Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Cooperation of interleukin-17 and interferon-γ on chemokine secretion in human fetal intestinal epithelial cells

Cooperation of interleukin-17 and interferon-γ on chemokine secretion in human fetal intestinal... Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Clin Exp Immunol 2001; 125:56 ±63 Cooperation of interleukin-17 and interferon-g on chemokine secretion in human fetal intestinal epithelial cells A. A N D O H * , H . T AK AY A*, J . M AK IN O*, H . S A T O², S . B AMBA *, Y. AR AK I*, K . H ATA * , M . S HI MA DA *, T. OK UN O*, Y . F UJI Y A M A * & T . B A M BA* *Department of Internal Medicine, Shiga University of Medical Science, Seta-Tukinowa, Japan, and ²Department of Clinical Pathology, Otowa Hospital, Yamashina, Kyoto, Japan (Accepted for publication 10 April 2001) SUMMARY Interleukin (IL)-17 is a newly identified T cell-derived cytokine that can regulate the functions of a variety of cell types. In this study, we investigated the effects of IL-17 and interferon (IFN)-g on chemokine secretion in human fetal intestinal epithelial cells. IL-8 and monocyte chemoattractant protein (MCP)-1 secretion by the human fetal intestinal epithelial cell line, intestine-407, was evaluated by ELISA and Northern blot. The expression of IL-17 receptor (R) was analysed by a binding assay using [ I]-labelled IL-17. The activation of nuclear factor-k B (NF-k B), NF-IL6 and AP-1 was assessed by an electrophoretic gel mobility shift assay (EMSA). IL-17 induced a dose-dependent increase in IL-8 and MCP-1 secretion. The inducing effects of IL-17 on IL-8 and MCP-1 mRNA abundance reached a maximum as early as 3 h, and then gradually decreased. IL-17 and IFN-g synergistically increased IL-8 and MCP-1 secretion and mRNA abundance. IFN-g induced a weak increase in IL-17 R mRNA abundance, and incubation with IFN-g for 24 h enhanced [ I]-labelled IL-17-binding by 2´4-fold. IL-17 rapidly induced the phosphorylation and degradation of Ik Ba molecules, and the combination of IL-17 and IFN-g induced a marked increase in NF-k B DNA- binding activity as early as 1´5 h after the stimulation. Furthermore, this combination induced an increase in NF-IL-6 and AP-1 DNA-binding activity. In conclusion, it becomes clear that IL-17 is an inducer of IL-8 and MCP-1 secretion by human fetal intestinal epithelial cells. The combination of IL-17 with IFN-g synergistically enhanced chemokine secretion. These effects of IL-17 and IFN-g might play an important role in the inflammatory responses in the intestinal mucosa. Keywords IBD IL-17 receptor transcription factor INTRODUCTION many different cell types such as monocytes/macrophages, neutrophils, lymphocytes, fibroblasts and endothelial cells [1,2], Chemokines have a broad range of actions on the recruitment and it has been reported that intestinal epithelial cells have an ability function of specific populations of leucocytes at the site of to produce chemokines in response to inflammatory cytokines inflammation. These factors play an important role in the such as IL-1b and tumour necrosis factor (TNF)-a [3]. initiation and maintenance of the host inflammatory response IL-17 is a newly identified T cell-specific cytokine [4,5]. The [1,2]. Chemokines are divided structurally into several groups by human IL-17 is a ,20-kDa glycoprotein of 155 amino acids, the base on the presence of an intervening amino acid between the sequence of which exhibits close homology to both cytotoxic T first two cysteine residues (e.g. C-X-C and C-C chemokines) lymphocyte-associated antigen-8 (CTLA-8) and the open read- [1,2]. The C-X-C chemokines act as chemoattractants and ing frame 13 of T-lymphotropic Herpesvirus saimiri (HVS-13). activators of neutrophils (e.g. interleukin (IL)-8), whereas the C- 1 1 IL-17 secretion is strictly limited in activated CD4 and CD8 C chemokines function mainly as chemoattractants for monocytes, T lymphocytes, predominantly in the memory CD45RO cells eosinophils, T cells and basophils (e.g. monocyte chemoattractant [6± 8]. In particular, both the Th1 and Th2 subsets of CD4 protein (MCP)-1). Although various chemokines are secreted by cells release IL-17. On the other hand, IL-17 receptor (R) is widely distributed on various cell types [9,10], and there is Correspondence: Akira Andoh MD, Department of Internal Medicine, increasing evidence that IL-17 is a potent mediator of Shiga University of Medical Science, Seta-Tukinowa, Otsu 520±2192, inflammatory responses in various tissues. For example, IL-17 Japan. E-mail: [email protected] induces several genes associated with inflammation, including 56 q 2001 Blackwell Science Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 57 IL-6, granulocyte-colony stimulating factor (G-CSF), leukaemia hybridization was performed with [ P]-labelled human IL-8 and inhibitory factor (LIF) and intercellular adhesion molecule MCP-1 probe, generated by a random primed DNA labelling kit (ICAM)-1 [11± 16]. (Amersham, Arlington Heights, IL, USA), and evaluated by Inflammatory bowel diseases (IBD), such as ulcerative colitis autoradiography. The human chemokine cDNA probe was (UC) and Crohn's disease (CD), are characterized by the recurrent prepared from a monolayer of human umbilical vein endothelial flare of inflammation on chronic enterocolitis. The activation of T cells by a reverse-transcription polymerase chain reaction (RT- cells has been regarded as an important factor in the pathogenesis PCR) method using primers: IL-8 (5 : ACATGACTTC of IBD [17 ± 20], and the T cell-rich infiltrate in the mucosa is CAAGCTGGCC corresponding to nucleotides 101± 121 isolated characteristic of the chronic phase. The mechanisms mediating the by Matsushima et al. [26], and 3 : TTTTATGA ATTCCAGCCCT flare of acute response (e.g. neutrophil infiltration) in IBD remain corresponding to nucleotides 404± 385), MCP-1 (5 : AT- unclear. GAAAGTCTCTGC-CGCCCTTCT corresponding to nucleotides A primary function of T cells is the release of cytokines which regulate the magnitude and duration of both immune and (a) inflammatory responses. IL-2, IFN-g and TNF-a released by 1 1 CD4 and CD8 T cells have proinflammatory effects, whereas IL-4 and IL-10 released by CD4 Th2 cells block these responses [14]. In the induction of acute responses during the chronic phase in IBD patients, INF-g and TNF-a have been identified as factors which amplify inflammation by stimulating resident mucosal cells to secrete chemokines that attract immune and inflammatory cells [19,20]. In this study, we set out to investigate the potential role of IL-17 in the induction of inflammatory responses in the intestinal mucosa. In particular, we focused on the interaction between IL-17 and IFN-g in the induction of IL-8 and MCP-1 secretion by intestinal epithelia cells. The observations in this study indicate that T cells play an important role in the inflammatory responses in the intestine through the secretion of IL-17 and IFN-g . MATERIALS AND METHODS Reagents Recombinant human IL-17 and IFN-g were obtained from R&D 0 1 10 100 500 1000 Systems (Minneapolis, MN, USA). All other reagents used in this study were purchased from Sigma Chemical Co. (St Louis, MO, USA). (b) Cells The intestine-407 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). This cell line was established from the small intestine of human fetus [21], retain a normal karyotype (data from ATCC) and exhibit typical epithelial morphology and growth. The cells are used as a model of normal intestinal epithelial cells in vitro [22,23]. The cells were cultured as a monolayer and maintained in Dulbecco's modified Eagle's medium (DMEM: Gibco Laboratories, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco), 5  10 U/l penicillin and 50 m g/l streptomycin. The cells were seeded at a density of 2´5  10 cells/ml, and cell culture media was changed every third day. All experiments were performed after cells had achieved confluence. Quantification of human chemokines The amounts of antigenic IL-8 and MCP-1 in the samples were determined by sandwich enzyme-linked immunosorbent assay 0 1 10 100 500 1000 (ELISA) kits purchased from Bio-Source (Camarillo, CA, USA). IL-17 (ng/ml) Northern blot analysis Fig. 1. Effects of IL-17 on IL-8 and MCP-1 secretion in intestine 407 Total cellular RNA was isolated by the acid guanidinium cells. The cells were incubated for 48 h in the presence of increasing thiocyanate ± phenol± chloroform method [24]. Northern blot was concentrations of IL-17. The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean^SD (n ˆ 4). performed according to methods described previously [25]. The q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 MCP-1 (pg / 10 cells) IL-8 (pg / 10 cells) Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 58 A. Andoh et al. Fig. 2. (a) Kinetics of IL-17-induced increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. Intestine-407 cells were stimulated with IL-17 (500 ng/ml), and the abundance of IL-8 and MCP-1 mRNA was sequentially determined by Northern blotting. (b) Kinetics of IL-17-induced increase in IL-8 (b) and MCP-1. (c) Secretion in intestine-407 cells. Intestine-407 cells were stimulated with IL- 17 (500 ng/ml), and the amounts of IL-8 and MCP-1 in supernatants were determined by ELISA. X, data of IL-17; W, data of medium only. Values were expressed as mean^SD (n ˆ 4). 1 ± 24 isolated by Yoshimura et al. [27], and 3 : TGAGTGTT by the Iodo-Gen method (Pierce, Rockford, IL, USA). Intestine- CAAGTCTTCGGAGTT corresponding to nucleotides 299± 278), 407 cells were cultured in 6-well plates and cultured for 24 h in and IL-17 R (5 : TGAAGGTAA-CCACGCCATGCAT corre- the presence or absence of IFN-g (200 U/ml). Non-specific sponding to nucleotides 601 ±622 isolated by Schall et al. [9], and binding of [ I]-IL-17 was determined by the count in the 3 : TCGGCTGAGTAGATGATCCAGA coresponding to nucleo- presence of a 500-fold excess of cold IL-17. tides 1192 ±1171). The PCR products were ligated into the TA cloning vector (Promega, Madison, WI, USA) and sequenced by Nuclear extracts and electrophoretic gel mobility shift assays the dideoxynucleotide chain termination method [28]. Nuclear extracts were prepared from intestine-407 cells exposed to IL-17 (500 ng/ml) and IFN-g (200 U/ml) for 1´5 h by the Radioiodination of recombinant IL-17 and binding assay method of Dignam and Roeder [29± 31]. Consensus oligonucleo- 125 0 Recombinant human IL-17 was labelled with 1 mCi of [ NaI] tides of NF-kB(5 : AATCGTGGAATTT-CCTCTGACA) [32], q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 59 Fig. 3. Effects of IFN-g on IL-17-induced secretion of IL-8 (a) and MCP-1 (b). Intestine-407 cells were incubated for 48 h in the presence or absence of IL-17 (500 ng/ml), IFN-g (200 U/ml), or IL-17 (500 ng/ml) plus IFN-g (200 U/ml). The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean^SD (n ˆ 4). Northern analysis of the effects of IL-17 and IFN-g on IL-8 (c) and MCP-1 (d) mRNA abundance in intestine-407 cells. The cells were incubated for 3 h in the presence or absence of IL-17 (500 ng/ml), IFN-g (200 U/ml), or IL-17 (500 ng/ml) plus IFN-g (200 U/ml), and then Northern blotting was performed. The same membrane was used for the determination of IL-8 and MCP-1 mRNA expression. NF-IL6 (TGCAGATTGCGCAATCTGCA) [33] and AP-1 (c-jun: Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Experiments 5 -CGCTTG ATG AGTCAGCCGGAA) [34 ± 39] were used. The with unlabelled oligonucleotides used a 100-fold molar excess consensus sequence for binding of transcription factor was relative to the radiolabelled oligonucleotide. underlined. Oligonucleotides were 5 end-labelled with T4 polynucleotide kinase (Promega, Madison, WI, USA) and RESULTS [g - P]ATP (Amersham). Binding reactions were performed according to methods described previously. Supershift experi- Induction of chemokine secretion by IL-17 ments were performed as described above except that 1 mlof Intestine-407 cells were incubated with increasing concentrations antibody to each transcription factor was added to the binding of IL-17, and IL-8 and MCP-1 levels in supernatants were mixture in the absence of labelled probe. Antisera specifically determined by ELISA. As shown in Fig. 1, the addition of recognizing each transcriptional factor were purchased from Santa IL-17 induced a dose-dependent increase in IL-8 and MCP-1 q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 60 A. Andoh et al. MCP-1 mRNA abundance then gradually decreased. As demon- strated in Fig. 2b,c, IL-17 induced a rapid secretion of IL-8 and MCP-1 as early as 12 h, and this then became slower. Effects of IL-17 in combination with IFN-g on chemokine secretion Intestine-407 cells were stimulated with IL-17 (500 ng/ml), IFN-g (200 U/ml) or IL-17 plus IFN-g . As shown in Fig. 3a,b, IFN-g induced a marked increase in MCP-1 secretion, whereas IFN-g did not affect IL-8 secretion. However, the combination of IL-17 and IFN-g induced a marked increase in both IL-8 and MCP-1 secretion. These effects were also observed at the level of mRNA (Fig. 3c,d). Intestine-407 cells were stimulated with IL-17, IFN-g , or IL-17 plus IFN-g for 3 h, and IL-8 and MCP-1 mRNA abundance was determined by Northern blotting. IFN-g induced a rapid increase in MCP-1 mRNA abundance, but its effect on IL-8 mRNA abundance was relatively modest. However, the combination of IL-17 and IFN-g induced a marked increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. These results were compatible with the observations at protein levels. Fig. 4. Kinetics of IL-17 receptor (R) mRNA abundance in intestine-407 cells. The cells were incubated in the presence of IL-17 (500 ng/ml), and Induction of IL-17 receptor (R) expression by IFN-g IL-17 R mRNA abundance was sequentially determined by Northern The induction of TNF-a receptor (R) expression by IFN-g has blotting. been reported [40], and this has been regarded as one of the mechanisms mediating the synergistic effects of TNF-a plus IFN-g on chemokine secretion. To define the role of similar secretion. The induction of chemokine secretion was clearly mechanisms in effects combined of IL-17 and IFN-g,we detectable at an IL-17 concentration of 100 ng/ml. When evaluated the effects of IFN-g on IL-17 R expression in comparing the effects of IL-17 with those induced by IL-1b or intestine-407 cells. As shown in Fig. 4, IFN-g induced a weak TNF-a , the effects of IL-17 were relatively modest; IL-1b 6 increase in IL-17 R mRNA abundance as early as 3 h, and this (50 ng/ml) induced 6´8 ^ 3´5 ng IL-8/10 cells and 8´0 ^ 2´4 ng 6 effect persisted for 12 h the binding assay using [ I]-labelled MCP-1/10 cells, and TNF-a (100 ng/ml) induced 6 6 IL-17 revealed that treatment with IFN-g for 24 h induced an 10´1 ^ 4´6 ng IL-8/10 cells and 9´6 ^ 3´4 ng MCP-1/10 cells, approximately two-fold increase in IL-17 binding (Table 1). respectively. These observations indicate that IL-g weakly induces IL-17 R The effects of IL-17 on IL-8 and MCP-1 mRNA abundance in expression in this cell line. intestine-407 cells were also investigated. Cells were incubated with IL-17 (500 ng/ml), and IL-8 and MCP-1 mRNA levels were Modulation of transcription factor activation successively determined by Northern blotting (Fig. 2a). IL-17 The importance of transcription factor activation in the induced a rapid increase in chemokine mRNA abundance at as regulation of many genes has been reported. In particular, the early as 1 h, and this reached a peak at 3 h. Induced-IL-8 and expression of several genes, including IL-8 and MCP-1, is regulated by the activation of specific transcription factors such as NF-k B, NF-IL6 and AP-1 [32± 38]. To elucidate the mechanisms underlying the response to IL-17, we evaluated activation of the transcription factors NF-k B, NF-IL6 and AP-1 in intestine-407 cells. As demonstrated in Fig. 5a, stimulation with IL-17 (500 ng/ml) for 1´5 h induced a weak increase in Table 1. Effects of IFN2g on [ ]-labelled IL-17 binding in intestine 407 cells Fig. 5. Electrophoretic gel mobility shift assays (EMSA) for NF-k B (a), Specific bound* Specific bound/cell 4 28 NF-IL6 (b) and AP-1 (c) DNA-binding activities. The cells were incubate (10 cpm) (10 ng/cell) with medium alone, IL-17 (500 ng/ml), IFN-g (200 U/ml) or IL-17 (500 ng/ml) plus IFN-g (200 U/ml) for 1´5 h, and then nuclear extracts Medium 6´32^2´23 1´90^0´67 were prepared. Lane 1, medium alone; lane 2, IL-17; lane 3, IFN-g ; lane 4, Incubated with IFN-g 15´56^3´04 4´61^0´96 IL-17 plus IFN-g; lane 5, IL-17 plus cold probe; lane 6, IL-17 plus antip50 antibody; lane 7, IL-17 plus antip65 antibody and (c) lane 1, medium Specific bound* ˆ (total bound) - (non-specific bound). Specific alone; lane 2, IL-17; lane 3, IFN-g ; lane 4, IL-17 plus IFN-g ; lane 5, IL-17 125 5 activity of [ I]-labelled IL-17 was 4´0  10 cpm/ng. plus cold probe. NS at the right side means non-specific band. q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 61 IFN-g in the regulation of chemokine secretion by human fetal intestinal epithelial cells. Combined stimulation leads to syner- gistic effects on IL-8 and MCP-1 secretion. Since both IL-17 and IFN-g are products of activated T cells, these observations indicate that T cells play an important role in inflammatory responses in the intestine. Intestinal epithelial cells play an important role in the first line of defence [30]. The primary role of the intestinal epithelial cells is to act as a physical barrier, separating the contents of a harsh luminal environment from the layers of tissue composing the internal milieu. Several lines of evidence have recently indicated that the intestinal epithelial cells also serve as active participants in various immunological functions. Fig. 6. Western blot analysis for Ik Ba degradation. The cells were Several studies have revealed the ability of intestinal epithelial stimulated with IL-17 (500 ng/ml), and then total Ik Ba molecules (lower cells to secrete chemokines, such as IL-8, MCP-1, epithelial lane) and phosphorylated Ik Ba molecules (upper lane) were sequentially neutrophil-activating peptide (ENA) 78 and macrophage analysed by Western blotting. inflammatory protein (MIP)-1 [3,30]. Intestinal epithelial cells express elevated chemokine mRNA levels during the develop- ment of colitis in IL-2-deficient mice [31]. Under conditions which promote infection or insult to the epithelial monolayer, NF-k B-DNA binding activity (lane 2), whereas IFN-g (200 U/ these chemokines, derived from intestinal epithelial cells, ml) had no effects (lane 3). However, the combination of IL-17 promote a rapid influx of immune and inflammatory cells into and IFN-g induced a marked increase in NF-k B-DNA binding the mucosa within hours. Because most of these chemokines activity (lane 4). The specificity of this reaction was confirmed are specific for a certain cell type, the ratio and concentration by the addition of cold oligo-DNA, which abolished the of the different chemokines will determine the composition of reactive band (lane 5). The addition of antibody directed against the cell infiltrate [1,2]. Previous studies have focused primarily a 65 000 MW-subunit (p65) of NF-k B induced a complete on the role of cytokines secreted by monocytes/macrophages. supershift of the binding complexes (lane 7), whereas the For example, IL-1b , IL-6 and TNF-a , which are mainly antibody against a 50 000 MW-subunit (p50) induced a weak produced by monocytes/macrophages, have been established as reaction. Thus, these findings indicate that the major binding potent stimulators of chemokine secretion in intestinal epithelial complex was a homodimer consisting of p65 subunits. We also cells. However, the exact role of IL-17, a cytokine derived from tested the effects of IL-17 and IFN-g on NF-IL6 DNA-binding T cells, remains unclear. activity (Fig. 6b). IL-17 did not affect NF-IL6 DNA binding activity, The induction of chemokine secretion by IL-17 has been whereas IFN-g increased NF-IL6 DNA binding activity. The previously reported in rodent intestinal epithelial cells [16]. combination of IL-17 plus IFN-g further enhanced this reaction. However, human intestinal epithelial cells have not been The specificity of this binding was also confirmed; the reactive previously studied. Here, we report that IL-17 and IFN-g band disappeared following the addition of a cold probe. synergistically induce IL-8 and MCP-1 secretion by human Concerning AP-1 activation, IL-17, but not IFN-g , enhanced intestinal epithelial cells. Similar synergistic effects of IL-17 and AP-1 DNA-binding activity (Fig. 6c). In addition, IFN-g weakly IFN-g have been previously reported in other cell types. For enhanced IL-17-induced AP-1 DNA-binding activity. Based on example, IL-17 and IFN-g synergistically up-regulate GM-CSF, these observations, we concluded that NF-k B, NF-IL6 and AP-1 GRO-a and IL-6 secretion in human keratinocytes [7]. To our activation plays a role in IL-17 and IFN-g -induced enhancement knowledge, this is the first report describing the synergistic effects of chemokine mRNA expression in intestine-407 cells. of IL-17 and IFN-g on chemokine secretion in human intestinal epithelial cells. These observations suggest an important role for Degradation of Ik Ba molecules IL-17 in the induction of inflammatory responses in the intestinal NF-k B activation is regulated by its cytoplasmic association with mucosa. Ik B molecules, which mask the nuclear localization signal of NF- T cell activation has been reported to play an important role in k B [35]. In most cells, Ik Ba is the predominant inhibitory the pathogenesis of IBD [19,20]. Infiltration of T cells is a molecule, and the activation and translocation of NF-kBinto the characteristic feature of chronic inflammation in IBD, and nucleus is contingent upon its release from Ik Ba.Numerous neutrophil infiltration becomes prominent in accordance with stimuli, including IL-1b and TNF-a , rapidly induce the the progress of disease activity. The synergistically induced IL-8 phosphorylation and proteolytic degradation of Ik Ba and the and MCP-1 secretion by intestinal epithelial cells in response to consequent activation of NF-k B. To confirm the activation of IL-17 and IFN-g emphasizes the important role of T-cell products Ik Ba molecules by IL-17 in intestine-407 cells, we assessed the in the induction of acute responses during chronic inflammation in activation of Ik Ba molecules. As demonstrated in Fig. 6, IL-17 the intestine. Elevated production of chemokines leads to further induced phosphorylation of Ik Ba molecules as early as 15 min, attraction of inflammatory cells and hence an amplification of the and a decrease in total IkBa molecules was subsequently observed. acute response. It is thought that the chronic inflammation in IBD patients is predominantly driven by Th1 immune responses [19,20]. Furthermore, expression of IFN-g is restricted to Th1 DISCUSSION cells, and IL-17 is secreted by both Th1 and Th2 cells. Therefore, the combined effects of Il-17 and IFN-g might play a prominent The present study demonstrated an important role for IL-17 and q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 62 A. Andoh et al. role in the Th1-mediated `acute on chronic' inflammation in IBD. ACKNOWLEDGEMENTS The exact role of IL-17 in the pathogenesis of IBD should be This study was supported in part by a Grant-in-Aid for Scientific Research evaluated further in future. from the Ministry of Education, Science, and Culture, Japan (12470121). The promoter regions of the human IL-8 and MCP-1 genes have previously been cloned, sequenced and shown to contain putative consensus binding motifs for the transcription factor NF- REFERENCES k B, NF-IL6 and AP-1 [32 ± 38]. NF-k B is important in the transcriptional activation of genes encoding the proteins that 1 Miller MD, Krangel MS. Biology and biochemistry of the chemokines: participate in the inflammatory and immune responses [32]. NF- a family of chemotactic and inflammatory cytokines. Crit Rev k B activation is regulated by its cytoplasmic association with Ik B Immunol 1992; 12:17±46. molecules, which mask the nuclear localization signal of NF-k B 2 Baggiolimi M, Dewald B, Moser B. Interleukin-8 and related [32,35]. In most cells Ik Ba is the predominant inhibitory chemotactic cytokines-CXC and CC chemokines. Adv Immunol 1994; 55:97 ±179. molecule, and the activation and translocation of NF-k B into 3 Eckmann L, Jung HC, Schurer-Maly C et al. Differential cytokine the nucleus is contingent upon its release from Ik Ba . Previous expression by human intestinal epithelial cell line: regulated expres- reports have shown NF-k B activation by IL-17 in several cell sion of interleukin 8. Gastroenterology 1993; 105:1689±97. types [14,16]. Furthermore, it has been shown that the signal 4 Fossiez F, Banchereau J, Murry R, van Kooten C, Garrone P, Lebecque transduction events triggered by IL-17 which induce NF-k B S. Interleukin-17. Intern Rev Immunol 1998; 16:541±51. activation involve MAP kinase activation downstream of TRAF6 5 Yao Z, Painter SL, Fanslow WC et al. Human IL-17: a novel cytokine [16]. Our results demonstrated that the activation of NF-k B was derived from T cells. J Immunol 1995; 155:5483±6. induced by IL-17, and this induction was associated with Ik Ba 6 Kennedy J, Rossi DL, Zurawski SM et al. Mouse IL-17: a cytokine 1 2 phosohorylation and degradation. More interestingly, the combi- preferentially expressed by ab TCR CD4±CD8 T cells. J Interferon Cytokine Res 1996; 16:611±7. nation of IL-17 and IFN-g induced a marked increase in NF-k B 7 Albanesi C, Scarponi C, Cavani A, Federici M, Nasorri F, Girolomoni DNA-binding activity. Similar results were also observed in AP-1 G. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and DNA binding activity. On the other hand, IL-17 did not affect NF- modulates interferon-g- and interleukin-4-induced activation of human IL6 DNA binding activity, whereas IFN-g induced an increase in keratinocytes. J Invest Dermatol 2000; 115:81 ±7. NF-IL6 DNA-binding activity. The induction of NF-IL6 DNA 8 Shin HC, Benbernou N, Esnault S, Guenounou M. Expression of IL-17 binding activity by IFN-g has recently been reported [39], but 1 in human memory CD45RO T lymphocytes and its regulation by there are no reports of how IL-17 modulates NF-IL6 and AP-1 protein kinase A pathway. Cytokine 1999; 11:257±66. DNA-binding activity. Our results suggest that IL-17 and IFN-g 9 Yao Z, Spriggs MK, Derry JM et al. Molecular characterization of the enhanced IL-8 and MCP-1 mRNA expression and secretion human interleukin (IL) -17 receptor. Cytokine 1997; 9:794±800. through synergistic effects on NF-k B, NF-IL-6 and AP-1 DNA 10 Yao Z, Fanslow WC, Seldin MF et al. Herpesvirus Saimiri encodes a new cytokine, IL-17, which bind to a novel cytokine receptor. binding activity. Immunity 1995; 3:811±21. The detail of mechanisms mediating the synergism between 11 Fossiez F, Djossou O, Chomarat P et al. T cell interleukin-17 induces IL-17 and IFN-g remains unclear. In this study we tested the stromal cells to produce proinflammatory and hematopoietic cytokines. possibility that IFN-g modulates IL-17R expression in intestine- J Exp Med 1996; 183:2593±603. 407 cells, since several reports have shown that IFN-g induces the 12 Chabaud M, Fossiez F, Taupin JL, Miossec P. Enhancing effects of IL- up-regulation of TNF-a R expression and enhances the inflam- 17 on IL-1-induced IL-6 and leukemia inhibitory factor production by matory effects of TNF-a [40]. The addition of IFN-g weakly rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. induced an increase in IL-17R mRNA abundance, and the J Immunol 1998; 161:409±14. incubation for 24 h significantly increased IL-17 binding activity 13 Cai XY, Gommol CPJ, Justice L, Narula SK, Fine JS. Reglation of by two-fold. However, the synergistic effect of IL-17 and IFN-g granulocyte colony-stimulating factor gene expression by interleukin- 17. Immunol Lett 1998; 62:51 ±8. on NF-k B activation was observed as early as 1´5 h. This rapid 14 Jovanovic DV, Di Battista JA, Martel PJ et al. IL-17 stimulates the induction of NF-k B binding activity indicates that the synergistic production and expression of proinflammatory cytokines, IL-1b and effect of IL-17 and IFN-g on chemokine secretion is not regulated TNF-a, by human macrophages. J Immunol 1998; 60:3513±21. at the level of IL-17R expression. It is likely that other 15 Albanesi C, Cavani A, Girolomoni G. IL-17 is produced by nickel- mechanisms, such as the convergence of intracellular pathways, specific T lymphocytes and regulates ICAM-1 expression and may contribute to this process. For example, how IL-17 affect chemokine production in human keratinocytes: synergistic or antago- IFN-g -induced STAT1 activation in this cell line should be nist effects with IFN-g and TNF-a. J Immunol 1999; 162:494±502. further defined, because studies with a variety of human cell types 16 Awane M, Andres PG, Li DJ, Reinecker HC. NF-kB-inducing kinase is have demonstrated that TNF-a and IFN-g coregulate in a a common mediator of IL-17-, TNF-a-, and IL-1b-induced chemokine synergistic manner the expression of many inflammatory genes promoter actiation in intestinal epithelial cells. J Immunol 1999; 162:5337±44. via the independent activation of two distinct transcription factor 17 Boirivant M, Marini M, DiFelice G et al. Lamina propria T cells in NF-k B and STAT-1 [41]. Further investigations will be required Crohn's disease and other gastrointestinal inflammation show to define the exact mechanisms mediating the synergistic effects defective CD2 pathway-induced apoptosis. Gastroenterology 1999; of IL-17 and IFN-g . 116:557±65. In conclusion, T-cell derived IL-17 and IFN-g synergisti- 18 Saubermann LJ, Probert CSJ, Christ AD et al. Evidence of T cell cally increase chemokine IL-8 and MCP-1 secretion by receptor b-chain patterns in inflammatory and noninflammatory bowel intestinal epithelial cells. These observations reinforce the disease states. Am J Physiol 1999; 276:G613±G21. concept that T-cell derived cytokines can collaborate in the 19 Kam LY, Targan SR. Cytokine-based therapies in inflammatory bowel promotion and shaping of inflammatory responses in the disease. Curr Opin Gastroenterol 1999; 15:302±7. intestinal mucosa. 20 Dohi T, Fujihashi K, Kiyono H, Elson CO, McGhee JR. Mice deficient q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 63 in Th1- and Th2-type cytokines develop distinct forms of hapten- Alteration of gene expression by intestinal epithelial cells precedes induced colitis. Gastroenterology 2000; 119:724±33. colitis in interleukin-2 deficient mice. Am J Physiol 1998; 274:G472±9. 21 Henle G, Deinhardt F. The establishment of strains of human cells in 32 Kim J, Sanders SP, Siekierski ES, Casolaro V, Proud D. Role of NF- tissue culture. J Immunol 1957; 79:54±9. kB incytokine production induced from human airway epithelial cells 22 Kawanishi M. The Epstein±Barr virus latent membrane protein 1 by rhinovirus infection. J Immunol 2000; 165:3384±92. (LMP1) enhances TNF-a-induced apoptosis of intestine 407 epithelial 33 Akira S, Isshiki H, Sugita T et al. A nuclear factor for IL-6 expression cells: the role of LMP1 C-terminal activation regions 1 and 2. Virology (NF-IL6) is a member of a C/EBP family. EMBO J 1990; 9:1897±906. 2000; 270:258±66. 34 Bohmann D, Bos TJ, Admon A et al. Human proto-oncogene c-jun 23 Andoh A, Takaya H, Araki y Tsujikawa T, Fujiyama Y, Bamba T. encodes a DNA binding protein with structural and functional Medium- and long-chain fatty acids differentially modulate inter- properties of transcriptional factor AP-1. Science 1987; 238:1386±92. leukin-8 secretion in human fetal intestinal epithelial cells. J Nutr 35 Finco TS, Baldwin AS. Mechanistic aspects of NF-kB regulation: the 2000; 130:2636±40. emerging role of phosphorylation and proteolysis. Immunity 1995; 24 Chomczynski P, Sacchi N. Single-step method of RNA isolation by 3:263±72. acid guanidinium thiocyanate-phenol-chloroform extraction. Anal 36 Kunsh C, Lang RK, Rosen CA, Shannon MF. Synergistic transcrip- Biochem 1987; 162:156±9. tional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF- 25 Andoh A, Takaya H, Saotome T et al. Cytokine regulation of chemokine IL6. J Immunol 1994; 153:153±64. (IL-8, MCP-1, and RANTES) gene expression in human pancreatic 37 Martin T, Cardarelli PM, Parry GC, Felts KA, Cobb RR. Cytokine periacinar myofibroblasts. Gastroenterology 2000; 119:211±9. induction of monocyte chemottractant protein-1 gene expression in 26 Matsushima K, Morishita K, Yoshimura T et al. Molecular cloning of a human endothelial cells depends on the cooperative action of NF-kB human monocyte-derived neutrophil chemotactic factor (MDNCF) and and AP-1. Eur J Immunol 1997; 27:1091±7. the induction of MDCF mRNA by interleukin 1 and tumor necrosis 38 Yasumoto K, Okamoto S, Mukaida N, Murakami S, Mai M, factor. J Exp Med 1988; 167:1883±93. Matsushima K. Tumor necrosis factor a and interferon g 27 Yoshimura T, Yuhki N, Moore SK, Appella E, Lerman MI, Leonald synergistically induce interleukin 8 production in a human gastric EJ. Human monocyte chemoattractant protein-1 (MCP-1). Full-length cancer cell line through acting concurrently on AP-1 and NF-kB- cDNA cloning, expression in mitogen-stimulated blood mononuclear like binding sites of the interleukin 8 gene. J Biol Chem 1992; leukocytes, and sequence similarity to mouse competence gene JE. 267:22506±11. FEBS Lett 1989; 244:487±93. 39 Roy SK, Wachira SJ, Weihua X, Hu J, Kalvakolanu DV. CCAAT/ 28 Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain- enhancing-binding protein-b regulates interferon-induced transcription terminating inhibitors. Proc Natl Acad Sci USA 1977; 74:5463±7. through a novel element. J Biol Chem 2000; 275:12626±32. 29 Dignam JP, Lebovitz RM, Roeder RG. Accurate transcription initiation 40 Ruggiero V, Tavernier J, Fiers W, Baglioni C. Induction of the by RNA polymerase II in a soluble extract from isolated mammalian synthesis of tumor necrosis factor receptors by interferon-g. J Immunol nuclei. Nucl Acids Res 1983; 11:1475±89. 1986; 136:2445±50. 30 Pitman RS, Blumberg RS. First line of defence: the role of the 41 Ohmori Y, Schreiber RD, Hamilton TA. Synergy between IFN-g and intestinal epithelium as an active component of the mucosal immune TNF-a in transcriptional activation is mediated by cooperation system. J Gastroenterol 2000; 35:805±14. between signal transducer and activator of transcription 1 and nuclear 31 Meijssen MA, Brandwein SL, Reinecker HC, Bhan AK, Podolsky DK. factor kB. J Biol Chem 1997; 272:14899±907. q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Clinical & Experimental Immunology Oxford University Press

Cooperation of interleukin-17 and interferon-γ on chemokine secretion in human fetal intestinal epithelial cells

Download PDF
8 pages

Loading next page...
 
/lp/oxford-university-press/cooperation-of-interleukin-17-and-interferon-on-chemokine-secretion-in-cKjYq9f40P

References (46)

Publisher
Oxford University Press
Copyright
Copyright © 2022 British Society for Immunology
ISSN
0009-9104
eISSN
1365-2249
DOI
10.1046/j.1365-2249.2001.01588.x
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Clin Exp Immunol 2001; 125:56 ±63 Cooperation of interleukin-17 and interferon-g on chemokine secretion in human fetal intestinal epithelial cells A. A N D O H * , H . T AK AY A*, J . M AK IN O*, H . S A T O², S . B AMBA *, Y. AR AK I*, K . H ATA * , M . S HI MA DA *, T. OK UN O*, Y . F UJI Y A M A * & T . B A M BA* *Department of Internal Medicine, Shiga University of Medical Science, Seta-Tukinowa, Japan, and ²Department of Clinical Pathology, Otowa Hospital, Yamashina, Kyoto, Japan (Accepted for publication 10 April 2001) SUMMARY Interleukin (IL)-17 is a newly identified T cell-derived cytokine that can regulate the functions of a variety of cell types. In this study, we investigated the effects of IL-17 and interferon (IFN)-g on chemokine secretion in human fetal intestinal epithelial cells. IL-8 and monocyte chemoattractant protein (MCP)-1 secretion by the human fetal intestinal epithelial cell line, intestine-407, was evaluated by ELISA and Northern blot. The expression of IL-17 receptor (R) was analysed by a binding assay using [ I]-labelled IL-17. The activation of nuclear factor-k B (NF-k B), NF-IL6 and AP-1 was assessed by an electrophoretic gel mobility shift assay (EMSA). IL-17 induced a dose-dependent increase in IL-8 and MCP-1 secretion. The inducing effects of IL-17 on IL-8 and MCP-1 mRNA abundance reached a maximum as early as 3 h, and then gradually decreased. IL-17 and IFN-g synergistically increased IL-8 and MCP-1 secretion and mRNA abundance. IFN-g induced a weak increase in IL-17 R mRNA abundance, and incubation with IFN-g for 24 h enhanced [ I]-labelled IL-17-binding by 2´4-fold. IL-17 rapidly induced the phosphorylation and degradation of Ik Ba molecules, and the combination of IL-17 and IFN-g induced a marked increase in NF-k B DNA- binding activity as early as 1´5 h after the stimulation. Furthermore, this combination induced an increase in NF-IL-6 and AP-1 DNA-binding activity. In conclusion, it becomes clear that IL-17 is an inducer of IL-8 and MCP-1 secretion by human fetal intestinal epithelial cells. The combination of IL-17 with IFN-g synergistically enhanced chemokine secretion. These effects of IL-17 and IFN-g might play an important role in the inflammatory responses in the intestinal mucosa. Keywords IBD IL-17 receptor transcription factor INTRODUCTION many different cell types such as monocytes/macrophages, neutrophils, lymphocytes, fibroblasts and endothelial cells [1,2], Chemokines have a broad range of actions on the recruitment and it has been reported that intestinal epithelial cells have an ability function of specific populations of leucocytes at the site of to produce chemokines in response to inflammatory cytokines inflammation. These factors play an important role in the such as IL-1b and tumour necrosis factor (TNF)-a [3]. initiation and maintenance of the host inflammatory response IL-17 is a newly identified T cell-specific cytokine [4,5]. The [1,2]. Chemokines are divided structurally into several groups by human IL-17 is a ,20-kDa glycoprotein of 155 amino acids, the base on the presence of an intervening amino acid between the sequence of which exhibits close homology to both cytotoxic T first two cysteine residues (e.g. C-X-C and C-C chemokines) lymphocyte-associated antigen-8 (CTLA-8) and the open read- [1,2]. The C-X-C chemokines act as chemoattractants and ing frame 13 of T-lymphotropic Herpesvirus saimiri (HVS-13). activators of neutrophils (e.g. interleukin (IL)-8), whereas the C- 1 1 IL-17 secretion is strictly limited in activated CD4 and CD8 C chemokines function mainly as chemoattractants for monocytes, T lymphocytes, predominantly in the memory CD45RO cells eosinophils, T cells and basophils (e.g. monocyte chemoattractant [6± 8]. In particular, both the Th1 and Th2 subsets of CD4 protein (MCP)-1). Although various chemokines are secreted by cells release IL-17. On the other hand, IL-17 receptor (R) is widely distributed on various cell types [9,10], and there is Correspondence: Akira Andoh MD, Department of Internal Medicine, increasing evidence that IL-17 is a potent mediator of Shiga University of Medical Science, Seta-Tukinowa, Otsu 520±2192, inflammatory responses in various tissues. For example, IL-17 Japan. E-mail: [email protected] induces several genes associated with inflammation, including 56 q 2001 Blackwell Science Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 57 IL-6, granulocyte-colony stimulating factor (G-CSF), leukaemia hybridization was performed with [ P]-labelled human IL-8 and inhibitory factor (LIF) and intercellular adhesion molecule MCP-1 probe, generated by a random primed DNA labelling kit (ICAM)-1 [11± 16]. (Amersham, Arlington Heights, IL, USA), and evaluated by Inflammatory bowel diseases (IBD), such as ulcerative colitis autoradiography. The human chemokine cDNA probe was (UC) and Crohn's disease (CD), are characterized by the recurrent prepared from a monolayer of human umbilical vein endothelial flare of inflammation on chronic enterocolitis. The activation of T cells by a reverse-transcription polymerase chain reaction (RT- cells has been regarded as an important factor in the pathogenesis PCR) method using primers: IL-8 (5 : ACATGACTTC of IBD [17 ± 20], and the T cell-rich infiltrate in the mucosa is CAAGCTGGCC corresponding to nucleotides 101± 121 isolated characteristic of the chronic phase. The mechanisms mediating the by Matsushima et al. [26], and 3 : TTTTATGA ATTCCAGCCCT flare of acute response (e.g. neutrophil infiltration) in IBD remain corresponding to nucleotides 404± 385), MCP-1 (5 : AT- unclear. GAAAGTCTCTGC-CGCCCTTCT corresponding to nucleotides A primary function of T cells is the release of cytokines which regulate the magnitude and duration of both immune and (a) inflammatory responses. IL-2, IFN-g and TNF-a released by 1 1 CD4 and CD8 T cells have proinflammatory effects, whereas IL-4 and IL-10 released by CD4 Th2 cells block these responses [14]. In the induction of acute responses during the chronic phase in IBD patients, INF-g and TNF-a have been identified as factors which amplify inflammation by stimulating resident mucosal cells to secrete chemokines that attract immune and inflammatory cells [19,20]. In this study, we set out to investigate the potential role of IL-17 in the induction of inflammatory responses in the intestinal mucosa. In particular, we focused on the interaction between IL-17 and IFN-g in the induction of IL-8 and MCP-1 secretion by intestinal epithelia cells. The observations in this study indicate that T cells play an important role in the inflammatory responses in the intestine through the secretion of IL-17 and IFN-g . MATERIALS AND METHODS Reagents Recombinant human IL-17 and IFN-g were obtained from R&D 0 1 10 100 500 1000 Systems (Minneapolis, MN, USA). All other reagents used in this study were purchased from Sigma Chemical Co. (St Louis, MO, USA). (b) Cells The intestine-407 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). This cell line was established from the small intestine of human fetus [21], retain a normal karyotype (data from ATCC) and exhibit typical epithelial morphology and growth. The cells are used as a model of normal intestinal epithelial cells in vitro [22,23]. The cells were cultured as a monolayer and maintained in Dulbecco's modified Eagle's medium (DMEM: Gibco Laboratories, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco), 5  10 U/l penicillin and 50 m g/l streptomycin. The cells were seeded at a density of 2´5  10 cells/ml, and cell culture media was changed every third day. All experiments were performed after cells had achieved confluence. Quantification of human chemokines The amounts of antigenic IL-8 and MCP-1 in the samples were determined by sandwich enzyme-linked immunosorbent assay 0 1 10 100 500 1000 (ELISA) kits purchased from Bio-Source (Camarillo, CA, USA). IL-17 (ng/ml) Northern blot analysis Fig. 1. Effects of IL-17 on IL-8 and MCP-1 secretion in intestine 407 Total cellular RNA was isolated by the acid guanidinium cells. The cells were incubated for 48 h in the presence of increasing thiocyanate ± phenol± chloroform method [24]. Northern blot was concentrations of IL-17. The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean^SD (n ˆ 4). performed according to methods described previously [25]. The q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 MCP-1 (pg / 10 cells) IL-8 (pg / 10 cells) Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 58 A. Andoh et al. Fig. 2. (a) Kinetics of IL-17-induced increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. Intestine-407 cells were stimulated with IL-17 (500 ng/ml), and the abundance of IL-8 and MCP-1 mRNA was sequentially determined by Northern blotting. (b) Kinetics of IL-17-induced increase in IL-8 (b) and MCP-1. (c) Secretion in intestine-407 cells. Intestine-407 cells were stimulated with IL- 17 (500 ng/ml), and the amounts of IL-8 and MCP-1 in supernatants were determined by ELISA. X, data of IL-17; W, data of medium only. Values were expressed as mean^SD (n ˆ 4). 1 ± 24 isolated by Yoshimura et al. [27], and 3 : TGAGTGTT by the Iodo-Gen method (Pierce, Rockford, IL, USA). Intestine- CAAGTCTTCGGAGTT corresponding to nucleotides 299± 278), 407 cells were cultured in 6-well plates and cultured for 24 h in and IL-17 R (5 : TGAAGGTAA-CCACGCCATGCAT corre- the presence or absence of IFN-g (200 U/ml). Non-specific sponding to nucleotides 601 ±622 isolated by Schall et al. [9], and binding of [ I]-IL-17 was determined by the count in the 3 : TCGGCTGAGTAGATGATCCAGA coresponding to nucleo- presence of a 500-fold excess of cold IL-17. tides 1192 ±1171). The PCR products were ligated into the TA cloning vector (Promega, Madison, WI, USA) and sequenced by Nuclear extracts and electrophoretic gel mobility shift assays the dideoxynucleotide chain termination method [28]. Nuclear extracts were prepared from intestine-407 cells exposed to IL-17 (500 ng/ml) and IFN-g (200 U/ml) for 1´5 h by the Radioiodination of recombinant IL-17 and binding assay method of Dignam and Roeder [29± 31]. Consensus oligonucleo- 125 0 Recombinant human IL-17 was labelled with 1 mCi of [ NaI] tides of NF-kB(5 : AATCGTGGAATTT-CCTCTGACA) [32], q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 59 Fig. 3. Effects of IFN-g on IL-17-induced secretion of IL-8 (a) and MCP-1 (b). Intestine-407 cells were incubated for 48 h in the presence or absence of IL-17 (500 ng/ml), IFN-g (200 U/ml), or IL-17 (500 ng/ml) plus IFN-g (200 U/ml). The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean^SD (n ˆ 4). Northern analysis of the effects of IL-17 and IFN-g on IL-8 (c) and MCP-1 (d) mRNA abundance in intestine-407 cells. The cells were incubated for 3 h in the presence or absence of IL-17 (500 ng/ml), IFN-g (200 U/ml), or IL-17 (500 ng/ml) plus IFN-g (200 U/ml), and then Northern blotting was performed. The same membrane was used for the determination of IL-8 and MCP-1 mRNA expression. NF-IL6 (TGCAGATTGCGCAATCTGCA) [33] and AP-1 (c-jun: Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Experiments 5 -CGCTTG ATG AGTCAGCCGGAA) [34 ± 39] were used. The with unlabelled oligonucleotides used a 100-fold molar excess consensus sequence for binding of transcription factor was relative to the radiolabelled oligonucleotide. underlined. Oligonucleotides were 5 end-labelled with T4 polynucleotide kinase (Promega, Madison, WI, USA) and RESULTS [g - P]ATP (Amersham). Binding reactions were performed according to methods described previously. Supershift experi- Induction of chemokine secretion by IL-17 ments were performed as described above except that 1 mlof Intestine-407 cells were incubated with increasing concentrations antibody to each transcription factor was added to the binding of IL-17, and IL-8 and MCP-1 levels in supernatants were mixture in the absence of labelled probe. Antisera specifically determined by ELISA. As shown in Fig. 1, the addition of recognizing each transcriptional factor were purchased from Santa IL-17 induced a dose-dependent increase in IL-8 and MCP-1 q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 60 A. Andoh et al. MCP-1 mRNA abundance then gradually decreased. As demon- strated in Fig. 2b,c, IL-17 induced a rapid secretion of IL-8 and MCP-1 as early as 12 h, and this then became slower. Effects of IL-17 in combination with IFN-g on chemokine secretion Intestine-407 cells were stimulated with IL-17 (500 ng/ml), IFN-g (200 U/ml) or IL-17 plus IFN-g . As shown in Fig. 3a,b, IFN-g induced a marked increase in MCP-1 secretion, whereas IFN-g did not affect IL-8 secretion. However, the combination of IL-17 and IFN-g induced a marked increase in both IL-8 and MCP-1 secretion. These effects were also observed at the level of mRNA (Fig. 3c,d). Intestine-407 cells were stimulated with IL-17, IFN-g , or IL-17 plus IFN-g for 3 h, and IL-8 and MCP-1 mRNA abundance was determined by Northern blotting. IFN-g induced a rapid increase in MCP-1 mRNA abundance, but its effect on IL-8 mRNA abundance was relatively modest. However, the combination of IL-17 and IFN-g induced a marked increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. These results were compatible with the observations at protein levels. Fig. 4. Kinetics of IL-17 receptor (R) mRNA abundance in intestine-407 cells. The cells were incubated in the presence of IL-17 (500 ng/ml), and Induction of IL-17 receptor (R) expression by IFN-g IL-17 R mRNA abundance was sequentially determined by Northern The induction of TNF-a receptor (R) expression by IFN-g has blotting. been reported [40], and this has been regarded as one of the mechanisms mediating the synergistic effects of TNF-a plus IFN-g on chemokine secretion. To define the role of similar secretion. The induction of chemokine secretion was clearly mechanisms in effects combined of IL-17 and IFN-g,we detectable at an IL-17 concentration of 100 ng/ml. When evaluated the effects of IFN-g on IL-17 R expression in comparing the effects of IL-17 with those induced by IL-1b or intestine-407 cells. As shown in Fig. 4, IFN-g induced a weak TNF-a , the effects of IL-17 were relatively modest; IL-1b 6 increase in IL-17 R mRNA abundance as early as 3 h, and this (50 ng/ml) induced 6´8 ^ 3´5 ng IL-8/10 cells and 8´0 ^ 2´4 ng 6 effect persisted for 12 h the binding assay using [ I]-labelled MCP-1/10 cells, and TNF-a (100 ng/ml) induced 6 6 IL-17 revealed that treatment with IFN-g for 24 h induced an 10´1 ^ 4´6 ng IL-8/10 cells and 9´6 ^ 3´4 ng MCP-1/10 cells, approximately two-fold increase in IL-17 binding (Table 1). respectively. These observations indicate that IL-g weakly induces IL-17 R The effects of IL-17 on IL-8 and MCP-1 mRNA abundance in expression in this cell line. intestine-407 cells were also investigated. Cells were incubated with IL-17 (500 ng/ml), and IL-8 and MCP-1 mRNA levels were Modulation of transcription factor activation successively determined by Northern blotting (Fig. 2a). IL-17 The importance of transcription factor activation in the induced a rapid increase in chemokine mRNA abundance at as regulation of many genes has been reported. In particular, the early as 1 h, and this reached a peak at 3 h. Induced-IL-8 and expression of several genes, including IL-8 and MCP-1, is regulated by the activation of specific transcription factors such as NF-k B, NF-IL6 and AP-1 [32± 38]. To elucidate the mechanisms underlying the response to IL-17, we evaluated activation of the transcription factors NF-k B, NF-IL6 and AP-1 in intestine-407 cells. As demonstrated in Fig. 5a, stimulation with IL-17 (500 ng/ml) for 1´5 h induced a weak increase in Table 1. Effects of IFN2g on [ ]-labelled IL-17 binding in intestine 407 cells Fig. 5. Electrophoretic gel mobility shift assays (EMSA) for NF-k B (a), Specific bound* Specific bound/cell 4 28 NF-IL6 (b) and AP-1 (c) DNA-binding activities. The cells were incubate (10 cpm) (10 ng/cell) with medium alone, IL-17 (500 ng/ml), IFN-g (200 U/ml) or IL-17 (500 ng/ml) plus IFN-g (200 U/ml) for 1´5 h, and then nuclear extracts Medium 6´32^2´23 1´90^0´67 were prepared. Lane 1, medium alone; lane 2, IL-17; lane 3, IFN-g ; lane 4, Incubated with IFN-g 15´56^3´04 4´61^0´96 IL-17 plus IFN-g; lane 5, IL-17 plus cold probe; lane 6, IL-17 plus antip50 antibody; lane 7, IL-17 plus antip65 antibody and (c) lane 1, medium Specific bound* ˆ (total bound) - (non-specific bound). Specific alone; lane 2, IL-17; lane 3, IFN-g ; lane 4, IL-17 plus IFN-g ; lane 5, IL-17 125 5 activity of [ I]-labelled IL-17 was 4´0  10 cpm/ng. plus cold probe. NS at the right side means non-specific band. q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 61 IFN-g in the regulation of chemokine secretion by human fetal intestinal epithelial cells. Combined stimulation leads to syner- gistic effects on IL-8 and MCP-1 secretion. Since both IL-17 and IFN-g are products of activated T cells, these observations indicate that T cells play an important role in inflammatory responses in the intestine. Intestinal epithelial cells play an important role in the first line of defence [30]. The primary role of the intestinal epithelial cells is to act as a physical barrier, separating the contents of a harsh luminal environment from the layers of tissue composing the internal milieu. Several lines of evidence have recently indicated that the intestinal epithelial cells also serve as active participants in various immunological functions. Fig. 6. Western blot analysis for Ik Ba degradation. The cells were Several studies have revealed the ability of intestinal epithelial stimulated with IL-17 (500 ng/ml), and then total Ik Ba molecules (lower cells to secrete chemokines, such as IL-8, MCP-1, epithelial lane) and phosphorylated Ik Ba molecules (upper lane) were sequentially neutrophil-activating peptide (ENA) 78 and macrophage analysed by Western blotting. inflammatory protein (MIP)-1 [3,30]. Intestinal epithelial cells express elevated chemokine mRNA levels during the develop- ment of colitis in IL-2-deficient mice [31]. Under conditions which promote infection or insult to the epithelial monolayer, NF-k B-DNA binding activity (lane 2), whereas IFN-g (200 U/ these chemokines, derived from intestinal epithelial cells, ml) had no effects (lane 3). However, the combination of IL-17 promote a rapid influx of immune and inflammatory cells into and IFN-g induced a marked increase in NF-k B-DNA binding the mucosa within hours. Because most of these chemokines activity (lane 4). The specificity of this reaction was confirmed are specific for a certain cell type, the ratio and concentration by the addition of cold oligo-DNA, which abolished the of the different chemokines will determine the composition of reactive band (lane 5). The addition of antibody directed against the cell infiltrate [1,2]. Previous studies have focused primarily a 65 000 MW-subunit (p65) of NF-k B induced a complete on the role of cytokines secreted by monocytes/macrophages. supershift of the binding complexes (lane 7), whereas the For example, IL-1b , IL-6 and TNF-a , which are mainly antibody against a 50 000 MW-subunit (p50) induced a weak produced by monocytes/macrophages, have been established as reaction. Thus, these findings indicate that the major binding potent stimulators of chemokine secretion in intestinal epithelial complex was a homodimer consisting of p65 subunits. We also cells. However, the exact role of IL-17, a cytokine derived from tested the effects of IL-17 and IFN-g on NF-IL6 DNA-binding T cells, remains unclear. activity (Fig. 6b). IL-17 did not affect NF-IL6 DNA binding activity, The induction of chemokine secretion by IL-17 has been whereas IFN-g increased NF-IL6 DNA binding activity. The previously reported in rodent intestinal epithelial cells [16]. combination of IL-17 plus IFN-g further enhanced this reaction. However, human intestinal epithelial cells have not been The specificity of this binding was also confirmed; the reactive previously studied. Here, we report that IL-17 and IFN-g band disappeared following the addition of a cold probe. synergistically induce IL-8 and MCP-1 secretion by human Concerning AP-1 activation, IL-17, but not IFN-g , enhanced intestinal epithelial cells. Similar synergistic effects of IL-17 and AP-1 DNA-binding activity (Fig. 6c). In addition, IFN-g weakly IFN-g have been previously reported in other cell types. For enhanced IL-17-induced AP-1 DNA-binding activity. Based on example, IL-17 and IFN-g synergistically up-regulate GM-CSF, these observations, we concluded that NF-k B, NF-IL6 and AP-1 GRO-a and IL-6 secretion in human keratinocytes [7]. To our activation plays a role in IL-17 and IFN-g -induced enhancement knowledge, this is the first report describing the synergistic effects of chemokine mRNA expression in intestine-407 cells. of IL-17 and IFN-g on chemokine secretion in human intestinal epithelial cells. These observations suggest an important role for Degradation of Ik Ba molecules IL-17 in the induction of inflammatory responses in the intestinal NF-k B activation is regulated by its cytoplasmic association with mucosa. Ik B molecules, which mask the nuclear localization signal of NF- T cell activation has been reported to play an important role in k B [35]. In most cells, Ik Ba is the predominant inhibitory the pathogenesis of IBD [19,20]. Infiltration of T cells is a molecule, and the activation and translocation of NF-kBinto the characteristic feature of chronic inflammation in IBD, and nucleus is contingent upon its release from Ik Ba.Numerous neutrophil infiltration becomes prominent in accordance with stimuli, including IL-1b and TNF-a , rapidly induce the the progress of disease activity. The synergistically induced IL-8 phosphorylation and proteolytic degradation of Ik Ba and the and MCP-1 secretion by intestinal epithelial cells in response to consequent activation of NF-k B. To confirm the activation of IL-17 and IFN-g emphasizes the important role of T-cell products Ik Ba molecules by IL-17 in intestine-407 cells, we assessed the in the induction of acute responses during chronic inflammation in activation of Ik Ba molecules. As demonstrated in Fig. 6, IL-17 the intestine. Elevated production of chemokines leads to further induced phosphorylation of Ik Ba molecules as early as 15 min, attraction of inflammatory cells and hence an amplification of the and a decrease in total IkBa molecules was subsequently observed. acute response. It is thought that the chronic inflammation in IBD patients is predominantly driven by Th1 immune responses [19,20]. Furthermore, expression of IFN-g is restricted to Th1 DISCUSSION cells, and IL-17 is secreted by both Th1 and Th2 cells. Therefore, the combined effects of Il-17 and IFN-g might play a prominent The present study demonstrated an important role for IL-17 and q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 62 A. Andoh et al. role in the Th1-mediated `acute on chronic' inflammation in IBD. ACKNOWLEDGEMENTS The exact role of IL-17 in the pathogenesis of IBD should be This study was supported in part by a Grant-in-Aid for Scientific Research evaluated further in future. from the Ministry of Education, Science, and Culture, Japan (12470121). The promoter regions of the human IL-8 and MCP-1 genes have previously been cloned, sequenced and shown to contain putative consensus binding motifs for the transcription factor NF- REFERENCES k B, NF-IL6 and AP-1 [32 ± 38]. NF-k B is important in the transcriptional activation of genes encoding the proteins that 1 Miller MD, Krangel MS. Biology and biochemistry of the chemokines: participate in the inflammatory and immune responses [32]. NF- a family of chemotactic and inflammatory cytokines. Crit Rev k B activation is regulated by its cytoplasmic association with Ik B Immunol 1992; 12:17±46. molecules, which mask the nuclear localization signal of NF-k B 2 Baggiolimi M, Dewald B, Moser B. Interleukin-8 and related [32,35]. In most cells Ik Ba is the predominant inhibitory chemotactic cytokines-CXC and CC chemokines. Adv Immunol 1994; 55:97 ±179. molecule, and the activation and translocation of NF-k B into 3 Eckmann L, Jung HC, Schurer-Maly C et al. Differential cytokine the nucleus is contingent upon its release from Ik Ba . Previous expression by human intestinal epithelial cell line: regulated expres- reports have shown NF-k B activation by IL-17 in several cell sion of interleukin 8. Gastroenterology 1993; 105:1689±97. types [14,16]. Furthermore, it has been shown that the signal 4 Fossiez F, Banchereau J, Murry R, van Kooten C, Garrone P, Lebecque transduction events triggered by IL-17 which induce NF-k B S. Interleukin-17. Intern Rev Immunol 1998; 16:541±51. activation involve MAP kinase activation downstream of TRAF6 5 Yao Z, Painter SL, Fanslow WC et al. Human IL-17: a novel cytokine [16]. Our results demonstrated that the activation of NF-k B was derived from T cells. J Immunol 1995; 155:5483±6. induced by IL-17, and this induction was associated with Ik Ba 6 Kennedy J, Rossi DL, Zurawski SM et al. Mouse IL-17: a cytokine 1 2 phosohorylation and degradation. More interestingly, the combi- preferentially expressed by ab TCR CD4±CD8 T cells. J Interferon Cytokine Res 1996; 16:611±7. nation of IL-17 and IFN-g induced a marked increase in NF-k B 7 Albanesi C, Scarponi C, Cavani A, Federici M, Nasorri F, Girolomoni DNA-binding activity. Similar results were also observed in AP-1 G. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and DNA binding activity. On the other hand, IL-17 did not affect NF- modulates interferon-g- and interleukin-4-induced activation of human IL6 DNA binding activity, whereas IFN-g induced an increase in keratinocytes. J Invest Dermatol 2000; 115:81 ±7. NF-IL6 DNA-binding activity. The induction of NF-IL6 DNA 8 Shin HC, Benbernou N, Esnault S, Guenounou M. Expression of IL-17 binding activity by IFN-g has recently been reported [39], but 1 in human memory CD45RO T lymphocytes and its regulation by there are no reports of how IL-17 modulates NF-IL6 and AP-1 protein kinase A pathway. Cytokine 1999; 11:257±66. DNA-binding activity. Our results suggest that IL-17 and IFN-g 9 Yao Z, Spriggs MK, Derry JM et al. Molecular characterization of the enhanced IL-8 and MCP-1 mRNA expression and secretion human interleukin (IL) -17 receptor. Cytokine 1997; 9:794±800. through synergistic effects on NF-k B, NF-IL-6 and AP-1 DNA 10 Yao Z, Fanslow WC, Seldin MF et al. Herpesvirus Saimiri encodes a new cytokine, IL-17, which bind to a novel cytokine receptor. binding activity. Immunity 1995; 3:811±21. The detail of mechanisms mediating the synergism between 11 Fossiez F, Djossou O, Chomarat P et al. T cell interleukin-17 induces IL-17 and IFN-g remains unclear. In this study we tested the stromal cells to produce proinflammatory and hematopoietic cytokines. possibility that IFN-g modulates IL-17R expression in intestine- J Exp Med 1996; 183:2593±603. 407 cells, since several reports have shown that IFN-g induces the 12 Chabaud M, Fossiez F, Taupin JL, Miossec P. Enhancing effects of IL- up-regulation of TNF-a R expression and enhances the inflam- 17 on IL-1-induced IL-6 and leukemia inhibitory factor production by matory effects of TNF-a [40]. The addition of IFN-g weakly rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. induced an increase in IL-17R mRNA abundance, and the J Immunol 1998; 161:409±14. incubation for 24 h significantly increased IL-17 binding activity 13 Cai XY, Gommol CPJ, Justice L, Narula SK, Fine JS. Reglation of by two-fold. However, the synergistic effect of IL-17 and IFN-g granulocyte colony-stimulating factor gene expression by interleukin- 17. Immunol Lett 1998; 62:51 ±8. on NF-k B activation was observed as early as 1´5 h. This rapid 14 Jovanovic DV, Di Battista JA, Martel PJ et al. IL-17 stimulates the induction of NF-k B binding activity indicates that the synergistic production and expression of proinflammatory cytokines, IL-1b and effect of IL-17 and IFN-g on chemokine secretion is not regulated TNF-a, by human macrophages. J Immunol 1998; 60:3513±21. at the level of IL-17R expression. It is likely that other 15 Albanesi C, Cavani A, Girolomoni G. IL-17 is produced by nickel- mechanisms, such as the convergence of intracellular pathways, specific T lymphocytes and regulates ICAM-1 expression and may contribute to this process. For example, how IL-17 affect chemokine production in human keratinocytes: synergistic or antago- IFN-g -induced STAT1 activation in this cell line should be nist effects with IFN-g and TNF-a. J Immunol 1999; 162:494±502. further defined, because studies with a variety of human cell types 16 Awane M, Andres PG, Li DJ, Reinecker HC. NF-kB-inducing kinase is have demonstrated that TNF-a and IFN-g coregulate in a a common mediator of IL-17-, TNF-a-, and IL-1b-induced chemokine synergistic manner the expression of many inflammatory genes promoter actiation in intestinal epithelial cells. J Immunol 1999; 162:5337±44. via the independent activation of two distinct transcription factor 17 Boirivant M, Marini M, DiFelice G et al. Lamina propria T cells in NF-k B and STAT-1 [41]. Further investigations will be required Crohn's disease and other gastrointestinal inflammation show to define the exact mechanisms mediating the synergistic effects defective CD2 pathway-induced apoptosis. Gastroenterology 1999; of IL-17 and IFN-g . 116:557±65. In conclusion, T-cell derived IL-17 and IFN-g synergisti- 18 Saubermann LJ, Probert CSJ, Christ AD et al. Evidence of T cell cally increase chemokine IL-8 and MCP-1 secretion by receptor b-chain patterns in inflammatory and noninflammatory bowel intestinal epithelial cells. These observations reinforce the disease states. Am J Physiol 1999; 276:G613±G21. concept that T-cell derived cytokines can collaborate in the 19 Kam LY, Targan SR. Cytokine-based therapies in inflammatory bowel promotion and shaping of inflammatory responses in the disease. Curr Opin Gastroenterol 1999; 15:302±7. intestinal mucosa. 20 Dohi T, Fujihashi K, Kiyono H, Elson CO, McGhee JR. Mice deficient q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63 Downloaded from https://academic.oup.com/cei/article/125/1/56/6461329 by DeepDyve user on 25 January 2022 Chemokine secretion by IECs 63 in Th1- and Th2-type cytokines develop distinct forms of hapten- Alteration of gene expression by intestinal epithelial cells precedes induced colitis. Gastroenterology 2000; 119:724±33. colitis in interleukin-2 deficient mice. Am J Physiol 1998; 274:G472±9. 21 Henle G, Deinhardt F. The establishment of strains of human cells in 32 Kim J, Sanders SP, Siekierski ES, Casolaro V, Proud D. Role of NF- tissue culture. J Immunol 1957; 79:54±9. kB incytokine production induced from human airway epithelial cells 22 Kawanishi M. The Epstein±Barr virus latent membrane protein 1 by rhinovirus infection. J Immunol 2000; 165:3384±92. (LMP1) enhances TNF-a-induced apoptosis of intestine 407 epithelial 33 Akira S, Isshiki H, Sugita T et al. A nuclear factor for IL-6 expression cells: the role of LMP1 C-terminal activation regions 1 and 2. Virology (NF-IL6) is a member of a C/EBP family. EMBO J 1990; 9:1897±906. 2000; 270:258±66. 34 Bohmann D, Bos TJ, Admon A et al. Human proto-oncogene c-jun 23 Andoh A, Takaya H, Araki y Tsujikawa T, Fujiyama Y, Bamba T. encodes a DNA binding protein with structural and functional Medium- and long-chain fatty acids differentially modulate inter- properties of transcriptional factor AP-1. Science 1987; 238:1386±92. leukin-8 secretion in human fetal intestinal epithelial cells. J Nutr 35 Finco TS, Baldwin AS. Mechanistic aspects of NF-kB regulation: the 2000; 130:2636±40. emerging role of phosphorylation and proteolysis. Immunity 1995; 24 Chomczynski P, Sacchi N. Single-step method of RNA isolation by 3:263±72. acid guanidinium thiocyanate-phenol-chloroform extraction. Anal 36 Kunsh C, Lang RK, Rosen CA, Shannon MF. Synergistic transcrip- Biochem 1987; 162:156±9. tional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF- 25 Andoh A, Takaya H, Saotome T et al. Cytokine regulation of chemokine IL6. J Immunol 1994; 153:153±64. (IL-8, MCP-1, and RANTES) gene expression in human pancreatic 37 Martin T, Cardarelli PM, Parry GC, Felts KA, Cobb RR. Cytokine periacinar myofibroblasts. Gastroenterology 2000; 119:211±9. induction of monocyte chemottractant protein-1 gene expression in 26 Matsushima K, Morishita K, Yoshimura T et al. Molecular cloning of a human endothelial cells depends on the cooperative action of NF-kB human monocyte-derived neutrophil chemotactic factor (MDNCF) and and AP-1. Eur J Immunol 1997; 27:1091±7. the induction of MDCF mRNA by interleukin 1 and tumor necrosis 38 Yasumoto K, Okamoto S, Mukaida N, Murakami S, Mai M, factor. J Exp Med 1988; 167:1883±93. Matsushima K. Tumor necrosis factor a and interferon g 27 Yoshimura T, Yuhki N, Moore SK, Appella E, Lerman MI, Leonald synergistically induce interleukin 8 production in a human gastric EJ. Human monocyte chemoattractant protein-1 (MCP-1). Full-length cancer cell line through acting concurrently on AP-1 and NF-kB- cDNA cloning, expression in mitogen-stimulated blood mononuclear like binding sites of the interleukin 8 gene. J Biol Chem 1992; leukocytes, and sequence similarity to mouse competence gene JE. 267:22506±11. FEBS Lett 1989; 244:487±93. 39 Roy SK, Wachira SJ, Weihua X, Hu J, Kalvakolanu DV. CCAAT/ 28 Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain- enhancing-binding protein-b regulates interferon-induced transcription terminating inhibitors. Proc Natl Acad Sci USA 1977; 74:5463±7. through a novel element. J Biol Chem 2000; 275:12626±32. 29 Dignam JP, Lebovitz RM, Roeder RG. Accurate transcription initiation 40 Ruggiero V, Tavernier J, Fiers W, Baglioni C. Induction of the by RNA polymerase II in a soluble extract from isolated mammalian synthesis of tumor necrosis factor receptors by interferon-g. J Immunol nuclei. Nucl Acids Res 1983; 11:1475±89. 1986; 136:2445±50. 30 Pitman RS, Blumberg RS. First line of defence: the role of the 41 Ohmori Y, Schreiber RD, Hamilton TA. Synergy between IFN-g and intestinal epithelium as an active component of the mucosal immune TNF-a in transcriptional activation is mediated by cooperation system. J Gastroenterol 2000; 35:805±14. between signal transducer and activator of transcription 1 and nuclear 31 Meijssen MA, Brandwein SL, Reinecker HC, Bhan AK, Podolsky DK. factor kB. J Biol Chem 1997; 272:14899±907. q 2001 Blackwell Science Ltd, Clinical and Experimental Immunology, 125:56±63

Journal

Clinical & Experimental Immunology – Oxford University Press

Published: Dec 20, 2001

Keywords: chemokines; bodily secretions; interleukin-17; intestines; epithelial cells; fetus; interferons; human leukocyte interferon; interleukin-8; monocyte chemoattractant protein-1

There are no references for this article.