Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Enhanced Chondrogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells in Low Oxygen Environment Micropellet Cultures

Enhanced Chondrogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells in Low... Cell Transplantation, Vol. 19, pp. 29–42, 2010 0963-6897/10 $90.00 + .00 Printed in the USA. All rights reserved. DOI: 10.3727/096368909X478560 Copyright  2010 Cognizant Comm. Corp. E-ISSN 1555-3892 www.cognizantcommunication.com Enhanced Chondrogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells in Low Oxygen Environment Micropellet Cultures Brandon D. Markway,* Guak-Kim Tan,* Gary Brooke,† James E. Hudson,* Justin J. Cooper-White,* and Michael R. Doran* *Tissue Engineering & Microfluidics Laboratory, Australian Institute for Bioengineering & Nanotechnology, The University of Queensland, Brisbane, Australia †Adult Stem Cell Team, Mater Medical Research Institute, Brisbane, Australia Chondrogenesis of mesenchymal stem cells (MSCs) is typically induced when they are condensed into a single aggregate and exposed to transforming growth factor-β (TGF-β). Hypoxia, like aggregation and TGF- β delivery, may be crucial for complete chondrogenesis. However, the pellet dimensions and associated self- induced oxygen gradients of current chondrogenic methods may limit the effectiveness of in vitro differentia- tion and subsequent therapeutic uses. Here we describe the use of embryoid body-forming technology to produce microscopic aggregates of human bone marrow MSCs (BM-MSCs) for chondrogenesis. The use of micropellets reduces the formation of gradients within the aggregates, resulting in a more homogeneous and controlled microenvironment. These micropellet cultures (170 cells/micropellet) as well as conventional pellet cultures (2 × 10 cells/pellet) were chondrogenically induced under 20% and 2% oxygen environ- ments for 14 days. Compared to conventional pellets under both environments, micropellets differentiated under 2% O showed significantly increased sulfated glycosaminoglycan (sGAG) production and more ho- mogeneous distribution of proteoglycans and collagen II. Aggrecan and collagen II gene expressions were increased in pellet cultures differentiated under 2% O relative to 20% O pellets but 2% O micropellets 2 2 2 showed even greater increases in these genes, as well as increased SOX9. These results suggest a more advanced stage of chondrogenesis in the micropellets accompanied by more homogeneous differentiation. Thus, we present a new method for enhancing MSC chondrogenesis that reveals a unique relationship be- tween oxygen tension and aggregate size. The inherent advantages of chondrogenic micropellets over a single macroscopic aggregate should allow for easy integration with a variety of cartilage engineering strate- gies. Key words: Cartilage regeneration; Bone marrow; Mesenchymal stem cells; Chondrogenesis; Extracellular matrix; Hypoxia INTRODUCTION may be an alternative autologous source for such appli- cations due to their multipotency and relative ease of iso- Articular cartilage has poor regenerative capacity fol- lation and expansion (64). The use of MSCs in cartilage lowing injury and degradation, due in part to its avascu- repair, however, will be dependent on the development lar nature. For some patients, autologous chondrocyte of efficient and controlled chondrogenesis methods. implantation (ACI) is a viable cartilage repair strategy; In vitro chondrogenesis of bone marrow-derived MSCs however, this procedure requires the isolation of chon- (BM-MSCs) in the presence of transforming growth fac- drocytes via a preliminary surgery, which itself may re- tor-β1 (TGF-β1) was first described using high-density sult in further cartilage degeneration (44). Additionally, pellet cultures (32,49,82). Aggregate formation along the expansion of articular chondrocytes (ACs) can result with members of the TGF-β superfamily (49,70) may be in dedifferentiation and loss of the mechanical and phe- essential for complete in vitro chondrogenesis of MSCs. notypic properties that make the cells ideal in the first While conventional pellet culture is an effective tool for place (11,13,76). Adult mesenchymal stem cells (MSCs) studying this process, it is not without its limitations. Received July 2, 2009; final acceptance October 12, 2009. Online prepub date: October 29, 2009. Address correspondence to Dr. Michael R. Doran, Tissue Engineering & Microfluidics Laboratory, Australian Institute for Bioengineering & Nanotechnology, Building 75, The University of Queensland, QLD 4072Australia. Tel: +61 7 3346 3868; Fax: +61 7 3346 3973; E-mail: michael. [email protected] 29 30 MARKWAY ET AL. Typical histological analyses of these macroscopic pel- stantial increases in the changes characteristic of chon- lets reveal heterogeneous staining of the chondrogenic- drogenic differentiation compared to conventional pellet specific matrix (5,31,37,49,55,56,61,70,82). This is pos- cultures in both environments. Specifically, we show that sibly due to fluctuating mass transport properties of the chondrogenic induction of BM-MSC micropellets formed TM increasingly dense pellet. Minimizing transport limita- in AggreWell plates under low oxygen tension results tions may improve homogeneity of differentiation, an in considerably increased sulfated glycosaminoglycan essential outcome for downstream therapeutic applica- (sGAG) production, uniform distribution of matrix com- tions. ponents, and enhanced expression of genes associated Another critical factor in chondrogenic differentia- with BM-MSC chondrogenesis. Thus, we have devel- tion, and possibly in BM-MSC maintenance in general, oped a new method for enhanced chondrogenic differen- is oxygen tension. The physiological environments of tiation of BM-MSCs that possesses properties ideal for both articular cartilage and bone marrow are reported to incorporation with current platforms for cartilage repair. exist within a range of 1–7% O (14,36). In human ACs, MATERIALS AND METHODS expression of the essential transcription factor for chon- Human Bone Marrow-Derived Mesenchymal Stem drogenesis, (sex determining region Y)-box 9 (SOX9), Cell Isolation and Culture is upregulated by hypoxia, resulting in increased expres- sion of collagen II and aggrecan, the major structural Full informed patient consent was obtained in all components of articular cartilage (41). Additionally, hy- cases and ethical approval granted through the Mater poxia promotes the chondrocyte phenotype through Health Services Human Research Ethics Committee in SOX9-independent gene regulation (40). In recent years, accordance with the Australian National Health and a number of studies have shown the benefits of low oxy- Medical Research Council’s Statement on Ethical Con- gen tension with regards to BM-MSC culture and differ- duct in Research Involving Humans. Approximately 10 entiation. Culture under a low oxygen environment has ml bone marrow was taken from iliac crest of healthy been shown to increase the expansion potential of BM- donors. The sample was diluted 1:1 with phosphate- MSCs (20,24,25,54,86). Furthermore, posthypoxia ex- buffered saline (PBS) and underlayed with 12 ml Ficoll- posure differentiation studies have shown these cells to Paque Plus (GE Healthcare, Little Chalfont, Bucking- maintain multilineage differentiation capacity with en- hamshire, UK). Tubes were spun at 535 × g for 20 min. hanced chondrogenic potential (51,86). The few studies Interface cells were washed and resuspended in low- utilizing low oxygen during chondrogenic differentiation glucose Dulbecco’s modified Eagle’s medium (DMEM- also indicate improved outcomes. Human adipose-derived LG; Gibco Life Technologies, Grand Island, NY) sup- MSCs in both alginate gels and aggregate culture under plemented with 20% fetal bovine serum (FBS; Gibco) hypoxic environments showed increased chondrogenesis and 50 µg/ml gentamicin (Amersham Pharmacia Bio- (36,79). Likewise, low oxygen tension enhanced chon- tech, Uppsala, Sweden) and placed in tissue culture drogenic differentiation of high-density cultures of bo- flasks. After 48 h, nonadherent cells were removed by vine, mouse, and rat BM-MSCs (34,68,69). washing with PBS and remaining adherent cells further Recently, Ungrin et al. developed a microfabrication- cultured with medium changes every 3–4 days. Cells based nonadhesive surface for the culture of thousands generally approached confluence after 14–20 days and of individual aggregates of embryonic stem cells to im- were then passaged and expanded. After the second pas- prove embryoid body homogeneity and differentiation sage, cells were immunophenotyped by flow cytometry (78). With a commercial tissue culture product employ- (monoclonal antibodies from BD Biosciences Phar- ing this microwell surface now available, we evaluated mingen, San Diego, CA) and were functionally assessed the effectiveness of such a technology for enhancing for differentiation potential. Cells were deemed MSC if − + + + chondrogenesis of human BM-MSCs. Due to the prom- they were CD45 , CD73 , CD90 , CD105 , and showed ising indications but lack of clarity regarding the role of adipogenic, osteogenic, and chondrogenic differentiation oxygen tension during chondrogenesis of human BM- potential as described previously (8). MSCs, the oxygen environment was varied between nor- For these experiments, second passage BM-MSCs moxic (20% O ) and hypoxic (2% O ) for this new cul- were expanded in DMEM-LG supplemented with 10% 2 2 ture system as well as for conventional pellet culture. FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin We show here that a long-term low oxygen environment (1% PS; Gibco) in an incubator with a 2% O atmo- during chondrogenic induction has beneficial effects on sphere due to the aforementioned evidence of the bene- the differentiation of human BM-MSCs in a conven- fits of hypoxic preconditioning on MSC chondrogenesis. tional pellet culture. Furthermore, creating smaller cell BM-MSCs from three different donors at fourth passage aggregates under low oxygen tension resulted in sub- were used in chondrogenic assays. LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 31 Chondrogenic Differentiation scribed (12) and visualizing with an Olympus BX61 mi- croscope equipped with polarizing filters. BM-MSCs were differentiated as conventional pellet Localizations of collagen I and collagen II were de- cultures in 15-ml polypropylene tubes or micropellet termined by double immunofluorescence staining (IF). TM cultures formed in AggreWell 400 plates (STEMCELL Briefly, the sections were digested with 0.01% pepsin Technologies, Vancouver, BC, Canada). BM-MSCs were (Sigma) in 0.01 M HCl (pH 2) at 37°C for 10 min, fol- grown to near confluence, detached using recombinant lowed by 0.1% hyaluronidase (Sigma) in PBS (pH 5) at trypsin replacement (TrypLE; Gibco), and placed in se- room temperature (RT) for 30 min. Cells were perme- rum-free chondrogenic induction medium consisting of abilized with 0.1% Triton X-100 for 5 min and blocked high-glucose DMEM (DMEM-HG; Gibco) containing −7 for 30 min at RT in TBS containing 2% bovine serum 10 ng/ml TGF-β1 (PeproTech, Rocky Hill, NJ), 10 M albumin and 2% normal goat serum. The sections were dexamethasone (Sigma, St. Louis, MO), 200 µM then stained with a 1:50 dilution of both polyclonal rab- ascorbic acid 2-phosphate (Sigma), 100 µg/ml sodium bit anti-collagen I (Cedarlane Labs, Burlington, ON, pyruvate (Sigma), 40 µg/ml proline (Sigma), 1× ITS+ Canada) and monoclonal mouse anti-collagen II (Lab (Gibco), and 1% PS. Pellet or micropellet cultures were Vision, Fremont, CA) primary antibodies for 2 h at RT. formed by centrifuging 2 × 10 cells at 500 × g in chon- This was followed by incubation with a mixture of sec- drogenic induction medium and then culturing in a 2% ondary antibodies containing Alexa Fluor 568-conju- O or 20% O atmosphere for a further 14 days. In this 2 2 gated goat anti-rabbit IgG and Alexa Fluor 488-conju- study, we used TGF-β1, which is known to induce chon- gated goat anti-mouse IgG (1:200 dilution; both from drogenic differentiation of MSCs but at a lesser rate than Molecular Probes) for 1 h at RT. After each staining TGF-β3 (5). This allowed us to evaluate micropellet dif- step, unbound antibodies were washed with TBS con- ferentiation at a time point (14 days) where chondrogen- taining 0.2% Tween-20. Nuclei were counterstained esis would be initiated in conventional pellet cultures with Hoechst 33342 for 5 min at RT. The sections were but still at an early stage (63). mounted and examined with an Olympus BX61 fluores- cence microscope. Negative controls without primary Sulfated Glycosaminoglycan Quantification antibodies were used for background correction. Medium from pellet and micropellet cultures was col- lected and stored at −80°C at each medium replacement, Relative Gene Expression Analysis every 3–4 days. At the end of 14 days, micropellets On day 14, RNA was collected from micropellets and were centrifuged to a single pellet. Micropellets and pel- mechanically disrupted conventional pellets using the lets were digested with 1.6 U/ml papain (Sigma) at 60°C RNEasy Mini Kit (Qiagen, Valencia, CA) as per the overnight. The sGAG content and DNA were quantified manufacturer’s instructions. RNA was also collected with 1,9-dimethymethylene blue (DMB; Sigma) and from day 0 monolayer BM-MSCs. RNA samples were Hoechst 33342 (Molecular Probes, Eugene, OR) as de- treated with DNase I (0.1 U/µl final; Fermentas, Glen scribed in detail by Liebman and Goldberg (47). Shark Burnie, MD) for 30 min at 37°C and then heat inacti- chondroitin sulfate (Sigma) and calf thymus DNA vated at 65°C for 5 min in the presence of 2.5 mM (Sigma) were used as the respective standards. Addition- EDTA. DNase I-treated RNA samples (50 ng) were re- ally, the DMB assay was used to quantify sGAGs re- verse transcribed using SuperScript III RT and oli- leased into the medium collected at days 3, 6, 10, and 14. go(dT) in the presence of RNaseOUT (all from In- vitrogen) as per the manufacturer’s instructions and Histology and Immunohistochemistry stored at −80°C until analysis. At the end of 14 days, micropellets and pellets were Real-time quantitative polymerase chain reaction fixed in 4% formaldehyde, embedded in Tissue-Tek (qPCR) was performed using a 7500 Fast Real-Time OCT compound (Sakura Finetek, Tokyo, Japan), and PCR System (Applied Biosystems, Foster City, CA) and snap-frozen in liquid nitrogen. Samples were cryosec- Platinum SYBR Green qPCR SuperMix-UDG (In- tioned and stored at −80°C until use. Before staining, vitrogen). The cycling parameters were 50°C for 2 min, the sections were rinsed in 70% ethanol and Tris- 95°C for 2 min, and then 95°C for 3 s and 60°C for 30 buffered saline (TBS) to remove OCT compound. To s for a total of 40 cycles. The primers used are shown in detect proteoglycan deposition sections were stained Table 1 and were all from previously published papers −∆∆ Ct with 0.1% toluidine blue (ProSciTech, Thuringowa, (52,72,77,81). Results were analyzed using the 2 QLD, Australia) in 1% NaCl solution (pH 2.3). Organi- method relative to the housekeeping gene cyclophilin A zation of fibrillar collagen was detected by staining with due to the instability of glyceraldehyde 3-phosphate de- 0.1% Picrosirius red F3B (ProSciTech) as previously de- hydrogenase (GAPDH) in oxygen-dependent studies 32 MARKWAY ET AL. Table 1. Primers Used for Real-Time Quantitative Polymerase Chain Reaction Amplicon Gene Primers Size (bp) Reference Cyclophilin A 164 77 Forward CTCGAATAAGTTTGACTTGTGTTT Reverse CTAGGCATGGGAGGGAACA GAPDH 119 52 Forward ATGGGGAAGGTGAAGGTCG Reverse TAAAAGCAGCCCTGGTGACC SOX9 77 81 Forward TTCCGCGACGTGGACAT Reverse TCAAACTCGTTGACATCGAAGGT Aggrecan 85 52 Forward TCGAGGACAGCGAGGCC Reverse TCGAGGGTGTAGCGTGTAGAGA Collagen II (COL2A1) 79 52 Forward GGCAATAGCAGGTTCACGTACA Reverse CGATAACAGTCTTGCCCCACTT Collagen I (COL1A1) 83 52 Forward CAGCCGCTTCACCTACAGC Reverse TTTTGTATTCAATCACTGTCTTGCC Versican 98 52 Forward TGGAATGATGTTCCCTGCAA Reverse AAGGTCTTGGCATTTTCTACAACAG Collagen X (COL10A1) 70 52 Forward CAAGGCACCATCTCCAGGAA Reverse AAAGGGTATTTGTGGCAGCATATT Runx2/Cbfa1 113 72 Forward GGAGTGGACGAGGCAAGAGTTT Reverse AGCTTCTGTCTGTGCCTTCTGG Osteocalcin 70 52 Forward GAAGCCCAGCGGTGCA Reverse CACTACCTCGCTGCCCTCC GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SOX9, (sex determining region Y)-box 9; Runx2/ Cbfa1, runt-related transcription factor 2/core-binding factor α1. (7,21,85). Specificity of products was confirmed by melt magnitude and direction of changes in pellets compared curve analysis and 3% agarose gel electrophoresis. to undifferentiated BM-MSCs. Therefore, all data shown Cyclophilin A was stable among day 14 differenti- and subjected to statistical analysis are compared to the ated BM-MSCs, but differed in monolayer BM-MSCs current standard for BM-MSC chondrogenesis, 20% O and thus could not be used to compare between days 0 pellets, and with cyclophilin A as a reference gene. and 14. GAPDH, however, was stable between 2% O Statistical Analysis micropellets and monolayer BM-MSCs. Thus, for some genes, we quantified the change in 2% O micropellets SPSS 17.0 (SPSS Inc., Chicago, IL) was used for compared to monolayer BM-MSCs and used this in con- one-way analysis of variance (ANOVA) with Tukey junction with the change among conditions calculated post hoc tests to assess statistical significance, which using cyclophilin A to indirectly estimate the change in was defined as p < 0.05. For qPCR data, statistical anal- the conventional pellets from monolayer BM-MSCs. ysis was conducted on the ∆ Ct values and the mean fold However, this was deemed to be more susceptible to increase and 95% confidence intervals are represented −∆∆ Ct error and was only used as an indication of the general by 2 evaluated at the mean Ct, at the lower confi- ∆∆ LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 33 dence limit of Ct, and at the upper confidence limit sGAGs, while 2% O micropellets had a distinctly linear of Ct between conditions (83). sGAG release profile (Fig. 2B). The 2% O pellets re- tained nearly twice the fraction of their total sGAGs as RESULTS the 20% O pellets (Fig. 2C) and correspondingly pro- Human BM-MSC Micropellet Development duced twice as much per microgram of DNA within the TM in AggreWell Plates matrix (Fig. 2D). Micropellets cultured at 2% O , mean- while, produced 8.2- and 4.0-fold more total sGAGs The feasibility of creating micropellets of BM-MSCs TM than pellets at 20% and 2% O , respectively (Fig. 2C). in the AggreWell plates was evaluated by varying the 5 4 The increase was also reflected in the amount of sGAGs number of cells per well from 2 × 10 to 1 × 10 (results retained with 6.3- and 1.6-fold more sGAGs within the not shown). We found that consistent aggregates could aggregate mass of 2% O micropellets. While 2% O 2 2 be formed under both 20% and 2% O using 2 × 10 micropellets retained less than half the fraction of their cells/well, a common number of MSCs used in conven- total as 2% O pellets (Fig. 2C), the increase in total tional pellet culture. At this density, aggregates formed released was of such a magnitude that the amount within under both oxygen environments within 14 days, albeit the aggregates’ matrices per DNA was not significantly with different morphologies (Fig. 1). Micropellets under different (Fig. 2D). The compact 20% O micropellets 2% O appeared to be more loosely aggregated while 2 were typically found to have very little DNA after 14 those under 20% O formed smaller compacted masses. days and a low amount of sGAGs within the collected Micropellets from both oxygen environments were eas- aggregate mass. We suspected that these micropellets ily collected for analysis at day 14 using only a pipette experienced substantial cell death as there were often to dislodge them from microwells. All subsequent stud- relatively few remaining after 10–14 days. Per DNA, ies therefore used 2 × 10 cells per centrifuge tube or per the amount of sGAGs was statistically equivalent to that well (170 cells/microwell). produced in the conventional 20% O pellet (Fig. 2D). Proteoglycan Production in Normoxic and Hypoxic Matrix Distribution in Hypoxic Micropellets Micropellets and Pellets and Normoxic and Hypoxic Pellets The proteoglycan production of micropellets was compared to that of conventional pellets by quantifying After 14 days the distributions of proteoglycans and the total amount of sGAGs released over the course of collagens in the pellets and 2% O micropellets were chondrogenic induction and the amount retained within visualized using toluidine blue and polarized light im- the aggregates’ matrices. While 20% O pellets displayed aging of picrosirius red, respectively. Due to the small a relatively level profile, the amount released by 2% O size of remaining 20% O micropellets, we did not cryo- 2 2 pellets showed a slightly increasing profile over 14 days section samples for this evaluation. In pellets, staining (Fig. 2A). Micropellets differentiated at 20% O gener- of proteoglycans was heterogeneous with the darkest ally displayed a steady but elevated release profile of staining around the periphery while 2% O micropellets Figure 1. Morphological changes of human BM-MSC micropellets over 14 days of chondrogenic TM induction in AggreWell plates under 20% and 2% O environments. Scale bar: 200 µm. ∆∆ ∆∆ 34 MARKWAY ET AL. Figure 2. Production of sGAGs by human BM-MSC pellets and micropellets differentiated under 20% and 2% O . The release profile of sGAGs over 14 days was determined by the quantity released into the supernatant between medium exchanges for (A) conventional pellet cultures and (B) micropellet cultures. (C) The total amount of sGAGs produced over 14 days and the amount retained within the pellets and micropellets after 14 days. (D) The amount of sGAGs that was retained within the pellets and micropellets normalized to DNA. All values are mean ± SD for n = 10 samples from three independent experiments. Statistical significance was determined by ANOVA with Tukey post hoc tests. *p < 0.05 compared to 20% O pellets; †p < 0.05 compared to 2% O pellets. sGAGs, sulfated glycosaminoglycans. exhibited homogeneous staining (Fig. 3A). Throughout blue staining, collagen II was only detected in areas 2% O micropellets the cells appeared as round, chon- along the periphery (Fig. 4A–C). In contrast, positive drocyte-like cells embedded within lacunae. The distri- immunohistochemical stainings of both collagen I and bution of collagen fibers was similar in the 20% O pel- collagen II were visualized essentially throughout the lets and 2% O pellets, with thicker fibers aligned along matrix of 2% O micropellets, although collagen I was 2 2 the periphery and random thin fibers in the central re- generally more intense in the inner regions. gion (Fig. 3B, C). A random meshwork of fibers with Gene Expression of Normoxic and Hypoxic no regional organization was observed surrounding the Micropellets and Pellets cells in the 2% O micropellets. The collagen matrix sur- rounding the differentiating cells was also assessed by The extent of chondrogenesis was distinguished by visualizing collagen I and collagen II using IF. Collagen quantifying the relative gene expression of collagen II, I was detected throughout pellets differentiated under aggrecan, and SOX9. We also evaluated a variety of both oxygen environments and consistent with toluidine genes more prevalent in MSCs, fibrocartilage, hypertro- LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 35 phic chondrocytes, and osteoblasts: collagen I, versican, consideration the sGAG results, did not continue with collagen X, runt-related transcription factor 2/core-bind- the full panel of genes for 20% O micropellets. ing factor α1 (Runx2/Cbfa1), and osteocalcin. Collagen I was not significantly different between After 14 days of chondrogenic induction, qPCR anal- pellet cultures but increased 4.2-fold in 2% O micropel- ysis revealed no significant difference in SOX9 expres- lets compared to 20% O pellets (Fig. 5C). Comparing sion between 2% O and 20% O pellets (Fig. 5A). SOX9 2% O micropellets to monolayer MSCs using GAPDH 2 2 2 in 2% O micropellets, meanwhile, showed an average revealed a 2.2-fold increase (data not shown), meaning increase of 7.5-fold over 20% O pellets and 3.0-fold that the monolayer MSCs expressed collagen I at an in- over 2% O pellets. Aggrecan was increased 12- and termediate level between pellets and 2% O micropel- 2 2 350-fold in 2% O pellets and 2% O micropellets, re- lets. Versican, on the other hand, was not significantly 2 2 spectively, compared to 20% O pellets (Fig. 5B). Colla- different among the differentiated conditions (Fig. 5B). gen II was increased on average 1,500-fold in 2% O Collagen X followed the trend of collagen II, although pellets and 33,000-fold in 2% O micropellets compared it was highly variable among samples even within the to 20% O pellets (Fig. 5C). We screened 20% O micro- same donor. Still, there was a significant 21-fold in- 2 2 pellet samples for aggrecan and collagen II gene expres- crease in collagen X in 2% O pellets and 1,600-fold in sion and found these to be expressed at similar levels 2% O micropellets compared to 20% O pellets (Fig. 2 2 as in 20% O pellets (data not shown) and taking into 5C). Despite this trend, there was no significant differ- Figure 3. Distribution of proteoglycans and organization of collagen fibers in 20% O pellet, 2% O pellet, and 2% O micropellet 2 2 2 cultures of human BM-MSCs in chondrogenic medium for 14 days. Fixed cryosections were stained with (A) toluidine blue for proteoglycans or (B) picrosirius red for collagen and viewed under normal bright field. (C) Birefringent collagen fibers of the picrosirius red-stained sections were visualized with polarized light microscopy. Inset scale bars: 100 µm. 36 MARKWAY ET AL. Figure 4. Localization of collagen in 20% O pellet, 2% O pellet, and 2% O micropellet cultures of human BM-MSCs maintained 2 2 2 in chondrogenic medium for 14 days. Fixed cryosections were double-stained with (A) anti-collagen I and (B) anti-collagen II antibodies, as described in Materials and Methods, with Hoechst 33342 as a counterstain for nuclei. Positive immunolocalization of collagen appears as red (collagen I) or green (collagen II) in the extracellular matrix, and nuclei are blue. Negative controls where the primary antibodies were omitted (images not shown) were used for background correction. (C) Composite images of (A) and (B) were digitally processed using ImageJ software. The overlapping regions (yellow) indicate colocalization of collagens I and II. Inset scale bars: 1 mm. ence in Runx2/Cbfa1 or osteocalcin gene expression in gin chondrogenesis but must later be switched off for 2% O micropellets compared to 20% O pellets (Fig. differentiation to continue (61). TGF-β3 was recently 2 2 5A, D), although Runx2/Cbfa1 was significantly lower discovered to downregulate Notch gene expression and in 2% O pellets compared to micropellets. protein levels in MSCs, resulting in the SOX9-mediated upregulation of collagen II (26). Thus, TGF-β may be a DISCUSSION key regulator resulting in the transience of Notch In this study, we investigated chondrogenesis of hu- signaling that is critical for chondrogenesis of MSCs. man BM-MSCs in conventional pellet culture com- Given that hypoxia reportedly enhances Notch signaling pared to micropellets and the effects of oxygen tension (27), oxygen tension may also be a crucial factor. We in these different aggregates. The importance of MSC hypothesize that the benefits of low oxygen on in vitro aggregation has been partially explained by the role of MSC chondrogenesis may be abrogated somewhat by Jagged-1-mediated Notch signaling in the chondrogen- the limitations of current chondrogenic protocols. Spe- esis pathway (29). Notch signaling, which is activated cifically, we believe that the mass transport properties by cell–cell contact, must be initiated for MSCs to be- and self-induced oxygen gradient of macroscopic pellet LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 37 culture are substantial obstacles to robust chondrogen- (3 and 500 kDa) had the greatest diffusivity through the esis. surface zone, while midrange dextran (40 and 70 kDa) The most critical known soluble factors for chondro- had lower diffusivity through the surface zone (43). genic differentiation of MSCs range in molecular weight Over the course of differentiation of pellet-cultured from 0.39 (dexamethasone) to 25 kDa (TGF-β). Mass MSCs, it is likely that matrix accumulation results in the transport studies of tissue-engineered cartilage constructs diffusivity approaching that of articular cartilage. There- have shown a relationship between increasing tissue fore, strategies that minimize the mass transport limita- density and decreasing diffusivity, even for molecules tions in MSC chondrogenesis have the potential to maxi- as small as glucose (0.18 kDa) (10,22,42). In pellet cul- mize the efficiency and homogeneity of differentiation. TM ture, the microarchitecture has been observed to resem- The wells of AggreWell plates each consist of approx- ble that of articular cartilage, with collagen fibers imately 1,200 microwells and allow for the creation of aligned parallel to the surface at the surface and perpen- very small diffusional distances in adjacent but physi- dicular to the surface in the deeper layers (6,31,56). In- cally separate microscopic aggregates. Using the as- terestingly, in articular cartilage, Leddy and Guilak dis- sumption that cells form perfect spheres of an equal ini- covered that small and large molecular weight dextrans tial total volume as a single perfect sphere of cells, Figure 5. Fold-change in mRNA levels of common markers for chondrogenesis, hypertrophy, and osteogenesis in human BM- MSC pellets and micropellets differentiated under 2% O compared to conventional 20% O pellets. After 14 days in chondrogenic 2 2 culture the relative gene expression levels of (A) the transcription factors SOX9 and Runx2/Cbfa1, (B) the proteoglycans aggrecan and versican, (C) collagens I, II, and X, and (D) the bone-forming marker osteocalcin were analyzed by real-time quantitative polymerase chain reaction. All values are the mean fold-change relative to 20% O pellets normalized to cyclophilin A for n = 7 samples from three independent experiments. Error bars represent 95% confidence intervals. Statistical significance was determined by ANOVA with Tukey post hoc tests. *p < 0.05 compared to 20% O pellets; †p < 0.05 compared to 2% O pellets. SOX9, (sex 2 2 determining region Y)-box 9; Runx2/Cbfa1, runt-related transcription factor 2/core-binding factor α1. 38 MARKWAY ET AL. TM distributing the cells across the AggreWells would de- proteoglycans and collagen II but showed collagen I crease the radius of aggregates by approximately 11 throughout. Although micropellets were not a perfectly times. This would result in an approximate 11-fold in- uniform size the distribution of proteoglycans and colla- crease in the surface area-to-volume ratio, which would gens appeared homogeneous. The micropellets also dis- substantially enhance mass transport. played random orientation of collagen fibers similar to Over 14 days of chondrogenic induction, BM-MSC the middle to deep zones of normal articular cartilage TM micropellets cultured in AggreWell plates under a 2% (19,56,65). There were no structurally aligned fibers O environment demonstrated substantially increased around the periphery of the micropellets as was seen in chondrogenesis over conventional pellet cultures differ- conventional pellets and as has been observed by others entiated under both 2% and 20% O . While the endpoint (56). Furthermore, while collagen I was variably distrib- for analysis was at 14 days, we monitored development uted in the micropellets, collagen II appeared throughout over the course of chondrogenic induction morphologi- micropellets after only 14 days with TGF-β1. cally and by quantifying the release of sGAGs. The ac- Analysis of cartilage-specific genes using qPCR re- cumulation of sGAGs begins in the early stages of MSC vealed collagen II and aggrecan to be significantly upreg- chondrogenesis (5) and the quantification of these pro- ulated in 2% O pellets but further increased in 2% O 2 2 teoglycan modifications can give an indication of ag- micropellets along with SOX9. Collagen II in 2% O grecan production. Aggrecan is largely responsible for micropellets was elevated 33,000-fold over 20% O pel- providing the compressive stiffness of articular cartilage lets and approximately 785,000-fold more than undiffer- (65) and obtaining cartilaginous tissues in vitro with entiated BM-MSCs (data not shown). In 2% O micro- similar aggrecan composition remains a challenge pellets with 10 ng/ml TGF-β1 we measured even greater (38,56). In accordance with results seen in pellets of nor- increases in collagen II expression at 14 days than has mal ACs (29), our BM-MSC pellets under 2% O re- been reported for normoxic pellet cultures supplemented tained more of their total sGAGs within the cell mass with 100 ng/ml of the more potent TGF-β3 (61). Due to and correspondingly produced more per DNA than the the extremely high level of sGAGs produced in 2% O 20% O pellets. These 2% O pellets were also notice- micropellets compared to pellet cultures, in addition to 2 2 ably larger when viewed with the naked eye, a result aggrecan we also evaluated versican expression, which others have reported for low oxygen-preconditioned and is high in dedifferentiated ACs but low in normal articu- low oxygen-exposed pellet cultures of MSCs and ACs, lar cartilage (4,52). Versican is also expressed in undif- which is likely primarily a product of increased proteo- ferentiated BM-MSCs (75) and an increase in its gene glycan content (29,51,53,86). The release profiles for expression has been described as an early event in pellet 20% O micropellets were generally elevated over pellet culture chondrogenesis (5). In this study, unlike ag- cultures but per DNA within the cell mass, they per- grecan expression which increased on average 350-fold formed no better than conventional 20% O pellets. The in 2% O micropellets compared to 20% O pellets, there 2 2 2 difference in sGAG production over 14 days in 2% O was no significant difference in versican expression micropellets, on the other hand, was striking. These mi- among the different conditions. cropellets swelled in size like their macroscopic counter- The inability to maintain high levels of collagen II parts under 2% O and had a highly linear increase in expression relative to collagen I in primary ACs ex- sGAG release over the entire 14 days. Although 2% O panded in vitro potentially reduces their efficacy in micropellets retained a lower fraction of their total than ACI procedures (4,67). While collagen I is highly ex- 2% O pellets, the total sGAG production was so signifi- pressed in BM-MSCs (75) and extremely low in nor- cantly elevated that the quantity of sGAGs per DNA mal ACs (4,50), its average expression during pellet within the mass was similar. culture chondrogenic induction of BM-MSCs has been We histologically assessed the distributions of pro- observed by some to increase along with collagen II teoglycans as well as collagen in the 20% O pellets, 2% and collagen X over the long term (35,55,63). We O pellets, and 2% O micropellets. In conventional pel- found that collagen I was significantly higher in 2% O 2 2 2 lets collagen II and proteoglycans are typically observed micropellets compared to 20% and 2% O pellet cul- either in the center (5,49,61,82) or at the periphery tures, both of which had decreased levels compared to (5,31,37,55,56,70). Although, due to multiple variables monolayer BM-MSCs. However, we think that with between these studies, it is difficult to discern the rea- continued induction beyond 14 days the pellets would soning for the different patterns observed, the fluctuat- continue to increase their average collagen II and colla- ing mass transport properties of the differentiating pellet gen X expression as well as their average collagen I may play a role. In larger pellets, central necrosis has expression. even been observed (17). In this study, both 20% and Perhaps the principal challenge of using BM-MSCs 2% O pellets displayed mostly peripheral staining of for cartilage repair will be the ability to obtain a stable 2 LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 39 chondrogenic phenotype. In this study, we evaluated sulfate (9) and parathyroid hormone-related protein the hypertrophic and osteogenic markers collagen X, (33,37), however, will likely be the most commonly in- Runx2/Cbfa1, and osteocalcin. Changes in collagen X vestigated solutions and, as shown here, a micropellet expression among conditions mirrored the changes seen system may maximize the efficiency of such strategies. with collagen II, as has been reported previously with Additionally, we have developed a membrane bioreactor conventional pellets (5,56,59,63,71,86). This could be a that is able to aid conventional pellet cultures in retain- significant obstacle with BM-MSCs, as Pelttari et al. ing sGAGs within their matrices (15) and believe micro- showed that ectopic implantation of in vitro differenti- pellet cultures will be easily integrated with such tech- ated BM-MSC pellets in SCID mice led to calcification nology. With a view towards future tissue engineering, and vascular invasion at the implant site, whereas no we believe the benefits of performing MSC chondrogen- such problems were observed with chondrocyte-derived esis in this way is to date unparalleled. Homogeneous pellets (63). However, we believe that our improved differentiation of the cell population can be achieved methodology will allow for better control when investi- more rapidly and the physical nature of the chondro- gating methods to reduce collagen X expression and, genic micropellets should make them easy to integrate likewise, collagen I expression. with a variety of stem cell-based cartilage and meniscal Collagen X expression in hypertrophic chondrocytes repair technologies such as intra-articular injections is regulated by Runx2/Cbfa1 (18,30,84), a critical tran- (45,57), hydrogels (60), and scaffolds (2,80). scription factor for osteoblast differentiation and bone ACKNOWLEDGMENTS: This work is supported by The Uni- formation (16,39,62) and an important regulator of hu- versity of Queensland Early Career Researcher Grant Scheme and in part by the Australian Research Council Discovery man BM-MSC osteogenic differentiation (1,28,48,73). Grants Scheme. The Whitaker Foundation provided support Despite greatly increased levels of collagen X, there was for B.D.M. with a Whitaker International Fellows Award no significant difference in Runx2/Cbfa1 gene expres- (2008-09). The authors thank Paul Addison for technical sup- sion compared to 20% O pellets. However, while in- 2 port with histology, Professor Julie Campbell for supporting this project with shared equipment and lab space, and the Aus- creased Runx2/Cbfa1 activity is critical for osteogenesis tralian Stem Cell Centre for generously allowing access to of human BM-MSCs, its mRNA expression may not analysis equipment. B.D.M. also thanks his Ph.D. advisor, Dr. change even during osteogenic differentiaton (73). We Monica Hinds of Oregon Health & Science University, for her therefore examined expression of another Runx2/Cbfa1 selfless support of his fellowship. target, osteocalcin, as it is regulated during osteogenesis REFERENCES and has been indicated as a hypertrophic marker in 1. Ahlstrom, M.; Pekkinen, M.; Lamberg-Allardt, C. Dexa- chondrocytes and in human BM-MSC pellet cultures methasone downregulates the expression of parathyroid (3,23,46,55,74). Despite the apparent advanced stage of hormone-related protein (PTHrP) in mesenchymal stem the 2% O micropellets, there was no significant differ- cells. Steroids 74(2):277–282; 2009. ence in osteocalcin expression among conditions. While 2. Angele, P.; Johnstone, B.; Kujat, R.; Zellner, J.; Nerlich, 14 days may be too early to see such changes even in M.; Goldberg, V.; Yoo, J. Stem cell based tissue engineer- ing for meniscus repair. J. Biomed. Mater. Res. A 85(2): the micropellets, in addition to observing reduced os- 445–455; 2008. teogenesis of BM-MSCs under prolonged low oxygen 3. Banerjee, C.; McCabe, L. R.; Choi, J. Y.; Hiebert, S. W.; tension (20), others have noted that even temporary hyp- Stein, J. L.; Stein, G. S.; Lian, J. B. Runt homology do- oxic exposure inhibits BM-MSC osteogenic differentia- main proteins in osteoblast differentiation: AML3/CBFA1 tion (66). Consequently, we believe that with further op- is a major component of a bone-specific complex. J. Cell. Biochem. 66(1):1–8; 1997. timization micropellets under low oxygen tension may 4. Barlic, A.; Drobnic, M.; Malicev, E.; Kregar-Velikonja, offer a means to reach a stable chondrogenic phenotype. N. Quantitative analysis of gene expression in human ar- Here we showed the benefit of low oxygen tension ticular chondrocytes assigned for autologous implantation. during chondrogenic induction of human BM-MSC us- J. Orthop. Res. 26(6):847–853; 2008. ing both conventional pellet culture and a new micropel- 5. Barry, F.; Boynton, R. E.; Liu, B.; Murphy, J. M. Chon- drogenic differentiation of mesenchymal stem cells from let culture. The benefits of low oxygen tension appear bone marrow: Differentiation-dependent gene expression to be maximized by creating very small aggregates that of matrix components. Exp. Cell Res. 268(2):189–200; limit mass transport and oxygen diffusion gradients. While the undesired collagen X was greatly upregulated 6. Below, S.; Arnoczky, S. P.; Dodds, J.; Kooima, C.; Walter, in 2% O micropellets, this problem persists in conven- N. The split-line pattern of the distal femur: A consider- ation in the orientation of autologous cartilage grafts. Ar- tional BM-MSC pellet culture as well. A plasma poly- throscopy 18(6):613–617; 2002. mer coating has recently been reported to decrease colla- 7. Benohr, P.; Harsch, S.; Proksch, B.; Gleiter, C. H. Does gen X (58) and such modifications would be easily angiotensin II modulate erythropoietin production in applicable to microfabricated surfaces such as the inserts HepG2 cells? Nephron Exp. Nephrol. 98(4):e124–131; TM of AggreWells . Soluble factors such as chondroitin 2004. 40 MARKWAY ET AL. 8. Brooke, G.; Tong, H.; Levesque, J. P.; Atkinson, K. Mo- of the complex functions of the hypertrophic chondrocyte lecular trafficking mechanisms of multipotent mesenchy- during endochondral bone development. J. Cell. Biochem. mal stem cells derived from human bone marrow and pla- 62(1):1–9; 1996. centa. Stem Cells Dev. 17(5):929–940; 2008. 24. Grayson, W. L.; Zhao, F.; Bunnell, B.; Ma, T. Hypoxia 9. Brown, C. C.; Balian, G. Effect of heparin on synthesis of enhances proliferation and tissue formation of human short chain collagen by chondrocytes and smooth muscle mesenchymal stem cells. Biochem. Biophys. Res. Com- cells. J. Cell Biol. 105(2):1007–1012; 1987. mun. 358(3):948–953; 2007. 10. Bursac, P. M.; Freed, L. E.; Biron, R. J.; Vunjak-Nova- 25. Grayson, W. L.; Zhao, F.; Izadpanah, R.; Bunnell, B.; Ma, kovic, G. Mass transfer studies of tissue engineered carti- T. Effects of hypoxia on human mesenchymal stem cell lage. Tissue Eng. 2(2):141–150; 1996. expansion and plasticity in 3D constructs. J. Cell. Physiol. 11. Cournil-Henrionnet, C.; Huselstein, C.; Wang, Y.; Galois, 207(2):331–339; 2006. L.; Mainard, D.; Decot, V.; Netter, P.; Stoltz, J. F.; Muller, 26. Grogan, S. P.; Olee, T.; Hiraoka, K.; Lotz, M. K. Repres- S.; Gillet, P.; Watrin-Pinzano, A. Phenotypic analysis of sion of chondrogenesis through binding of notch signaling cell surface markers and gene expression of human mes- proteins HES-1 and HEY-1 to N-box domains in the enchymal stem cells and chondrocytes during monolayer COL2A1 enhancer site. Arthritis Rheum. 58(9):2754– expansion. Biorheology 45(3–4):513–526; 2008. 2763; 2008. 12. Dayan, D.; Hiss, Y.; Hirshberg, A.; Bubis, J. J.; Wolman, 27. Gustafsson, M. V.; Zheng, X.; Pereira, T.; Gradin, K.; Jin, M. Are the polarization colors of picrosirius red-stained S.; Lundkvist, J.; Ruas, J. L.; Poellinger, L.; Lendahl, U.; collagen determined only by the diameter of the fibers? Bondesson, M. Hypoxia requires notch signaling to main- Histochemistry 93(1):27–29; 1989. tain the undifferentiated cell state. Dev. Cell 9(5):617– 13. Dell’Accio, F.; De Bari, C.; Luyten, F. P. Molecular 628; 2005. markers predictive of the capacity of expanded human ar- 28. Hamidouche, Z.; Hay, E.; Vaudin, P.; Charbord, P.; ticular chondrocytes to form stable cartilage in vivo. Ar- Schule, R.; Marie, P. J.; Fromigue, O. FHL2 mediates thritis Rheum. 44(7):1608–1619; 2001. dexamethasone-induced mesenchymal cell differentiation 14. D’Ippolito, G.; Diabira, S.; Howard, G. A.; Roos, B. A.; into osteoblasts by activating Wnt/beta-catenin signaling- Schiller, P. C. Low oxygen tension inhibits osteogenic dif- dependent Runx2 expression. FASEB J. 22(11):3813– ferentiation and enhances stemness of human MIAMI 3822; 2008. cells. Bone 39(3):513–522; 2006. 29. Hardingham, T. E.; Oldershaw, R. A.; Tew, S. R. Carti- 15. Doran, M. R.; Markway, B. D.; Clark, A.; Athanasas-Plat- lage, SOX9 and Notch signals in chondrogenesis. J. Anat. sis, S.; Brooke, G.; Atkinson, K.; Nielsen, L. K.; Cooper- 209(4):469–480; 2006. White, J. J. Membrane bioreactors enhance microenviron- 30. Higashikawa, A.; Saito, T.; Ikeda, T.; Kamekura, S.; mental conditioning and tissue development. Tissue Eng. Kawamura, N.; Kan, A.; Oshima, Y.; Ohba, S.; Ogata, N.; Part C Methods; 2009. Takeshita, K.; Nakamura, K.; Chung, U. I.; Kawaguchi, 16. Ducy, P.; Zhang, R.; Geoffroy, V.; Ridall, A. L.; Karsenty, H. Identification of the core element responsive to runt- G. Osf2/Cbfa1: A transcriptional activator of osteoblast related transcription factor 2 in the promoter of human differentiation. Cell 89(5):747–754; 1997. type X collagen gene. Arthritis Rheum. 60(1):166–178; 17. Ebisawa, K.; Hata, K.; Okada, K.; Kimata, K.; Ueda, M.; 2009. Torii, S.; Watanabe, H. Ultrasound enhances transforming 31. Hui, T. Y.; Cheung, K. M.; Cheung, W. L.; Chan, D.; growth factor beta-mediated chondrocyte differentiation Chan, B. P. In vitro chondrogenic differentiation of human of human mesenchymal stem cells. Tissue Eng. 10(5–6): mesenchymal stem cells in collagen microspheres: Influ- 921–929; 2004. ence of cell seeding density and collagen concentration. 18. Enomoto, H.; Enomoto-Iwamoto, M.; Iwamoto, M.; Biomaterials 29(22):3201–3212; 2008. Nomura, S.; Himeno, M.; Kitamura, Y.; Kishimoto, T.; 32. Johnstone, B.; Hering, T. M.; Caplan, A. I.; Goldberg, Komori, T. Cbfa1 is a positive regulatory factor in chon- V. M.; Yoo, J. U. In vitro chondrogenesis of bone mar- drocyte maturation. J. Biol. Chem. 275(12):8695–8702; row-derived mesenchymal progenitor cells. Exp. Cell Res. 2000. 238(1):265–272; 1998. 19. Eyre, D. Collagen of articular cartilage. Arthritis Res. 33. Kafienah, W.; Mistry, S.; Dickinson, S. C.; Sims, T. J.; 4(1):30–35; 2002. Learmonth, I.; Hollander, A. P. Three-dimensional 20. Fehrer, C.; Brunauer, R.; Laschober, G.; Unterluggauer, cartilage tissue engineering using adult stem cells from H.; Reitinger, S.; Kloss, F.; Gully, C.; Gassner, R.; osteoarthritis patients. Arthritis Rheum. 56(1):177–187; Lepperdinger, G. Reduced oxygen tension attenuates dif- 2007. ferentiation capacity of human mesenchymal stem cells 34. Kanichai, M.; Ferguson, D.; Prendergast, P. J.; Campbell, and prolongs their lifespan. Aging Cell 6(6):745–757; V. A. Hypoxia promotes chondrogenesis in rat mesenchy- 2007. mal stem cells: A role for AKT and hypoxia-inducible fac- 21. Fink, T.; Lund, P.; Pilgaard, L.; Rasmussen, J. G.; tor (HIF)-1alpha. J. Cell. Physiol. 216(3):708–715; 2008. Duroux, M.; Zachar, V. Instability of standard PCR refer- 35. Karlsson, C.; Brantsing, C.; Svensson, T.; Brisby, H.; Asp, ence genes in adipose-derived stem cells during propaga- J.; Tallheden, T.; Lindahl, A. Differentiation of human tion, differentiation and hypoxic exposure. BMC Mol. mesenchymal stem cells and articular chondrocytes: Anal- Biol. 9:98; 2008. ysis of chondrogenic potential and expression pattern of 22. Freed, L. E.; Marquis, J. C.; Langer, R.; Vunjak-Nova- differentiation-related transcription factors. J. Orthop. Res. kovic, G. Kinetics of chondrocyte growth in cell-polymer 25(2):152–163; 2007. implants. Biotechnol. Bioeng. 43(7):597–604; 1994. 36. Khan, W. S.; Adesida, A. B.; Hardingham, T. E. Hypoxic 23. Gerstenfeld, L. C.; Shapiro, F. D. Expression of bone- conditions increase hypoxia-inducible transcription factor specific genes by hypertrophic chondrocytes: implication 2alpha and enhance chondrogenesis in stem cells from the LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 41 infrapatellar fat pad of osteoarthritis patients. Arthritis 51. Martin-Rendon, E.; Hale, S. J.; Ryan, D.; Baban, D.; Res. Ther. 9(3):R55; 2007. Forde, S. P.; Roubelakis, M.; Sweeney, D.; Moukayed, 37. Kim, Y. J.; Kim, H. J.; Im, G. I. PTHrP promotes chon- M.; Harris, A. L.; Davies, K.; Watt, S. M. Transcriptional drogenesis and suppresses hypertrophy from both bone profiling of human cord blood CD133+ and cultured bone marrow-derived and adipose tissue-derived MSCs. Bio- marrow mesenchymal stem cells in response to hypoxia. chem. Biophys. Res. Commun. 373(1):104–108; 2008. Stem Cells 25(4):1003–1012; 2007. 38. Kobayashi, S.; Meir, A.; Urban, J. Effect of cell density 52. Martin, I.; Jakob, M.; Schafer, D.; Dick, W.; Spagnoli, G.; on the rate of glycosaminoglycan accumulation by disc Heberer, M. Quantitative analysis of gene expression in and cartilage cells in vitro. J. Orthop. Res. 26(4):493–503; human articular cartilage from normal and osteoarthritic 2008. joints. Osteoarthritis Cartilage 9(2):112–118; 2001. 39. Komori, T.; Yagi, H.; Nomura, S.; Yamaguchi, A.; Sasaki, 53. Martinez, I.; Elvenes, J.; Olsen, R.; Bertheussen, K.; K.; Deguchi, K.; Shimizu, Y.; Bronson, R. T.; Gao, Y. H.; Johansen, O. Redifferentiation of in vitro expanded adult Inada, M.; Sato, M.; Okamoto, R.; Kitamura, Y.; Yoshiki, articular chondrocytes by combining the hanging-drop S.; Kishimoto, T. Targeted disruption of Cbfa1 results in cultivation method with hypoxic environment. Cell Trans- a complete lack of bone formation owing to maturational plant. 17(8):987–996; 2008. arrest of osteoblasts. Cell 89(5):755–764; 1997. 54. Moussavi-Harami, F.; Duwayri, Y.; Martin, J. A.; Mous- 40. Lafont, J. E.; Talma, S.; Hopfgarten, C.; Murphy, C. L. savi-Harami, F.; Buckwalter, J. A. Oxygen effects on se- Hypoxia promotes the differentiated human articular nescence in chondrocytes and mesenchymal stem cells: chondrocyte phenotype through SOX9-dependent and Consequences for tissue engineering. Iowa Orthop. J. 24: -independent pathways. J. Biol. Chem. 283(8):4778– 15–20; 2004. 4786; 2008. 55. Mueller, M. B.; Tuan, R. S. Functional characterization 41. Lafont, J. E.; Talma, S.; Murphy, C. L. Hypoxia-inducible of hypertrophy in chondrogenesis of human mesenchymal factor 2alpha is essential for hypoxic induction of the hu- stem cells. Arthritis Rheum. 58(5):1377–1388; 2008. man articular chondrocyte phenotype. Arthritis Rheum. 56. Murdoch, A. D.; Grady, L. M.; Ablett, M. P.; Katopodi, 56(10):3297–3306; 2007. T.; Meadows, R. S.; Hardingham, T. E. Chondrogenic dif- 42. Leddy, H. A.; Awad, H. A.; Guilak, F. Molecular diffu- ferentiation of human bone marrow stem cells in transwell sion in tissue-engineered cartilage constructs: Effects of cultures: Generation of scaffold-free cartilage. Stem Cells scaffold material, time, and culture conditions. J. Biomed. 25(11):2786–2796; 2007. Mater. Res. B Appl. Biomater. 70(2):397–406; 2004. 57. Murphy, J. M.; Fink, D. J.; Hunziker, E. B.; Barry, 43. Leddy, H. A.; Guilak, F. Site-specific molecular diffusion F. P. Stem cell therapy in a caprine model of osteoarthri- in articular cartilage measured using fluorescence recov- tis. Arthritis Rheum. 48(12):3464–3474; 2003. ery after photobleaching. Ann. Biomed. Eng. 31(7):753– 58. Mwale, F.; Girard-Lauriault, P. L.; Wang, H. T.; Lerouge, 760; 2003. S.; Antoniou, J.; Wertheimer, M. R. Suppression of genes 44. Lee, C. R.; Grodzinsky, A. J.; Hsu, H. P.; Martin, S. D.; related to hypertrophy and osteogenesis in committed hu- Spector, M. Effects of harvest and selected cartilage repair man mesenchymal stem cells cultured on novel nitrogen- procedures on the physical and biochemical properties of rich plasma polymer coatings. Tissue Eng. 12(9):2639– articular cartilage in the canine knee. J. Orthop. Res. 2647; 2006. 18(5):790–799; 2000. 59. Mwale, F.; Stachura, D.; Roughley, P.; Antoniou, J. Limi- 45. Lee, K. B.; Hui, J. H.; Song, I. C.; Ardany, L.; Lee, E. H. tations of using aggrecan and type X collagen as markers Injectable mesenchymal stem cell therapy for large carti- of chondrogenesis in mesenchymal stem cell differentia- lage defects—a porcine model. Stem Cells 25(11):2964– tion. J. Orthop. Res. 24(8):1791–1798; 2006. 2971; 2007. 60. Noth, U.; Rackwitz, L.; Heymer, A.; Weber, M.; 46. Lian, J. B.; McKee, M. D.; Todd, A. M.; Gerstenfeld, Baumann, B.; Steinert, A.; Schutze, N.; Jakob, F.; Eulert, L. C. Induction of bone-related proteins, osteocalcin and J. Chondrogenic differentiation of human mesenchymal osteopontin, and their matrix ultrastructural localization stem cells in collagen type I hydrogels. J. Biomed. Mater. with development of chondrocyte hypertrophy in vitro. J. Res. A 83(3):626–635; 2007. Cell. Biochem. 52(2):206–219; 1993. 61. Oldershaw, R. A.; Tew, S. R.; Russell, A. M.; Meade, K.; 47. Liebman, J.; Goldberg, R. L. Unit 12.2 chondrocyte cul- Hawkins, R.; McKay, T. R.; Brennan, K. R.; Hardingham, ture and assay. Curr. Protoc. Pharmacol. 12(Suppl.):S1– T. E. Notch signaling through Jagged-1 is necessary to 18; 2001. initiate chondrogenesis in human bone marrow stromal 48. Liu, F.; Akiyama, Y.; Tai, S.; Maruyama, K.; Kawaguchi, cells but must be switched off to complete chondrogen- Y.; Muramatsu, K.; Yamaguchi, K. Changes in the expres- esis. Stem Cells 26(3):666–674; 2008. sion of CD106, osteogenic genes, and transcription factors 62. Otto, F.; Thornell, A. P.; Crompton, T.; Denzel, A.; involved in the osteogenic differentiation of human bone Gilmour, K. C.; Rosewell, I. R.; Stamp, G. W.; Bedding- marrow mesenchymal stem cells. J. Bone Miner. Metab. ton, R. S.; Mundlos, S.; Olsen, B. R.; Selby, P. B.; Owen, 26(4):312–320; 2008. M. J. Cbfa1, a candidate gene for cleidocranial dysplasia 49. Mackay, A. M.; Beck, S. C.; Murphy, J. M.; Barry, F. P.; syndrome, is essential for osteoblast differentiation and Chichester, C. O.; Pittenger, M. F. Chondrogenic differen- bone development. Cell 89(5):765–771; 1997. tiation of cultured human mesenchymal stem cells from 63. Pelttari, K.; Winter, A.; Steck, E.; Goetzke, K.; Hennig, marrow. Tissue Eng. 4(4):415–428; 1998. T.; Ochs, B. G.; Aigner, T.; Richter, W. Premature induc- 50. Marlovits, S.; Hombauer, M.; Tamandl, D.; Vecsei, V.; tion of hypertrophy during in vitro chondrogenesis of hu- Schlegel, W. Quantitative analysis of gene expression in man mesenchymal stem cells correlates with calcification human articular chondrocytes in monolayer culture. Int. J. and vascular invasion after ectopic transplantation in Mol. Med. 13(2):281–287; 2004. SCID mice. Arthritis Rheum. 54(10):3254–3266; 2006. 42 MARKWAY ET AL. 64. Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; Jaiswal, 75. Silva, Jr., W. A.; Covas, D. T.; Panepucci, R. A.; Proto- R. K.; Douglas, R.; Mosca, J. D.; Moorman, M. A.; Simo- Siqueira, R.; Siufi, J. L.; Zanette, D. L.; Santos, A. R.; netti, D. W.; Craig, S.; Marshak, D. R. Multilineage po- Zago, M. A. The profile of gene expression of human tential of adult human mesenchymal stem cells. Science marrow mesenchymal stem cells. Stem Cells 21(6):661– 284(5411):143–147; 1999. 669; 2003. 65. Poole, A. R.; Kojima, T.; Yasuda, T.; Mwale, F.; Kobay- 76. Stewart, M. C.; Saunders, K. M.; Burton-Wurster, N.; ashi, M.; Laverty, S. Composition and structure of articu- Macleod, J. N. Phenotypic stability of articular chondro- lar cartilage: A template for tissue repair. Clin. Orthop. cytes in vitro: The effects of culture models, bone mor- Relat. Res. 391(Suppl.):S26–33; 2001. phogenetic protein 2, and serum supplementation. J. Bone 66. Potier, E.; Ferreira, E.; Andriamanalijaona, R.; Pujol, J. P.; Miner. Res. 15(1):166–174; 2000. Oudina, K.; Logeart-Avramoglou, D.; Petite, H. Hypoxia 77. Thijssen, V. L.; Brandwijk, R. J.; Dings, R. P.; Griffioen, affects mesenchymal stromal cell osteogenic differentia- A. W. Angiogenesis gene expression profiling in xeno- tion and angiogenic factor expression. Bone 40(4):1078– graft models to study cellular interactions. Exp. Cell Res. 1087; 2007. 299(2):286–293; 2004. 67. Roberts, S.; Menage, J.; Sandell, L. J.; Evans, E. H.; Rich- 78. Ungrin, M. D.; Joshi, C.; Nica, A.; Bauwens, C.; Zandstra, ardson, J. B. Immunohistochemical study of collagen P. W. Reproducible, ultra high-throughput formation of types I and II and procollagen IIA in human cartilage re- multicellular organization from single cell suspension- pair tissue following autologous chondrocyte implanta- derived human embryonic stem cell aggregates. PLoS tion. Knee 16(5):398–404; 2009. ONE 3(2):e1565; 2008. 68. Robins, J. C.; Akeno, N.; Mukherjee, A.; Dalal, R. R.; 79. Wang, D. W.; Fermor, B.; Gimble, J. M.; Awad, H. A.; Aronow, B. J.; Koopman, P.; Clemens, T. L. Hypoxia in- Guilak, F. Influence of oxygen on the proliferation and duces chondrocyte-specific gene expression in mesenchy- metabolism of adipose derived adult stem cells. J. Cell. mal cells in association with transcriptional activation of Physiol. 204(1):184–191; 2005. Sox9. Bone 37(3):313–322; 2005. 80. Wei, Y.; Hu, H.; Wang, H.; Wu, Y.; Deng, L.; Qi, J. Carti- 69. Scherer, K.; Schunke, M.; Sellckau, R.; Hassenpflug, J.; lage regeneration of adipose-derived stem cells in a hybrid Kurz, B. The influence of oxygen and hydrostatic pressure scaffold from fibrin-modified PLGA. Cell Transplant. on articular chondrocytes and adherent bone marrow cells 18(2):159–170; 2009. in vitro. Biorheology 41(3–4):323–333; 2004. 81. Xu, J.; Wang, W.; Ludeman, M.; Cheng, K.; Hayami, T.; 70. Schmitt, B.; Ringe, J.; Haupl, T.; Notter, M.; Manz, R.; Lotz, J. C.; Kapila, S. Chondrogenic differentiation of hu- Burmester, G. R.; Sittinger, M.; Kaps, C. BMP2 initiates man mesenchymal stem cells in three-dimensional algi- chondrogenic lineage development of adult human mesen- nate gels. Tissue Eng. Part A 14(5):667–680; 2008. chymal stem cells in high-density culture. Differentiation 82. Yoo, J. U.; Barthel, T. S.; Nishimura, K.; Solchaga, L.; 71(9–10):567–577; 2003. Caplan, A. I.; Goldberg, V. M.; Johnstone, B. The chon- 71. Sekiya, I.; Vuoristo, J. T.; Larson, B. L.; Prockop, D. J. drogenic potential of human bone-marrow-derived mesen- In vitro cartilage formation by human adult stem cells chymal progenitor cells. J. Bone Joint Surg. Am. 80(12): from bone marrow stroma defines the sequence of cellular 1745–1757; 1998. and molecular events during chondrogenesis. Proc. Natl. 83. Yuan, J. S.; Reed, A.; Chen, F.; Stewart, Jr., C. N. Statisti- Acad. Sci. USA 99(7):4397–4402; 2002. cal analysis of real-time PCR data. BMC Bioinformatics 72. Selvamurugan, N.; Kwok, S.; Partridge, N. C. Smad3 in- 7:85; 2006. teracts with JunB and Cbfa1/Runx2 for transforming 84. Zheng, Q.; Zhou, G.; Morello, R.; Chen, Y.; Garcia-Rojas, growth factor-beta1-stimulated collagenase-3 expression X.; Lee, B. Type X collagen gene regulation by Runx2 in human breast cancer cells. J. Biol. Chem. 279(26): contributes directly to its hypertrophic chondrocyte-specific 27764–27773; 2004. expression in vivo. J. Cell Biol. 162(5):833–842; 2003. 73. Shui, C.; Spelsberg, T. C.; Riggs, B. L.; Khosla, S. 85. Zhong, H.; Simons, J. W. Direct comparison of GAPDH, Changes in Runx2/Cbfa1 expression and activity during beta-actin, cyclophilin, and 28S rRNA as internal stan- osteoblastic differentiation of human bone marrow stromal dards for quantifying RNA levels under hypoxia. Bio- cells. J. Bone Miner. Res. 18(2):213–221; 2003. chem. Biophys. Res. Commun. 259(3):523–526; 1999. 74. Sierra, J.; Villagra, A.; Paredes, R.; Cruzat, F.; Gutierrez, 86. Zscharnack, M.; Poesel, C.; Galle, J.; Bader, A. Low oxy- S.; Javed, A.; Arriagada, G.; Olate, J.; Imschenetzky, M.; gen expansion improves subsequent chondrogenesis of Van Wijnen, A. J.; Lian, J. B.; Stein, G. S.; Stein, J. L.; ovine bone-marrow-derived mesenchymal stem cells in Montecino, M. Regulation of the bone-specific osteocalcin collagen type I hydrogel. Cells Tissues Organs 190(2):81– gene by p300 requires Runx2/Cbfa1 and the vitamin D3 93; 2009. receptor but not p300 intrinsic histone acetyltransferase activity. Mol. Cell. Biol. 23(9):3339–3351; 2003. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Transplantation SAGE

Enhanced Chondrogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells in Low Oxygen Environment Micropellet Cultures

Download PDF
14 pages

Loading next page...
 
/lp/sage/enhanced-chondrogenic-differentiation-of-human-bone-marrow-derived-dN5gx8UEHY

References (99)

Publisher
SAGE
Copyright
© 2010 Cognizant Comm. Corp.
ISSN
0963-6897
eISSN
1555-3892
DOI
10.3727/096368909x478560
Publisher site
See Article on Publisher Site

Abstract

Cell Transplantation, Vol. 19, pp. 29–42, 2010 0963-6897/10 $90.00 + .00 Printed in the USA. All rights reserved. DOI: 10.3727/096368909X478560 Copyright  2010 Cognizant Comm. Corp. E-ISSN 1555-3892 www.cognizantcommunication.com Enhanced Chondrogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells in Low Oxygen Environment Micropellet Cultures Brandon D. Markway,* Guak-Kim Tan,* Gary Brooke,† James E. Hudson,* Justin J. Cooper-White,* and Michael R. Doran* *Tissue Engineering & Microfluidics Laboratory, Australian Institute for Bioengineering & Nanotechnology, The University of Queensland, Brisbane, Australia †Adult Stem Cell Team, Mater Medical Research Institute, Brisbane, Australia Chondrogenesis of mesenchymal stem cells (MSCs) is typically induced when they are condensed into a single aggregate and exposed to transforming growth factor-β (TGF-β). Hypoxia, like aggregation and TGF- β delivery, may be crucial for complete chondrogenesis. However, the pellet dimensions and associated self- induced oxygen gradients of current chondrogenic methods may limit the effectiveness of in vitro differentia- tion and subsequent therapeutic uses. Here we describe the use of embryoid body-forming technology to produce microscopic aggregates of human bone marrow MSCs (BM-MSCs) for chondrogenesis. The use of micropellets reduces the formation of gradients within the aggregates, resulting in a more homogeneous and controlled microenvironment. These micropellet cultures (170 cells/micropellet) as well as conventional pellet cultures (2 × 10 cells/pellet) were chondrogenically induced under 20% and 2% oxygen environ- ments for 14 days. Compared to conventional pellets under both environments, micropellets differentiated under 2% O showed significantly increased sulfated glycosaminoglycan (sGAG) production and more ho- mogeneous distribution of proteoglycans and collagen II. Aggrecan and collagen II gene expressions were increased in pellet cultures differentiated under 2% O relative to 20% O pellets but 2% O micropellets 2 2 2 showed even greater increases in these genes, as well as increased SOX9. These results suggest a more advanced stage of chondrogenesis in the micropellets accompanied by more homogeneous differentiation. Thus, we present a new method for enhancing MSC chondrogenesis that reveals a unique relationship be- tween oxygen tension and aggregate size. The inherent advantages of chondrogenic micropellets over a single macroscopic aggregate should allow for easy integration with a variety of cartilage engineering strate- gies. Key words: Cartilage regeneration; Bone marrow; Mesenchymal stem cells; Chondrogenesis; Extracellular matrix; Hypoxia INTRODUCTION may be an alternative autologous source for such appli- cations due to their multipotency and relative ease of iso- Articular cartilage has poor regenerative capacity fol- lation and expansion (64). The use of MSCs in cartilage lowing injury and degradation, due in part to its avascu- repair, however, will be dependent on the development lar nature. For some patients, autologous chondrocyte of efficient and controlled chondrogenesis methods. implantation (ACI) is a viable cartilage repair strategy; In vitro chondrogenesis of bone marrow-derived MSCs however, this procedure requires the isolation of chon- (BM-MSCs) in the presence of transforming growth fac- drocytes via a preliminary surgery, which itself may re- tor-β1 (TGF-β1) was first described using high-density sult in further cartilage degeneration (44). Additionally, pellet cultures (32,49,82). Aggregate formation along the expansion of articular chondrocytes (ACs) can result with members of the TGF-β superfamily (49,70) may be in dedifferentiation and loss of the mechanical and phe- essential for complete in vitro chondrogenesis of MSCs. notypic properties that make the cells ideal in the first While conventional pellet culture is an effective tool for place (11,13,76). Adult mesenchymal stem cells (MSCs) studying this process, it is not without its limitations. Received July 2, 2009; final acceptance October 12, 2009. Online prepub date: October 29, 2009. Address correspondence to Dr. Michael R. Doran, Tissue Engineering & Microfluidics Laboratory, Australian Institute for Bioengineering & Nanotechnology, Building 75, The University of Queensland, QLD 4072Australia. Tel: +61 7 3346 3868; Fax: +61 7 3346 3973; E-mail: michael. [email protected] 29 30 MARKWAY ET AL. Typical histological analyses of these macroscopic pel- stantial increases in the changes characteristic of chon- lets reveal heterogeneous staining of the chondrogenic- drogenic differentiation compared to conventional pellet specific matrix (5,31,37,49,55,56,61,70,82). This is pos- cultures in both environments. Specifically, we show that sibly due to fluctuating mass transport properties of the chondrogenic induction of BM-MSC micropellets formed TM increasingly dense pellet. Minimizing transport limita- in AggreWell plates under low oxygen tension results tions may improve homogeneity of differentiation, an in considerably increased sulfated glycosaminoglycan essential outcome for downstream therapeutic applica- (sGAG) production, uniform distribution of matrix com- tions. ponents, and enhanced expression of genes associated Another critical factor in chondrogenic differentia- with BM-MSC chondrogenesis. Thus, we have devel- tion, and possibly in BM-MSC maintenance in general, oped a new method for enhanced chondrogenic differen- is oxygen tension. The physiological environments of tiation of BM-MSCs that possesses properties ideal for both articular cartilage and bone marrow are reported to incorporation with current platforms for cartilage repair. exist within a range of 1–7% O (14,36). In human ACs, MATERIALS AND METHODS expression of the essential transcription factor for chon- Human Bone Marrow-Derived Mesenchymal Stem drogenesis, (sex determining region Y)-box 9 (SOX9), Cell Isolation and Culture is upregulated by hypoxia, resulting in increased expres- sion of collagen II and aggrecan, the major structural Full informed patient consent was obtained in all components of articular cartilage (41). Additionally, hy- cases and ethical approval granted through the Mater poxia promotes the chondrocyte phenotype through Health Services Human Research Ethics Committee in SOX9-independent gene regulation (40). In recent years, accordance with the Australian National Health and a number of studies have shown the benefits of low oxy- Medical Research Council’s Statement on Ethical Con- gen tension with regards to BM-MSC culture and differ- duct in Research Involving Humans. Approximately 10 entiation. Culture under a low oxygen environment has ml bone marrow was taken from iliac crest of healthy been shown to increase the expansion potential of BM- donors. The sample was diluted 1:1 with phosphate- MSCs (20,24,25,54,86). Furthermore, posthypoxia ex- buffered saline (PBS) and underlayed with 12 ml Ficoll- posure differentiation studies have shown these cells to Paque Plus (GE Healthcare, Little Chalfont, Bucking- maintain multilineage differentiation capacity with en- hamshire, UK). Tubes were spun at 535 × g for 20 min. hanced chondrogenic potential (51,86). The few studies Interface cells were washed and resuspended in low- utilizing low oxygen during chondrogenic differentiation glucose Dulbecco’s modified Eagle’s medium (DMEM- also indicate improved outcomes. Human adipose-derived LG; Gibco Life Technologies, Grand Island, NY) sup- MSCs in both alginate gels and aggregate culture under plemented with 20% fetal bovine serum (FBS; Gibco) hypoxic environments showed increased chondrogenesis and 50 µg/ml gentamicin (Amersham Pharmacia Bio- (36,79). Likewise, low oxygen tension enhanced chon- tech, Uppsala, Sweden) and placed in tissue culture drogenic differentiation of high-density cultures of bo- flasks. After 48 h, nonadherent cells were removed by vine, mouse, and rat BM-MSCs (34,68,69). washing with PBS and remaining adherent cells further Recently, Ungrin et al. developed a microfabrication- cultured with medium changes every 3–4 days. Cells based nonadhesive surface for the culture of thousands generally approached confluence after 14–20 days and of individual aggregates of embryonic stem cells to im- were then passaged and expanded. After the second pas- prove embryoid body homogeneity and differentiation sage, cells were immunophenotyped by flow cytometry (78). With a commercial tissue culture product employ- (monoclonal antibodies from BD Biosciences Phar- ing this microwell surface now available, we evaluated mingen, San Diego, CA) and were functionally assessed the effectiveness of such a technology for enhancing for differentiation potential. Cells were deemed MSC if − + + + chondrogenesis of human BM-MSCs. Due to the prom- they were CD45 , CD73 , CD90 , CD105 , and showed ising indications but lack of clarity regarding the role of adipogenic, osteogenic, and chondrogenic differentiation oxygen tension during chondrogenesis of human BM- potential as described previously (8). MSCs, the oxygen environment was varied between nor- For these experiments, second passage BM-MSCs moxic (20% O ) and hypoxic (2% O ) for this new cul- were expanded in DMEM-LG supplemented with 10% 2 2 ture system as well as for conventional pellet culture. FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin We show here that a long-term low oxygen environment (1% PS; Gibco) in an incubator with a 2% O atmo- during chondrogenic induction has beneficial effects on sphere due to the aforementioned evidence of the bene- the differentiation of human BM-MSCs in a conven- fits of hypoxic preconditioning on MSC chondrogenesis. tional pellet culture. Furthermore, creating smaller cell BM-MSCs from three different donors at fourth passage aggregates under low oxygen tension resulted in sub- were used in chondrogenic assays. LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 31 Chondrogenic Differentiation scribed (12) and visualizing with an Olympus BX61 mi- croscope equipped with polarizing filters. BM-MSCs were differentiated as conventional pellet Localizations of collagen I and collagen II were de- cultures in 15-ml polypropylene tubes or micropellet termined by double immunofluorescence staining (IF). TM cultures formed in AggreWell 400 plates (STEMCELL Briefly, the sections were digested with 0.01% pepsin Technologies, Vancouver, BC, Canada). BM-MSCs were (Sigma) in 0.01 M HCl (pH 2) at 37°C for 10 min, fol- grown to near confluence, detached using recombinant lowed by 0.1% hyaluronidase (Sigma) in PBS (pH 5) at trypsin replacement (TrypLE; Gibco), and placed in se- room temperature (RT) for 30 min. Cells were perme- rum-free chondrogenic induction medium consisting of abilized with 0.1% Triton X-100 for 5 min and blocked high-glucose DMEM (DMEM-HG; Gibco) containing −7 for 30 min at RT in TBS containing 2% bovine serum 10 ng/ml TGF-β1 (PeproTech, Rocky Hill, NJ), 10 M albumin and 2% normal goat serum. The sections were dexamethasone (Sigma, St. Louis, MO), 200 µM then stained with a 1:50 dilution of both polyclonal rab- ascorbic acid 2-phosphate (Sigma), 100 µg/ml sodium bit anti-collagen I (Cedarlane Labs, Burlington, ON, pyruvate (Sigma), 40 µg/ml proline (Sigma), 1× ITS+ Canada) and monoclonal mouse anti-collagen II (Lab (Gibco), and 1% PS. Pellet or micropellet cultures were Vision, Fremont, CA) primary antibodies for 2 h at RT. formed by centrifuging 2 × 10 cells at 500 × g in chon- This was followed by incubation with a mixture of sec- drogenic induction medium and then culturing in a 2% ondary antibodies containing Alexa Fluor 568-conju- O or 20% O atmosphere for a further 14 days. In this 2 2 gated goat anti-rabbit IgG and Alexa Fluor 488-conju- study, we used TGF-β1, which is known to induce chon- gated goat anti-mouse IgG (1:200 dilution; both from drogenic differentiation of MSCs but at a lesser rate than Molecular Probes) for 1 h at RT. After each staining TGF-β3 (5). This allowed us to evaluate micropellet dif- step, unbound antibodies were washed with TBS con- ferentiation at a time point (14 days) where chondrogen- taining 0.2% Tween-20. Nuclei were counterstained esis would be initiated in conventional pellet cultures with Hoechst 33342 for 5 min at RT. The sections were but still at an early stage (63). mounted and examined with an Olympus BX61 fluores- cence microscope. Negative controls without primary Sulfated Glycosaminoglycan Quantification antibodies were used for background correction. Medium from pellet and micropellet cultures was col- lected and stored at −80°C at each medium replacement, Relative Gene Expression Analysis every 3–4 days. At the end of 14 days, micropellets On day 14, RNA was collected from micropellets and were centrifuged to a single pellet. Micropellets and pel- mechanically disrupted conventional pellets using the lets were digested with 1.6 U/ml papain (Sigma) at 60°C RNEasy Mini Kit (Qiagen, Valencia, CA) as per the overnight. The sGAG content and DNA were quantified manufacturer’s instructions. RNA was also collected with 1,9-dimethymethylene blue (DMB; Sigma) and from day 0 monolayer BM-MSCs. RNA samples were Hoechst 33342 (Molecular Probes, Eugene, OR) as de- treated with DNase I (0.1 U/µl final; Fermentas, Glen scribed in detail by Liebman and Goldberg (47). Shark Burnie, MD) for 30 min at 37°C and then heat inacti- chondroitin sulfate (Sigma) and calf thymus DNA vated at 65°C for 5 min in the presence of 2.5 mM (Sigma) were used as the respective standards. Addition- EDTA. DNase I-treated RNA samples (50 ng) were re- ally, the DMB assay was used to quantify sGAGs re- verse transcribed using SuperScript III RT and oli- leased into the medium collected at days 3, 6, 10, and 14. go(dT) in the presence of RNaseOUT (all from In- vitrogen) as per the manufacturer’s instructions and Histology and Immunohistochemistry stored at −80°C until analysis. At the end of 14 days, micropellets and pellets were Real-time quantitative polymerase chain reaction fixed in 4% formaldehyde, embedded in Tissue-Tek (qPCR) was performed using a 7500 Fast Real-Time OCT compound (Sakura Finetek, Tokyo, Japan), and PCR System (Applied Biosystems, Foster City, CA) and snap-frozen in liquid nitrogen. Samples were cryosec- Platinum SYBR Green qPCR SuperMix-UDG (In- tioned and stored at −80°C until use. Before staining, vitrogen). The cycling parameters were 50°C for 2 min, the sections were rinsed in 70% ethanol and Tris- 95°C for 2 min, and then 95°C for 3 s and 60°C for 30 buffered saline (TBS) to remove OCT compound. To s for a total of 40 cycles. The primers used are shown in detect proteoglycan deposition sections were stained Table 1 and were all from previously published papers −∆∆ Ct with 0.1% toluidine blue (ProSciTech, Thuringowa, (52,72,77,81). Results were analyzed using the 2 QLD, Australia) in 1% NaCl solution (pH 2.3). Organi- method relative to the housekeeping gene cyclophilin A zation of fibrillar collagen was detected by staining with due to the instability of glyceraldehyde 3-phosphate de- 0.1% Picrosirius red F3B (ProSciTech) as previously de- hydrogenase (GAPDH) in oxygen-dependent studies 32 MARKWAY ET AL. Table 1. Primers Used for Real-Time Quantitative Polymerase Chain Reaction Amplicon Gene Primers Size (bp) Reference Cyclophilin A 164 77 Forward CTCGAATAAGTTTGACTTGTGTTT Reverse CTAGGCATGGGAGGGAACA GAPDH 119 52 Forward ATGGGGAAGGTGAAGGTCG Reverse TAAAAGCAGCCCTGGTGACC SOX9 77 81 Forward TTCCGCGACGTGGACAT Reverse TCAAACTCGTTGACATCGAAGGT Aggrecan 85 52 Forward TCGAGGACAGCGAGGCC Reverse TCGAGGGTGTAGCGTGTAGAGA Collagen II (COL2A1) 79 52 Forward GGCAATAGCAGGTTCACGTACA Reverse CGATAACAGTCTTGCCCCACTT Collagen I (COL1A1) 83 52 Forward CAGCCGCTTCACCTACAGC Reverse TTTTGTATTCAATCACTGTCTTGCC Versican 98 52 Forward TGGAATGATGTTCCCTGCAA Reverse AAGGTCTTGGCATTTTCTACAACAG Collagen X (COL10A1) 70 52 Forward CAAGGCACCATCTCCAGGAA Reverse AAAGGGTATTTGTGGCAGCATATT Runx2/Cbfa1 113 72 Forward GGAGTGGACGAGGCAAGAGTTT Reverse AGCTTCTGTCTGTGCCTTCTGG Osteocalcin 70 52 Forward GAAGCCCAGCGGTGCA Reverse CACTACCTCGCTGCCCTCC GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SOX9, (sex determining region Y)-box 9; Runx2/ Cbfa1, runt-related transcription factor 2/core-binding factor α1. (7,21,85). Specificity of products was confirmed by melt magnitude and direction of changes in pellets compared curve analysis and 3% agarose gel electrophoresis. to undifferentiated BM-MSCs. Therefore, all data shown Cyclophilin A was stable among day 14 differenti- and subjected to statistical analysis are compared to the ated BM-MSCs, but differed in monolayer BM-MSCs current standard for BM-MSC chondrogenesis, 20% O and thus could not be used to compare between days 0 pellets, and with cyclophilin A as a reference gene. and 14. GAPDH, however, was stable between 2% O Statistical Analysis micropellets and monolayer BM-MSCs. Thus, for some genes, we quantified the change in 2% O micropellets SPSS 17.0 (SPSS Inc., Chicago, IL) was used for compared to monolayer BM-MSCs and used this in con- one-way analysis of variance (ANOVA) with Tukey junction with the change among conditions calculated post hoc tests to assess statistical significance, which using cyclophilin A to indirectly estimate the change in was defined as p < 0.05. For qPCR data, statistical anal- the conventional pellets from monolayer BM-MSCs. ysis was conducted on the ∆ Ct values and the mean fold However, this was deemed to be more susceptible to increase and 95% confidence intervals are represented −∆∆ Ct error and was only used as an indication of the general by 2 evaluated at the mean Ct, at the lower confi- ∆∆ LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 33 dence limit of Ct, and at the upper confidence limit sGAGs, while 2% O micropellets had a distinctly linear of Ct between conditions (83). sGAG release profile (Fig. 2B). The 2% O pellets re- tained nearly twice the fraction of their total sGAGs as RESULTS the 20% O pellets (Fig. 2C) and correspondingly pro- Human BM-MSC Micropellet Development duced twice as much per microgram of DNA within the TM in AggreWell Plates matrix (Fig. 2D). Micropellets cultured at 2% O , mean- while, produced 8.2- and 4.0-fold more total sGAGs The feasibility of creating micropellets of BM-MSCs TM than pellets at 20% and 2% O , respectively (Fig. 2C). in the AggreWell plates was evaluated by varying the 5 4 The increase was also reflected in the amount of sGAGs number of cells per well from 2 × 10 to 1 × 10 (results retained with 6.3- and 1.6-fold more sGAGs within the not shown). We found that consistent aggregates could aggregate mass of 2% O micropellets. While 2% O 2 2 be formed under both 20% and 2% O using 2 × 10 micropellets retained less than half the fraction of their cells/well, a common number of MSCs used in conven- total as 2% O pellets (Fig. 2C), the increase in total tional pellet culture. At this density, aggregates formed released was of such a magnitude that the amount within under both oxygen environments within 14 days, albeit the aggregates’ matrices per DNA was not significantly with different morphologies (Fig. 1). Micropellets under different (Fig. 2D). The compact 20% O micropellets 2% O appeared to be more loosely aggregated while 2 were typically found to have very little DNA after 14 those under 20% O formed smaller compacted masses. days and a low amount of sGAGs within the collected Micropellets from both oxygen environments were eas- aggregate mass. We suspected that these micropellets ily collected for analysis at day 14 using only a pipette experienced substantial cell death as there were often to dislodge them from microwells. All subsequent stud- relatively few remaining after 10–14 days. Per DNA, ies therefore used 2 × 10 cells per centrifuge tube or per the amount of sGAGs was statistically equivalent to that well (170 cells/microwell). produced in the conventional 20% O pellet (Fig. 2D). Proteoglycan Production in Normoxic and Hypoxic Matrix Distribution in Hypoxic Micropellets Micropellets and Pellets and Normoxic and Hypoxic Pellets The proteoglycan production of micropellets was compared to that of conventional pellets by quantifying After 14 days the distributions of proteoglycans and the total amount of sGAGs released over the course of collagens in the pellets and 2% O micropellets were chondrogenic induction and the amount retained within visualized using toluidine blue and polarized light im- the aggregates’ matrices. While 20% O pellets displayed aging of picrosirius red, respectively. Due to the small a relatively level profile, the amount released by 2% O size of remaining 20% O micropellets, we did not cryo- 2 2 pellets showed a slightly increasing profile over 14 days section samples for this evaluation. In pellets, staining (Fig. 2A). Micropellets differentiated at 20% O gener- of proteoglycans was heterogeneous with the darkest ally displayed a steady but elevated release profile of staining around the periphery while 2% O micropellets Figure 1. Morphological changes of human BM-MSC micropellets over 14 days of chondrogenic TM induction in AggreWell plates under 20% and 2% O environments. Scale bar: 200 µm. ∆∆ ∆∆ 34 MARKWAY ET AL. Figure 2. Production of sGAGs by human BM-MSC pellets and micropellets differentiated under 20% and 2% O . The release profile of sGAGs over 14 days was determined by the quantity released into the supernatant between medium exchanges for (A) conventional pellet cultures and (B) micropellet cultures. (C) The total amount of sGAGs produced over 14 days and the amount retained within the pellets and micropellets after 14 days. (D) The amount of sGAGs that was retained within the pellets and micropellets normalized to DNA. All values are mean ± SD for n = 10 samples from three independent experiments. Statistical significance was determined by ANOVA with Tukey post hoc tests. *p < 0.05 compared to 20% O pellets; †p < 0.05 compared to 2% O pellets. sGAGs, sulfated glycosaminoglycans. exhibited homogeneous staining (Fig. 3A). Throughout blue staining, collagen II was only detected in areas 2% O micropellets the cells appeared as round, chon- along the periphery (Fig. 4A–C). In contrast, positive drocyte-like cells embedded within lacunae. The distri- immunohistochemical stainings of both collagen I and bution of collagen fibers was similar in the 20% O pel- collagen II were visualized essentially throughout the lets and 2% O pellets, with thicker fibers aligned along matrix of 2% O micropellets, although collagen I was 2 2 the periphery and random thin fibers in the central re- generally more intense in the inner regions. gion (Fig. 3B, C). A random meshwork of fibers with Gene Expression of Normoxic and Hypoxic no regional organization was observed surrounding the Micropellets and Pellets cells in the 2% O micropellets. The collagen matrix sur- rounding the differentiating cells was also assessed by The extent of chondrogenesis was distinguished by visualizing collagen I and collagen II using IF. Collagen quantifying the relative gene expression of collagen II, I was detected throughout pellets differentiated under aggrecan, and SOX9. We also evaluated a variety of both oxygen environments and consistent with toluidine genes more prevalent in MSCs, fibrocartilage, hypertro- LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 35 phic chondrocytes, and osteoblasts: collagen I, versican, consideration the sGAG results, did not continue with collagen X, runt-related transcription factor 2/core-bind- the full panel of genes for 20% O micropellets. ing factor α1 (Runx2/Cbfa1), and osteocalcin. Collagen I was not significantly different between After 14 days of chondrogenic induction, qPCR anal- pellet cultures but increased 4.2-fold in 2% O micropel- ysis revealed no significant difference in SOX9 expres- lets compared to 20% O pellets (Fig. 5C). Comparing sion between 2% O and 20% O pellets (Fig. 5A). SOX9 2% O micropellets to monolayer MSCs using GAPDH 2 2 2 in 2% O micropellets, meanwhile, showed an average revealed a 2.2-fold increase (data not shown), meaning increase of 7.5-fold over 20% O pellets and 3.0-fold that the monolayer MSCs expressed collagen I at an in- over 2% O pellets. Aggrecan was increased 12- and termediate level between pellets and 2% O micropel- 2 2 350-fold in 2% O pellets and 2% O micropellets, re- lets. Versican, on the other hand, was not significantly 2 2 spectively, compared to 20% O pellets (Fig. 5B). Colla- different among the differentiated conditions (Fig. 5B). gen II was increased on average 1,500-fold in 2% O Collagen X followed the trend of collagen II, although pellets and 33,000-fold in 2% O micropellets compared it was highly variable among samples even within the to 20% O pellets (Fig. 5C). We screened 20% O micro- same donor. Still, there was a significant 21-fold in- 2 2 pellet samples for aggrecan and collagen II gene expres- crease in collagen X in 2% O pellets and 1,600-fold in sion and found these to be expressed at similar levels 2% O micropellets compared to 20% O pellets (Fig. 2 2 as in 20% O pellets (data not shown) and taking into 5C). Despite this trend, there was no significant differ- Figure 3. Distribution of proteoglycans and organization of collagen fibers in 20% O pellet, 2% O pellet, and 2% O micropellet 2 2 2 cultures of human BM-MSCs in chondrogenic medium for 14 days. Fixed cryosections were stained with (A) toluidine blue for proteoglycans or (B) picrosirius red for collagen and viewed under normal bright field. (C) Birefringent collagen fibers of the picrosirius red-stained sections were visualized with polarized light microscopy. Inset scale bars: 100 µm. 36 MARKWAY ET AL. Figure 4. Localization of collagen in 20% O pellet, 2% O pellet, and 2% O micropellet cultures of human BM-MSCs maintained 2 2 2 in chondrogenic medium for 14 days. Fixed cryosections were double-stained with (A) anti-collagen I and (B) anti-collagen II antibodies, as described in Materials and Methods, with Hoechst 33342 as a counterstain for nuclei. Positive immunolocalization of collagen appears as red (collagen I) or green (collagen II) in the extracellular matrix, and nuclei are blue. Negative controls where the primary antibodies were omitted (images not shown) were used for background correction. (C) Composite images of (A) and (B) were digitally processed using ImageJ software. The overlapping regions (yellow) indicate colocalization of collagens I and II. Inset scale bars: 1 mm. ence in Runx2/Cbfa1 or osteocalcin gene expression in gin chondrogenesis but must later be switched off for 2% O micropellets compared to 20% O pellets (Fig. differentiation to continue (61). TGF-β3 was recently 2 2 5A, D), although Runx2/Cbfa1 was significantly lower discovered to downregulate Notch gene expression and in 2% O pellets compared to micropellets. protein levels in MSCs, resulting in the SOX9-mediated upregulation of collagen II (26). Thus, TGF-β may be a DISCUSSION key regulator resulting in the transience of Notch In this study, we investigated chondrogenesis of hu- signaling that is critical for chondrogenesis of MSCs. man BM-MSCs in conventional pellet culture com- Given that hypoxia reportedly enhances Notch signaling pared to micropellets and the effects of oxygen tension (27), oxygen tension may also be a crucial factor. We in these different aggregates. The importance of MSC hypothesize that the benefits of low oxygen on in vitro aggregation has been partially explained by the role of MSC chondrogenesis may be abrogated somewhat by Jagged-1-mediated Notch signaling in the chondrogen- the limitations of current chondrogenic protocols. Spe- esis pathway (29). Notch signaling, which is activated cifically, we believe that the mass transport properties by cell–cell contact, must be initiated for MSCs to be- and self-induced oxygen gradient of macroscopic pellet LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 37 culture are substantial obstacles to robust chondrogen- (3 and 500 kDa) had the greatest diffusivity through the esis. surface zone, while midrange dextran (40 and 70 kDa) The most critical known soluble factors for chondro- had lower diffusivity through the surface zone (43). genic differentiation of MSCs range in molecular weight Over the course of differentiation of pellet-cultured from 0.39 (dexamethasone) to 25 kDa (TGF-β). Mass MSCs, it is likely that matrix accumulation results in the transport studies of tissue-engineered cartilage constructs diffusivity approaching that of articular cartilage. There- have shown a relationship between increasing tissue fore, strategies that minimize the mass transport limita- density and decreasing diffusivity, even for molecules tions in MSC chondrogenesis have the potential to maxi- as small as glucose (0.18 kDa) (10,22,42). In pellet cul- mize the efficiency and homogeneity of differentiation. TM ture, the microarchitecture has been observed to resem- The wells of AggreWell plates each consist of approx- ble that of articular cartilage, with collagen fibers imately 1,200 microwells and allow for the creation of aligned parallel to the surface at the surface and perpen- very small diffusional distances in adjacent but physi- dicular to the surface in the deeper layers (6,31,56). In- cally separate microscopic aggregates. Using the as- terestingly, in articular cartilage, Leddy and Guilak dis- sumption that cells form perfect spheres of an equal ini- covered that small and large molecular weight dextrans tial total volume as a single perfect sphere of cells, Figure 5. Fold-change in mRNA levels of common markers for chondrogenesis, hypertrophy, and osteogenesis in human BM- MSC pellets and micropellets differentiated under 2% O compared to conventional 20% O pellets. After 14 days in chondrogenic 2 2 culture the relative gene expression levels of (A) the transcription factors SOX9 and Runx2/Cbfa1, (B) the proteoglycans aggrecan and versican, (C) collagens I, II, and X, and (D) the bone-forming marker osteocalcin were analyzed by real-time quantitative polymerase chain reaction. All values are the mean fold-change relative to 20% O pellets normalized to cyclophilin A for n = 7 samples from three independent experiments. Error bars represent 95% confidence intervals. Statistical significance was determined by ANOVA with Tukey post hoc tests. *p < 0.05 compared to 20% O pellets; †p < 0.05 compared to 2% O pellets. SOX9, (sex 2 2 determining region Y)-box 9; Runx2/Cbfa1, runt-related transcription factor 2/core-binding factor α1. 38 MARKWAY ET AL. TM distributing the cells across the AggreWells would de- proteoglycans and collagen II but showed collagen I crease the radius of aggregates by approximately 11 throughout. Although micropellets were not a perfectly times. This would result in an approximate 11-fold in- uniform size the distribution of proteoglycans and colla- crease in the surface area-to-volume ratio, which would gens appeared homogeneous. The micropellets also dis- substantially enhance mass transport. played random orientation of collagen fibers similar to Over 14 days of chondrogenic induction, BM-MSC the middle to deep zones of normal articular cartilage TM micropellets cultured in AggreWell plates under a 2% (19,56,65). There were no structurally aligned fibers O environment demonstrated substantially increased around the periphery of the micropellets as was seen in chondrogenesis over conventional pellet cultures differ- conventional pellets and as has been observed by others entiated under both 2% and 20% O . While the endpoint (56). Furthermore, while collagen I was variably distrib- for analysis was at 14 days, we monitored development uted in the micropellets, collagen II appeared throughout over the course of chondrogenic induction morphologi- micropellets after only 14 days with TGF-β1. cally and by quantifying the release of sGAGs. The ac- Analysis of cartilage-specific genes using qPCR re- cumulation of sGAGs begins in the early stages of MSC vealed collagen II and aggrecan to be significantly upreg- chondrogenesis (5) and the quantification of these pro- ulated in 2% O pellets but further increased in 2% O 2 2 teoglycan modifications can give an indication of ag- micropellets along with SOX9. Collagen II in 2% O grecan production. Aggrecan is largely responsible for micropellets was elevated 33,000-fold over 20% O pel- providing the compressive stiffness of articular cartilage lets and approximately 785,000-fold more than undiffer- (65) and obtaining cartilaginous tissues in vitro with entiated BM-MSCs (data not shown). In 2% O micro- similar aggrecan composition remains a challenge pellets with 10 ng/ml TGF-β1 we measured even greater (38,56). In accordance with results seen in pellets of nor- increases in collagen II expression at 14 days than has mal ACs (29), our BM-MSC pellets under 2% O re- been reported for normoxic pellet cultures supplemented tained more of their total sGAGs within the cell mass with 100 ng/ml of the more potent TGF-β3 (61). Due to and correspondingly produced more per DNA than the the extremely high level of sGAGs produced in 2% O 20% O pellets. These 2% O pellets were also notice- micropellets compared to pellet cultures, in addition to 2 2 ably larger when viewed with the naked eye, a result aggrecan we also evaluated versican expression, which others have reported for low oxygen-preconditioned and is high in dedifferentiated ACs but low in normal articu- low oxygen-exposed pellet cultures of MSCs and ACs, lar cartilage (4,52). Versican is also expressed in undif- which is likely primarily a product of increased proteo- ferentiated BM-MSCs (75) and an increase in its gene glycan content (29,51,53,86). The release profiles for expression has been described as an early event in pellet 20% O micropellets were generally elevated over pellet culture chondrogenesis (5). In this study, unlike ag- cultures but per DNA within the cell mass, they per- grecan expression which increased on average 350-fold formed no better than conventional 20% O pellets. The in 2% O micropellets compared to 20% O pellets, there 2 2 2 difference in sGAG production over 14 days in 2% O was no significant difference in versican expression micropellets, on the other hand, was striking. These mi- among the different conditions. cropellets swelled in size like their macroscopic counter- The inability to maintain high levels of collagen II parts under 2% O and had a highly linear increase in expression relative to collagen I in primary ACs ex- sGAG release over the entire 14 days. Although 2% O panded in vitro potentially reduces their efficacy in micropellets retained a lower fraction of their total than ACI procedures (4,67). While collagen I is highly ex- 2% O pellets, the total sGAG production was so signifi- pressed in BM-MSCs (75) and extremely low in nor- cantly elevated that the quantity of sGAGs per DNA mal ACs (4,50), its average expression during pellet within the mass was similar. culture chondrogenic induction of BM-MSCs has been We histologically assessed the distributions of pro- observed by some to increase along with collagen II teoglycans as well as collagen in the 20% O pellets, 2% and collagen X over the long term (35,55,63). We O pellets, and 2% O micropellets. In conventional pel- found that collagen I was significantly higher in 2% O 2 2 2 lets collagen II and proteoglycans are typically observed micropellets compared to 20% and 2% O pellet cul- either in the center (5,49,61,82) or at the periphery tures, both of which had decreased levels compared to (5,31,37,55,56,70). Although, due to multiple variables monolayer BM-MSCs. However, we think that with between these studies, it is difficult to discern the rea- continued induction beyond 14 days the pellets would soning for the different patterns observed, the fluctuat- continue to increase their average collagen II and colla- ing mass transport properties of the differentiating pellet gen X expression as well as their average collagen I may play a role. In larger pellets, central necrosis has expression. even been observed (17). In this study, both 20% and Perhaps the principal challenge of using BM-MSCs 2% O pellets displayed mostly peripheral staining of for cartilage repair will be the ability to obtain a stable 2 LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 39 chondrogenic phenotype. In this study, we evaluated sulfate (9) and parathyroid hormone-related protein the hypertrophic and osteogenic markers collagen X, (33,37), however, will likely be the most commonly in- Runx2/Cbfa1, and osteocalcin. Changes in collagen X vestigated solutions and, as shown here, a micropellet expression among conditions mirrored the changes seen system may maximize the efficiency of such strategies. with collagen II, as has been reported previously with Additionally, we have developed a membrane bioreactor conventional pellets (5,56,59,63,71,86). This could be a that is able to aid conventional pellet cultures in retain- significant obstacle with BM-MSCs, as Pelttari et al. ing sGAGs within their matrices (15) and believe micro- showed that ectopic implantation of in vitro differenti- pellet cultures will be easily integrated with such tech- ated BM-MSC pellets in SCID mice led to calcification nology. With a view towards future tissue engineering, and vascular invasion at the implant site, whereas no we believe the benefits of performing MSC chondrogen- such problems were observed with chondrocyte-derived esis in this way is to date unparalleled. Homogeneous pellets (63). However, we believe that our improved differentiation of the cell population can be achieved methodology will allow for better control when investi- more rapidly and the physical nature of the chondro- gating methods to reduce collagen X expression and, genic micropellets should make them easy to integrate likewise, collagen I expression. with a variety of stem cell-based cartilage and meniscal Collagen X expression in hypertrophic chondrocytes repair technologies such as intra-articular injections is regulated by Runx2/Cbfa1 (18,30,84), a critical tran- (45,57), hydrogels (60), and scaffolds (2,80). scription factor for osteoblast differentiation and bone ACKNOWLEDGMENTS: This work is supported by The Uni- formation (16,39,62) and an important regulator of hu- versity of Queensland Early Career Researcher Grant Scheme and in part by the Australian Research Council Discovery man BM-MSC osteogenic differentiation (1,28,48,73). Grants Scheme. The Whitaker Foundation provided support Despite greatly increased levels of collagen X, there was for B.D.M. with a Whitaker International Fellows Award no significant difference in Runx2/Cbfa1 gene expres- (2008-09). The authors thank Paul Addison for technical sup- sion compared to 20% O pellets. However, while in- 2 port with histology, Professor Julie Campbell for supporting this project with shared equipment and lab space, and the Aus- creased Runx2/Cbfa1 activity is critical for osteogenesis tralian Stem Cell Centre for generously allowing access to of human BM-MSCs, its mRNA expression may not analysis equipment. B.D.M. also thanks his Ph.D. advisor, Dr. change even during osteogenic differentiaton (73). We Monica Hinds of Oregon Health & Science University, for her therefore examined expression of another Runx2/Cbfa1 selfless support of his fellowship. target, osteocalcin, as it is regulated during osteogenesis REFERENCES and has been indicated as a hypertrophic marker in 1. Ahlstrom, M.; Pekkinen, M.; Lamberg-Allardt, C. Dexa- chondrocytes and in human BM-MSC pellet cultures methasone downregulates the expression of parathyroid (3,23,46,55,74). Despite the apparent advanced stage of hormone-related protein (PTHrP) in mesenchymal stem the 2% O micropellets, there was no significant differ- cells. Steroids 74(2):277–282; 2009. ence in osteocalcin expression among conditions. While 2. Angele, P.; Johnstone, B.; Kujat, R.; Zellner, J.; Nerlich, 14 days may be too early to see such changes even in M.; Goldberg, V.; Yoo, J. Stem cell based tissue engineer- ing for meniscus repair. J. Biomed. Mater. Res. A 85(2): the micropellets, in addition to observing reduced os- 445–455; 2008. teogenesis of BM-MSCs under prolonged low oxygen 3. Banerjee, C.; McCabe, L. R.; Choi, J. Y.; Hiebert, S. W.; tension (20), others have noted that even temporary hyp- Stein, J. L.; Stein, G. S.; Lian, J. B. Runt homology do- oxic exposure inhibits BM-MSC osteogenic differentia- main proteins in osteoblast differentiation: AML3/CBFA1 tion (66). Consequently, we believe that with further op- is a major component of a bone-specific complex. J. Cell. Biochem. 66(1):1–8; 1997. timization micropellets under low oxygen tension may 4. Barlic, A.; Drobnic, M.; Malicev, E.; Kregar-Velikonja, offer a means to reach a stable chondrogenic phenotype. N. Quantitative analysis of gene expression in human ar- Here we showed the benefit of low oxygen tension ticular chondrocytes assigned for autologous implantation. during chondrogenic induction of human BM-MSC us- J. Orthop. Res. 26(6):847–853; 2008. ing both conventional pellet culture and a new micropel- 5. Barry, F.; Boynton, R. E.; Liu, B.; Murphy, J. M. Chon- drogenic differentiation of mesenchymal stem cells from let culture. The benefits of low oxygen tension appear bone marrow: Differentiation-dependent gene expression to be maximized by creating very small aggregates that of matrix components. Exp. Cell Res. 268(2):189–200; limit mass transport and oxygen diffusion gradients. While the undesired collagen X was greatly upregulated 6. Below, S.; Arnoczky, S. P.; Dodds, J.; Kooima, C.; Walter, in 2% O micropellets, this problem persists in conven- N. The split-line pattern of the distal femur: A consider- ation in the orientation of autologous cartilage grafts. Ar- tional BM-MSC pellet culture as well. A plasma poly- throscopy 18(6):613–617; 2002. mer coating has recently been reported to decrease colla- 7. Benohr, P.; Harsch, S.; Proksch, B.; Gleiter, C. H. Does gen X (58) and such modifications would be easily angiotensin II modulate erythropoietin production in applicable to microfabricated surfaces such as the inserts HepG2 cells? Nephron Exp. Nephrol. 98(4):e124–131; TM of AggreWells . Soluble factors such as chondroitin 2004. 40 MARKWAY ET AL. 8. Brooke, G.; Tong, H.; Levesque, J. P.; Atkinson, K. Mo- of the complex functions of the hypertrophic chondrocyte lecular trafficking mechanisms of multipotent mesenchy- during endochondral bone development. J. Cell. Biochem. mal stem cells derived from human bone marrow and pla- 62(1):1–9; 1996. centa. Stem Cells Dev. 17(5):929–940; 2008. 24. Grayson, W. L.; Zhao, F.; Bunnell, B.; Ma, T. Hypoxia 9. Brown, C. C.; Balian, G. Effect of heparin on synthesis of enhances proliferation and tissue formation of human short chain collagen by chondrocytes and smooth muscle mesenchymal stem cells. Biochem. Biophys. Res. Com- cells. J. Cell Biol. 105(2):1007–1012; 1987. mun. 358(3):948–953; 2007. 10. Bursac, P. M.; Freed, L. E.; Biron, R. J.; Vunjak-Nova- 25. Grayson, W. L.; Zhao, F.; Izadpanah, R.; Bunnell, B.; Ma, kovic, G. Mass transfer studies of tissue engineered carti- T. Effects of hypoxia on human mesenchymal stem cell lage. Tissue Eng. 2(2):141–150; 1996. expansion and plasticity in 3D constructs. J. Cell. Physiol. 11. Cournil-Henrionnet, C.; Huselstein, C.; Wang, Y.; Galois, 207(2):331–339; 2006. L.; Mainard, D.; Decot, V.; Netter, P.; Stoltz, J. F.; Muller, 26. Grogan, S. P.; Olee, T.; Hiraoka, K.; Lotz, M. K. Repres- S.; Gillet, P.; Watrin-Pinzano, A. Phenotypic analysis of sion of chondrogenesis through binding of notch signaling cell surface markers and gene expression of human mes- proteins HES-1 and HEY-1 to N-box domains in the enchymal stem cells and chondrocytes during monolayer COL2A1 enhancer site. Arthritis Rheum. 58(9):2754– expansion. Biorheology 45(3–4):513–526; 2008. 2763; 2008. 12. Dayan, D.; Hiss, Y.; Hirshberg, A.; Bubis, J. J.; Wolman, 27. Gustafsson, M. V.; Zheng, X.; Pereira, T.; Gradin, K.; Jin, M. Are the polarization colors of picrosirius red-stained S.; Lundkvist, J.; Ruas, J. L.; Poellinger, L.; Lendahl, U.; collagen determined only by the diameter of the fibers? Bondesson, M. Hypoxia requires notch signaling to main- Histochemistry 93(1):27–29; 1989. tain the undifferentiated cell state. Dev. Cell 9(5):617– 13. Dell’Accio, F.; De Bari, C.; Luyten, F. P. Molecular 628; 2005. markers predictive of the capacity of expanded human ar- 28. Hamidouche, Z.; Hay, E.; Vaudin, P.; Charbord, P.; ticular chondrocytes to form stable cartilage in vivo. Ar- Schule, R.; Marie, P. J.; Fromigue, O. FHL2 mediates thritis Rheum. 44(7):1608–1619; 2001. dexamethasone-induced mesenchymal cell differentiation 14. D’Ippolito, G.; Diabira, S.; Howard, G. A.; Roos, B. A.; into osteoblasts by activating Wnt/beta-catenin signaling- Schiller, P. C. Low oxygen tension inhibits osteogenic dif- dependent Runx2 expression. FASEB J. 22(11):3813– ferentiation and enhances stemness of human MIAMI 3822; 2008. cells. Bone 39(3):513–522; 2006. 29. Hardingham, T. E.; Oldershaw, R. A.; Tew, S. R. Carti- 15. Doran, M. R.; Markway, B. D.; Clark, A.; Athanasas-Plat- lage, SOX9 and Notch signals in chondrogenesis. J. Anat. sis, S.; Brooke, G.; Atkinson, K.; Nielsen, L. K.; Cooper- 209(4):469–480; 2006. White, J. J. Membrane bioreactors enhance microenviron- 30. Higashikawa, A.; Saito, T.; Ikeda, T.; Kamekura, S.; mental conditioning and tissue development. Tissue Eng. Kawamura, N.; Kan, A.; Oshima, Y.; Ohba, S.; Ogata, N.; Part C Methods; 2009. Takeshita, K.; Nakamura, K.; Chung, U. I.; Kawaguchi, 16. Ducy, P.; Zhang, R.; Geoffroy, V.; Ridall, A. L.; Karsenty, H. Identification of the core element responsive to runt- G. Osf2/Cbfa1: A transcriptional activator of osteoblast related transcription factor 2 in the promoter of human differentiation. Cell 89(5):747–754; 1997. type X collagen gene. Arthritis Rheum. 60(1):166–178; 17. Ebisawa, K.; Hata, K.; Okada, K.; Kimata, K.; Ueda, M.; 2009. Torii, S.; Watanabe, H. Ultrasound enhances transforming 31. Hui, T. Y.; Cheung, K. M.; Cheung, W. L.; Chan, D.; growth factor beta-mediated chondrocyte differentiation Chan, B. P. In vitro chondrogenic differentiation of human of human mesenchymal stem cells. Tissue Eng. 10(5–6): mesenchymal stem cells in collagen microspheres: Influ- 921–929; 2004. ence of cell seeding density and collagen concentration. 18. Enomoto, H.; Enomoto-Iwamoto, M.; Iwamoto, M.; Biomaterials 29(22):3201–3212; 2008. Nomura, S.; Himeno, M.; Kitamura, Y.; Kishimoto, T.; 32. Johnstone, B.; Hering, T. M.; Caplan, A. I.; Goldberg, Komori, T. Cbfa1 is a positive regulatory factor in chon- V. M.; Yoo, J. U. In vitro chondrogenesis of bone mar- drocyte maturation. J. Biol. Chem. 275(12):8695–8702; row-derived mesenchymal progenitor cells. Exp. Cell Res. 2000. 238(1):265–272; 1998. 19. Eyre, D. Collagen of articular cartilage. Arthritis Res. 33. Kafienah, W.; Mistry, S.; Dickinson, S. C.; Sims, T. J.; 4(1):30–35; 2002. Learmonth, I.; Hollander, A. P. Three-dimensional 20. Fehrer, C.; Brunauer, R.; Laschober, G.; Unterluggauer, cartilage tissue engineering using adult stem cells from H.; Reitinger, S.; Kloss, F.; Gully, C.; Gassner, R.; osteoarthritis patients. Arthritis Rheum. 56(1):177–187; Lepperdinger, G. Reduced oxygen tension attenuates dif- 2007. ferentiation capacity of human mesenchymal stem cells 34. Kanichai, M.; Ferguson, D.; Prendergast, P. J.; Campbell, and prolongs their lifespan. Aging Cell 6(6):745–757; V. A. Hypoxia promotes chondrogenesis in rat mesenchy- 2007. mal stem cells: A role for AKT and hypoxia-inducible fac- 21. Fink, T.; Lund, P.; Pilgaard, L.; Rasmussen, J. G.; tor (HIF)-1alpha. J. Cell. Physiol. 216(3):708–715; 2008. Duroux, M.; Zachar, V. Instability of standard PCR refer- 35. Karlsson, C.; Brantsing, C.; Svensson, T.; Brisby, H.; Asp, ence genes in adipose-derived stem cells during propaga- J.; Tallheden, T.; Lindahl, A. Differentiation of human tion, differentiation and hypoxic exposure. BMC Mol. mesenchymal stem cells and articular chondrocytes: Anal- Biol. 9:98; 2008. ysis of chondrogenic potential and expression pattern of 22. Freed, L. E.; Marquis, J. C.; Langer, R.; Vunjak-Nova- differentiation-related transcription factors. J. Orthop. Res. kovic, G. Kinetics of chondrocyte growth in cell-polymer 25(2):152–163; 2007. implants. Biotechnol. Bioeng. 43(7):597–604; 1994. 36. Khan, W. S.; Adesida, A. B.; Hardingham, T. E. Hypoxic 23. Gerstenfeld, L. C.; Shapiro, F. D. Expression of bone- conditions increase hypoxia-inducible transcription factor specific genes by hypertrophic chondrocytes: implication 2alpha and enhance chondrogenesis in stem cells from the LOW OXYGEN MICROPELLETS FOR MSC CHONDROGENESIS 41 infrapatellar fat pad of osteoarthritis patients. Arthritis 51. Martin-Rendon, E.; Hale, S. J.; Ryan, D.; Baban, D.; Res. Ther. 9(3):R55; 2007. Forde, S. P.; Roubelakis, M.; Sweeney, D.; Moukayed, 37. Kim, Y. J.; Kim, H. J.; Im, G. I. PTHrP promotes chon- M.; Harris, A. L.; Davies, K.; Watt, S. M. Transcriptional drogenesis and suppresses hypertrophy from both bone profiling of human cord blood CD133+ and cultured bone marrow-derived and adipose tissue-derived MSCs. Bio- marrow mesenchymal stem cells in response to hypoxia. chem. Biophys. Res. Commun. 373(1):104–108; 2008. Stem Cells 25(4):1003–1012; 2007. 38. Kobayashi, S.; Meir, A.; Urban, J. Effect of cell density 52. Martin, I.; Jakob, M.; Schafer, D.; Dick, W.; Spagnoli, G.; on the rate of glycosaminoglycan accumulation by disc Heberer, M. Quantitative analysis of gene expression in and cartilage cells in vitro. J. Orthop. Res. 26(4):493–503; human articular cartilage from normal and osteoarthritic 2008. joints. Osteoarthritis Cartilage 9(2):112–118; 2001. 39. Komori, T.; Yagi, H.; Nomura, S.; Yamaguchi, A.; Sasaki, 53. Martinez, I.; Elvenes, J.; Olsen, R.; Bertheussen, K.; K.; Deguchi, K.; Shimizu, Y.; Bronson, R. T.; Gao, Y. H.; Johansen, O. Redifferentiation of in vitro expanded adult Inada, M.; Sato, M.; Okamoto, R.; Kitamura, Y.; Yoshiki, articular chondrocytes by combining the hanging-drop S.; Kishimoto, T. Targeted disruption of Cbfa1 results in cultivation method with hypoxic environment. Cell Trans- a complete lack of bone formation owing to maturational plant. 17(8):987–996; 2008. arrest of osteoblasts. Cell 89(5):755–764; 1997. 54. Moussavi-Harami, F.; Duwayri, Y.; Martin, J. A.; Mous- 40. Lafont, J. E.; Talma, S.; Hopfgarten, C.; Murphy, C. L. savi-Harami, F.; Buckwalter, J. A. Oxygen effects on se- Hypoxia promotes the differentiated human articular nescence in chondrocytes and mesenchymal stem cells: chondrocyte phenotype through SOX9-dependent and Consequences for tissue engineering. Iowa Orthop. J. 24: -independent pathways. J. Biol. Chem. 283(8):4778– 15–20; 2004. 4786; 2008. 55. Mueller, M. B.; Tuan, R. S. Functional characterization 41. Lafont, J. E.; Talma, S.; Murphy, C. L. Hypoxia-inducible of hypertrophy in chondrogenesis of human mesenchymal factor 2alpha is essential for hypoxic induction of the hu- stem cells. Arthritis Rheum. 58(5):1377–1388; 2008. man articular chondrocyte phenotype. Arthritis Rheum. 56. Murdoch, A. D.; Grady, L. M.; Ablett, M. P.; Katopodi, 56(10):3297–3306; 2007. T.; Meadows, R. S.; Hardingham, T. E. Chondrogenic dif- 42. Leddy, H. A.; Awad, H. A.; Guilak, F. Molecular diffu- ferentiation of human bone marrow stem cells in transwell sion in tissue-engineered cartilage constructs: Effects of cultures: Generation of scaffold-free cartilage. Stem Cells scaffold material, time, and culture conditions. J. Biomed. 25(11):2786–2796; 2007. Mater. Res. B Appl. Biomater. 70(2):397–406; 2004. 57. Murphy, J. M.; Fink, D. J.; Hunziker, E. B.; Barry, 43. Leddy, H. A.; Guilak, F. Site-specific molecular diffusion F. P. Stem cell therapy in a caprine model of osteoarthri- in articular cartilage measured using fluorescence recov- tis. Arthritis Rheum. 48(12):3464–3474; 2003. ery after photobleaching. Ann. Biomed. Eng. 31(7):753– 58. Mwale, F.; Girard-Lauriault, P. L.; Wang, H. T.; Lerouge, 760; 2003. S.; Antoniou, J.; Wertheimer, M. R. Suppression of genes 44. Lee, C. R.; Grodzinsky, A. J.; Hsu, H. P.; Martin, S. D.; related to hypertrophy and osteogenesis in committed hu- Spector, M. Effects of harvest and selected cartilage repair man mesenchymal stem cells cultured on novel nitrogen- procedures on the physical and biochemical properties of rich plasma polymer coatings. Tissue Eng. 12(9):2639– articular cartilage in the canine knee. J. Orthop. Res. 2647; 2006. 18(5):790–799; 2000. 59. Mwale, F.; Stachura, D.; Roughley, P.; Antoniou, J. Limi- 45. Lee, K. B.; Hui, J. H.; Song, I. C.; Ardany, L.; Lee, E. H. tations of using aggrecan and type X collagen as markers Injectable mesenchymal stem cell therapy for large carti- of chondrogenesis in mesenchymal stem cell differentia- lage defects—a porcine model. Stem Cells 25(11):2964– tion. J. Orthop. Res. 24(8):1791–1798; 2006. 2971; 2007. 60. Noth, U.; Rackwitz, L.; Heymer, A.; Weber, M.; 46. Lian, J. B.; McKee, M. D.; Todd, A. M.; Gerstenfeld, Baumann, B.; Steinert, A.; Schutze, N.; Jakob, F.; Eulert, L. C. Induction of bone-related proteins, osteocalcin and J. Chondrogenic differentiation of human mesenchymal osteopontin, and their matrix ultrastructural localization stem cells in collagen type I hydrogels. J. Biomed. Mater. with development of chondrocyte hypertrophy in vitro. J. Res. A 83(3):626–635; 2007. Cell. Biochem. 52(2):206–219; 1993. 61. Oldershaw, R. A.; Tew, S. R.; Russell, A. M.; Meade, K.; 47. Liebman, J.; Goldberg, R. L. Unit 12.2 chondrocyte cul- Hawkins, R.; McKay, T. R.; Brennan, K. R.; Hardingham, ture and assay. Curr. Protoc. Pharmacol. 12(Suppl.):S1– T. E. Notch signaling through Jagged-1 is necessary to 18; 2001. initiate chondrogenesis in human bone marrow stromal 48. Liu, F.; Akiyama, Y.; Tai, S.; Maruyama, K.; Kawaguchi, cells but must be switched off to complete chondrogen- Y.; Muramatsu, K.; Yamaguchi, K. Changes in the expres- esis. Stem Cells 26(3):666–674; 2008. sion of CD106, osteogenic genes, and transcription factors 62. Otto, F.; Thornell, A. P.; Crompton, T.; Denzel, A.; involved in the osteogenic differentiation of human bone Gilmour, K. C.; Rosewell, I. R.; Stamp, G. W.; Bedding- marrow mesenchymal stem cells. J. Bone Miner. Metab. ton, R. S.; Mundlos, S.; Olsen, B. R.; Selby, P. B.; Owen, 26(4):312–320; 2008. M. J. Cbfa1, a candidate gene for cleidocranial dysplasia 49. Mackay, A. M.; Beck, S. C.; Murphy, J. M.; Barry, F. P.; syndrome, is essential for osteoblast differentiation and Chichester, C. O.; Pittenger, M. F. Chondrogenic differen- bone development. Cell 89(5):765–771; 1997. tiation of cultured human mesenchymal stem cells from 63. Pelttari, K.; Winter, A.; Steck, E.; Goetzke, K.; Hennig, marrow. Tissue Eng. 4(4):415–428; 1998. T.; Ochs, B. G.; Aigner, T.; Richter, W. Premature induc- 50. Marlovits, S.; Hombauer, M.; Tamandl, D.; Vecsei, V.; tion of hypertrophy during in vitro chondrogenesis of hu- Schlegel, W. Quantitative analysis of gene expression in man mesenchymal stem cells correlates with calcification human articular chondrocytes in monolayer culture. Int. J. and vascular invasion after ectopic transplantation in Mol. Med. 13(2):281–287; 2004. SCID mice. Arthritis Rheum. 54(10):3254–3266; 2006. 42 MARKWAY ET AL. 64. Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; Jaiswal, 75. Silva, Jr., W. A.; Covas, D. T.; Panepucci, R. A.; Proto- R. K.; Douglas, R.; Mosca, J. D.; Moorman, M. A.; Simo- Siqueira, R.; Siufi, J. L.; Zanette, D. L.; Santos, A. R.; netti, D. W.; Craig, S.; Marshak, D. R. Multilineage po- Zago, M. A. The profile of gene expression of human tential of adult human mesenchymal stem cells. Science marrow mesenchymal stem cells. Stem Cells 21(6):661– 284(5411):143–147; 1999. 669; 2003. 65. Poole, A. R.; Kojima, T.; Yasuda, T.; Mwale, F.; Kobay- 76. Stewart, M. C.; Saunders, K. M.; Burton-Wurster, N.; ashi, M.; Laverty, S. Composition and structure of articu- Macleod, J. N. Phenotypic stability of articular chondro- lar cartilage: A template for tissue repair. Clin. Orthop. cytes in vitro: The effects of culture models, bone mor- Relat. Res. 391(Suppl.):S26–33; 2001. phogenetic protein 2, and serum supplementation. J. Bone 66. Potier, E.; Ferreira, E.; Andriamanalijaona, R.; Pujol, J. P.; Miner. Res. 15(1):166–174; 2000. Oudina, K.; Logeart-Avramoglou, D.; Petite, H. Hypoxia 77. Thijssen, V. L.; Brandwijk, R. J.; Dings, R. P.; Griffioen, affects mesenchymal stromal cell osteogenic differentia- A. W. Angiogenesis gene expression profiling in xeno- tion and angiogenic factor expression. Bone 40(4):1078– graft models to study cellular interactions. Exp. Cell Res. 1087; 2007. 299(2):286–293; 2004. 67. Roberts, S.; Menage, J.; Sandell, L. J.; Evans, E. H.; Rich- 78. Ungrin, M. D.; Joshi, C.; Nica, A.; Bauwens, C.; Zandstra, ardson, J. B. Immunohistochemical study of collagen P. W. Reproducible, ultra high-throughput formation of types I and II and procollagen IIA in human cartilage re- multicellular organization from single cell suspension- pair tissue following autologous chondrocyte implanta- derived human embryonic stem cell aggregates. PLoS tion. Knee 16(5):398–404; 2009. ONE 3(2):e1565; 2008. 68. Robins, J. C.; Akeno, N.; Mukherjee, A.; Dalal, R. R.; 79. Wang, D. W.; Fermor, B.; Gimble, J. M.; Awad, H. A.; Aronow, B. J.; Koopman, P.; Clemens, T. L. Hypoxia in- Guilak, F. Influence of oxygen on the proliferation and duces chondrocyte-specific gene expression in mesenchy- metabolism of adipose derived adult stem cells. J. Cell. mal cells in association with transcriptional activation of Physiol. 204(1):184–191; 2005. Sox9. Bone 37(3):313–322; 2005. 80. Wei, Y.; Hu, H.; Wang, H.; Wu, Y.; Deng, L.; Qi, J. Carti- 69. Scherer, K.; Schunke, M.; Sellckau, R.; Hassenpflug, J.; lage regeneration of adipose-derived stem cells in a hybrid Kurz, B. The influence of oxygen and hydrostatic pressure scaffold from fibrin-modified PLGA. Cell Transplant. on articular chondrocytes and adherent bone marrow cells 18(2):159–170; 2009. in vitro. Biorheology 41(3–4):323–333; 2004. 81. Xu, J.; Wang, W.; Ludeman, M.; Cheng, K.; Hayami, T.; 70. Schmitt, B.; Ringe, J.; Haupl, T.; Notter, M.; Manz, R.; Lotz, J. C.; Kapila, S. Chondrogenic differentiation of hu- Burmester, G. R.; Sittinger, M.; Kaps, C. BMP2 initiates man mesenchymal stem cells in three-dimensional algi- chondrogenic lineage development of adult human mesen- nate gels. Tissue Eng. Part A 14(5):667–680; 2008. chymal stem cells in high-density culture. Differentiation 82. Yoo, J. U.; Barthel, T. S.; Nishimura, K.; Solchaga, L.; 71(9–10):567–577; 2003. Caplan, A. I.; Goldberg, V. M.; Johnstone, B. The chon- 71. Sekiya, I.; Vuoristo, J. T.; Larson, B. L.; Prockop, D. J. drogenic potential of human bone-marrow-derived mesen- In vitro cartilage formation by human adult stem cells chymal progenitor cells. J. Bone Joint Surg. Am. 80(12): from bone marrow stroma defines the sequence of cellular 1745–1757; 1998. and molecular events during chondrogenesis. Proc. Natl. 83. Yuan, J. S.; Reed, A.; Chen, F.; Stewart, Jr., C. N. Statisti- Acad. Sci. USA 99(7):4397–4402; 2002. cal analysis of real-time PCR data. BMC Bioinformatics 72. Selvamurugan, N.; Kwok, S.; Partridge, N. C. Smad3 in- 7:85; 2006. teracts with JunB and Cbfa1/Runx2 for transforming 84. Zheng, Q.; Zhou, G.; Morello, R.; Chen, Y.; Garcia-Rojas, growth factor-beta1-stimulated collagenase-3 expression X.; Lee, B. Type X collagen gene regulation by Runx2 in human breast cancer cells. J. Biol. Chem. 279(26): contributes directly to its hypertrophic chondrocyte-specific 27764–27773; 2004. expression in vivo. J. Cell Biol. 162(5):833–842; 2003. 73. Shui, C.; Spelsberg, T. C.; Riggs, B. L.; Khosla, S. 85. Zhong, H.; Simons, J. W. Direct comparison of GAPDH, Changes in Runx2/Cbfa1 expression and activity during beta-actin, cyclophilin, and 28S rRNA as internal stan- osteoblastic differentiation of human bone marrow stromal dards for quantifying RNA levels under hypoxia. Bio- cells. J. Bone Miner. Res. 18(2):213–221; 2003. chem. Biophys. Res. Commun. 259(3):523–526; 1999. 74. Sierra, J.; Villagra, A.; Paredes, R.; Cruzat, F.; Gutierrez, 86. Zscharnack, M.; Poesel, C.; Galle, J.; Bader, A. Low oxy- S.; Javed, A.; Arriagada, G.; Olate, J.; Imschenetzky, M.; gen expansion improves subsequent chondrogenesis of Van Wijnen, A. J.; Lian, J. B.; Stein, G. S.; Stein, J. L.; ovine bone-marrow-derived mesenchymal stem cells in Montecino, M. Regulation of the bone-specific osteocalcin collagen type I hydrogel. Cells Tissues Organs 190(2):81– gene by p300 requires Runx2/Cbfa1 and the vitamin D3 93; 2009. receptor but not p300 intrinsic histone acetyltransferase activity. Mol. Cell. Biol. 23(9):3339–3351; 2003.

Journal

Cell Transplantation – SAGE

Published: Jan 1, 2010

Keywords: Cartilage regeneration; Bone marrow; Mesenchymal stem cells; Chondrogenesis; Extracellular matrix; Hypoxia

There are no references for this article.