarly, we employed a degradation system using unstable GFP (Bence et al, 2001). In this system, the CL1 peptide, which functions as a degron, is fused to EGFP (EGFP-CL1). Degradation by conjugation with the degron is mediated by the UPS (Bence et al, 2001). EGFP- CL1, constitutively expressed in HEK293 cells, is unstable and the estimated half-life (t ) of EGFP-CL1 in this system 1/2 Figure 6 Denervation induced muscular atrophy was attenuated in is about 11 min. Ubiquitinylated EGFP-CL1 protein stabilized lex/lex ZNF216 mice. (A) Reduction of GA muscle weight upon by treatment with a proteasome inhibitor was associated neurectomy. Percent decreases in muscle weights are shown as with ZNF216 but EGFP itself was not (not shown). As a percent of control, calculated as the left/right muscle weights. (B) Cross-sections from gastrocnemius muscle were stained by shown in Figure 8A, protein degradation was markedly indirect immunofluorescence with anti-laminin. The reduction in retarded in the presence of ectopic ZNF216 (t 430 min) 1/2 size was also significant in muscle fibers of control mice but less in lex/lex compared to cells transfected with the loss of function mutant Znf216 .(C) Muscle fiber cross-sectional areas were measured ZNF216M3 or mock-transfected cells. Rapid turnover of in transverse tissue section (B). Percent relative fiber area of denervated muscle to control fiber area (sham-operated) are shown. EGFP-CL1 protein was inhibited by treatment with the &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 559 | | Reduction in GA muscle weight (%) Relative fiber area (%) (Denervation fiber area/ control fiber area) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Sham Denervation AB P < 0.005 +/+ lex/lex +/+ lex/lex P < 0.05 12 3 1 2 3 1 2 3 1 2 3 NS NS MAFbx MuRF-1 PSMA1 +/+ lex/lex +/+ lex/lex PSMD11 Sham Denervation GAPDH Sham Ad lib Fasting Denervation +/+ lex/lex +/+ lex/lex +/+ lex/lex +/+ lex/lex 12 3 1 2 3 12 3 1 2 3 1 2 1 2 1 2 1 2 Actin Ad lib Fasting UbI GST UbI GST UbI GST UbI GST ZNF216 S10 Figure 7 Changes in UPS upon muscular atrophy. (A) Expression of UPS components in denervation-induced muscular atrophy. Total RNAs were purified from gastrocnemius muscle, and Northern blotting was performed using indicated probes. Expression of genes for ubiquitin- ligases, such as MAFbx or MuRF-1, and proteasome subunits PSMA1 and PSMD11 was induced by muscle atrophy at comparable levels lex/lex lex/lex between wild-type and ZNF216 mice. (B) Proteasome activity. Proteasome activities in muscle extracts from wild-type or ZNF216 lex/lex mice were measured and are shown as arbitrary units. No significant difference in proteasome activity between wild-type and ZNF216 was lex/lex observed. (C) High levels of ubiquitinylated proteins accumulated in muscles from ZNF216 mice than in muscles from wild-type mice. lex/lex Muscle extracts from wild-type or ZNF216 mice were subjected to immunoblotting using anti-ubiquitin antibody to analyze levels of ubiquitinylated proteins. Left and right panels show fasting-induced and denervation-induced muscle atrophy, respectively. Each membrane was re-probed with anti-actin antibody. (D) Association of ZNF216 with the proteasome was increased upon atrophy. The proteasome fractions in muscle extracts from fed (ad lib) or fasted (fasting) mice were precipitated with GST-Ubl or GST only as a negative control. Endogenous ZNF216 protein was co-precipitated with the proteasome, which is probed by the anti-S10 antibody. proteasome inhibitor MG132 (MG132, Figure 8B). The levels overexpression of ZNF216 inhibits degradation of unstable of the proteins stabilized by MG132 were comparable among proteins via the UPS. cells transfected with ZNF216 constructs, indicating that protein synthesis of EGFP-CL1 was not significantly Discussion affected by ectopic expression of ZNF216 (MG132, Figure 8B). ZNF216WT, and to a lesser extent the mutants ZNF216 is an atrogene lex/lex M1 and M2 but not M3, attenuated degradation (NT, In this report, we show that Znf216 mice exhibit resis- Figure 8B). Thus, as is the case with other shuttle proteins, tance to denervation-induced muscle atrophy. It has been 560 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | Ubiquitinylated proteins Relative proteasome activity (arbitary unit) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Mock ZNF216WT dependent NF-kB activation, LPS-induced cytokine expres- CHX (min) 010 20 30 60 0 10 20 30 60 sion or proliferation (unpublished data). Therefore, ZNF216 EGFP-CL1 seems to function as a downstream effector (i.e., a compo- nent of the UPS) rather than a specific negative regulator of Tubulin NF-kB signaling, although ZNF216 function in that pathway is still under investigation. Whereas expression of ZNF216 is FLAG not restricted to muscle, such expression was induced upon muscular atrophy and loss of function of Znf216 promotes ZNF216M3 resistance to denervation-induced atrophy, thereby suggest- CHX (min) 010 20 30 60 ing that it fulfills the definition of an ‘atrogene’. EGFP-CL1 As it is in skeletal muscle, ZNF216 is highly expressed in Tubulin the brain (Scott et al, 1998). Aberrations in the UPS have been documented in the pathogenesis of neurodegenerative FLAG diseases such as Parkinson’s and Huntington’s diseases (Ross and Poirier, 2004). Massive accumulation of ubiquitinylated NT MG132 proteins, which are often aggregated and impair the UPS Mock WT M1 M2 M3 Mock WT M1 M2 M3 leading to neuronal degeneration, has been observed in these EGFP-CL1 pathogenic conditions (Ciechanover and Brundin, 2003; Tubulin Korhonen and Lindholm, 2004). In cultured cells, blocking the UPS by proteasome inhibitors leads to accumulation of FLAG ubiquitinylated proteins. These ubiquitinylated proteins are Figure 8 Ectopic expression of ZNF216-affected protein degrada- then transferred to perinuclear locations and form aggre- tion. (A) Degradation of EGFP-CL1 protein was delayed by over- somes (Johnston et al, 1998). As shown here, ZNF216 is expression of ZNF216. 293 cells stably expressing EGFP-CL1 were localized in aggresomes together with ubiquitinylated pro- transfected with plasmid of ZNF216WT, ZNF216M3 or pcDNA3 teins. Interestingly, proteomic analysis of a protein complex (mock). Estimated half-lives of the EGFP-CL1 are 35, 11 and 11 min in ZNF216WT-, ZNF216M3- and mock-transfected cells, containing HDAC6, a protein often associated with aggre- respectively. De novo protein synthesis was arrested by cyclohex- somes (Kawaguchi et al, 2003), showed that the complex imide (CHX). The membrane was re-probed with tubulin antibody included AWP1, a structural homologue of ZNF216 to control for protein loading (tubulin) and FLAG antibody to detect (Seigneurin-Berny et al, 2001). Although it is unclear whether ZNF216 expression (FLAG). (B) Degradation of EGFP-CL1 protein in the presence of various ZNF216 constructs. HEK293 cells stably ZNF216 is involved in aggresome formation, there is great expressing EGFP-CL1 were transfected with plasmids expressing interest in the role of ZNF216 in the pathogenesis of neuro- the indicated mutants. Transfected cells were not treated (NT) or degenerative diseases. MG132-treated (MG132), and EGFP-CL1 protein was detected with an anti-GFP antibody (EGFP-CL1). The membrane was re-probed with tubulin antibody to control for protein loading (tubulin) and Molecular function of an A20-containing protein, FLAG antibody to detect ZNF216 expression (FLAG). ZNF216 In muscle atrophy, more ubiquitinylated proteins accumulate lex/lex in muscle from Znf216 mice than in muscle from wild- shown that TNFa induces catabolic conditions through UPS type mice, suggesting an abnormal UPS function. Inhibition during cancer cachexia (Mitch and Price, 2001). Recently, it of neither polyubiquitinylation nor DUB activity was ob- has been reported that mice deficient in molecules involved served in ZNF216. Although our in vivo data showed sig- in the NF-kB pathway exhibit resistance to muscular atrophy nificant accumulation of polyubiquitinylated proteins in lex/lex (Cai et al, 2004; Hunter and Kandarian, 2004; McKinnell and muscle from Znf216 mice, there is a possibility that Rudnicki, 2004). On the other hand, the IGF-FOXO axis has ZNF216 is a ubiquitin-ligase. It has been recently reported been suggested to regulate muscle mass through induction of that A20/TNFAIP3 protein possesses ubiquitin ligase activity ‘atrogenes’ such as Murf1 and MAFbx/Atrogin-1 (Sandri against RIP through its ZnF-A20 repeats (Wertz et al, 2004). et al, 2004; Stitt et al, 2004). Although we provide evidence We asked whether the ZnF-A20 of ZNF216 exhibited activity that Znf216 is downstream of FOXO, the NF-kB pathway similar to A20/TNFAIP3, but in vitro ubiquitinylation assays could represent an alternative signal inducing ZNF216. were negative (Supplementary Figure S6). In fact, the ZnF- Indeed, we have identified Znf216 as a gene induced by A20 of A20/TNFAIP3 protein does not bind polyubiquitin RANKL, a TNF family ligand (Hishiya et al, 2005) which chains as does the ZnF-A20 of ZNF216 (Supplementary activates the NF-kB pathway through RANK (Anderson et al, Figure S1). Furthermore, there are seven ZnF-A20 motifs in 1997; Lacey et al, 1998). Moreover, TNFa and IL-1b upregu- A20/TNFAIP3 and only the fourth is responsible for E3 late expression of ZNF216 in fibroblasts and macrophages activity, suggesting that the ZnF-A20 motif is not inherently (Hishiya et al, 2005). These results suggest that Znf216 may active enzymatically (Wertz et al, 2004). However, we cannot be activated by NF-kB. Huang et al (2004) recently reported exclude the possibility that ZNF216 may possess DUB or E3 that ZNF216 inhibits the NF-kB pathway. Whereas treatment activity highly specific to an unknown substrate without with TNFa or overexpression of TRAF6 dramatically acti- nonspecific or self-ubiquitinylating activity. vated a reporter driven by NF-kB response elements, ectopic ZNF216 likely acts as a bridging or a shuttle factor of expression of A20/TNFAIP3 but not ZNF216 inhibited NF-kB ubiquitinylated proteins targeted to the proteasome. Shuttle activation (not shown). Using mouse embryonic fibroblasts, proteins, such as Rad23p and Dsk2p, share interfaces for lex/lex splenocytes or bone marrow cells from Znf216 or wild- ubiquitinylated proteins and the proteasome (Hartmann- type mice, no significant differences were observed in TNFa- Petersen and Gordon, 2004; Elsasser and Finley, 2005). &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 561 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al pGBKT7-ZNF216 was performed as described previously (Masuda Although shuttle proteins are required for efficient protein et al, 2001). Identification of the co-immunoprecipitated proteins degradation, ectopic expression of hHR23 or hPLIC, the with N- or C-terminally FLAG-tagged ZNF216 (ZA20D2) or AWP1 human homologues of Rad23p or Dsk2p, respectively, lead (ZA20D3) was essentially done by a nano-LC/MS/MS system as to stabilization of p53 protein (Kleijnen et al, 2000; Glockzin previously described (Natsume et al, 2002; Komatsu et al, 2004). et al, 2003). These outcomes may be caused by titration Experimental models of muscle atrophy effects due to overexpression and are commonly observed For fasting-induced muscle atrophy, 8-week-old C57BL6 male mice following misexpression of shuttle proteins in yeast and were deprived of food but given free access to water. After 2 days, mammals (Hartmann-Petersen and Gordon, 2004; Verma gastrocnemius muscles were harvested for each experiment. et al, 2004). Here, we show that ZNF216 has a ubiquitin Denervation-induced muscle atrophy was performed by dissecting the sciatic nerve of one hindlimb, and the other hindlimb was sham binding domain and can associate with the 26S proteasome operated as the control. After 7 days, the contralateral normal and even in the absence of ubiquitin binding, and that over- denervated gastrocnemius muscles were harvested for each expression of the zinc-finger protein attenuates protein de- experiment. All animal experiments were approved in advance by the Ethics Review Committee for Animal Experimentation of the gradation rate. There is no structural counterpart of ZNF216 National Institute for Longevity Sciences and the National Center in the yeast genome. We asked whether ZNF216 could rescue for Geriatrics and Gerontology. Student’s t-tests were used to the bridging function of RAD23 or DSK2 mutants by introdu- evaluate statistical differences between the two groups. cing ZNF216 into Drad23Ddsk2 yeast cells, but the phenotype could not be rescued (data not shown). This suggests that Znf216-deficient mice þ /lex ZNF216 is not the functional orthologue of these proteins. Generation of heterozygous Znf216 mice was essentially done by the gene trap method at Lexicon Genetics (Zambrowicz et al, Recently, the presence of an alternative pathway of Rad23p/ 1998). Briefly, ES cells heterozygous for the trapped Znf216 gene Dsk2p in protein targeting to the proteasome has been were microinjected into eight-cell-stage ICR mouse embryos and suggested (Bazirgan and Hampton, 2005; Richly et al, transplanted into uteri. Chimeric mice were crossed to C57BL/6J mice. Northern and immunoblot analyses confirmed disruption of 2005). It has been reported that tetra-ubiquitin constitutes the gene (see text). For genotyping, primers were as follows: KO-A, the minimum proteasomal targeting signal and that the ACCGACAGGATAGACAATGGCAGAG; KO-B, CGATTTTAAGAAAG length of polyubiquitin chain may determine the targeting GAGGCTCTGACC; LTR2, AAATGGCGTTACTTAAGCTAGCTTGC. route (Thrower et al, 2000; Bazirgan and Hampton, 2005; The wild-type and inserted alleles were detected by PCR using KO-A and KO-B (0.5 kb), and LTR2 and KO-B (0.3 kb), respectively. Richly et al, 2005). Notably, ZNF216 preferentially binds polyubiquitin chains longer than di- or tri-ubiquitin EGFP-CL1 degradation assay (Figure 1D). Therefore, these data suggest that ZNF216 is a The nucleotide sequence encoding the CL1 peptide novel ubiquitin recognition factor, required for efficient pro- (ACKNWFSSLSHFVIHL) (Gilon et al, 1998) was inserted into the tein degradation via a pathway different from the canonical XhoI/EcoRI site of pEGFP-C3, and the resulting plasmid was designated pEGFP-CL1. A cell line stably expressing EGFP-CL1 Rad23p/Dsk2p pathway. Although it is now under investiga- (293EGFP-CL1) was generated by transfection of pEGFP-CL1 into tion, the characterization of ZnF-AN1, an AN1-type zinc- 293 cells. For the degradation assay, ZNF216 expression vectors finger domain located at the C-terminus of ZNF216, may were transfected into 293EGFP-CL1 cells and cells were harvested reveal the precise molecular function of ZNF216. 48 h after transfection. MG132 (final 10 mM) or cycloheximide (final 100 mg/ml) was added to the culture at 12 or 1 h before harvest, respectively. Protein extraction was as described above. Materials and methods For more details on supplementary Materials and methods, see Supplementary data Antibodies An anti-ZNF216 antibody was raised by immunizing rabbits against Supplementary data synthesized peptide corresponding to the C-terminal sequence of Supplementary data are available at The EMBO Journal Online. mouse ZNF216. Mouse monoclonal antibodies for FLAG (Sigma, St Louis, MO) and ubiquitin (Santa Cruz Biotechnology, CA), rabbit polyclonal antibodies for ubiquitin (Affiniti Research Products) and Acknowledgements actin (Neo Markers, CA), a rat monoclonal antibody for HA (Roche Diagnostics, Mannheim, Germany), and a rabbit polyclonal anti- We are grateful to Drs Kazuhiro Iwai (Osaka City University) and body against S10a/Rpn7p (Affiniti Research Products) were Noboru Motoyama (NCGG) for reagents, helpful comments and purchased from the indicated manufacturers. For indirect immuno- suggestions throughout this study. We also thank Drs Akio Matsuda fluorescence staining, AlexaFluor 488 goat anti-mouse IgG or and Tatsuo Furuyama for experimental instruction and advice; Dr AlexaFluor 546 goat anti-rat IgG antibody was obtained from Aya Sasaki for pathological determinations; Ms Miho Kamiya and Molecular Probes, OR. Ms Kumi Tsutsumi for technical assistance; and Dr Elise Lamar for proofreading the manuscript. This study is supported in part by the Identification of interacting proteins Program for Promotion of Fundamental Studies in Health Sciences RNA was purified from RAW264.7 cells stimulated by RANKL, and of the Organization for Pharmaceutical Safety and Research of used to construct the yeast library (MatchMaker Library Construc- Japan, and by a Research Grant for Longevity Sciences from the tion & Screening Kit, Clontech). Yeast two-hybrid screening with Ministry of Health, Labor and Welfare. References Anderson DM, Maraskovsky E, Billingsley WL, Dougall WC, in rats by augmenting transcription of genes encoding proteins of Tometsko ME, Roux ER, Teepe MC, DuBose RF, Cosman D, the ATP-dependent ubiquitin-proteasome pathway. J Clin Invest Galibert L (1997) A homologue of the TNF receptor and its ligand 97: 1447–1453 enhance T-cell growth and dendritic-cell function. Nature 390: Bazirgan OA, Hampton RY (2005) Cdc48-Ufd2-Rad23: the road less 175–179 ubiquitinated? Nat Cell Biol 7: 207–209 Bailey JL, Wang X, England BK, Price SR, Ding X, Mitch WE (1996) Bence NF, Sampat RM, Kopito RR (2001) Impairment of the ubiquitin– The acidosis of chronic renal failure activates muscle proteolysis proteasome system by protein aggregation. Science 292: 1552–1555 562 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Kopito RR (2000) Aggresomes, inclusion bodies and protein aggre- Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, gation. Trends Cell Biol 10: 524–530 Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass Korhonen L, Lindholm D (2004) The ubiquitin proteasome system DJ (2001) Identification of ubiquitin ligases required for skeletal in synaptic and axonal degeneration: a new twist to an old cycle. muscle atrophy. Science 294: 1704–1708 J Cell Biol 165: 27–30 Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, MJ, Arden KC, Blenis J, Greenberg ME (1999) Akt promotes cell Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, survival by phosphorylating and inhibiting a Forkhead transcrip- Hawkins N, Davy E, Capparelli C, Eli A, Qian YX, Kaufman S, tion factor. Cell 96: 857–868 Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ Cai D, Frantz JD, Tawa Jr NE, Melendez PA, Oh BC, Lidov HG, (1998) Osteoprotegerin ligand is a cytokine that regulates osteo- Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE (2004) clast differentiation and activation. Cell 93: 165–176 IKKbeta/NF-kappaB activation causes severe muscle wasting in Lambertson D, Chen L, Madura K (1999) Pleiotropic defects caused mice. Cell 119: 285–298 by loss of the proteasome-interacting factors Rad23 and Rpn10 of Chen L, Shinde U, Ortolan TG, Madura K (2001) Ubiquitin-asso- Saccharomyces cerevisiae. Genetics 153: 69–79 ciated (UBA) domains in Rad23 bind ubiquitin and promote Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price inhibition of multi-ubiquitin chain assembly. EMBO Rep 2: SR, Mitch WE, Goldberg AL (2004) Multiple types of skeletal 933–938 muscle atrophy involve a common program of changes in gene Ciechanover A, Brundin P (2003) The ubiquitin proteasome system expression. FASEB J 18: 39–51 in neurodegenerative diseases: sometimes the chicken, some- Lecker SH, Solomon V, Mitch WE, Goldberg AL (1999) Muscle times the egg. Neuron 40: 427–446 protein breakdown and the critical role of the ubiquitin–protea- Elsasser S, Finley D (2005) Delivery of ubiquitinated substrates to some pathway in normal and disease states. J Nutr 129: protein-unfolding machines. Nat Cell Biol 7: 742–749 227S–237S Funakoshi M, Sasaki T, Nishimoto T, Kobayashi H (2002) Budding Lelouard H, Gatti E, Cappello F, Gresser O, Camosseto V, Pierre P yeast Dsk2p is a polyubiquitin-binding protein that can interact (2002) Transient aggregation of ubiquitinated proteins during with the proteasome. Proc Natl Acad Sci USA 99: 745–750 dendritic cell maturation. Nature 417: 177–182 Furukawa-Hibi Y, Yoshida-Araki K, Ohta T, Ikeda K, Motoyama Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, Watanabe K N (2002) FOXO forkhead transcription factors induce G(2)-M (2001) Dlxin-1, a novel protein that binds Dlx5 and regulates its checkpoint in response to oxidative stress. J Biol Chem 277: transcriptional function. J Biol Chem 276: 5331–5338 26729–26732 McKinnell IW, Rudnicki MA (2004) Molecular mechanisms of Gilon T, Chomsky O, Kulka RG (1998) Degradation signals for muscle atrophy. Cell 119: 907–910 ubiquitin system proteolysis in Saccharomyces cerevisiae. Medina R, Wing SS, Haas A, Goldberg AL (1991) Activation of the EMBO J 17: 2759–2766 ubiquitin-ATP-dependent proteolytic system in skeletal muscle Glickman MH, Ciechanover A (2002) The ubiquitin-proteasome during fasting and denervation atrophy. Biomed Biochim Acta 50: proteolytic pathway: destruction for the sake of construction. 347–356 Physiol Rev 82: 373–428 Mitch WE, Goldberg AL (1996) Mechanisms of muscle wasting. The Glockzin S, Ogi FX, Hengstermann A, Scheffner M, Blattner C role of the ubiquitin-proteasome pathway. N Engl J Med 335: (2003) Involvement of the DNA repair protein hHR23 in p53 1897–1905 degradation. Mol Cell Biol 23: 8960–8969 Mitch WE, Price SR (2001) Transcription factors and muscle Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL (2001) cachexia: is there a therapeutic target? Lancet 357: 734–735 Atrogin-1, a muscle-specific F-box protein highly expressed dur- Natsume T, Yamauchi Y, Nakayama H, Shinkawa T, Yanagida M, ing muscle atrophy. Proc Natl Acad Sci USA 98: 14440–14445 Takahashi N, Isobe T (2002) A direct nanoflow liquid chromato- Hartmann-Petersen R, Gordon C (2004) Protein degradation: recog- graphy-tandem mass spectrometry system for interaction proteo- nition of ubiquitinylated substrates. Curr Biol 14: R754–R756 mics. Anal Chem 74: 4725–4733 Hershko A, Ciechanover A (1998) The ubiquitin system. Annu Rev Opipari Jr AW, Boguski MS, Dixit VM (1990) The A20 cDNA induced Biochem 67: 425–479 by tumor necrosis factor alpha encodes a novel type of zinc finger Hishiya A, Ikeda K, Watanabe K (2005) A RANKL-inducible gene protein. J Biol Chem 265: 14705–14708 Znf216 in osteoclast differentiation. J. Receptor Signal Transduct Pickart CM, Cohen RE (2004) Proteasomes and their kin: proteases 25: 199–216 in the machine age. Nat Rev Mol Cell Biol 5: 177–187 Horiuchi H, Lippe R, McBride HM, Rubino M, Woodman P, Price SR, Bailey JL, Wang X, Jurkovitz C, England BK, Ding X, Stenmark H, Rybin V, Wilm M, Ashman K, Mann M, Zerial M Phillips LS, Mitch WE (1996) Muscle wasting in insulinopenic (1997) A novel Rab5 GDP/GTP exchange factor complexed to rats results from activation of the ATP-dependent, ubiquitin- Rabaptin-5 links nucleotide exchange to effector recruitment and proteasome proteolytic pathway by a mechanism including function. Cell 90: 1149–1159 gene transcription. J Clin Invest 98: 1703–1708 Huang J, Teng L, Li L, Liu T, Li L, Chen D, Xu LG, Zhai Z, Shu HB Richly H, Rape M, Braun S, Rumpf S, Hoege C, Jentsch S (2005) A (2004) ZNF216 is an A20-like and IkappaB kinase gamma- series of ubiquitin binding factors connects CDC48/p97 to sub- interacting inhibitor of NFkappaB activation. J Biol Chem 279: strate multiubiquitylation and proteasomal targeting. Cell 120: 16847–16853 73–84 Hunter RB, Kandarian SC (2004) Disruption of either the Nfkb1 or Ross CA, Poirier MA (2004) Protein aggregation and neurodegen- the Bcl3 gene inhibits skeletal muscle atrophy. J Clin Invest 114: erative disease. Nat Med 10 (Suppl): S10–S17 1504–1511 Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL (2004) IGF-I Jagoe RT, Lecker SH, Gomes M, Goldberg AL (2002) Patterns of gene stimulates muscle growth by suppressing protein breakdown and expression in atrophying skeletal muscles: response to food expression of atrophy-related ubiquitin ligases, atrogin-1 and deprivation. FASEB J 16: 1697–1712 MuRF1. Am J Physiol Endocrinol Metab 287: E591–E601 Johnston JA, Ward CL, Kopito RR (1998) Aggresomes: a cellular Saeki Y, Saitoh A, Toh-e A, Yokosawa H (2002) Ubiquitin- response to misfolded proteins. J Cell Biol 143: 1883–1898 like proteins and Rpn10 play cooperative roles in ubiquitin- Kawaguchi Y, Kovacs JJ, McLaurin A, Vance JM, Ito A, Yao TP dependent proteolysis. Biochem Biophys Res Commun 293: (2003) The deacetylase HDAC6 regulates aggresome formation 986–992 and cell viability in response to misfolded protein stress. Cell 115: Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh 727–738 K, Schiaffino S, Lecker SH, Goldberg AL (2004) Foxo transcription Kleijnen MF, Shih AH, Zhou P, Kumar S, Soccio RE, Kedersha NL, factors induce the atrophy-related ubiquitin ligase atrogin-1 and Gill G, Howley PM (2000) The hPLIC proteins may provide a link cause skeletal muscle atrophy. Cell 117: 399–412 between the ubiquitination machinery and the proteasome. Mol Scott DA, Greinwald Jr JH, Marietta JR, Drury S, Swiderski RE, Cell 6: 409–419 Vinas A, DeAngelis MM, Carmi R, Ramesh A, Kraft ML, Elbedour Komatsu M, Chiba T, Tatsumi K, Iemura S, Tanida I, Okazaki N, K, Skworak AB, Friedman RA, Srikumari Srisailapathy CR, Ueno T, Kominami E, Natsume T, Tanaka K (2004) A novel Verhoeven K, Van Gamp G, Lovett M, Deininger PL, Batzer MA, protein-conjugating system for Ufm1, a ubiquitin-fold modifier. Morton CC, Keats BJ, Smith RJ, Sheffield VC (1998) Identifica- EMBO J 23: 1977–1986 tion and mutation analysis of a cochlear-expressed, zinc finger &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 563 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al protein gene at the DFNB7/11 and dn hearing-loss loci on Wertz IE, O’Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, Wu human chromosome 9q and mouse chromosome 19. Gene 215: P, Wiesmann C, Baker R, Boone DL, Ma A, Koonin EV, Dixit VM 461–469 (2004) De-ubiquitination and ubiquitin ligase domains of A20 Seigneurin-Berny D, Verdel A, Curtet S, Lemercier C, Garin J, downregulate NF-kappaB signalling. Nature 430: 694–699 Rousseaux S, Khochbin S (2001) Identification of components Wilkinson CR, Ferrell K, Penney M, Wallace M, Dubiel W, Gordon C of the murine histone deacetylase 6 complex: link between (2000) Analysis of a gene encoding Rpn10 of the fission yeast acetylation and ubiquitination signaling pathways. Mol Cell Biol proteasome reveals that the polyubiquitin-binding site of this 21: 8035–8044 subunit is essential when Rpn12/Mts3 activity is compromised. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, J Biol Chem 275: 15182–15192 Gonzalez M, Yancopoulos GD, Glass DJ (2004) The IGF-1/PI3K/ Wing SS, Goldberg AL (1993) Glucocorticoids activate the ATP- Akt pathway prevents expression of muscle atrophy-induced ubiquitin-dependent proteolytic system in skeletal muscle during ubiquitin ligases by inhibiting FOXO transcription factors. Mol fasting. Am J Physiol 264: E668–E676 Cell 14: 395–403 Wing SS, Haas AL, Goldberg AL (1995) Increase in ubiquitin– Tawa Jr NE, Odessey R, Goldberg AL (1997) Inhibitors of the protein conjugates concomitant with the increase in proteolysis proteasome reduce the accelerated proteolysis in atrophying rat in rat skeletal muscle during starvation and atrophy denervation. skeletal muscles. J Clin Invest 100: 197–203 Biochem J 307 (Part 3): 639–645 Thrower JS, Hoffman L, Rechsteiner M, Pickart CM (2000) Young P, Deveraux Q, Beal RE, Pickart CM, Rechsteiner M (1998) Recognition of the polyubiquitin proteolytic signal. EMBO J 19: Characterization of two polyubiquitin binding sites in the 26 S 94–102 protease subunit 5a. J Biol Chem 273: 5461–5467 Verma R, Oania R, Graumann J, Deshaies RJ (2004) Multiubiquitin Zambrowicz BP, Friedrich GA, Buxton EC, Lilleberg SL, Person C, chain receptors define a layer of substrate selectivity in the Sands AT (1998) Disruption and sequence identification of 2000 ubiquitin–proteasome system. Cell 118: 99–110 genes in mouse embryonic stem cells. Nature 392: 608–611 564 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

A novel ubiquitin‐binding protein ZNF216 functioning in muscle atrophy

Download PDF
11 pages

Loading next page...
 
/lp/springer-journals/a-novel-ubiquitin-binding-protein-znf216-functioning-in-muscle-atrophy-e1vp3PQLod

References (70)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 2006
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1038/sj.emboj.7600945
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal (2006) 25, 554–564 & 2006 European Molecular Biology Organization All Rights Reserved 0261-4189/06 | | THE THE www.embojournal.org EMB EMB EMBO O O JO JOU URN R NAL AL A novel ubiquitin-binding protein ZNF216 functioning in muscle atrophy 1,2 3 or 19S subunits of proteasome and proteolysis in the Akinori Hishiya , Shun-ichiro Iemura , 3 2 proteasome. Tohru Natsume , Shinichi Takayama , 1 1, Many catabolic conditions, such as low-insulin state, hy- Kyoji Ikeda and Ken Watanabe * perthyroidism, sepsis and cancer cachexia lead to enhance- Department of Bone & Joint Disease, National Center for Geriatrics 2 ment of protein breakdown in skeletal muscle known as & Gerontology (NCGG), Obu, Aichi, Japan, Program of Molecular muscle atrophy (Mitch and Goldberg, 1996; Lecker et al, Chaperone Biology, Department of Radiology, Medical College of Georgia, Augusta, GA, USA and Japan Biological Information Research 1999). In muscle atrophy, the UPS plays a pivotal role in Center (JBIRC), National Institute of Advanced Industrial Science protein breakdown (Price et al, 1996; Tawa et al, 1997). & Technology (AIST), Tokyo, Japan Several studies indicate that mRNAs encoding UPS compo- nents are increased in atrophying muscle (Medina et al, 1991; The ubiquitin–proteasome system (UPS) is critical for Wing and Goldberg, 1993; Bailey et al, 1996; Price et al, 1996; specific degradation of cellular proteins and plays a pivotal Jagoe et al, 2002). In particular, the E3 ubiquitin ligases role on protein breakdown in muscle atrophy. Here, we MAFbx/Atrogin-1 and MuRF-1 (muscle RING finger 1) are show that ZNF216 directly binds polyubiquitin chains known to be markers of muscle atrophy (Bodine et al, through its N-terminal A20-type zinc-finger domain and 2001; Gomes et al, 2001). Both are induced in multiple associates with the 26S proteasome. ZNF216 was coloca- models of muscle atrophy including immobilization, dener- lized with the aggresome, which contains ubiquitinylated vation and hindlimb suspension, and mice deficient in proteins and other UPS components. Expression of Znf216 either gene are resistant to denervation-induced muscle was increased in both denervation- and fasting-induced atrophy (Bodine et al, 2001). Goldberg and co-workers pro- muscle atrophy and upregulated by expression of consti- posed that atrophy-related genes, whose expression is in- tutively active FOXO, a master regulator of muscle atrophy. duced in multiple types of muscle atrophy, are called Mice deficient in Znf216 exhibited resistance to denerva- ‘atrogenes’ (Sandri et al, 2004). Recently, it was demon- tion-induced atrophy, and ubiquitinylated proteins mark- strated that the IGF-I/PI3K/Akt pathway is an important edly accumulated in neurectomized muscle compared to regulator of muscle mass in muscle hypertrophy and atrophy wild-type mice. These data suggest that ZNF216 functions (Sacheck et al, 2004; Sandri et al, 2004; Stitt et al, 2004). in protein degradation via the UPS and plays a crucial role In that case, the transcription factor FOXO plays a pivotal in muscle atrophy. role in activating atrogenes such as MAFbx/Atrogin-1 The EMBO Journal (2006) 25, 554–564. doi:10.1038/ (Gomes et al, 2001). sj.emboj.7600945; Published online 19 January 2006 Although many UPS players such as E3 ligases have been Subject Categories: proteins; molecular biology of disease characterized, the mechanism of how ubiquitinylated pro- Keywords: aggresome; muscular atrophy; proteasome; teins are delivered to the proteasome have not been fully ubiquitin; zinc-finger protein elucidated. A component of 19S proteasome, Rpn10/S5a, recognizes the ubiquitinylated proteins (Young et al, 1998; Wilkinson et al, 2000). It has been shown that yeast proteins, Rad23p and Dsk2p, bind to ubiquitinylated substrates and to Introduction the 26S proteasome through their UBA and Ubl domains, respectively, thereby functioning as shuttle proteins that The ubiquitin–proteasome system (UPS) is one of the major present polyubiquitinylated proteins to the proteasome protein degradation pathways in eukaryotic cells. The UPS (Chen et al, 2001; Funakoshi et al, 2002; Elsasser and plays key regulatory roles in many cellular processes, includ- Finley, 2005). Loss-of-function of shuttle proteins results in ing cell cycle control, the regulation of transcription and abnormal accumulation of polyubiquitinylated proteins protein quality control (Hershko and Ciechanover, 1998; (Lambertson et al, 1999; Saeki et al, 2002). However, yeast Pickart and Cohen, 2004). Aberrations of this system lead can survive when both RAD23 and DSK2 genes are mutated, to many forms of pathogenesis, such as malignancies, suggesting that other mechanisms or molecule(s) poss- neurodegenerative disease and inflammatory response essing a shuttle function exist (Saeki et al, 2002). Here, we (Glickman and Ciechanover, 2002). The UPS includes show that ZNF216, a novel ubiquitin-binding protein sequential, multistep reactions: ubiquitin-conjugation of containing an A20-type zinc-finger, is such a factor. Znf216 target proteins by E1, E2 and E3 enzymes, recognition of expression is upregulated in skeletal muscle in experi- ubiquitinylated proteins by ubiquitin-binding proteins mental models of muscle atrophy, and Znf216-deficient mice exhibit resistance to muscle atrophy accompanied by *Corresponding author. Department of Bone & Joint Disease, National Center for Geriatrics & Gerontology (NCGG), Obu, Aichi 474-8522, abnormal accumulation of polyubiquitinylated proteins in Japan. Tel.: þ 81 562 46 2311; Fax: þ 81 562 44 6595; skeletal muscle. Our findings suggest that ZNF216, with its E-mail: [email protected] potential function of anchoring ubiquitinylated proteins to the proteasome, plays a critical role in degrading Received: 6 June 2005; accepted: 14 December 2005; published online: 19 January 2006 muscle proteins. 554 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al nents was monitored by immunoblotting using an antibody Results against Rpn7p (S10a), a non-ATPase subunit of the 19S ZNF216 directly binds to polyubiquitin regulatory subunit. As shown in Figure 2A, this protein We have identified a gene, Znf216 (Za20d2, Mouse Genome efficiently co-precipitated with FLAG-tagged ZNF216. The Informatics), encoding an A20 zinc-finger (Znf-A20) motif- interaction was also observed with truncated or point mu- containing protein, as a RANKL-induced gene upregulated tants of ZnF-A20 (DN or M1), indicating that ubiquitin- upon osteoclast formation using a microarray technique binding ability is dispensable for association with the 26S (Hishiya et al, 2005). Znf216 was originally identified as a proteasome. To determine whether endogenous ZNF216 pro- candidate gene for hearing loss and is expressed in cochlear teins are also associated with the 26S proteasome, we per- and skeletal muscle (Scott et al, 1998; Huang et al, 2004). To formed a GST pull-down assay using the ubiquitin-like (Ubl) determine the function of ZNF216, we searched for molecules domain of hHR23B, a human homologue of Rad23, which is that associate with ZNF216 using yeast two-hybrid screening known to bind to the 26S proteasome. As shown in Figure 2B, and isolated several clones encoding a gene for polyubiquitin GST-Ubl but not GST was pulled down with the endogenous C. To determine whether ZNF216 interacts with ubiquitin in 26S proteasome. Endogenous ZNF216 was also detected mammalian cells, we transfected HEK293 cells with an in the GST-Ubl/26S proteasome complex (upper panels, expression vector for FLAG-tagged ZNF216 and HA-tagged Figure 2B). Furthermore, purified recombinant ZNF216 did ubiquitin and performed co-immunoprecipitation experi- not bind to GST-Ubl (lower panel, Figure 2B), suggesting that ments. ZNF216 possesses A20-type (amino acids 11–35) and endogenous ZNF216 is not directly bound to the Ubl domain AN1-type (amino acids 154–191) zinc-finger domains at its but associates with the 26S proteasome. N- and C-termini, respectively (Figure 1A). Endogenous ubiquitinylated proteins, which appear as smears, were co- Colocalization with the aggresome immunoprecipitated with FLAG-tagged ZNF216 (Figure 1B). Next, we determined the subcellular localization of ZNF216. Notably, N-terminal deletion (DN; amino acids 36–213) or Indirect immunofluorescence of ZNF216 expressed in point mutants (M1 and M3) of the A20-type zinc-finger (ZnF- COS-7 cells showed that the protein was largely cytoplasmic A20) domain abolished ubiquitin-binding ability of ZNF216, but was seen to a lesser extent in the nucleus (Figure 3A). indicating that the ZnF-A20 domain is indispensable for Aggresomes, which are insoluble aggregates of ubiquitiny- binding to ubiquitin (Figures 1A and B). Whereas in non- lated proteins complexed with the proteasome and induced denaturing conditions, ubiquitinylated molecules were pre- by treatment with proteasome inhibitors, are known to mimic sent with FLAG-tagged ZNF216, these molecules completely inclusions seen in pathogenic UPS disorders (Johnston et al, disappear from immunoprecipitates following heat denatura- 1998; Kopito, 2000; Lelouard et al, 2002). As shown in tion, which abolishes noncovalent protein–protein interac- Figures 3D–H, ZNF216 proteins were colocalized with aggre- tions (Figure 1C), suggesting that ZNF216 associates with somes induced by treatment with the proteasome inhibitor ubiquitinylated proteins rather than being ubiquitinylated MG132. ZNF216 itself was not ubiquitinylated as shown in itself. Next, to determine whether ZNF216 binds to ubiquitin Figure 1C. directly, we performed GST pull-down assays using GST- ZNF216 fusion proteins (Figure 1D) and purified polyubiqui- Induction of ZNF216 expression upon muscle atrophy tin. As shown in Figure 1E, GST-ZNF216 but not GST bound Biochemical and cell biological evidence presented here to polyubiquitin chains. As expected, binding of ZNF216 strongly suggests that ZNF216 functions in the UPS. In to polyubiquitin chains was completely abolished by a skeletal muscle, it is generally accepted that the UPS plays point mutation in the ZnF-A20 domain (M1, Figure 1E). a critical role in muscular atrophy, and expression of atrophy- Furthermore, a GST fusion protein containing only the ZnF- related genes including those encoding UPS components is A20 domain (amino acids 2–60) could bind to polyubiquitin induced in atrophying muscle (Jagoe et al, 2002; Lecker et al, chains, suggesting that ZNF216 directly binds to polyubiqui- 2004). As Znf216 was predominantly expressed in brain tin chains, and that the ZnF-A20 domain is required for and skeletal muscle (Scott et al, 1998), we investigated the binding to polyubiquitin. As for other ZnF-A20 containing relationship between ZNF216 and muscle atrophy. To deter- proteins, AWP1 (ZA20D3) also possessed polyubiquitin-bind- mine whether Znf216 expression is induced during muscle ing activity but the ZnF-A20 domain(s) of Rabex-5 (Horiuchi atrophy, an in vitro model of muscle atrophy was utilized. It et al, 1997) and A20/TNFAIP3 (Opipari et al, 1990) proteins has been reported that addition of dexamethasone to cultures did not (Supplementary Figure S1). of differentiated C2C12 myotubes causes formation of myo- tubes exhibiting signs of atrophy, including a reduction in ZNF216 associates with the 26S proteasome myotube diameter (Stitt et al, 2004). Such treatment drama- We also identified molecules associating with ZNF216 by tically induced expression of Znf216 (Figure 4A). proteomic analysis of complexes formed with FLAG-tagged Next, expression of Znf216 was determined in in vivo ZNF216. Molecules expressed in HEK293 cells and that co- experimental models of muscle atrophy. Mice that undergo immunoprecipitated with FLAG-tagged ZNF216 were ana- fasting for 2 days show significant decreases in body weight, lyzed by tandem mass spectrometry. By this analysis, every as well as in the mass of the gastrocnemius muscles (data not subunit of the 26S proteasome complex was identified as shown). In this model, fasting for 2 days results in dramatic associating with FLAG-tagged ZNF216 (data not shown). To increases in Znf216 mRNA (Figure 4B) and protein identify the region of ZNF216 required for association with (Supplementary Figure S3) in muscle. Although there were the 26S proteasome, lysates of cells expressing either FLAG- differences in induction patterns of two differently sized tagged ZNF216 or its mutants were immunoprecipitated with transcripts of Znf216 by atrophy-inducting stimuli, both anti-FLAG antibody. Co-precipitation of proteasomal compo- transcripts encode the same protein (Supplementary Figures &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 555 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Figure 1 ZNF216 binds polyubiquitin directly through the ZnF-A20 domain. (A) Schematic representation of the primary structure of wild-type ZNF216 and its mutants. ZNF216DN (aa 36–213) and ZNF216DC (aa 2–153) constructs lack the ZnF-A20 (aa 11–35) and ZnF-AN1 (aa 154–194) domains, respectively. Cysteine residues at positions 30 and 33 within the ZnF-A20 were substituted with alanines (C30A/C33A) in ZNF216M1, and both cysteines 170 and 175 within the ZnF-AN1 were substituted with alanines (C170A/C175A) in ZNF216M2. Both ZnF-A20 and ZnF-AN1 domains were mutated in ZNF216M3. (B) Co-precipitation of ubiquitinylated proteins and ZNF216. FLAG-tagged ZNF216 or mutants were expressed in HEK293 cells, and cell extracts were immunoprecipitated with anti-FLAG antibody. Ubiquitinylated proteins detected with anti- ubiquitin antibody were precipitated with FLAG-tagged ZNF216 but not with ZnF-A20 mutants. Expression levels of FLAG-tagged ZNF216 constructs are shown at the bottom. Bands corresponding to immunoglobulin chains are marked by an asterisk. (C) ZNF216 is minimally ubiquitinylated. HEK293 cells expressing FLAG-tagged ZNF216 or HA-tagged ubiquitin were lysed and immunoprecipitation was performed using anti-FLAG antibody. Aliquots of precipitated beads were boiled and immunoprecipitated again (re-IP). Each sample was separated on gels and probed with anti-HA (left) or anti-FLAG antibody (right). Bands for immunoglobulin chains are marked by asterisks. (D) Constructs used for in vitro binding assay. ZNF216WT, ZNF216M1 and ZNF216 M2 were as indicated in (A). ZNF216A20 possesses only the A20 domain (aa 2–60). All constructs were produced as GST fusion proteins. (E) In vitro ubiquitin binding assay. Left panel: GST protein fused to the constructs indicated in (D) was incubated with purified K48-linked polyubiquitin chains, followed by precipitation with GSH beads. In all, 10% of purified polyubiquitin chains was separated without pull-down to evaluate protein amount (10% input). Right panel: the membrane was stained with ponceau to evaluate levels of GST fusion protein. S2 and S3). Expression of MuRF-1 (Figure 4B) and MAFbx within the first 7 days postsurgery. As expected, expression of (Gomes et al, 2001) was also induced in fasting. Upregulation Znf216 and MuRF-1 was induced in gastrocnemius muscles of Znf216 was also observed in a model of denervation- by denervation-induced muscle atrophy (Figure 4C). These induced muscle atrophy. Neurectomy promotes significant results suggest that Znf216 expression is associated with reduction (B20%) in the weight of gastrocnemius muscles atrophy in skeletal muscles. 556 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al The transcription factor FOXO has been reported to play a critical role in muscular atrophy by inducing atrophy-related genes, including MAFbx/Atrogin-1 (Sandri et al, 2004; Stitt et al, 2004). Therefore, we asked whether FOXO activation upregulated Znf216 expression. To do so, we employed a Cre- loxP system (Furukawa-Hibi et al, 2002) in which constitu- tively active FOXO4 (AFX-TM) created by mutation of the three Akt phosphorylation sites, T32A, S253A and S315A (Brunet et al, 1999), was expressed in C2C12-AFX-TM cells following infection by Cre recombinase-expressing adeno- virus (Cre) (Figure 4D). Both AFX-TM mRNA and protein were induced 24 h after infection with Cre but not with control adenovirus (Furukawa-Hibi et al, 2002). ZNF216 mRNA was markedly increased in C2C12-AFX-TM cells as a result of infection with Cre but not following infection with control virus (Figure 4E). These results suggest that ZNF216 may function as a downstream effector of FOXO in muscle atrophy. Generation of mice lacking ZNF216 To investigate the in vivo function of ZNF216, mice deficient lex/lex for ZNF216 (Znf216 ) were generated by gene trapping at Omnibank of Lexicon Genetics (Zambrowicz et al, 1998). The structure of the predicted trapped gene is shown in Figure 5A. Figure 2 Interaction of ZNF216 with the 26S proteasome in mam- The trapping vector, VICTR48, was inserted 3.3 kbp upstream malian cells. (A) Co-precipitation of the 26S proteasome and ZNF216. Co-precipitated proteins with FLAG-ZNF216 were resolved of exon 3, which encodes the first methionine of mouse lex/lex by SDS–PAGE and detected by immunoblotting using anti-S10a/ Znf216 (Figure 5A). Znf216 mice were born from in- Rpn7p antibody (anti-S10) or anti-FLAG antibody. Aliquots of þ /lex terbred heterozygous Znf216 mice in Mendelian ratios, cellular extracts were immunoblotted without immunoprecipitation indicating that ZNF216 is dispensable for embryogenesis or to evaluate protein expression in the bottom panels. (B) ZNF216 fetal development. No ZNF216 mRNA or protein was detected was detected in the 26S proteasome fraction. Upper panel, cell lex/lex lysates were incubated with a GST fusion of HHR23B Ubl (HHR23B in Znf216 mice by Northern or immunoblot analyses, Ubl) to isolate the 26S proteasome. Precipitated proteins (P/D) were respectively (Figures 5B and C), indicating that the mice are separated and probed with anti-S10 or anti-ZNF216 antibody. Lower þ /lex ZNF216 nulls. Expression levels of ZNF216 in Znf216 panel: purified recombinant ZNF216 was incubated with a GST fusion of HHR23B Ubl or GST protein. Precipitated (P/D) or not heterozygotes were nearly one-half those of wild-type mice. lex/lex precipitated (Sup) proteins were probed with anti-ZNF216 antibody. Znf216 mice were viable and fertile, without gross No direct binding of ZNF216 to the Ubl domain of HHR23B was abnormalities or apparent pathological alteration, but they detected. weighed less than sex- and age-matched controls (Figure 5D). þ /þ At 45 weeks, the average weights of Znf216 and Figure 3 ZNF216 is localized in ‘aggresomes’ with ubiquitinylated proteins. (A–H) COS cells were transfected with expression vectors for FLAG-tagged ZNF216 and HA-tagged ubiquitin. Fixed cells were subjected to indirect immunofluorescence using (A, E) anti-FLAG (with AlexaFluor 488 anti-mouse IgG, green) and (B, F) anti-HA (with AlexaFluor 546 anti-rat IgG antibodies, red) antibodies. (C, G) Nuclei were stained with DAPI in the same fields of each panel. (E–H) Transfected COS cells were treated with the proteasome inhibitor, MG132 (0.5 mM). Aggresomes formed are indicated by arrowheads. The merged images were shown in (D and H). &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 557 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al LTR SA NEO pA PGK BTK SD LTR Dex C1 C2 F1 F2 F3 AB A Time (h) 0 24 48 72 96 VICTR48 ZNF216 ZNF216 ATG TAA 5′ 3′ Wild-type gene EF1α α E1 E2 E3 E4E5 E6 E7 MuRF-1 GAPDH Transgenic allele 5′ 3′ E1 E2 E3E4 E5 E6 E7 Denervation Sham +/+ +/lex lex/lex +/+ +/lex lex/lex 12 3 4 5 6 7 1 2 3 4 5 6 7 B C ZNF216 ZNF216 ZNF216 Tubulin MuRF-1 EF1α α GAPDH * * D 50 * * * * * CAG EGFP pA Flag-AFX-TM pA * * * 45 * Cre recombinase (Cre Adeno) CAG Flag-AFX-TM pA 30 * * * * * 25 * * * * * * * * * * * * * 012345678 9 101112131415161718 Age (months) ZNF216 Figure 5 Disruption of Znf216 gene in mice. (A) Gene trap strategy of Znf216 gene. The structure of the trapping vector, VICTR48, is EF1α shown in the upper line. The wild-type allele and the trapped, transgenic allele follow the vector. The retroviral vector, VICTR48, Figure 4 Expression of ZNF216 is induced by muscle atrophy. (A) was integrated between exons 1 and 2 of the Znf216 gene and C2C12 myoblast cells were differentiated into myotubes, and treated transcription of downstream exons encoding ZNF216 was dimin- with 100 mM Dex for the indicated times. Northern blotting was ished. Exons are depicted by striped (noncoding exons) or sha- performed to reveal the effect of Dex on ZNF216 expression. The dowed boxes (protein-coding exons) and numbered (E1 and E2). entire coding region of ZNF216 was used as a probe, which LTR, long terminal repeat; SA, splice acceptor site; SD, splice donor recognized 2.4 and 1.5 kb mRNA species arising from alternative site; pA, polyadenylation signal; PGK, PGK promoter. (B) Northern þ /þ splicing and polyadenylation. The loading control was elongation blot analysis. Total RNA was prepared from brains of Znf216 , þ /lex lex/lex factor a (EF1a). (B) Fasting-induced muscle atrophy. Three mice ZnfF216 or Znf216 mice. Full-length mouse ZNF216 cDNA were fasted (F1BF3), and two mice (C1, C2) were fed freely. After 2 was used as a probe. The membrane was re-probed using an EF1a þ /þ days, RNA was purified from gastrocnemius muscle, and Northern probe. (C) Immunoblot analysis. Extracts from brain of Znf216 , þ /lex lex/lex blotting was performed to determine ZNF216 expression. The Znf216 or Znf216 mice were immunoblotted with anti- membrane was re-probed with MuRF-1 and GAPDH. (C) body against ZNF216. The membrane was re-probed using anti- lex/lex Denervation-induced muscle atrophy was induced by cutting the tubulin antibody. (D) Growth curve of Znf216 mice. Body þ /þ lex/lex sciatic nerve of the hindlimb of seven mice (1B7). The opposite weights at each time point of Znf216 and Znf216 mice limb was sham operated as the control. At 7 days after surgery, total were indicated as open square boxes (males) or circles (females) RNA was purified from gastrocnemius muscles, and Northern and closed square boxes (males) or circles (females), respectively. blotting was performed to detect ZNF216 expression. The mem- *Po0.05; **Po0.005. brane was re-probed with MuRF-1 and GAPDH. (D) Cre-loxP- mediated, constitutively active FOXO expression system. cDNA encoding FLAG-tagged constitutively active FOXO4 (AFX-TM) is þ /lex Znf216 mice gained weight as they aged (Figure 5D). separated from the CAG promoter of an expression vector by a lex/lex The size of most organs in Znf216 mice was reduced in loxP-flanked EGFP-poly(A) cassette. Infection with adenovirus ex- pressing Cre recombinase (Cre) results in excision of the DNA proportion with body weight. However, the fat volume of fragment located between the two loxP sequences and expression lex/lex aged (430 weeks of age) Znf216 mice was significantly of FLAG-tagged AFX-TM. (E) ZNF216 is downstream of FOXO. Total decreased, suggesting that the marked difference in body RNAs were prepared from C2C12-AFX-TM cells at the indicated lex/lex times after infection with adenovirus expressing Cre (Cre) or lacZ weight between wild-type and aged Znf216 mice is lex/lex (control) and probed by Znf216 or EF1a. A marked increase in mainly caused by decreased fat mass seen in Znf216 expression of Znf216 was observed only in Cre-infected cells. mice (not shown). Detailed phenotypic characterization of aged mutant mice will be provided elsewhere. lex/lex Znf216 male mice were 42.6677.06 g (n¼ 14) and lex/lex 33.1674.44 g (n¼ 9), respectively. The average weights of Znf216 mice exhibit partial resistance to þ /þ lex/lex female Znf216 and Znf216 mice were 34.4674.21 g denervation-induced muscle atrophy (n¼ 14) and 26.8575.38 g (n¼ 11), respectively. After 30 To further explore the involvement of ZNF216 in muscle lex/lex weeks, both female and male Znf216 mice showed no atrophy, neurectomy of sciatic nerve was undertaken in þ /þ lex/lex or subtle increases in weight, whereas Znf216 or wild-type and Znf216 mice. As shown in Figure 6A, 7 558 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | No infection Cre adeno (24H) Control adeno (24H) Cre adeno (48H) Control adeno (48H) Body weight (g) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al days after denervation, significant muscle weight loss and expression levels of factors involved in muscle atrophy. As reduction in fiber sizes of the gastrocnemius muscle were expected, expression of MAFbx/Atrogin-1 and MuRF-1 was observed in wild-type mice. By contrast, such decreases in dramatically induced by denervation-induced muscle atrophy lex/lex muscle weight were significantly attenuated in Znf216 in gastrocnemius muscle from wild-type mice (Figure 6A). lex/lex mice (Figure 6A). Sections of gastrocnemius muscle also In Znf216 mice, expression of MAFbx/Atrogin-1 and showed larger fibers in muscle from neurectomized MuRF-1 was also induced at levels comparable to those lex/lex Znf216 mice than in control muscle (Figure 6B). seen in wild-type mice. Induction of Pmsa1 and Pmsd11, However, there was no significant difference in fiber area genes encoding the 26S proteasome subunits a6 and Rpn6, lex/lex lex/lex between sham-operated wild-type and Znf216 mice respectively, was also indistinguishable between Znf216 (wild typeþ sham operated, 19887530mm ; wild typeþ de- and wild-type mice (Figure 7A). Furthermore, proteasome nervation, 13797345 mm ; lex/lexþ sham operated, activities in gastrocnemius muscles were comparable 2 2 lex/lex 17767484 mm ; lex/lexþ denervation, 13937344 mm ). As between wild-type and Znf216 mice (Figure 7B). Thus, shown in Figure 6C, the reduction in fiber area was also induction of relevant ubiquitin ligases or proteasome compo- lex/lex lex/lex less apparent in Znf216 mice compared to wild-type nents was not affected in Znf216 mice. It is known that mice. These results suggest that ZNF216 plays a crucial role ubiquitinylated proteins accumulate during muscle atrophy in reduction of muscle mass on denervation-induced muscle (Medina et al, 1991; Wing et al, 1995). As shown in atrophy. Figure 7C, following denervation, ubiquitinylated proteins accumulated in the gastrocnemius muscle of wild-type Abnormal accumulation of ubiquitinylated proteins mice, but higher levels of ubiquitinylated proteins accumu- lex/lex lex/lex lated in muscle derived from Znf216 mice (B2-fold: in muscle from Znf216 mice lex/lex Po0.001 in neurectomized Znf216 versus wild-type To investigate what abnormalities occur during denervation- lex/lex muscle). Similar results were obtained by fasting-induced induced muscle atrophy in Znf216 mice, we examined muscle atrophy, although no difference in the levels of ubiquitinylated proteins from controls (sham-operated or fed) was observed between genotypes (Figure 7C). These A C P < 0.05 P < 0.001 90 results indicate that ZNF216 is a critical regulator of muscle atrophy, most likely functioning to regulate degradation of muscle proteins without altering expression of proteasomal 70 components or known E3 ligases. 15 60 Effect of ZNF216 on UPS-mediated protein degradation Accumulation of ubiquitinylated protein under any circum- stance might be because of loss of inhibition of ubiquitinyla- tion and/or deubiquitinylation (DUB). However, no inhibition or DUB activity was observed (Supplementary Figures S4 and S5). As shown in Figure 7D, association of 0 20 ZNF216 protein to the proteasome was significantly increased +/+ lex/lex +/+ lex/lex when atrophy was induced, suggesting that ZNF216 may be involved in association of ubiquitinylated proteins and the +/+ +/+ Znf216 (Sham) Znf216 (Denervation) proteasome. The biochemical activity of ZNF216 is similar to that of the UPS proteins, hHR23 and hPLIC, both of which have a shuttle function and are known to bind to both polyubiquitinylated proteins and the 26S proteasome (Hartmann-Petersen and Gordon, 2004; Elsasser and Finley, 2005). Interestingly, overexpression of hHR23 and hPLIC results in stabilization of unstable proteins such as p53 lex/lex lex/lex Znf216 (Sham) Znf216 (Denervation) (Kleijnen et al, 2000; Glockzin et al, 2003). To determine if ZNF216 functioned similarly, we employed a degradation system using unstable GFP (Bence et al, 2001). In this system, the CL1 peptide, which functions as a degron, is fused to EGFP (EGFP-CL1). Degradation by conjugation with the degron is mediated by the UPS (Bence et al, 2001). EGFP- CL1, constitutively expressed in HEK293 cells, is unstable and the estimated half-life (t ) of EGFP-CL1 in this system 1/2 Figure 6 Denervation induced muscular atrophy was attenuated in is about 11 min. Ubiquitinylated EGFP-CL1 protein stabilized lex/lex ZNF216 mice. (A) Reduction of GA muscle weight upon by treatment with a proteasome inhibitor was associated neurectomy. Percent decreases in muscle weights are shown as with ZNF216 but EGFP itself was not (not shown). As a percent of control, calculated as the left/right muscle weights. (B) Cross-sections from gastrocnemius muscle were stained by shown in Figure 8A, protein degradation was markedly indirect immunofluorescence with anti-laminin. The reduction in retarded in the presence of ectopic ZNF216 (t 430 min) 1/2 size was also significant in muscle fibers of control mice but less in lex/lex compared to cells transfected with the loss of function mutant Znf216 .(C) Muscle fiber cross-sectional areas were measured ZNF216M3 or mock-transfected cells. Rapid turnover of in transverse tissue section (B). Percent relative fiber area of denervated muscle to control fiber area (sham-operated) are shown. EGFP-CL1 protein was inhibited by treatment with the &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 559 | | Reduction in GA muscle weight (%) Relative fiber area (%) (Denervation fiber area/ control fiber area) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Sham Denervation AB P < 0.005 +/+ lex/lex +/+ lex/lex P < 0.05 12 3 1 2 3 1 2 3 1 2 3 NS NS MAFbx MuRF-1 PSMA1 +/+ lex/lex +/+ lex/lex PSMD11 Sham Denervation GAPDH Sham Ad lib Fasting Denervation +/+ lex/lex +/+ lex/lex +/+ lex/lex +/+ lex/lex 12 3 1 2 3 12 3 1 2 3 1 2 1 2 1 2 1 2 Actin Ad lib Fasting UbI GST UbI GST UbI GST UbI GST ZNF216 S10 Figure 7 Changes in UPS upon muscular atrophy. (A) Expression of UPS components in denervation-induced muscular atrophy. Total RNAs were purified from gastrocnemius muscle, and Northern blotting was performed using indicated probes. Expression of genes for ubiquitin- ligases, such as MAFbx or MuRF-1, and proteasome subunits PSMA1 and PSMD11 was induced by muscle atrophy at comparable levels lex/lex lex/lex between wild-type and ZNF216 mice. (B) Proteasome activity. Proteasome activities in muscle extracts from wild-type or ZNF216 lex/lex mice were measured and are shown as arbitrary units. No significant difference in proteasome activity between wild-type and ZNF216 was lex/lex observed. (C) High levels of ubiquitinylated proteins accumulated in muscles from ZNF216 mice than in muscles from wild-type mice. lex/lex Muscle extracts from wild-type or ZNF216 mice were subjected to immunoblotting using anti-ubiquitin antibody to analyze levels of ubiquitinylated proteins. Left and right panels show fasting-induced and denervation-induced muscle atrophy, respectively. Each membrane was re-probed with anti-actin antibody. (D) Association of ZNF216 with the proteasome was increased upon atrophy. The proteasome fractions in muscle extracts from fed (ad lib) or fasted (fasting) mice were precipitated with GST-Ubl or GST only as a negative control. Endogenous ZNF216 protein was co-precipitated with the proteasome, which is probed by the anti-S10 antibody. proteasome inhibitor MG132 (MG132, Figure 8B). The levels overexpression of ZNF216 inhibits degradation of unstable of the proteins stabilized by MG132 were comparable among proteins via the UPS. cells transfected with ZNF216 constructs, indicating that protein synthesis of EGFP-CL1 was not significantly Discussion affected by ectopic expression of ZNF216 (MG132, Figure 8B). ZNF216WT, and to a lesser extent the mutants ZNF216 is an atrogene lex/lex M1 and M2 but not M3, attenuated degradation (NT, In this report, we show that Znf216 mice exhibit resis- Figure 8B). Thus, as is the case with other shuttle proteins, tance to denervation-induced muscle atrophy. It has been 560 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | Ubiquitinylated proteins Relative proteasome activity (arbitary unit) A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Mock ZNF216WT dependent NF-kB activation, LPS-induced cytokine expres- CHX (min) 010 20 30 60 0 10 20 30 60 sion or proliferation (unpublished data). Therefore, ZNF216 EGFP-CL1 seems to function as a downstream effector (i.e., a compo- nent of the UPS) rather than a specific negative regulator of Tubulin NF-kB signaling, although ZNF216 function in that pathway is still under investigation. Whereas expression of ZNF216 is FLAG not restricted to muscle, such expression was induced upon muscular atrophy and loss of function of Znf216 promotes ZNF216M3 resistance to denervation-induced atrophy, thereby suggest- CHX (min) 010 20 30 60 ing that it fulfills the definition of an ‘atrogene’. EGFP-CL1 As it is in skeletal muscle, ZNF216 is highly expressed in Tubulin the brain (Scott et al, 1998). Aberrations in the UPS have been documented in the pathogenesis of neurodegenerative FLAG diseases such as Parkinson’s and Huntington’s diseases (Ross and Poirier, 2004). Massive accumulation of ubiquitinylated NT MG132 proteins, which are often aggregated and impair the UPS Mock WT M1 M2 M3 Mock WT M1 M2 M3 leading to neuronal degeneration, has been observed in these EGFP-CL1 pathogenic conditions (Ciechanover and Brundin, 2003; Tubulin Korhonen and Lindholm, 2004). In cultured cells, blocking the UPS by proteasome inhibitors leads to accumulation of FLAG ubiquitinylated proteins. These ubiquitinylated proteins are Figure 8 Ectopic expression of ZNF216-affected protein degrada- then transferred to perinuclear locations and form aggre- tion. (A) Degradation of EGFP-CL1 protein was delayed by over- somes (Johnston et al, 1998). As shown here, ZNF216 is expression of ZNF216. 293 cells stably expressing EGFP-CL1 were localized in aggresomes together with ubiquitinylated pro- transfected with plasmid of ZNF216WT, ZNF216M3 or pcDNA3 teins. Interestingly, proteomic analysis of a protein complex (mock). Estimated half-lives of the EGFP-CL1 are 35, 11 and 11 min in ZNF216WT-, ZNF216M3- and mock-transfected cells, containing HDAC6, a protein often associated with aggre- respectively. De novo protein synthesis was arrested by cyclohex- somes (Kawaguchi et al, 2003), showed that the complex imide (CHX). The membrane was re-probed with tubulin antibody included AWP1, a structural homologue of ZNF216 to control for protein loading (tubulin) and FLAG antibody to detect (Seigneurin-Berny et al, 2001). Although it is unclear whether ZNF216 expression (FLAG). (B) Degradation of EGFP-CL1 protein in the presence of various ZNF216 constructs. HEK293 cells stably ZNF216 is involved in aggresome formation, there is great expressing EGFP-CL1 were transfected with plasmids expressing interest in the role of ZNF216 in the pathogenesis of neuro- the indicated mutants. Transfected cells were not treated (NT) or degenerative diseases. MG132-treated (MG132), and EGFP-CL1 protein was detected with an anti-GFP antibody (EGFP-CL1). The membrane was re-probed with tubulin antibody to control for protein loading (tubulin) and Molecular function of an A20-containing protein, FLAG antibody to detect ZNF216 expression (FLAG). ZNF216 In muscle atrophy, more ubiquitinylated proteins accumulate lex/lex in muscle from Znf216 mice than in muscle from wild- shown that TNFa induces catabolic conditions through UPS type mice, suggesting an abnormal UPS function. Inhibition during cancer cachexia (Mitch and Price, 2001). Recently, it of neither polyubiquitinylation nor DUB activity was ob- has been reported that mice deficient in molecules involved served in ZNF216. Although our in vivo data showed sig- in the NF-kB pathway exhibit resistance to muscular atrophy nificant accumulation of polyubiquitinylated proteins in lex/lex (Cai et al, 2004; Hunter and Kandarian, 2004; McKinnell and muscle from Znf216 mice, there is a possibility that Rudnicki, 2004). On the other hand, the IGF-FOXO axis has ZNF216 is a ubiquitin-ligase. It has been recently reported been suggested to regulate muscle mass through induction of that A20/TNFAIP3 protein possesses ubiquitin ligase activity ‘atrogenes’ such as Murf1 and MAFbx/Atrogin-1 (Sandri against RIP through its ZnF-A20 repeats (Wertz et al, 2004). et al, 2004; Stitt et al, 2004). Although we provide evidence We asked whether the ZnF-A20 of ZNF216 exhibited activity that Znf216 is downstream of FOXO, the NF-kB pathway similar to A20/TNFAIP3, but in vitro ubiquitinylation assays could represent an alternative signal inducing ZNF216. were negative (Supplementary Figure S6). In fact, the ZnF- Indeed, we have identified Znf216 as a gene induced by A20 of A20/TNFAIP3 protein does not bind polyubiquitin RANKL, a TNF family ligand (Hishiya et al, 2005) which chains as does the ZnF-A20 of ZNF216 (Supplementary activates the NF-kB pathway through RANK (Anderson et al, Figure S1). Furthermore, there are seven ZnF-A20 motifs in 1997; Lacey et al, 1998). Moreover, TNFa and IL-1b upregu- A20/TNFAIP3 and only the fourth is responsible for E3 late expression of ZNF216 in fibroblasts and macrophages activity, suggesting that the ZnF-A20 motif is not inherently (Hishiya et al, 2005). These results suggest that Znf216 may active enzymatically (Wertz et al, 2004). However, we cannot be activated by NF-kB. Huang et al (2004) recently reported exclude the possibility that ZNF216 may possess DUB or E3 that ZNF216 inhibits the NF-kB pathway. Whereas treatment activity highly specific to an unknown substrate without with TNFa or overexpression of TRAF6 dramatically acti- nonspecific or self-ubiquitinylating activity. vated a reporter driven by NF-kB response elements, ectopic ZNF216 likely acts as a bridging or a shuttle factor of expression of A20/TNFAIP3 but not ZNF216 inhibited NF-kB ubiquitinylated proteins targeted to the proteasome. Shuttle activation (not shown). Using mouse embryonic fibroblasts, proteins, such as Rad23p and Dsk2p, share interfaces for lex/lex splenocytes or bone marrow cells from Znf216 or wild- ubiquitinylated proteins and the proteasome (Hartmann- type mice, no significant differences were observed in TNFa- Petersen and Gordon, 2004; Elsasser and Finley, 2005). &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 561 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al pGBKT7-ZNF216 was performed as described previously (Masuda Although shuttle proteins are required for efficient protein et al, 2001). Identification of the co-immunoprecipitated proteins degradation, ectopic expression of hHR23 or hPLIC, the with N- or C-terminally FLAG-tagged ZNF216 (ZA20D2) or AWP1 human homologues of Rad23p or Dsk2p, respectively, lead (ZA20D3) was essentially done by a nano-LC/MS/MS system as to stabilization of p53 protein (Kleijnen et al, 2000; Glockzin previously described (Natsume et al, 2002; Komatsu et al, 2004). et al, 2003). These outcomes may be caused by titration Experimental models of muscle atrophy effects due to overexpression and are commonly observed For fasting-induced muscle atrophy, 8-week-old C57BL6 male mice following misexpression of shuttle proteins in yeast and were deprived of food but given free access to water. After 2 days, mammals (Hartmann-Petersen and Gordon, 2004; Verma gastrocnemius muscles were harvested for each experiment. et al, 2004). Here, we show that ZNF216 has a ubiquitin Denervation-induced muscle atrophy was performed by dissecting the sciatic nerve of one hindlimb, and the other hindlimb was sham binding domain and can associate with the 26S proteasome operated as the control. After 7 days, the contralateral normal and even in the absence of ubiquitin binding, and that over- denervated gastrocnemius muscles were harvested for each expression of the zinc-finger protein attenuates protein de- experiment. All animal experiments were approved in advance by the Ethics Review Committee for Animal Experimentation of the gradation rate. There is no structural counterpart of ZNF216 National Institute for Longevity Sciences and the National Center in the yeast genome. We asked whether ZNF216 could rescue for Geriatrics and Gerontology. Student’s t-tests were used to the bridging function of RAD23 or DSK2 mutants by introdu- evaluate statistical differences between the two groups. cing ZNF216 into Drad23Ddsk2 yeast cells, but the phenotype could not be rescued (data not shown). This suggests that Znf216-deficient mice þ /lex ZNF216 is not the functional orthologue of these proteins. Generation of heterozygous Znf216 mice was essentially done by the gene trap method at Lexicon Genetics (Zambrowicz et al, Recently, the presence of an alternative pathway of Rad23p/ 1998). Briefly, ES cells heterozygous for the trapped Znf216 gene Dsk2p in protein targeting to the proteasome has been were microinjected into eight-cell-stage ICR mouse embryos and suggested (Bazirgan and Hampton, 2005; Richly et al, transplanted into uteri. Chimeric mice were crossed to C57BL/6J mice. Northern and immunoblot analyses confirmed disruption of 2005). It has been reported that tetra-ubiquitin constitutes the gene (see text). For genotyping, primers were as follows: KO-A, the minimum proteasomal targeting signal and that the ACCGACAGGATAGACAATGGCAGAG; KO-B, CGATTTTAAGAAAG length of polyubiquitin chain may determine the targeting GAGGCTCTGACC; LTR2, AAATGGCGTTACTTAAGCTAGCTTGC. route (Thrower et al, 2000; Bazirgan and Hampton, 2005; The wild-type and inserted alleles were detected by PCR using KO-A and KO-B (0.5 kb), and LTR2 and KO-B (0.3 kb), respectively. Richly et al, 2005). Notably, ZNF216 preferentially binds polyubiquitin chains longer than di- or tri-ubiquitin EGFP-CL1 degradation assay (Figure 1D). Therefore, these data suggest that ZNF216 is a The nucleotide sequence encoding the CL1 peptide novel ubiquitin recognition factor, required for efficient pro- (ACKNWFSSLSHFVIHL) (Gilon et al, 1998) was inserted into the tein degradation via a pathway different from the canonical XhoI/EcoRI site of pEGFP-C3, and the resulting plasmid was designated pEGFP-CL1. A cell line stably expressing EGFP-CL1 Rad23p/Dsk2p pathway. Although it is now under investiga- (293EGFP-CL1) was generated by transfection of pEGFP-CL1 into tion, the characterization of ZnF-AN1, an AN1-type zinc- 293 cells. For the degradation assay, ZNF216 expression vectors finger domain located at the C-terminus of ZNF216, may were transfected into 293EGFP-CL1 cells and cells were harvested reveal the precise molecular function of ZNF216. 48 h after transfection. MG132 (final 10 mM) or cycloheximide (final 100 mg/ml) was added to the culture at 12 or 1 h before harvest, respectively. Protein extraction was as described above. Materials and methods For more details on supplementary Materials and methods, see Supplementary data Antibodies An anti-ZNF216 antibody was raised by immunizing rabbits against Supplementary data synthesized peptide corresponding to the C-terminal sequence of Supplementary data are available at The EMBO Journal Online. mouse ZNF216. Mouse monoclonal antibodies for FLAG (Sigma, St Louis, MO) and ubiquitin (Santa Cruz Biotechnology, CA), rabbit polyclonal antibodies for ubiquitin (Affiniti Research Products) and Acknowledgements actin (Neo Markers, CA), a rat monoclonal antibody for HA (Roche Diagnostics, Mannheim, Germany), and a rabbit polyclonal anti- We are grateful to Drs Kazuhiro Iwai (Osaka City University) and body against S10a/Rpn7p (Affiniti Research Products) were Noboru Motoyama (NCGG) for reagents, helpful comments and purchased from the indicated manufacturers. For indirect immuno- suggestions throughout this study. We also thank Drs Akio Matsuda fluorescence staining, AlexaFluor 488 goat anti-mouse IgG or and Tatsuo Furuyama for experimental instruction and advice; Dr AlexaFluor 546 goat anti-rat IgG antibody was obtained from Aya Sasaki for pathological determinations; Ms Miho Kamiya and Molecular Probes, OR. Ms Kumi Tsutsumi for technical assistance; and Dr Elise Lamar for proofreading the manuscript. This study is supported in part by the Identification of interacting proteins Program for Promotion of Fundamental Studies in Health Sciences RNA was purified from RAW264.7 cells stimulated by RANKL, and of the Organization for Pharmaceutical Safety and Research of used to construct the yeast library (MatchMaker Library Construc- Japan, and by a Research Grant for Longevity Sciences from the tion & Screening Kit, Clontech). Yeast two-hybrid screening with Ministry of Health, Labor and Welfare. References Anderson DM, Maraskovsky E, Billingsley WL, Dougall WC, in rats by augmenting transcription of genes encoding proteins of Tometsko ME, Roux ER, Teepe MC, DuBose RF, Cosman D, the ATP-dependent ubiquitin-proteasome pathway. J Clin Invest Galibert L (1997) A homologue of the TNF receptor and its ligand 97: 1447–1453 enhance T-cell growth and dendritic-cell function. Nature 390: Bazirgan OA, Hampton RY (2005) Cdc48-Ufd2-Rad23: the road less 175–179 ubiquitinated? Nat Cell Biol 7: 207–209 Bailey JL, Wang X, England BK, Price SR, Ding X, Mitch WE (1996) Bence NF, Sampat RM, Kopito RR (2001) Impairment of the ubiquitin– The acidosis of chronic renal failure activates muscle proteolysis proteasome system by protein aggregation. Science 292: 1552–1555 562 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Kopito RR (2000) Aggresomes, inclusion bodies and protein aggre- Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, gation. Trends Cell Biol 10: 524–530 Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass Korhonen L, Lindholm D (2004) The ubiquitin proteasome system DJ (2001) Identification of ubiquitin ligases required for skeletal in synaptic and axonal degeneration: a new twist to an old cycle. muscle atrophy. Science 294: 1704–1708 J Cell Biol 165: 27–30 Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, MJ, Arden KC, Blenis J, Greenberg ME (1999) Akt promotes cell Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, survival by phosphorylating and inhibiting a Forkhead transcrip- Hawkins N, Davy E, Capparelli C, Eli A, Qian YX, Kaufman S, tion factor. Cell 96: 857–868 Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ Cai D, Frantz JD, Tawa Jr NE, Melendez PA, Oh BC, Lidov HG, (1998) Osteoprotegerin ligand is a cytokine that regulates osteo- Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE (2004) clast differentiation and activation. Cell 93: 165–176 IKKbeta/NF-kappaB activation causes severe muscle wasting in Lambertson D, Chen L, Madura K (1999) Pleiotropic defects caused mice. Cell 119: 285–298 by loss of the proteasome-interacting factors Rad23 and Rpn10 of Chen L, Shinde U, Ortolan TG, Madura K (2001) Ubiquitin-asso- Saccharomyces cerevisiae. Genetics 153: 69–79 ciated (UBA) domains in Rad23 bind ubiquitin and promote Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price inhibition of multi-ubiquitin chain assembly. EMBO Rep 2: SR, Mitch WE, Goldberg AL (2004) Multiple types of skeletal 933–938 muscle atrophy involve a common program of changes in gene Ciechanover A, Brundin P (2003) The ubiquitin proteasome system expression. FASEB J 18: 39–51 in neurodegenerative diseases: sometimes the chicken, some- Lecker SH, Solomon V, Mitch WE, Goldberg AL (1999) Muscle times the egg. Neuron 40: 427–446 protein breakdown and the critical role of the ubiquitin–protea- Elsasser S, Finley D (2005) Delivery of ubiquitinated substrates to some pathway in normal and disease states. J Nutr 129: protein-unfolding machines. Nat Cell Biol 7: 742–749 227S–237S Funakoshi M, Sasaki T, Nishimoto T, Kobayashi H (2002) Budding Lelouard H, Gatti E, Cappello F, Gresser O, Camosseto V, Pierre P yeast Dsk2p is a polyubiquitin-binding protein that can interact (2002) Transient aggregation of ubiquitinated proteins during with the proteasome. Proc Natl Acad Sci USA 99: 745–750 dendritic cell maturation. Nature 417: 177–182 Furukawa-Hibi Y, Yoshida-Araki K, Ohta T, Ikeda K, Motoyama Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, Watanabe K N (2002) FOXO forkhead transcription factors induce G(2)-M (2001) Dlxin-1, a novel protein that binds Dlx5 and regulates its checkpoint in response to oxidative stress. J Biol Chem 277: transcriptional function. J Biol Chem 276: 5331–5338 26729–26732 McKinnell IW, Rudnicki MA (2004) Molecular mechanisms of Gilon T, Chomsky O, Kulka RG (1998) Degradation signals for muscle atrophy. Cell 119: 907–910 ubiquitin system proteolysis in Saccharomyces cerevisiae. Medina R, Wing SS, Haas A, Goldberg AL (1991) Activation of the EMBO J 17: 2759–2766 ubiquitin-ATP-dependent proteolytic system in skeletal muscle Glickman MH, Ciechanover A (2002) The ubiquitin-proteasome during fasting and denervation atrophy. Biomed Biochim Acta 50: proteolytic pathway: destruction for the sake of construction. 347–356 Physiol Rev 82: 373–428 Mitch WE, Goldberg AL (1996) Mechanisms of muscle wasting. The Glockzin S, Ogi FX, Hengstermann A, Scheffner M, Blattner C role of the ubiquitin-proteasome pathway. N Engl J Med 335: (2003) Involvement of the DNA repair protein hHR23 in p53 1897–1905 degradation. Mol Cell Biol 23: 8960–8969 Mitch WE, Price SR (2001) Transcription factors and muscle Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL (2001) cachexia: is there a therapeutic target? Lancet 357: 734–735 Atrogin-1, a muscle-specific F-box protein highly expressed dur- Natsume T, Yamauchi Y, Nakayama H, Shinkawa T, Yanagida M, ing muscle atrophy. Proc Natl Acad Sci USA 98: 14440–14445 Takahashi N, Isobe T (2002) A direct nanoflow liquid chromato- Hartmann-Petersen R, Gordon C (2004) Protein degradation: recog- graphy-tandem mass spectrometry system for interaction proteo- nition of ubiquitinylated substrates. Curr Biol 14: R754–R756 mics. Anal Chem 74: 4725–4733 Hershko A, Ciechanover A (1998) The ubiquitin system. Annu Rev Opipari Jr AW, Boguski MS, Dixit VM (1990) The A20 cDNA induced Biochem 67: 425–479 by tumor necrosis factor alpha encodes a novel type of zinc finger Hishiya A, Ikeda K, Watanabe K (2005) A RANKL-inducible gene protein. J Biol Chem 265: 14705–14708 Znf216 in osteoclast differentiation. J. Receptor Signal Transduct Pickart CM, Cohen RE (2004) Proteasomes and their kin: proteases 25: 199–216 in the machine age. Nat Rev Mol Cell Biol 5: 177–187 Horiuchi H, Lippe R, McBride HM, Rubino M, Woodman P, Price SR, Bailey JL, Wang X, Jurkovitz C, England BK, Ding X, Stenmark H, Rybin V, Wilm M, Ashman K, Mann M, Zerial M Phillips LS, Mitch WE (1996) Muscle wasting in insulinopenic (1997) A novel Rab5 GDP/GTP exchange factor complexed to rats results from activation of the ATP-dependent, ubiquitin- Rabaptin-5 links nucleotide exchange to effector recruitment and proteasome proteolytic pathway by a mechanism including function. Cell 90: 1149–1159 gene transcription. J Clin Invest 98: 1703–1708 Huang J, Teng L, Li L, Liu T, Li L, Chen D, Xu LG, Zhai Z, Shu HB Richly H, Rape M, Braun S, Rumpf S, Hoege C, Jentsch S (2005) A (2004) ZNF216 is an A20-like and IkappaB kinase gamma- series of ubiquitin binding factors connects CDC48/p97 to sub- interacting inhibitor of NFkappaB activation. J Biol Chem 279: strate multiubiquitylation and proteasomal targeting. Cell 120: 16847–16853 73–84 Hunter RB, Kandarian SC (2004) Disruption of either the Nfkb1 or Ross CA, Poirier MA (2004) Protein aggregation and neurodegen- the Bcl3 gene inhibits skeletal muscle atrophy. J Clin Invest 114: erative disease. Nat Med 10 (Suppl): S10–S17 1504–1511 Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL (2004) IGF-I Jagoe RT, Lecker SH, Gomes M, Goldberg AL (2002) Patterns of gene stimulates muscle growth by suppressing protein breakdown and expression in atrophying skeletal muscles: response to food expression of atrophy-related ubiquitin ligases, atrogin-1 and deprivation. FASEB J 16: 1697–1712 MuRF1. Am J Physiol Endocrinol Metab 287: E591–E601 Johnston JA, Ward CL, Kopito RR (1998) Aggresomes: a cellular Saeki Y, Saitoh A, Toh-e A, Yokosawa H (2002) Ubiquitin- response to misfolded proteins. J Cell Biol 143: 1883–1898 like proteins and Rpn10 play cooperative roles in ubiquitin- Kawaguchi Y, Kovacs JJ, McLaurin A, Vance JM, Ito A, Yao TP dependent proteolysis. Biochem Biophys Res Commun 293: (2003) The deacetylase HDAC6 regulates aggresome formation 986–992 and cell viability in response to misfolded protein stress. Cell 115: Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh 727–738 K, Schiaffino S, Lecker SH, Goldberg AL (2004) Foxo transcription Kleijnen MF, Shih AH, Zhou P, Kumar S, Soccio RE, Kedersha NL, factors induce the atrophy-related ubiquitin ligase atrogin-1 and Gill G, Howley PM (2000) The hPLIC proteins may provide a link cause skeletal muscle atrophy. Cell 117: 399–412 between the ubiquitination machinery and the proteasome. Mol Scott DA, Greinwald Jr JH, Marietta JR, Drury S, Swiderski RE, Cell 6: 409–419 Vinas A, DeAngelis MM, Carmi R, Ramesh A, Kraft ML, Elbedour Komatsu M, Chiba T, Tatsumi K, Iemura S, Tanida I, Okazaki N, K, Skworak AB, Friedman RA, Srikumari Srisailapathy CR, Ueno T, Kominami E, Natsume T, Tanaka K (2004) A novel Verhoeven K, Van Gamp G, Lovett M, Deininger PL, Batzer MA, protein-conjugating system for Ufm1, a ubiquitin-fold modifier. Morton CC, Keats BJ, Smith RJ, Sheffield VC (1998) Identifica- EMBO J 23: 1977–1986 tion and mutation analysis of a cochlear-expressed, zinc finger &2006 European Molecular Biology Organization The EMBO Journal VOL 25 NO 3 2006 563 | | A novel ubiquitin-binding protein, ZNF216 A Hishiya et al protein gene at the DFNB7/11 and dn hearing-loss loci on Wertz IE, O’Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, Wu human chromosome 9q and mouse chromosome 19. Gene 215: P, Wiesmann C, Baker R, Boone DL, Ma A, Koonin EV, Dixit VM 461–469 (2004) De-ubiquitination and ubiquitin ligase domains of A20 Seigneurin-Berny D, Verdel A, Curtet S, Lemercier C, Garin J, downregulate NF-kappaB signalling. Nature 430: 694–699 Rousseaux S, Khochbin S (2001) Identification of components Wilkinson CR, Ferrell K, Penney M, Wallace M, Dubiel W, Gordon C of the murine histone deacetylase 6 complex: link between (2000) Analysis of a gene encoding Rpn10 of the fission yeast acetylation and ubiquitination signaling pathways. Mol Cell Biol proteasome reveals that the polyubiquitin-binding site of this 21: 8035–8044 subunit is essential when Rpn12/Mts3 activity is compromised. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, J Biol Chem 275: 15182–15192 Gonzalez M, Yancopoulos GD, Glass DJ (2004) The IGF-1/PI3K/ Wing SS, Goldberg AL (1993) Glucocorticoids activate the ATP- Akt pathway prevents expression of muscle atrophy-induced ubiquitin-dependent proteolytic system in skeletal muscle during ubiquitin ligases by inhibiting FOXO transcription factors. Mol fasting. Am J Physiol 264: E668–E676 Cell 14: 395–403 Wing SS, Haas AL, Goldberg AL (1995) Increase in ubiquitin– Tawa Jr NE, Odessey R, Goldberg AL (1997) Inhibitors of the protein conjugates concomitant with the increase in proteolysis proteasome reduce the accelerated proteolysis in atrophying rat in rat skeletal muscle during starvation and atrophy denervation. skeletal muscles. J Clin Invest 100: 197–203 Biochem J 307 (Part 3): 639–645 Thrower JS, Hoffman L, Rechsteiner M, Pickart CM (2000) Young P, Deveraux Q, Beal RE, Pickart CM, Rechsteiner M (1998) Recognition of the polyubiquitin proteolytic signal. EMBO J 19: Characterization of two polyubiquitin binding sites in the 26 S 94–102 protease subunit 5a. J Biol Chem 273: 5461–5467 Verma R, Oania R, Graumann J, Deshaies RJ (2004) Multiubiquitin Zambrowicz BP, Friedrich GA, Buxton EC, Lilleberg SL, Person C, chain receptors define a layer of substrate selectivity in the Sands AT (1998) Disruption and sequence identification of 2000 ubiquitin–proteasome system. Cell 118: 99–110 genes in mouse embryonic stem cells. Nature 392: 608–611 564 The EMBO Journal VOL 25 NO 3 2006 &2006 European Molecular Biology Organization | |

Journal

The EMBO Journal – Springer Journals

Published: Feb 8, 2006

Keywords: aggresome; muscular atrophy; proteasome; ubiquitin; zinc‐finger protein

There are no references for this article.