Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Transcriptional Regulation ofN-Acetylglucosaminyltransferase V by the srcOncogene

Transcriptional Regulation ofN-Acetylglucosaminyltransferase V by the srcOncogene THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 31, Issue of August 1, pp. 19575–19581, 1997 © 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Transcriptional Regulation of N-Acetylglucosaminyltransferase V by the src Oncogene* (Received for publication, April 3, 1997) Phillip Buckhaults‡§, Lin Chen‡, Nevis Fregien¶, and Michael Pierce‡i From the ‡Department of Biochemistry and Molecular Biology and Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, 30602 and the ¶Department of Cell Biology and Anatomy, University of Miami Medical School, Miami, Florida 33101 Transformation of baby hamster kidney fibroblasts by caused by oncogenic transformation using a variety of agents the Rous sarcoma virus causes a significant increase in (6 –14). This increase in size was found to result mainly from an the GlcNAcb(1,6)Man-branched oligosaccharides by ele- increase in the levels of asparagine-linked oligosaccharides vating the activity and mRNA transcript levels encoding containing N-acetylglucosamine linked b1,6 to the a(1,6)- N-acetylglucosaminyltransferase V (GlcNAc-T V). Ele- linked mannose in the trimannosyl core, (GlcNAcb(1,6)Man), vated activity and mRNA levels could be inhibited by and in many cases these oligosaccharides express polylac- blocking cell proliferation with herbimycin A, demon- tosamine that can be sialylated (15–18). The (GlcNAcb(1,6)Man) strating that Src kinase activity can regulate GlcNAc-T branch is synthesized by N-acetylglucosaminyltransferase V V expression. 5* RACE analysis was used to identify a 1 (GlcNAc-T V), the enzyme whose activity is significantly and 3-kilobase 5*-untranslated region from GlcNAc-T V selectively increased after transformation by tumor viruses or mRNA and locate a transcriptional start site in a 25- isolated oncogenes (16, 19 –22). Moreover, decreased expression kilobase pair GlcNAc-T V human genomic clone. A 6-kil- of the GlcNAcb(1,6)Man branch has been correlated with de- obase pair fragment of the 5* region of the gene con- creased metastatic potential (23, 24), whereas the increased tained AP-1 and PEA3/Ets binding elements and, when expression of this branch appears in some instances to corre- co-transfected with a src expression plasmid into HepG2 late with the progression of invasive malignancies (25). cells, conferred src-stimulated transcriptional enhance- The transformation of baby hamster kidney (BHK) fibro- ment upon a luciferase reporter gene. This stimulation blasts by the src oncogene causes an increase in N-linked by src could be antagonized by co-transfection with a oligosaccharide (GlcNAcb(1,6)Man) branching, and the mech- dominant-negative mutant of the Raf kinase, suggesting anism by which this increase occurs has been under investiga- the involvement of Ets transcription factors in the reg- tion in our laboratories. To elucidate this mechanism, we ex- ulation of GlcNAc-T V gene expression. The src-respon- sive element was localized by 5* deletion analysis to a amined GlcNAc-T V enzyme activity and mRNA levels in BHK 250-base pair region containing two overlapping Ets cells and their Rous sarcoma virus-transformed counterparts sites. src stimulation of transcription from this region (RSV-BHK) in the presence of the Src kinase inhibitor, herbi- was inhibited by co-transfection with a dominant-nega- mycin A. The results from these experiments led us to examine tive mutant of Ets-2, demonstrating that the effects of the 59 region of the human gene encoding GlcNAc-T V and its the src kinase on GlcNAc-T V expression are dependent increased expression caused by Src activity. Our results indi- on Ets. cate that the N-acetylglucosaminyltransferase V gene can be transcriptionally activated by Src tyrosine kinase activity, and this control is dependent on both the Raf-1 kinase and an Ets The glycosylation of cell surface glycoproteins is a dynamic family transcriptional activator. process that can be regulated by agents that cause differenti- EXPERIMENTAL PROCEDURES ation, such as retinoic acid (1) or transforming growth factor-b Glycosyltransferase Activity Assays—Cells were grown to confluency (2), or by those that induce cellular proliferation, for example, and harvested in 50 mM MES 6.5, 150 mM NaCl, and lysed by addition interleukin-1 or tumor necrosis factor-a (3). In many instances, of Trition X-100 to 1%. Lysates were assayed according to the method of alterations of the oligosaccharides on cell surface glycoproteins 6 3 Palcic et al. (22). Briefly, 10 cpm of UDP-[ H]GlcNAc (25 cpm/pmol) cause significant changes in the adhesive or migratory behav- and 10 nmol of synthetic trisaccharide acceptor for GlcNAc-T V (octyl ior of a cell (4, 5). An induced alteration in the glycosylation of 6-O-[2-O-(2-acetamido-2-deoxy-b-D-glucosyl-pyranosyl)-a-D-mannopyr- cell surface glycoproteins that has been documented for many anosyl]-b-D-glucopyraoside) were dried under vacuum in a 1.5-ml mi- crocentrifuge tube. Extracts of various protein concentrations were years concerns the significant increase in oligosaccharide size prepared, and 10 ml were added to the assay tube. Assays were incu- bated at 37 °C for 4 h and quenched by the addition of 500 ml of water. Radiolabeled product was isolated on a C Sep-Pak (Waters) column, * This research was supported by the NCI, National Institutes of eluted in 2 ml of methanol, and counted in a scintillation counter. Health. The costs of publication of this article were defrayed in part by Assays were performed in duplicate or triplicate, at two or three protein the payment of page charges. This article must therefore be hereby concentrations, and specific activity was calculated by linear least marked “advertisement” in accordance with 18 U.S.C. Section 1734 squares regression analysis of the data. solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted TM to the GenBank /EBI Data Bank with accession number(s) AF004882. In memoriam, E.A.P. The abbreviations used are: GlcNAc-T V, N-acetylglucosaminyl- § Present address: The Oncology Center, Johns Hopkins University transferase V; BHK, baby hamster kidney; RSV, Rous sarcoma virus; School of Medicine, Baltimore, MD 21231. PEA, polyoma enhancer activator; GAPDH, glyceraldehyde phosphate To whom correspondence should be addressed: Dept. of Biochemis- dehydrogenase; RACE, rapid amplification of cDNA ends; GlcNAc-T I, try and Cell Biology, Life Science Bldg., University of Georgia, Athens, N-acetylglucosaminyltransferase I; MES, 4-morpholineethanesulfonic GA 30602. Tel.: 706-542-1702; Fax: 706-542-1759; E-mail: pierce@ acid; kb, kilobase pair(s); PCR, polymerase chain reaction; bp, base bscr.uga.edu. pair(s); UTR, untranslated region. This paper is available on line at http://www.jbc.org 19575 This is an Open Access article under the CC BY license. 19576 src Regulation of GlcNAc-T V Expression Northern Analysis—20 mg of total RNA was electrophoresed on a 1% formaldehyde-agarose gel and blotted to nylon. A 1-kb fragment of a partial rat GlcNAc-T V cDNA clone was random prime-labeled (26), and the blot was probed according to the method of Church and Gilbert (27). Data were collected and quantitated with a PhosphorImager. Phosphotyrosine Quantitation—Cells were harvested by the addition of 1 ml of preheated SDS-polyacrylamide gel electrophoresis sample buffer to a 10-cm plate and shearing through a 20 gauge needle. Protein concentrations were determined on trichloroacetic acid precipitates us- ing the BCA reagents (Pierce). 20 mg of protein were electrophoresed on a 4 –20% gradient acrylamide gel and transferred to nitrocellulose (Bio- Rad). Blots were probed with an anti-phosphotyrosine antibody (a kind gift from Dr. Bart Sefton) followed by a goat anti-mouse horseradish peroxidase conjugate. Bands were detected using the ECL reagents (Amersham Corp.) and quantitated by scanning densitometry. 59 RACE Analysis—Marathon Race Ready cDNA from human whole brain (CLONTECH) was used as a template in a 59 RACE PCR accord- ing to the manufacturer’s instructions. A 39 PCR primer (303, CCTG- GACCTCAGCAAAAGGTACATCAAGGC) designed near the 59 end of the published human cDNA sequence was used along with the 59 anchor primer in a primary round of RACE PCR. Products were separated on FIG.1. BHK and RSV-BHK cell GlcNAc-T V and GlcNAc-T I a 1% Tris-acetic acid-EDTA-agarose gel and blotted to nitrocellulose. A specific activities. The specific activities of both enzymes were meas- nested PCR product was generated using the primers 501 (GAATG- ured in cell lysates under optimal conditions. The specific activity of GAAGTGAGGGAAGGC) and 305 (GGAAGTTGTCCTCTCAGAAGCT- each enzyme in BHK cells was set at 100%. GGGCTTT) and a genomic clone template. This product was random prime-labeled (26) and used to probe the membrane to which the RACE increase in GlcNAc-T V activity in the transformed cells could PCR product was transferred (see Fig. 6). To improve yields of authentic result from differences in mRNA levels. GlcNAc-T V activity products, a secondary round of RACE PCR was then performed. A nested GlcNAc-T V 39 primer (305) and nested 59 anchor primer were was assayed under optimal conditions in BHK and RSV-BHK used in the secondary round of RACE PCR using as templates the cells using a synthetic trisaccharide acceptor. The transformed products from the primary RACE PCR. The products from this round of BHK cells demonstrated a GlcNAc-T V enzyme specific activity RACE PCR were directly subcloned into the TA cloning vector (Invitro- 6-fold higher than the untransformed BHK cells. By contrast, gen), and clones were sequenced. no difference was seen in the specific activity of another N- Genomic Clone Isolation—The human GlcNAc-T V promoter se- acetylglucosaminyltransferase that functions in the synthesis quences were isolated from a human genomic library cloned in the l-FIX II vector (Stratagene, Inc.). A 687-bp EcoRI fragment containing of N-linked oligosaccharides, GlcNAc-T I (Fig. 1), indicating the the 59-untranslated region of the rat cDNA (28) was used as a probe to specificity of Rous sarcoma virus transformation on GlcNAc-T screen this library using standard plaque hybridization procedures. V activity. To investigate the possibility that the difference in Screening 5 3 10 phage plaques yielded two overlapping genomic GlcNAc-T V specific activity is associated with a difference in clones that span a region of approximately 30 kb. steady-state mRNA levels, Northern blots were performed us- Nucleotide Sequencing—Sequencing of RACE PCR clones and hu- ing a fragment of a cDNA encoding GlcNAc-T V. Compared man genomic clones was performed using the Applied Biosystems, Inc. reagents by the UGA Molecular Genetics Instrumentation Facility. with BHK cells, RSV-transformed cells were found to have a Luciferase Reporter Construction—For pGL2-TV1, a 6-kb XhoI-SacI 6-fold increase in the expression levels of both 8.7 and 9.3 kb fragment of the genomic clone was band-purified (Sephaglass, Pharma- GlcNAc-T V transcripts, but no change in either GAPDH or cia Biotech Inc.) and subcloned into XhoI-SacI sites of the pGL2-Basic GlcNAc-T I transcripts (Fig. 2). Although not apparent in Fig. vector (Promega). For pGL2-TV2 through pGL2-TV4, PCR products 2, PhosphorImager quantitation demonstrated an equivalent were generated using the genomic clone as a template and subcloned increase in both GlcNAc-T V mRNA transcripts. These results into the TA vector. TA clones of the correct orientation were cut with XhoI-SacI, and inserts were cloned into XhoI-SacI sites of pGL2-Basic. demonstrated that the elevation of enzyme activity in the RSV- Promoter Activity Determinations—SV40-b-galactosidase (2 mg) and transformed cells was a result of either transcriptional activa- reporter constructs (2 mg) 6 effector plasmids (2 mg) were transfected by tion or increased mRNA stability and argue against postrans- the calcium-phosphate precipitation method (29) into 50% confluent lational modifications of the enzyme causing a significant cultures of HepG2 cells grown in 6-well culture plates. 40 h post- increase in its catalytic activity. transfection, cell lysates were prepared and assayed for b-galactosidase To obtain convincing evidence that the differences in Glc- and luciferase (Promega). Luciferase activity was normalized to vector- dependent b-galactosidase activity. NAc-T V expression result from src tyrosine kinase activity, we Plasmids—The plasmids encoding the Raf-1 kinase and its dominant made use of a src-selective tyrosine kinase inhibitor, herbimy- negative form (30) were kind gifts from Dr. Ulf Rapp. Plasmids encod- cin A, a metabolite produced by Streptomyces sp. MH237-CF8. ing Ets-2 and its dominant negative form (31) were kinds gifts from Dr. This inhibitor was first identified for its ability to reverse the K. E. Boulukos. The v-src expression plasmid was a kind gift from transformed morphology of Rous sarcoma virus-infected rat Dr. Tony Hunter. kidney cells (32), and this reversion of morphology was associ- RESULTS ated with a reduction in total cellular phosphotyrosine levels Earlier experiments utilizing BHK and RSV-BHK cells met- (33). Herbimycin A was unable, however, to reverse the trans- abolically radiolabeled with [2- H]mannose indicated at least a formed morphologies induced by the ras, raf,or myc oncogenes, 2-fold increase in the total amount of (2,6)-substituted mannose demonstrating its specificity for the src family of tyrosine ki- in the RSV-BHK cells, normalized to total mannose-labeled nase oncogenes (34). Herbimycin A is also able to reverse src- glycopeptides. Although the specific activity of GlcNAc-T V was stimulated expression of the glucose transporter gene (35) and increased over 6-fold in the RSV-transformed cells, no signifi- to cause a reversible G contact arrest in src-transformed nor- cant differences in the kinetic properties of GlcNAc-T V in the mal rat kidney cells (36). We utilized herbimycin A, therefore, transformed cells could be detected. These results suggested to test the hypothesis that the expression of GlcNAc-T V is that the increases in GlcNAcb(1,6)Man levels after transforma- positively regulated by the src tyrosine kinase. tion were most likely not due to post-translational effects on First, to monitor the effects of src kinase and demonstrate its the enzyme (22). The specific activity of GlcNAc-T V and its inhibition by herbimycin A, we measured total cellular phos- mRNA levels were measured, therefore, to determine if the photyrosine levels by performing Western blots with an a-phos- src Regulation of GlcNAc-T V Expression 19577 FIG.3. BHK and RSV-BHK cell phosphotyrosine levels. Total cell extracts were subjected to SDS-polyacrylamide gel electrophoresis and subjected to Western blotting using as a probe an anti-phosphoty- rosine antibody. Bound antibody was visualized using luminescent reagents and quantitated by densitometer scanning. FIG.2. BHK and RSV-BHK cell GlcNAc-T V mRNA levels. Upper panel, Northern blot of total RNA from BHK (lane 1) and RSV-BHK cells (lane 2) probed with a 1-kb radiolabeled fragment from the open reading frame of murine GlcNAc-T V and visualized using a Phosphor- Imager. Lower panel, PhosphorImager quantitation of the band inten- sities from the analysis shown in the upper panel. The blot was stripped FIG.4. BHK and RSV-BHK GlcNAc-T V specific activities after and hybridized with a rat GAPDH radiolabeled cDNA to demonstrate treatment with herbimycin A. GlcNAc-T V enzyme specific activity loading equivalence. was measured in cell lysates that had been incubated for 24 h with various concentrations of herbimycin A. photyrosine antibody on extracts made from cells treated for 24 h with various concentrations of the drug. These results pared from RSV-transformed cells treated with various concen- demonstrate that, as expected, herbimycin A caused a dose-de- trations of the drug. Similar to its effects on GlcNAc-T V en- pendent decrease in cellular phosphotyrosine levels (Fig. 3). At zyme specific activity, herbimycin A caused a decrease in a concentration of 1 mg/ml, herbimycin A caused a reversal of GlcNAc-T V message levels in the RSV-BHK cells in a dose-de- the RSV-transformed morphology and a complete inhibition of pendent manner (Fig. 5). Taken together, these results indicate cell division (data not shown). Consistent with the drug’s effect that expression of the GlcNAc-T V mRNA in the src-trans- of inhibiting the src kinase (33) and blocking cell division in G formed cells is under the control of the src tyrosine kinase. (36), herbimycin A caused a dose-dependent decrease in Glc- To elucidate the mechanism by which src induces the expres- NAc-T V enzyme specific activity in RSV-transformed BHK sion of GlcNAc-T V, we isolated the 59-flanking region of the cells (Fig. 4). Interestingly, although the drug blocked cell gene and analyzed this region for promoter activity. The Glc- division and caused a modest decrease in phosphotyrosine lev- NAc-T V message is approximately 9 kb in most rodent and els in the untransformed BHK cells (data not shown), it had human tissues, with brain having high expression levels. To little effect on the expression level of GlcNAc-T V enzyme locate a promoter for GlcNAc-T V, 59 RACE PCR techniques activity in confluent cultures of untransformed cells (Fig. 4). were used to isolate and sequence the 59 end of the message This result suggests that regulation of GlcNAc-T V expression from human brain. RACE PCR products were first generated is complex, with both src-dependent and src-independent fac- from the genomic clone using the 303 primer (designed against tors. Herbimycin A had no effect on the specific activity of the 59 end of the human GlcNAc-T V cDNA sequence) and then GlcNAc-T I (data not shown), arguing against nonspecific toxic analyzed by Southern blotting. GlcNAc-T V-specific sequences effects on the transformed cells and confirming that GlcNAc-T were detected using a nested 501–305 PCR product as the I is not regulated by src. To determine if the inhibition of hybridization probe. Multiple bands were detected, the longest expression of GlcNAc-T V enzyme activity by herbimycin A was of which was 2.9 kb (Fig. 6). PCR products were ligated into the a result of inhibiting the expression of the mRNA encoding the TA cloning vector, and clones corresponding to the 600- and enzyme, Northern blots were performed on RNA samples pre- 1200-bp products were obtained and found to overlap and differ 19578 src Regulation of GlcNAc-T V Expression FIG.5. BHK and RSV GlcNAc-T V mRNA levels after treatment FIG.7. Schematic representation of the 5* region of the Glc- with herbimycin A. Total RNA was extracted from cells treated for NAc-T V gene. The fine line represents 8390 bp of genomic sequence 24 h with herbimycin A and subjected to Northern blot analysis, and the whose 59 boundary is a SacI site, which is also the 59 boundary of the results were quantitated using a PhosphorImager. The level of Glc- pGL2-TV1 construct and can be found in the GenBanky accession NAc-T V mRNA in untreated cells was set at 100%. number: AF004882. The XhoI site marks the 39 boundary of the pGL2- TV1 construct. TV2, TV3, and TV4 mark the 59 boundaries of the pGL2-TV2, pGL2-TV3, and pGL2-TV4 constructs, respectively. The 39 boundaries of these three constructs are each 70 bp 39 of the transcrip- tional start site. The PEA-3 (ets-2 binding sites) and AP-1 sites neces- sary for full src- responsiveness are denoted above the line. The bold line denotes the GlcNAc-T V open reading frame. start site, a 6-kb SacI-XhoI genomic fragment containing 848 bp of the brain 59-UTR and 5.5 kb of 59-flanking sequence (depicted in Fig. 7), designated pGL2-TV1, was cloned into the luciferase expression vector pGL2-basic. The activity of this region as a promoter and its responsiveness to src were then examined in transiently transfected HepG2 cells. pGL2-TV1 was found to act as a weak promoter, shown in Fig. 8, consist- ent with the low levels of GlcNAc-T V transcript observed in HepG2 cells and most tissues. Moreover, this DNA fragment conferred transcriptional responsiveness to src when co-trans- fected with a src-containing expression plasmid (Fig. 8). The similarity between the increases in GlcNAc-T V expression in the RSV-transformed cells and src stimulation of transcription FIG.6. RACE PCR Southern blot analysis. A RACE-anchored from the GlcNAc-T V promoter in HepG2 cells suggests that human brain cDNA library was used for PCR using a 39 GlcNAc-T V transcriptional control is likely the most important regulatory primer (GCCTTGATGTACCTTTTGCCGAGGTCCAGG) and a 59 an- chor primer, and the products were separated and subjected to South- influence of src on GlcNAc-T V activity. ern blot analysis. The blot was probed with a biotinylated GlcNAc-T-V Transformation and some transcriptional activation by src PCR product to detect authentic GlcNAc-T V products, as described occurs via the MAPK pathway in a Raf-1-dependent manner. under “Experimental Procedures.” The largest band visualized by this For example, a dominant-negative Raf-1 mutant suppresses src analysis (left lane) was calculated to be 2.8 kb in length. Size markers are shown at right. transformation of BALB/c mouse fibroblasts (37) and is able to block src-stimulated transcriptional activation of the EGR gene only in the length of their 59 ends. To isolate a product that (38). Furthermore, this mutant is able to block serum or Ras encompassed all of the 59-untranslated region of the GlcNAc-T stimulation of the transcription of an AP-1/Ets-driven gene V message, a second round of RACE PCR was then performed (30). If transcriptional activation of GlcNAc-T V by src occurs at using two nested primers designed near the 59 end of the 0.6 kb least in part via the MAPK pathway, we reasoned that the clone, and the resulting products were subcloned and se- activation should be inhibited by the dominant-negative Raf-1 quenced. Clones corresponding to the 1.8- and 2.9-kb bands mutant. Consistent with this hypothesis, the transcriptional were isolated from this second round of RACE PCR and se- stimulation of the GlcNAc-T V promoter by src was signifi- quenced. As before, these clones were found to differ only in the cantly inhibited when co-transfected with a plasmid encoding a length of their 59 ends. A third round of RACE PCR using a 39 dominant-negative mutant Raf, RafC4B-DN (Fig. 8). Because primer designed to the sequence near the 59 end of the 2.9-kb proliferation often occurs in a Raf-dependent manner, this re- clone produced a single product of the expected size (70 bp). The sult is consistent with correlations noted between GlcNAc-T assembled sequence of the RACE clones was co-linear with the V expression and cellular proliferation in nontransformed sequence of the genomic clone in this region, indicating that no cells (39, 40) and may predict in certain cell types a general splicing events occurred in the 59-UTR of the message from association between GlcNAc-T V enzyme activity and cell human brain. These results demonstrate, therefore, that the proliferation. location of the 59-most transcriptional start site utilized in To map more closely the region of the GlcNAc-T V promoter brain is located approximately 2.9 kb upstream of the ATG, responsible for transcriptional activation by src, a series of 59 corresponding to the band of this size shown in Fig. 6. deletions containing 70 bp of the brain 59-UTR and different To examine the 59 region flanking the 59-most transcriptional amounts of the 59-flanking region were constructed by PCR src Regulation of GlcNAc-T V Expression 19579 FIG.9. Mapping the Src-responsive region of the GlcNAc-T V genomic fragments. Fragments TV1 through TV4 were separately subcloned into the pGL2-Basic luciferase reporter vector and tested for src responsiveness. The TV3 fragment contained the shortest sequence that showed responsiveness and includes two overlapping PEA-3 sites upstream from a single AP-1 site. FIG.8. The TV1 fragment promoter activity is responsive to src and is dependent on raf. The TV1 fragment depicted in Fig. 7, representing a 6240-bp SacI-XhoI fragment of the 59-flanking region, was cloned into the pGL2-Basic luciferase reporter vector and used to transfect Hep G-2 cells in the presence and the absence of a co-trans- fected src-expression plasmid. A dominant negative raf-1 expression plasmid, Raf C4B, was also utilized in some transfections, as well as an expression plasmid containing an inactive point mutant of the same, Raf C4B pm17. amplification from the genomic clone, the boundaries of which are depicted in Fig. 7. Promoter fragments were cloned into the pGL2-basic vector and tested for basal promoter activity and FIG. 10. Nucleotide sequence of the GlcNAc-T V genomic frag- src responsiveness. Based on the results from several sets of ment TV3. This sequence corresponds to the shortest fragment tested experiments, both pGL2-TV2, which contained about 1.2 kb, that conferred src responsiveness to a GlcNAc-T V promoter-driven and pGL2-TV3, which contained 739 bp, were both found to be luciferase gene. The fragment was generated as described under “Ex- perimental Procedures” and included 70 bp 39 of the transcriptional weakly active as promoters and transcriptionally responsive to start site. PEA-3 (Ets-2 binding sites) and AP-1 binding sites are de- src (Fig. 9). The pGL2-TV4 construct containing 339 bp, how- noted by solid underlining and dotted underlining, respectively. The 59 ever, was found to be inactive as a basic promoter and com- and 39 ends correspond to positions 2659 and 170, respectively, as pletely unresponsive to src. These results suggest a require- depicted in Fig. 7. ment for the two overlapping PEA-3 sites located near the transcriptional start site, contained in pGL2-TV3, in the src- DISCUSSION mediated transcriptional activation of the GlcNAc-T V gene (Figs. 7 and 10). A major regulatory mechanism for controlling the expression PEA-3 sites are bound by the Ets family of transcriptional of glycan structures is alteration in the activities of the en- activators and mediate transcriptional activation in response zymes involved in their synthesis. Changes in glycosyltrans- to mitogenic signals from plasma membrane-associated tyro- ferase activity may occur by several different mechanisms, sine kinase oncogenes (41). To obtain more direct evidence for including post-translational interactions with specifier pro- the involvement of an Ets family transcription factor in src- teins (42) and translational control of glycosyltransferase tran- stimulated transcription of the GlcNAc-T V gene, we exploited scripts. For example, the b(1,4)-galactosyltransferase is ex- the availability of an ets-2 expression plasmid along with an pressed at low to moderate levels in most tissues as a 4.1-kb expression plasmid that encoded a truncated ets-2 with a dom- transcript. However, high level expression in lactating mam- inant-negative activity, ets-2D1–328 (31). Co-transfection of mary gland is accompanied by a switch from one transcrip- pGL2-TV3 with ets-2 resulted in stimulation of transcription, tional start site to another, which is more proximal to the whereas co-transfection with ets-2D1–328 was able to block translational start site, giving rise to the expression of a 3.9-kb src-transcriptional stimulation (Fig. 11). This result demon- transcript (43). The longer transcript is predicted to form a strates that this region is capable of being transcriptionally stable hairpin loop structure in the 59-untranslated region, stimulated in response to ets-2 expression and suggests that src which may reduce translation efficiency. The shorter transcript transcriptionally activates this region through a factor that is predicted to be unable to form any significant 59 structure binds to the PEA-3 site(s). and therefore is thought to be translated with greater effi- 19580 src Regulation of GlcNAc-T V Expression been described in several systems. Early indications of this regulatory mechanism were found in a functional analysis of a promoter of the a(2,6)-sialyltransferase gene. This transferase is highly expressed in liver, and its promoter was found to contain binding sites for liver-enriched transcription factors. These sites and their cognate transcription factors were found to be functional in luciferase reporter transactivation assays in Hep G2 cells but were not functional in Chinese hamster ovary cells. These transcription factors and their binding sites are thought to be responsible for the liver-restricted expression of this message (46, 47). Also, retinoic acid-induced differentia- tion of F9 teratocarcinoma cells has been documented to be associated with an increase in the activity of the murine a(1, 3)-galactosyltransferase and a switch in the expression of ter- minal capping structures from a(2, 3)-linked sialic acid to ga- lactose. The increase in the activity of the transferase is asso- ciated with an elevation in the steady-state levels of the mRNA and a similar increase in the transcription rate of the gene (1). The association between oncogenic transformation and in- creases in GlcNAc-T V enzyme activity and expression of GlcNAcb(1,6)Man branches on glycoproteins raises the ques- tion concerning the mechanism by which oncogenes and prolif- erative signals in general up-regulate the synthesis of GlcNAcb(1,6)Man branches. From our results it is reasonable to conclude that the increases in GlcNAc-T V enzyme activity seen in src-transformed cells are not due to an increase in the catalytic efficiency of the glycosyltransferase; rather, they are FIG. 11. Src responsiveness to the TV3 fragment can be inhib- due to an increase in the expression of the GlcNAc-T-V mRNA ited by a dominant negative ets-2. pGL2-TV3 was transfected into and subsequently an increase in the number of GlcNAc-T V HepG2 cells alone, with src, ets-2, and/or a dominant negative mutant enzyme molecules/cell. The elevation in steady-state mRNA of ets-2, D1–328. levels could be a result of increased mRNA stability or an increase in the transcription rate of the gene. Our results ciency. More direct evidence of this kind of regulation can be demonstrate that a 59 fragment of the GlcNAc-T V gene is able found in a comparison between a(2,6)-sialyltransferase cDNAs to confer src-transcriptional responsiveness upon a heterologus from different tissues. The cDNAs from transcripts encoding an reporter gene, indicating that the mechanism by which src a(2,6)-sialyltransferase isolated from placenta and B cells en- increases steady-state mRNA levels is most likely transcrip- code identical proteins, but their 59-untranslated regions di- tional activation. Also, the 59-flanking region of the GlcNAc-T V verge from each other approximately 180 bp upstream from the gene was found to contain AP-1 and PEA-3 binding sites, the ATG. The 59-untranslated regions confer different in vitro presence of at least two being required for src-stimulated tran- translational efficiencies on the respective mRNAs. The placen- scriptional enhancement. These data suggest that cooperation tal transcript is translated with what appears to be a 10-fold may be required between AP-1 and Ets transcription factors to greater efficiency than is the B cell transcript. Furthermore, an render the gene fully responsive to oncogenic stimulation. Fi- artificial cDNA construct lacking the 400-bp 59-untranslated nally, transcriptional stimulation by src was found to be sig- region is translated with an apparent 10-fold greater efficiency nificantly dependent on the Ras-Raf pathway, again implicat- than the B cell transcript, indicating that both 59-untranslated ing transcription factors that are activated by the MAPK regions function with different efficiencies as translational sup- pathway and suggesting a general association, at least in some pressors (44). cell types, between GlcNAcb(1,6)Man branching and cellular Another mechanism for the regulation of glycosylation is the proliferation. Other studies have shown that particular glyco- alteration in the stability of the mRNAs that encode glycosyl- syltransferase activities are increased after ras-transforma- transferases. F9 teratocarcinoma cells treated with retinoic tion; notably, a(2,6)-sialyltransferase activity in NIH3T3 acid plus dibutyryl cyclic AMP differentiate into parietal cells is specifically increased by ras expression, and this in- endoderm-like cells and express 20-fold greater specific activity crease is due to increased levels of the mRNA encoding this of the b(1,4)-galactosyltransferase. This increased expression enzyme (49, 50). of activity was found to be accompanied by a similar increase in The regulation of the expression of the GlcNAc-TV gene is the expression levels of the mRNA encoding the enzyme. How- quite complex, involving the use of multiple promoters and ever, promoter activity determinations based on luciferase re- alternative splicing. The brain transcript described in this pa- porter activity, as well as nuclear run-off assays both indicated per begins at a promoter about 3 kb upstream of the translation there to be no significant increase in the transcription rate of initiation site, generating a long 59-untranslated sequence that the gene. The elevated expression of the mRNA was found to be associated with a marked increase in the half-life of both the is unspliced and colinear with the genomic sequence. This transcript and its promoter are different from those observed in short and long transcripts encoding the enzyme (45). In a similar study an effect on the stability of the mRNA for N- HuCC-T1 human bile duct carcinoma cells (48). The GlcNAc-T V mRNAs in these cells appear to be initiated from multiple acetylglucosaminyltransferase V has been shown to account for an increase in mRNA levels in B-16 mouse melanoma cells promoters, one of which is about 1.4 kb downstream of the treated with transforming growth factor-b (2). brain promoter. These mRNAs are also differentially spliced in Finally, control of glycan structure through control of the the 59-UTR to generate messages with much shorter 59-UTRs. transcriptional activity of glycosyltransferase genes has now There are also data to suggest that there are additional pro- src Regulation of GlcNAc-T V Expression 19581 14. Meezan, E., Wu, H. C., Black, P. H., and Robbins, P. W. (1969) Biochemistry 8, moters and alternative splices used by A431 cells when ex- 2518 –2524 pressing this gene. The precise identification of the cis-acting 15. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S., and Kobata, A. (1984) sequences that mediate the activation of GlcNAc-T V transcrip- J. Biol. Chem. 259, 10834 –10840 16. Arango, J., and Pierce, M. (1988) J. Cell. Biochem. 37, 225–231 tion from these alternate promoters will require further inves- 17. Santer, U. V., DeSantis, R., Hard, K. J., van Kuik, J. A., Vliegenthart, J. F., tigation. Other regulatory mechanisms may also be operative Won, B., and Glick, M. C. (1989) Eur. J. Biochem. 181, 249 –260 18. Yamamura, K., Takasaki, S., Ichihashi, M., Mishima, Y., and Kobata, A. in some cell types, including translational control. The Glc- (1991) J. Invest. Dermatol. 97, 735–741 NAc-T V transcript expressed in human brain and in HepG2 19. Yamashita, K., Tachibana, Y., Ohkura, T., and Kobata, A. (1985) J. Biol. cells is approximately three times larger than the coding re- Chem. 260, 3963–3969 20. Yousefi, S., Higgins, E., Daoling, Z., Pollex-Kruger, A., Hindsgaul, O., and gion, indicating the presence of extensive 59- and 39-untrans- Dennis, J. W. (1991) J. Biol. Chem. 266, 1772–1782 lated sequences. The transcript from human brain was found to 21. Lu, Y., and Chaney, W. (1993) Mol. Cell. Biochem. 122, 85–92 have a 59-untranslated region of approximately 3 kb, the long- 22. Palcic, M. M., Ripka, J., Kaur, K. J., Shoreibah, M., Hindsgaul, O., and Pierce, M. (1990) J. Biol. Chem. 265, 6759 – 6769 est 59-UTR of any glycosyltransferase observed to date. This 23. Dennis, J. W., Laferte, S., Waghorne, C., Breitman, M. L., and Kerbel, R. S. 59-UTR may function as a regulator of translation efficiency, as (1987) Science 236, 582–585 has been suggested in the case of the mammary-specific tran- 24. Lu, Y., Pelling, J. C., and Chaney, W. G. (1994) Clin. Exp. Metastasis 12, 47–54 25. Fernandes, B., Sagman, U., Auger, M., Demetriou, M., and Dennis, J. W. script for the b(1,4)-galactosyltransferase and demonstrated for (1991) Cancer Res. 51, 718 –723 the placental and B cell forms of the a(2,6)-sialyltransferase. 26. Vogelstein, B., and Gillespie, D. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 615– 619 Of what consequence is the increased expression of 27. Church, G. M., and Gilbert, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, GlcNAcb(1,6)Man branches during proliferation? One possibil- 1991–1995 ity is that these branches expressed on cell surface proteins 28. Shoreibah, M., Perng, G.-S., Adler, B., Weinstein, J., Basu, R., Cupples, R., Wen, D., Browne, J. K., Buckhaults, P., Fregien, N., and Pierce, M. (1993) that function in cell adhesion can significantly alter the adhe- J. Biol. Chem. 268, 15381–15385 siveness of cells to the extracellular matrix or to each other, 29. Graham, F. L., and van der Eb, A. J. (1973) Virology 54, 536 –539 allowing them to become more migratory. Evidence in support 30. Bruder, J. T., Heidecker, G., and Rapp, U. R. (1992) Genes & Dev. 6, 545–556 31. Aperlo, C., Pognonec, P., Stanley, R., and Boulukos, K. E. (1996) Mol. Cell. of this hypothesis has been observed in the case of mink lung Biol. 16, 6851– 6858 epithelial cells stabily transfected with and overexpressing 32. Uehara, Y., Hori, M., Takeuchi, T., and Umezawa, H. (1985) Jpn. J. Cancer Res. 76, 672– 675 mouse GlcNAc-T V (51). The cells overexpressing GlcNAc-T V 33. Uehara, Y., Murakami, Y., Sugimoto, Y., and Mizuno, S. (1989) Cancer Res. 49, show an altered morphology show altered rates of migration in 780 –785 an in vitro assay. Moreover, these cells show less adhesion to 34. Uehara, Y., Murakami, Y., Mizuno, S., and Kawai, S. (1988) Virology 164, 294 –298 laminin-coated surfaces, compared with the nontransfected 35. Murakami, Y., Mizuno, S., Hori, M., and Uehara, Y. (1988) Cancer Res. 48, controls, suggesting an effect of GlcNAc-T V expression on 1587–1590 laminin adhesion. 36. Suzukake-Tsuchiya, K., Moriya, Y., Hori, M., Uehara, Y., and Takeuchi, T. (1989) J. Antibiot. (Tokyo) 42, 1831–1837 Acknowledgment—We are grateful to Dr. Kelley Moremen for many 37. Qureshi, S. A., Joseph, C. K., Hendrickson, M., Song, J., Gupta, R., Bruder, J., Rapp, U., and Foster, D. A. (1993) Biochem. Biophys. Res. Commun. 192, insightful discussions and suggestions. 969 –975 REFERENCES 38. Qureshi, S. A., Rim, M., Bruder, J., Kolch, W., Rapp, U., Sukhatme, V. P., and Foster, D. A. (1991) J. Biol. Chem. 266, 20594 –20597 1. Cho, S. K., Yeh, J., Cho, M., and Cummings, R. D. (1996) J. Biol. Chem. 271, 39. Perng, G. S., Shoreibah, M., Margitich, I., Pierce, M., and Fregien, N. (1995) 3238 –3246 Glycobiology 4, 867– 871 2. Miyoshi, E., Nishikawa, A., Ihara, Y., Saito, H., Uozumi, N., Hayashi, N., 40. Hahn, T. J., and Goochee, C. F. (1992) J. Biol. Chem. 267, 23982–23987 Fusamoto, H., Kamada, T., and Taniguchi, N. (1995) J. Biol. Chem. 270, 41. Wasylyk, B., Wasylyk, C., Flores, P., Begue, A., Leprince, D., and Stehelin, D. 6216 – 6220 (1990) Nature 346, 191–193 3. Hanasaki, K., Varki, A., Stamenkovic, I., and Bevilacqua, M. P. (1994) J. Biol. 42. Brew, K., Vanaman, T. C., and Hill, R. L. (1968) Biochemistry 59, 491– 497 Chem. 269, 10637–10643 43. Harduin-Lepers, A., Shaper, J. H., and Shaper, N. L. (1993) J. Biol. Chem. 268, 4. Finne, J., Castori, S., Feizi, T., and Burger, M. M. (1989) Int. J. Cancer 43, 14348 –14359 300 –304 44. Aasheim, H. C., Aas-Eng, D. A., Deggerdal, A., Blomhoff, H. K., Funderud, S., 5. Kawano, I., Takasaki, S., Tao, T.-W., and Kobata, A. (1993) Int. J. Cancer 53, and Smeland, E. B. (1993) Eur. J. Biochem. 213, 467– 475 91–96 45. Kudo, T., and Narimatsu, H. (1995) Glycobiology 5, 397– 405 6. Buck, C. A., Glick, M. C., and Warren, L. (1971) Biochemistry 10, 2176 –2180 46. Svensson, E. C., Soreghan, B., and Paulson, J. C. (1990) J. Biol. Chem. 265, 7. Dennis, J. W., Laferte, S., Waghorne, C., Breitman, M. L., and Kerbel, R. S. 20863–20868 (1987) Science 236, 582–585 47. Svensson, E. C., Conley, P. B., and Paulson, J. C. (1992) J. Biol. Chem. 267, 8. Buck, C. A., Glick, M. C., and Warren, L. (1970) Biochemistry 9, 4567– 4576 3466 –3472 9. Tuszynski, G. P., Baker, S. R., Fuhrer, J. P., Buck, C. A., and Warren, L. (1978) 48. Saito, H., Gu, J., Nishikawa, A., Ihara, Y., Fujii, J., Kohgo, Y., and Taniguchi, J. Biol. Chem. 253, 6092– 6099 N. (1995) Eur. J. Biochem. 233, 18 –26 10. Warren, L., Fuhrer, J. P., and Buck, C. A. (1972) Proc. Natl. Acad. Sci. U. S. A. 49. Easton, E. W., Bolscher, J. G. M., and van den Eijnden, D. H. (1991) J. Biol. 69, 1838 –1842 11. Warren, L., Critchley, D., and Macpherson, I. (1972) Nature 235, 275–278 Chem. 266, 21674 –21680 50. Le Marer, N., Laudet, V., Svensson, E. C., Cazlaris, H., Van Hille, B., Lagrou, 12. Glick, M. C. (1979) Biochemistry 18, 2525–2532 13. Glick, M. C., and Buck, C. A. (1973) Biochemistry 12, 85–90 C., Stehelin, D., Montreuil, J., Verbert, A., and Delannoy, P. (1992) Glycobiology 2, 49 –56 51. Demetriou, M., Nabi, I. R., Coppolino, M., Dedhar, S., and Dennis, J. W. (1995) N. Fregien, unpublished observation. J. Cell. Biol. 130, 383–392 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Transcriptional Regulation ofN-Acetylglucosaminyltransferase V by the srcOncogene

Buckhaults, Phillip; Chen, Lin; Fregien, Nevis; Pierce, Michael
Journal of Biological Chemistry – Aug 1, 1997
Download PDF
7 pages

Loading next page...
 
/lp/unpaywall/transcriptional-regulation-ofn-acetylglucosaminyltransferase-v-by-the-aka0ECZgac

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.272.31.19575
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 31, Issue of August 1, pp. 19575–19581, 1997 © 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Transcriptional Regulation of N-Acetylglucosaminyltransferase V by the src Oncogene* (Received for publication, April 3, 1997) Phillip Buckhaults‡§, Lin Chen‡, Nevis Fregien¶, and Michael Pierce‡i From the ‡Department of Biochemistry and Molecular Biology and Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, 30602 and the ¶Department of Cell Biology and Anatomy, University of Miami Medical School, Miami, Florida 33101 Transformation of baby hamster kidney fibroblasts by caused by oncogenic transformation using a variety of agents the Rous sarcoma virus causes a significant increase in (6 –14). This increase in size was found to result mainly from an the GlcNAcb(1,6)Man-branched oligosaccharides by ele- increase in the levels of asparagine-linked oligosaccharides vating the activity and mRNA transcript levels encoding containing N-acetylglucosamine linked b1,6 to the a(1,6)- N-acetylglucosaminyltransferase V (GlcNAc-T V). Ele- linked mannose in the trimannosyl core, (GlcNAcb(1,6)Man), vated activity and mRNA levels could be inhibited by and in many cases these oligosaccharides express polylac- blocking cell proliferation with herbimycin A, demon- tosamine that can be sialylated (15–18). The (GlcNAcb(1,6)Man) strating that Src kinase activity can regulate GlcNAc-T branch is synthesized by N-acetylglucosaminyltransferase V V expression. 5* RACE analysis was used to identify a 1 (GlcNAc-T V), the enzyme whose activity is significantly and 3-kilobase 5*-untranslated region from GlcNAc-T V selectively increased after transformation by tumor viruses or mRNA and locate a transcriptional start site in a 25- isolated oncogenes (16, 19 –22). Moreover, decreased expression kilobase pair GlcNAc-T V human genomic clone. A 6-kil- of the GlcNAcb(1,6)Man branch has been correlated with de- obase pair fragment of the 5* region of the gene con- creased metastatic potential (23, 24), whereas the increased tained AP-1 and PEA3/Ets binding elements and, when expression of this branch appears in some instances to corre- co-transfected with a src expression plasmid into HepG2 late with the progression of invasive malignancies (25). cells, conferred src-stimulated transcriptional enhance- The transformation of baby hamster kidney (BHK) fibro- ment upon a luciferase reporter gene. This stimulation blasts by the src oncogene causes an increase in N-linked by src could be antagonized by co-transfection with a oligosaccharide (GlcNAcb(1,6)Man) branching, and the mech- dominant-negative mutant of the Raf kinase, suggesting anism by which this increase occurs has been under investiga- the involvement of Ets transcription factors in the reg- tion in our laboratories. To elucidate this mechanism, we ex- ulation of GlcNAc-T V gene expression. The src-respon- sive element was localized by 5* deletion analysis to a amined GlcNAc-T V enzyme activity and mRNA levels in BHK 250-base pair region containing two overlapping Ets cells and their Rous sarcoma virus-transformed counterparts sites. src stimulation of transcription from this region (RSV-BHK) in the presence of the Src kinase inhibitor, herbi- was inhibited by co-transfection with a dominant-nega- mycin A. The results from these experiments led us to examine tive mutant of Ets-2, demonstrating that the effects of the 59 region of the human gene encoding GlcNAc-T V and its the src kinase on GlcNAc-T V expression are dependent increased expression caused by Src activity. Our results indi- on Ets. cate that the N-acetylglucosaminyltransferase V gene can be transcriptionally activated by Src tyrosine kinase activity, and this control is dependent on both the Raf-1 kinase and an Ets The glycosylation of cell surface glycoproteins is a dynamic family transcriptional activator. process that can be regulated by agents that cause differenti- EXPERIMENTAL PROCEDURES ation, such as retinoic acid (1) or transforming growth factor-b Glycosyltransferase Activity Assays—Cells were grown to confluency (2), or by those that induce cellular proliferation, for example, and harvested in 50 mM MES 6.5, 150 mM NaCl, and lysed by addition interleukin-1 or tumor necrosis factor-a (3). In many instances, of Trition X-100 to 1%. Lysates were assayed according to the method of alterations of the oligosaccharides on cell surface glycoproteins 6 3 Palcic et al. (22). Briefly, 10 cpm of UDP-[ H]GlcNAc (25 cpm/pmol) cause significant changes in the adhesive or migratory behav- and 10 nmol of synthetic trisaccharide acceptor for GlcNAc-T V (octyl ior of a cell (4, 5). An induced alteration in the glycosylation of 6-O-[2-O-(2-acetamido-2-deoxy-b-D-glucosyl-pyranosyl)-a-D-mannopyr- cell surface glycoproteins that has been documented for many anosyl]-b-D-glucopyraoside) were dried under vacuum in a 1.5-ml mi- crocentrifuge tube. Extracts of various protein concentrations were years concerns the significant increase in oligosaccharide size prepared, and 10 ml were added to the assay tube. Assays were incu- bated at 37 °C for 4 h and quenched by the addition of 500 ml of water. Radiolabeled product was isolated on a C Sep-Pak (Waters) column, * This research was supported by the NCI, National Institutes of eluted in 2 ml of methanol, and counted in a scintillation counter. Health. The costs of publication of this article were defrayed in part by Assays were performed in duplicate or triplicate, at two or three protein the payment of page charges. This article must therefore be hereby concentrations, and specific activity was calculated by linear least marked “advertisement” in accordance with 18 U.S.C. Section 1734 squares regression analysis of the data. solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted TM to the GenBank /EBI Data Bank with accession number(s) AF004882. In memoriam, E.A.P. The abbreviations used are: GlcNAc-T V, N-acetylglucosaminyl- § Present address: The Oncology Center, Johns Hopkins University transferase V; BHK, baby hamster kidney; RSV, Rous sarcoma virus; School of Medicine, Baltimore, MD 21231. PEA, polyoma enhancer activator; GAPDH, glyceraldehyde phosphate To whom correspondence should be addressed: Dept. of Biochemis- dehydrogenase; RACE, rapid amplification of cDNA ends; GlcNAc-T I, try and Cell Biology, Life Science Bldg., University of Georgia, Athens, N-acetylglucosaminyltransferase I; MES, 4-morpholineethanesulfonic GA 30602. Tel.: 706-542-1702; Fax: 706-542-1759; E-mail: pierce@ acid; kb, kilobase pair(s); PCR, polymerase chain reaction; bp, base bscr.uga.edu. pair(s); UTR, untranslated region. This paper is available on line at http://www.jbc.org 19575 This is an Open Access article under the CC BY license. 19576 src Regulation of GlcNAc-T V Expression Northern Analysis—20 mg of total RNA was electrophoresed on a 1% formaldehyde-agarose gel and blotted to nylon. A 1-kb fragment of a partial rat GlcNAc-T V cDNA clone was random prime-labeled (26), and the blot was probed according to the method of Church and Gilbert (27). Data were collected and quantitated with a PhosphorImager. Phosphotyrosine Quantitation—Cells were harvested by the addition of 1 ml of preheated SDS-polyacrylamide gel electrophoresis sample buffer to a 10-cm plate and shearing through a 20 gauge needle. Protein concentrations were determined on trichloroacetic acid precipitates us- ing the BCA reagents (Pierce). 20 mg of protein were electrophoresed on a 4 –20% gradient acrylamide gel and transferred to nitrocellulose (Bio- Rad). Blots were probed with an anti-phosphotyrosine antibody (a kind gift from Dr. Bart Sefton) followed by a goat anti-mouse horseradish peroxidase conjugate. Bands were detected using the ECL reagents (Amersham Corp.) and quantitated by scanning densitometry. 59 RACE Analysis—Marathon Race Ready cDNA from human whole brain (CLONTECH) was used as a template in a 59 RACE PCR accord- ing to the manufacturer’s instructions. A 39 PCR primer (303, CCTG- GACCTCAGCAAAAGGTACATCAAGGC) designed near the 59 end of the published human cDNA sequence was used along with the 59 anchor primer in a primary round of RACE PCR. Products were separated on FIG.1. BHK and RSV-BHK cell GlcNAc-T V and GlcNAc-T I a 1% Tris-acetic acid-EDTA-agarose gel and blotted to nitrocellulose. A specific activities. The specific activities of both enzymes were meas- nested PCR product was generated using the primers 501 (GAATG- ured in cell lysates under optimal conditions. The specific activity of GAAGTGAGGGAAGGC) and 305 (GGAAGTTGTCCTCTCAGAAGCT- each enzyme in BHK cells was set at 100%. GGGCTTT) and a genomic clone template. This product was random prime-labeled (26) and used to probe the membrane to which the RACE increase in GlcNAc-T V activity in the transformed cells could PCR product was transferred (see Fig. 6). To improve yields of authentic result from differences in mRNA levels. GlcNAc-T V activity products, a secondary round of RACE PCR was then performed. A nested GlcNAc-T V 39 primer (305) and nested 59 anchor primer were was assayed under optimal conditions in BHK and RSV-BHK used in the secondary round of RACE PCR using as templates the cells using a synthetic trisaccharide acceptor. The transformed products from the primary RACE PCR. The products from this round of BHK cells demonstrated a GlcNAc-T V enzyme specific activity RACE PCR were directly subcloned into the TA cloning vector (Invitro- 6-fold higher than the untransformed BHK cells. By contrast, gen), and clones were sequenced. no difference was seen in the specific activity of another N- Genomic Clone Isolation—The human GlcNAc-T V promoter se- acetylglucosaminyltransferase that functions in the synthesis quences were isolated from a human genomic library cloned in the l-FIX II vector (Stratagene, Inc.). A 687-bp EcoRI fragment containing of N-linked oligosaccharides, GlcNAc-T I (Fig. 1), indicating the the 59-untranslated region of the rat cDNA (28) was used as a probe to specificity of Rous sarcoma virus transformation on GlcNAc-T screen this library using standard plaque hybridization procedures. V activity. To investigate the possibility that the difference in Screening 5 3 10 phage plaques yielded two overlapping genomic GlcNAc-T V specific activity is associated with a difference in clones that span a region of approximately 30 kb. steady-state mRNA levels, Northern blots were performed us- Nucleotide Sequencing—Sequencing of RACE PCR clones and hu- ing a fragment of a cDNA encoding GlcNAc-T V. Compared man genomic clones was performed using the Applied Biosystems, Inc. reagents by the UGA Molecular Genetics Instrumentation Facility. with BHK cells, RSV-transformed cells were found to have a Luciferase Reporter Construction—For pGL2-TV1, a 6-kb XhoI-SacI 6-fold increase in the expression levels of both 8.7 and 9.3 kb fragment of the genomic clone was band-purified (Sephaglass, Pharma- GlcNAc-T V transcripts, but no change in either GAPDH or cia Biotech Inc.) and subcloned into XhoI-SacI sites of the pGL2-Basic GlcNAc-T I transcripts (Fig. 2). Although not apparent in Fig. vector (Promega). For pGL2-TV2 through pGL2-TV4, PCR products 2, PhosphorImager quantitation demonstrated an equivalent were generated using the genomic clone as a template and subcloned increase in both GlcNAc-T V mRNA transcripts. These results into the TA vector. TA clones of the correct orientation were cut with XhoI-SacI, and inserts were cloned into XhoI-SacI sites of pGL2-Basic. demonstrated that the elevation of enzyme activity in the RSV- Promoter Activity Determinations—SV40-b-galactosidase (2 mg) and transformed cells was a result of either transcriptional activa- reporter constructs (2 mg) 6 effector plasmids (2 mg) were transfected by tion or increased mRNA stability and argue against postrans- the calcium-phosphate precipitation method (29) into 50% confluent lational modifications of the enzyme causing a significant cultures of HepG2 cells grown in 6-well culture plates. 40 h post- increase in its catalytic activity. transfection, cell lysates were prepared and assayed for b-galactosidase To obtain convincing evidence that the differences in Glc- and luciferase (Promega). Luciferase activity was normalized to vector- dependent b-galactosidase activity. NAc-T V expression result from src tyrosine kinase activity, we Plasmids—The plasmids encoding the Raf-1 kinase and its dominant made use of a src-selective tyrosine kinase inhibitor, herbimy- negative form (30) were kind gifts from Dr. Ulf Rapp. Plasmids encod- cin A, a metabolite produced by Streptomyces sp. MH237-CF8. ing Ets-2 and its dominant negative form (31) were kinds gifts from Dr. This inhibitor was first identified for its ability to reverse the K. E. Boulukos. The v-src expression plasmid was a kind gift from transformed morphology of Rous sarcoma virus-infected rat Dr. Tony Hunter. kidney cells (32), and this reversion of morphology was associ- RESULTS ated with a reduction in total cellular phosphotyrosine levels Earlier experiments utilizing BHK and RSV-BHK cells met- (33). Herbimycin A was unable, however, to reverse the trans- abolically radiolabeled with [2- H]mannose indicated at least a formed morphologies induced by the ras, raf,or myc oncogenes, 2-fold increase in the total amount of (2,6)-substituted mannose demonstrating its specificity for the src family of tyrosine ki- in the RSV-BHK cells, normalized to total mannose-labeled nase oncogenes (34). Herbimycin A is also able to reverse src- glycopeptides. Although the specific activity of GlcNAc-T V was stimulated expression of the glucose transporter gene (35) and increased over 6-fold in the RSV-transformed cells, no signifi- to cause a reversible G contact arrest in src-transformed nor- cant differences in the kinetic properties of GlcNAc-T V in the mal rat kidney cells (36). We utilized herbimycin A, therefore, transformed cells could be detected. These results suggested to test the hypothesis that the expression of GlcNAc-T V is that the increases in GlcNAcb(1,6)Man levels after transforma- positively regulated by the src tyrosine kinase. tion were most likely not due to post-translational effects on First, to monitor the effects of src kinase and demonstrate its the enzyme (22). The specific activity of GlcNAc-T V and its inhibition by herbimycin A, we measured total cellular phos- mRNA levels were measured, therefore, to determine if the photyrosine levels by performing Western blots with an a-phos- src Regulation of GlcNAc-T V Expression 19577 FIG.3. BHK and RSV-BHK cell phosphotyrosine levels. Total cell extracts were subjected to SDS-polyacrylamide gel electrophoresis and subjected to Western blotting using as a probe an anti-phosphoty- rosine antibody. Bound antibody was visualized using luminescent reagents and quantitated by densitometer scanning. FIG.2. BHK and RSV-BHK cell GlcNAc-T V mRNA levels. Upper panel, Northern blot of total RNA from BHK (lane 1) and RSV-BHK cells (lane 2) probed with a 1-kb radiolabeled fragment from the open reading frame of murine GlcNAc-T V and visualized using a Phosphor- Imager. Lower panel, PhosphorImager quantitation of the band inten- sities from the analysis shown in the upper panel. The blot was stripped FIG.4. BHK and RSV-BHK GlcNAc-T V specific activities after and hybridized with a rat GAPDH radiolabeled cDNA to demonstrate treatment with herbimycin A. GlcNAc-T V enzyme specific activity loading equivalence. was measured in cell lysates that had been incubated for 24 h with various concentrations of herbimycin A. photyrosine antibody on extracts made from cells treated for 24 h with various concentrations of the drug. These results pared from RSV-transformed cells treated with various concen- demonstrate that, as expected, herbimycin A caused a dose-de- trations of the drug. Similar to its effects on GlcNAc-T V en- pendent decrease in cellular phosphotyrosine levels (Fig. 3). At zyme specific activity, herbimycin A caused a decrease in a concentration of 1 mg/ml, herbimycin A caused a reversal of GlcNAc-T V message levels in the RSV-BHK cells in a dose-de- the RSV-transformed morphology and a complete inhibition of pendent manner (Fig. 5). Taken together, these results indicate cell division (data not shown). Consistent with the drug’s effect that expression of the GlcNAc-T V mRNA in the src-trans- of inhibiting the src kinase (33) and blocking cell division in G formed cells is under the control of the src tyrosine kinase. (36), herbimycin A caused a dose-dependent decrease in Glc- To elucidate the mechanism by which src induces the expres- NAc-T V enzyme specific activity in RSV-transformed BHK sion of GlcNAc-T V, we isolated the 59-flanking region of the cells (Fig. 4). Interestingly, although the drug blocked cell gene and analyzed this region for promoter activity. The Glc- division and caused a modest decrease in phosphotyrosine lev- NAc-T V message is approximately 9 kb in most rodent and els in the untransformed BHK cells (data not shown), it had human tissues, with brain having high expression levels. To little effect on the expression level of GlcNAc-T V enzyme locate a promoter for GlcNAc-T V, 59 RACE PCR techniques activity in confluent cultures of untransformed cells (Fig. 4). were used to isolate and sequence the 59 end of the message This result suggests that regulation of GlcNAc-T V expression from human brain. RACE PCR products were first generated is complex, with both src-dependent and src-independent fac- from the genomic clone using the 303 primer (designed against tors. Herbimycin A had no effect on the specific activity of the 59 end of the human GlcNAc-T V cDNA sequence) and then GlcNAc-T I (data not shown), arguing against nonspecific toxic analyzed by Southern blotting. GlcNAc-T V-specific sequences effects on the transformed cells and confirming that GlcNAc-T were detected using a nested 501–305 PCR product as the I is not regulated by src. To determine if the inhibition of hybridization probe. Multiple bands were detected, the longest expression of GlcNAc-T V enzyme activity by herbimycin A was of which was 2.9 kb (Fig. 6). PCR products were ligated into the a result of inhibiting the expression of the mRNA encoding the TA cloning vector, and clones corresponding to the 600- and enzyme, Northern blots were performed on RNA samples pre- 1200-bp products were obtained and found to overlap and differ 19578 src Regulation of GlcNAc-T V Expression FIG.5. BHK and RSV GlcNAc-T V mRNA levels after treatment FIG.7. Schematic representation of the 5* region of the Glc- with herbimycin A. Total RNA was extracted from cells treated for NAc-T V gene. The fine line represents 8390 bp of genomic sequence 24 h with herbimycin A and subjected to Northern blot analysis, and the whose 59 boundary is a SacI site, which is also the 59 boundary of the results were quantitated using a PhosphorImager. The level of Glc- pGL2-TV1 construct and can be found in the GenBanky accession NAc-T V mRNA in untreated cells was set at 100%. number: AF004882. The XhoI site marks the 39 boundary of the pGL2- TV1 construct. TV2, TV3, and TV4 mark the 59 boundaries of the pGL2-TV2, pGL2-TV3, and pGL2-TV4 constructs, respectively. The 39 boundaries of these three constructs are each 70 bp 39 of the transcrip- tional start site. The PEA-3 (ets-2 binding sites) and AP-1 sites neces- sary for full src- responsiveness are denoted above the line. The bold line denotes the GlcNAc-T V open reading frame. start site, a 6-kb SacI-XhoI genomic fragment containing 848 bp of the brain 59-UTR and 5.5 kb of 59-flanking sequence (depicted in Fig. 7), designated pGL2-TV1, was cloned into the luciferase expression vector pGL2-basic. The activity of this region as a promoter and its responsiveness to src were then examined in transiently transfected HepG2 cells. pGL2-TV1 was found to act as a weak promoter, shown in Fig. 8, consist- ent with the low levels of GlcNAc-T V transcript observed in HepG2 cells and most tissues. Moreover, this DNA fragment conferred transcriptional responsiveness to src when co-trans- fected with a src-containing expression plasmid (Fig. 8). The similarity between the increases in GlcNAc-T V expression in the RSV-transformed cells and src stimulation of transcription FIG.6. RACE PCR Southern blot analysis. A RACE-anchored from the GlcNAc-T V promoter in HepG2 cells suggests that human brain cDNA library was used for PCR using a 39 GlcNAc-T V transcriptional control is likely the most important regulatory primer (GCCTTGATGTACCTTTTGCCGAGGTCCAGG) and a 59 an- chor primer, and the products were separated and subjected to South- influence of src on GlcNAc-T V activity. ern blot analysis. The blot was probed with a biotinylated GlcNAc-T-V Transformation and some transcriptional activation by src PCR product to detect authentic GlcNAc-T V products, as described occurs via the MAPK pathway in a Raf-1-dependent manner. under “Experimental Procedures.” The largest band visualized by this For example, a dominant-negative Raf-1 mutant suppresses src analysis (left lane) was calculated to be 2.8 kb in length. Size markers are shown at right. transformation of BALB/c mouse fibroblasts (37) and is able to block src-stimulated transcriptional activation of the EGR gene only in the length of their 59 ends. To isolate a product that (38). Furthermore, this mutant is able to block serum or Ras encompassed all of the 59-untranslated region of the GlcNAc-T stimulation of the transcription of an AP-1/Ets-driven gene V message, a second round of RACE PCR was then performed (30). If transcriptional activation of GlcNAc-T V by src occurs at using two nested primers designed near the 59 end of the 0.6 kb least in part via the MAPK pathway, we reasoned that the clone, and the resulting products were subcloned and se- activation should be inhibited by the dominant-negative Raf-1 quenced. Clones corresponding to the 1.8- and 2.9-kb bands mutant. Consistent with this hypothesis, the transcriptional were isolated from this second round of RACE PCR and se- stimulation of the GlcNAc-T V promoter by src was signifi- quenced. As before, these clones were found to differ only in the cantly inhibited when co-transfected with a plasmid encoding a length of their 59 ends. A third round of RACE PCR using a 39 dominant-negative mutant Raf, RafC4B-DN (Fig. 8). Because primer designed to the sequence near the 59 end of the 2.9-kb proliferation often occurs in a Raf-dependent manner, this re- clone produced a single product of the expected size (70 bp). The sult is consistent with correlations noted between GlcNAc-T assembled sequence of the RACE clones was co-linear with the V expression and cellular proliferation in nontransformed sequence of the genomic clone in this region, indicating that no cells (39, 40) and may predict in certain cell types a general splicing events occurred in the 59-UTR of the message from association between GlcNAc-T V enzyme activity and cell human brain. These results demonstrate, therefore, that the proliferation. location of the 59-most transcriptional start site utilized in To map more closely the region of the GlcNAc-T V promoter brain is located approximately 2.9 kb upstream of the ATG, responsible for transcriptional activation by src, a series of 59 corresponding to the band of this size shown in Fig. 6. deletions containing 70 bp of the brain 59-UTR and different To examine the 59 region flanking the 59-most transcriptional amounts of the 59-flanking region were constructed by PCR src Regulation of GlcNAc-T V Expression 19579 FIG.9. Mapping the Src-responsive region of the GlcNAc-T V genomic fragments. Fragments TV1 through TV4 were separately subcloned into the pGL2-Basic luciferase reporter vector and tested for src responsiveness. The TV3 fragment contained the shortest sequence that showed responsiveness and includes two overlapping PEA-3 sites upstream from a single AP-1 site. FIG.8. The TV1 fragment promoter activity is responsive to src and is dependent on raf. The TV1 fragment depicted in Fig. 7, representing a 6240-bp SacI-XhoI fragment of the 59-flanking region, was cloned into the pGL2-Basic luciferase reporter vector and used to transfect Hep G-2 cells in the presence and the absence of a co-trans- fected src-expression plasmid. A dominant negative raf-1 expression plasmid, Raf C4B, was also utilized in some transfections, as well as an expression plasmid containing an inactive point mutant of the same, Raf C4B pm17. amplification from the genomic clone, the boundaries of which are depicted in Fig. 7. Promoter fragments were cloned into the pGL2-basic vector and tested for basal promoter activity and FIG. 10. Nucleotide sequence of the GlcNAc-T V genomic frag- src responsiveness. Based on the results from several sets of ment TV3. This sequence corresponds to the shortest fragment tested experiments, both pGL2-TV2, which contained about 1.2 kb, that conferred src responsiveness to a GlcNAc-T V promoter-driven and pGL2-TV3, which contained 739 bp, were both found to be luciferase gene. The fragment was generated as described under “Ex- perimental Procedures” and included 70 bp 39 of the transcriptional weakly active as promoters and transcriptionally responsive to start site. PEA-3 (Ets-2 binding sites) and AP-1 binding sites are de- src (Fig. 9). The pGL2-TV4 construct containing 339 bp, how- noted by solid underlining and dotted underlining, respectively. The 59 ever, was found to be inactive as a basic promoter and com- and 39 ends correspond to positions 2659 and 170, respectively, as pletely unresponsive to src. These results suggest a require- depicted in Fig. 7. ment for the two overlapping PEA-3 sites located near the transcriptional start site, contained in pGL2-TV3, in the src- DISCUSSION mediated transcriptional activation of the GlcNAc-T V gene (Figs. 7 and 10). A major regulatory mechanism for controlling the expression PEA-3 sites are bound by the Ets family of transcriptional of glycan structures is alteration in the activities of the en- activators and mediate transcriptional activation in response zymes involved in their synthesis. Changes in glycosyltrans- to mitogenic signals from plasma membrane-associated tyro- ferase activity may occur by several different mechanisms, sine kinase oncogenes (41). To obtain more direct evidence for including post-translational interactions with specifier pro- the involvement of an Ets family transcription factor in src- teins (42) and translational control of glycosyltransferase tran- stimulated transcription of the GlcNAc-T V gene, we exploited scripts. For example, the b(1,4)-galactosyltransferase is ex- the availability of an ets-2 expression plasmid along with an pressed at low to moderate levels in most tissues as a 4.1-kb expression plasmid that encoded a truncated ets-2 with a dom- transcript. However, high level expression in lactating mam- inant-negative activity, ets-2D1–328 (31). Co-transfection of mary gland is accompanied by a switch from one transcrip- pGL2-TV3 with ets-2 resulted in stimulation of transcription, tional start site to another, which is more proximal to the whereas co-transfection with ets-2D1–328 was able to block translational start site, giving rise to the expression of a 3.9-kb src-transcriptional stimulation (Fig. 11). This result demon- transcript (43). The longer transcript is predicted to form a strates that this region is capable of being transcriptionally stable hairpin loop structure in the 59-untranslated region, stimulated in response to ets-2 expression and suggests that src which may reduce translation efficiency. The shorter transcript transcriptionally activates this region through a factor that is predicted to be unable to form any significant 59 structure binds to the PEA-3 site(s). and therefore is thought to be translated with greater effi- 19580 src Regulation of GlcNAc-T V Expression been described in several systems. Early indications of this regulatory mechanism were found in a functional analysis of a promoter of the a(2,6)-sialyltransferase gene. This transferase is highly expressed in liver, and its promoter was found to contain binding sites for liver-enriched transcription factors. These sites and their cognate transcription factors were found to be functional in luciferase reporter transactivation assays in Hep G2 cells but were not functional in Chinese hamster ovary cells. These transcription factors and their binding sites are thought to be responsible for the liver-restricted expression of this message (46, 47). Also, retinoic acid-induced differentia- tion of F9 teratocarcinoma cells has been documented to be associated with an increase in the activity of the murine a(1, 3)-galactosyltransferase and a switch in the expression of ter- minal capping structures from a(2, 3)-linked sialic acid to ga- lactose. The increase in the activity of the transferase is asso- ciated with an elevation in the steady-state levels of the mRNA and a similar increase in the transcription rate of the gene (1). The association between oncogenic transformation and in- creases in GlcNAc-T V enzyme activity and expression of GlcNAcb(1,6)Man branches on glycoproteins raises the ques- tion concerning the mechanism by which oncogenes and prolif- erative signals in general up-regulate the synthesis of GlcNAcb(1,6)Man branches. From our results it is reasonable to conclude that the increases in GlcNAc-T V enzyme activity seen in src-transformed cells are not due to an increase in the catalytic efficiency of the glycosyltransferase; rather, they are FIG. 11. Src responsiveness to the TV3 fragment can be inhib- due to an increase in the expression of the GlcNAc-T-V mRNA ited by a dominant negative ets-2. pGL2-TV3 was transfected into and subsequently an increase in the number of GlcNAc-T V HepG2 cells alone, with src, ets-2, and/or a dominant negative mutant enzyme molecules/cell. The elevation in steady-state mRNA of ets-2, D1–328. levels could be a result of increased mRNA stability or an increase in the transcription rate of the gene. Our results ciency. More direct evidence of this kind of regulation can be demonstrate that a 59 fragment of the GlcNAc-T V gene is able found in a comparison between a(2,6)-sialyltransferase cDNAs to confer src-transcriptional responsiveness upon a heterologus from different tissues. The cDNAs from transcripts encoding an reporter gene, indicating that the mechanism by which src a(2,6)-sialyltransferase isolated from placenta and B cells en- increases steady-state mRNA levels is most likely transcrip- code identical proteins, but their 59-untranslated regions di- tional activation. Also, the 59-flanking region of the GlcNAc-T V verge from each other approximately 180 bp upstream from the gene was found to contain AP-1 and PEA-3 binding sites, the ATG. The 59-untranslated regions confer different in vitro presence of at least two being required for src-stimulated tran- translational efficiencies on the respective mRNAs. The placen- scriptional enhancement. These data suggest that cooperation tal transcript is translated with what appears to be a 10-fold may be required between AP-1 and Ets transcription factors to greater efficiency than is the B cell transcript. Furthermore, an render the gene fully responsive to oncogenic stimulation. Fi- artificial cDNA construct lacking the 400-bp 59-untranslated nally, transcriptional stimulation by src was found to be sig- region is translated with an apparent 10-fold greater efficiency nificantly dependent on the Ras-Raf pathway, again implicat- than the B cell transcript, indicating that both 59-untranslated ing transcription factors that are activated by the MAPK regions function with different efficiencies as translational sup- pathway and suggesting a general association, at least in some pressors (44). cell types, between GlcNAcb(1,6)Man branching and cellular Another mechanism for the regulation of glycosylation is the proliferation. Other studies have shown that particular glyco- alteration in the stability of the mRNAs that encode glycosyl- syltransferase activities are increased after ras-transforma- transferases. F9 teratocarcinoma cells treated with retinoic tion; notably, a(2,6)-sialyltransferase activity in NIH3T3 acid plus dibutyryl cyclic AMP differentiate into parietal cells is specifically increased by ras expression, and this in- endoderm-like cells and express 20-fold greater specific activity crease is due to increased levels of the mRNA encoding this of the b(1,4)-galactosyltransferase. This increased expression enzyme (49, 50). of activity was found to be accompanied by a similar increase in The regulation of the expression of the GlcNAc-TV gene is the expression levels of the mRNA encoding the enzyme. How- quite complex, involving the use of multiple promoters and ever, promoter activity determinations based on luciferase re- alternative splicing. The brain transcript described in this pa- porter activity, as well as nuclear run-off assays both indicated per begins at a promoter about 3 kb upstream of the translation there to be no significant increase in the transcription rate of initiation site, generating a long 59-untranslated sequence that the gene. The elevated expression of the mRNA was found to be associated with a marked increase in the half-life of both the is unspliced and colinear with the genomic sequence. This transcript and its promoter are different from those observed in short and long transcripts encoding the enzyme (45). In a similar study an effect on the stability of the mRNA for N- HuCC-T1 human bile duct carcinoma cells (48). The GlcNAc-T V mRNAs in these cells appear to be initiated from multiple acetylglucosaminyltransferase V has been shown to account for an increase in mRNA levels in B-16 mouse melanoma cells promoters, one of which is about 1.4 kb downstream of the treated with transforming growth factor-b (2). brain promoter. These mRNAs are also differentially spliced in Finally, control of glycan structure through control of the the 59-UTR to generate messages with much shorter 59-UTRs. transcriptional activity of glycosyltransferase genes has now There are also data to suggest that there are additional pro- src Regulation of GlcNAc-T V Expression 19581 14. Meezan, E., Wu, H. C., Black, P. H., and Robbins, P. W. (1969) Biochemistry 8, moters and alternative splices used by A431 cells when ex- 2518 –2524 pressing this gene. The precise identification of the cis-acting 15. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S., and Kobata, A. (1984) sequences that mediate the activation of GlcNAc-T V transcrip- J. Biol. Chem. 259, 10834 –10840 16. Arango, J., and Pierce, M. (1988) J. Cell. Biochem. 37, 225–231 tion from these alternate promoters will require further inves- 17. Santer, U. V., DeSantis, R., Hard, K. J., van Kuik, J. A., Vliegenthart, J. F., tigation. Other regulatory mechanisms may also be operative Won, B., and Glick, M. C. (1989) Eur. J. Biochem. 181, 249 –260 18. Yamamura, K., Takasaki, S., Ichihashi, M., Mishima, Y., and Kobata, A. in some cell types, including translational control. The Glc- (1991) J. Invest. Dermatol. 97, 735–741 NAc-T V transcript expressed in human brain and in HepG2 19. Yamashita, K., Tachibana, Y., Ohkura, T., and Kobata, A. (1985) J. Biol. cells is approximately three times larger than the coding re- Chem. 260, 3963–3969 20. Yousefi, S., Higgins, E., Daoling, Z., Pollex-Kruger, A., Hindsgaul, O., and gion, indicating the presence of extensive 59- and 39-untrans- Dennis, J. W. (1991) J. Biol. Chem. 266, 1772–1782 lated sequences. The transcript from human brain was found to 21. Lu, Y., and Chaney, W. (1993) Mol. Cell. Biochem. 122, 85–92 have a 59-untranslated region of approximately 3 kb, the long- 22. Palcic, M. M., Ripka, J., Kaur, K. J., Shoreibah, M., Hindsgaul, O., and Pierce, M. (1990) J. Biol. Chem. 265, 6759 – 6769 est 59-UTR of any glycosyltransferase observed to date. This 23. Dennis, J. W., Laferte, S., Waghorne, C., Breitman, M. L., and Kerbel, R. S. 59-UTR may function as a regulator of translation efficiency, as (1987) Science 236, 582–585 has been suggested in the case of the mammary-specific tran- 24. Lu, Y., Pelling, J. C., and Chaney, W. G. (1994) Clin. Exp. Metastasis 12, 47–54 25. Fernandes, B., Sagman, U., Auger, M., Demetriou, M., and Dennis, J. W. script for the b(1,4)-galactosyltransferase and demonstrated for (1991) Cancer Res. 51, 718 –723 the placental and B cell forms of the a(2,6)-sialyltransferase. 26. Vogelstein, B., and Gillespie, D. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 615– 619 Of what consequence is the increased expression of 27. Church, G. M., and Gilbert, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, GlcNAcb(1,6)Man branches during proliferation? One possibil- 1991–1995 ity is that these branches expressed on cell surface proteins 28. Shoreibah, M., Perng, G.-S., Adler, B., Weinstein, J., Basu, R., Cupples, R., Wen, D., Browne, J. K., Buckhaults, P., Fregien, N., and Pierce, M. (1993) that function in cell adhesion can significantly alter the adhe- J. Biol. Chem. 268, 15381–15385 siveness of cells to the extracellular matrix or to each other, 29. Graham, F. L., and van der Eb, A. J. (1973) Virology 54, 536 –539 allowing them to become more migratory. Evidence in support 30. Bruder, J. T., Heidecker, G., and Rapp, U. R. (1992) Genes & Dev. 6, 545–556 31. Aperlo, C., Pognonec, P., Stanley, R., and Boulukos, K. E. (1996) Mol. Cell. of this hypothesis has been observed in the case of mink lung Biol. 16, 6851– 6858 epithelial cells stabily transfected with and overexpressing 32. Uehara, Y., Hori, M., Takeuchi, T., and Umezawa, H. (1985) Jpn. J. Cancer Res. 76, 672– 675 mouse GlcNAc-T V (51). The cells overexpressing GlcNAc-T V 33. Uehara, Y., Murakami, Y., Sugimoto, Y., and Mizuno, S. (1989) Cancer Res. 49, show an altered morphology show altered rates of migration in 780 –785 an in vitro assay. Moreover, these cells show less adhesion to 34. Uehara, Y., Murakami, Y., Mizuno, S., and Kawai, S. (1988) Virology 164, 294 –298 laminin-coated surfaces, compared with the nontransfected 35. Murakami, Y., Mizuno, S., Hori, M., and Uehara, Y. (1988) Cancer Res. 48, controls, suggesting an effect of GlcNAc-T V expression on 1587–1590 laminin adhesion. 36. Suzukake-Tsuchiya, K., Moriya, Y., Hori, M., Uehara, Y., and Takeuchi, T. (1989) J. Antibiot. (Tokyo) 42, 1831–1837 Acknowledgment—We are grateful to Dr. Kelley Moremen for many 37. Qureshi, S. A., Joseph, C. K., Hendrickson, M., Song, J., Gupta, R., Bruder, J., Rapp, U., and Foster, D. A. (1993) Biochem. Biophys. Res. Commun. 192, insightful discussions and suggestions. 969 –975 REFERENCES 38. Qureshi, S. A., Rim, M., Bruder, J., Kolch, W., Rapp, U., Sukhatme, V. P., and Foster, D. A. (1991) J. Biol. Chem. 266, 20594 –20597 1. Cho, S. K., Yeh, J., Cho, M., and Cummings, R. D. (1996) J. Biol. Chem. 271, 39. Perng, G. S., Shoreibah, M., Margitich, I., Pierce, M., and Fregien, N. (1995) 3238 –3246 Glycobiology 4, 867– 871 2. Miyoshi, E., Nishikawa, A., Ihara, Y., Saito, H., Uozumi, N., Hayashi, N., 40. Hahn, T. J., and Goochee, C. F. (1992) J. Biol. Chem. 267, 23982–23987 Fusamoto, H., Kamada, T., and Taniguchi, N. (1995) J. Biol. Chem. 270, 41. Wasylyk, B., Wasylyk, C., Flores, P., Begue, A., Leprince, D., and Stehelin, D. 6216 – 6220 (1990) Nature 346, 191–193 3. Hanasaki, K., Varki, A., Stamenkovic, I., and Bevilacqua, M. P. (1994) J. Biol. 42. Brew, K., Vanaman, T. C., and Hill, R. L. (1968) Biochemistry 59, 491– 497 Chem. 269, 10637–10643 43. Harduin-Lepers, A., Shaper, J. H., and Shaper, N. L. (1993) J. Biol. Chem. 268, 4. Finne, J., Castori, S., Feizi, T., and Burger, M. M. (1989) Int. J. Cancer 43, 14348 –14359 300 –304 44. Aasheim, H. C., Aas-Eng, D. A., Deggerdal, A., Blomhoff, H. K., Funderud, S., 5. Kawano, I., Takasaki, S., Tao, T.-W., and Kobata, A. (1993) Int. J. Cancer 53, and Smeland, E. B. (1993) Eur. J. Biochem. 213, 467– 475 91–96 45. Kudo, T., and Narimatsu, H. (1995) Glycobiology 5, 397– 405 6. Buck, C. A., Glick, M. C., and Warren, L. (1971) Biochemistry 10, 2176 –2180 46. Svensson, E. C., Soreghan, B., and Paulson, J. C. (1990) J. Biol. Chem. 265, 7. Dennis, J. W., Laferte, S., Waghorne, C., Breitman, M. L., and Kerbel, R. S. 20863–20868 (1987) Science 236, 582–585 47. Svensson, E. C., Conley, P. B., and Paulson, J. C. (1992) J. Biol. Chem. 267, 8. Buck, C. A., Glick, M. C., and Warren, L. (1970) Biochemistry 9, 4567– 4576 3466 –3472 9. Tuszynski, G. P., Baker, S. R., Fuhrer, J. P., Buck, C. A., and Warren, L. (1978) 48. Saito, H., Gu, J., Nishikawa, A., Ihara, Y., Fujii, J., Kohgo, Y., and Taniguchi, J. Biol. Chem. 253, 6092– 6099 N. (1995) Eur. J. Biochem. 233, 18 –26 10. Warren, L., Fuhrer, J. P., and Buck, C. A. (1972) Proc. Natl. Acad. Sci. U. S. A. 49. Easton, E. W., Bolscher, J. G. M., and van den Eijnden, D. H. (1991) J. Biol. 69, 1838 –1842 11. Warren, L., Critchley, D., and Macpherson, I. (1972) Nature 235, 275–278 Chem. 266, 21674 –21680 50. Le Marer, N., Laudet, V., Svensson, E. C., Cazlaris, H., Van Hille, B., Lagrou, 12. Glick, M. C. (1979) Biochemistry 18, 2525–2532 13. Glick, M. C., and Buck, C. A. (1973) Biochemistry 12, 85–90 C., Stehelin, D., Montreuil, J., Verbert, A., and Delannoy, P. (1992) Glycobiology 2, 49 –56 51. Demetriou, M., Nabi, I. R., Coppolino, M., Dedhar, S., and Dennis, J. W. (1995) N. Fregien, unpublished observation. J. Cell. Biol. 130, 383–392

Journal

Journal of Biological Chemistry – Unpaywall

Published: Aug 1, 1997

There are no references for this article.