Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

A key role for replication factor C in DNA replication checkpoint function in fission yeast

A key role for replication factor C in DNA replication checkpoint function in fission yeast 462–469 Nucleic Acids Research, 1999, Vol. 27, No. 2  1999 Oxford University Press A key role for replication factor C in DNA replication checkpoint function in fission yeast Nicola Reynolds, Peter A. Fantes and Stuart A. MacNeill* Institute of Cell and Molecular Biology, University of Edinburgh, King’s Buildings, Mayfield Road, Edinburgh EH9 3JR, UK Received October 8, 1998; Revised and Accepted November 13, 1998 ABSTRACT budding yeast (16–18), as is the putative Rfc4 protein in Drosophila (19), indicating that although the individual subunits Replication factor C (RF-C) is a five subunit DNA are structurally related to one another, presumably as a result of polymerase (Pol) δ/ε accessory factor required at the being descended from a common ancestor, their functions are not replication fork for loading the essential processivity interchangeable. factor PCNA onto the 3′-ends of nascent DNA strands. Although RF-C is specifically a eukaryotic replication factor, Here we describe the genetic analysis of the rfc2 gene the function it performs appears to be universally conserved. A of the fission yeast Schizosaccharomyces pombe structurally related complex in Escherichia coli (the γ complex) encoding a structural homologue of the budding yeast acts to load the PCNA-like β sliding clamp onto DNA for Rfc2p and human hRFC37 proteins. Deletion of the processive synthesis of chromosomal DNA by Pol III, while rfc2 gene from the chromosome is lethal but does not phage T4 DNA replication relies upon the RF-C-like gp44/62 result in the checkpoint-dependent cell cycle arrest seen complex loading the gp45 processivity factor (akin to PCNA) in cells deleted for the gene encoding PCNA or for those onto DNA (reviewed in 4). In addition, putative RF-C and PCNA genes encoding subunits of either Pol δ or Pol ε. Instead, homologues have recently been identified in archeal species (20). rfc2Δ cells proceed into mitosis with incompletely In addition to being required for successful DNA replication, replicated DNA, indicating that the DNA replication two of the five subunits of S.cerevisiae RF-C have also been checkpoint is inactive under these conditions. Taken shown to be required for DNA replication checkpoint function together with recent results, these observations (21–23). In the absence of complete DNA replication or when suggest a simple model in which assembly of the RF-C DNA is damaged, checkpoints are activated that prevent entry complex onto the 3′-end of the nascent RNA–DNA into mitosis until replication is completed and/or the damaged primer is the last step required for the establishment of DNA is repaired (24). In the yeasts S.cerevisiae and S.pombe this a checkpoint-competent state. phenomenon is most clearly seen either when cells are treated with the DNA replication inhibitor hydroxyurea, which acts by blocking nucleotide precursor synthesis catalysed by ribonucleotide INTRODUCTION reductase, or when certain DNA replication functions are Replication factor C (RF-C, previously also known as activator-1) inactivated by mutation. Under these circumstances, cell cycle is a five subunit auxiliary factor for DNA polymerases (Pol) δ and progression is halted, with the result that the cells accumulate in ε that was first identified on the basis of its requirement for the interphase and do not enter mitosis (reviewed in 25). Analysis of replication of SV40 viral DNA in vitro by mammalian cell temperature-sensitive budding yeast mutants rfc5-5 and rfc2-1, proteins (1,2). In the presence of ATP, RF-C recognises and binds however, has shown that although DNA replication is blocked when these cells are shifted to the restrictive temperature, entry to the 3′-end of primers synthesised by the Pol α–primase into mitosis is not inhibited, indicating that the DNA replication complex and through ATP hydrolysis facilitates the loading of the trimeric processivity factor PCNA onto DNA. Subsequently checkpoint is non-functional (21,23). This has led to the either Pol δ or Pol ε is loaded onto the DNA template, thus conclusion that RF-C function is required for both DNA permitting highly processive DNA synthesis (3,4). replication and for DNA replication checkpoint function in RF-C has been purified from a number of sources, including budding yeast. various mammalian cells (2,5–7) and the yeasts Saccharomyces In the fission yeast S.pombe several proteins have been cerevisiae (8–10) and Schizosaccharomyces pombe (11). In each identified that, like Rfc2 and Rfc5 in S.cerevisiae, are required case the RF-C complex comprises one large (95–130 kDa) and both for DNA replication and for replication checkpoint function. four small (35–40 kDa) subunits. All five proteins are related to These include the origin recognition complex (ORC) components one another at the primary sequence level. The large subunit Orp1/Cdc30 and Orp2, the regulatory proteins Cdc18 and Hsk1 interacts directly with PCNA and with DNA (12,13) and one or and the catalytic subunit of Pol α, Pol1 (26–31). Cells carrying more of the small subunits are also likely to contact PCNA deletions of any of these genes fail to complete DNA replication (7,14,15). Each subunit is essential for growth and division in satisfactorily yet are still able to enter mitosis. This is in sharp *To whom correspondence should be addressed. Tel: +44 131 650 7088; Fax: +44 131 650 8650; Email: [email protected] Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 463 Nucleic Acids Research, 1999, Vol. 27, No. 2 463 Nucleic Acids Research, 1994, Vol. 22, No. 1 contrast to the behaviour of cells carrying deletions of any of the Subcloning of rfc2 genes encoding the essential subunits of Pol δ (Pol3/Cdc6, Cdc1 The rfc2 gene is located on cosmid SPAC23D3 at nucleotide and Cdc27), the catalytic subunit of Pol ε (Cdc20/Pol2) or PCNA positions 1668–2742. To allow convenient manipulation of the rfc2 (Pcn1) (32–36). Deletion of any of the latter genes leads to cell gene, a 3.8 kb MscI–HindIII fragment (nt 402–4242 inclusive) cycle arrest prior to entry into mitosis, indicating that checkpoint encompassing the entire rfc2 ORF was sub-cloned into pTZ19R function is not compromised by loss of any of these functions. (Pharmacia) using the SmaI and HindIII sites in this vector, to In order to understand better the function of the RF-C complex make plasmid pTZ19R-Rfc2. in DNA replication and checkpoint control, we have embarked For expression in S.pombe the rfc2 ORF was cloned into upon a study of the cellular roles of the RF-C complex in the pREP3X to make pREP3X-Rfc2 by the following method. First, fission yeast S.pombe. Here we describe our initial genetic the XbaI site located beyond the 3′-end of the rfc2 ORF in analysis of the rfc2 gene which encodes a protein related to the pTZ19R-Rfc2 was mutated to a SmaI site by oligonucleotide- budding yeast Rfc2p and human hRFC37 proteins (16,18,23). directed in vitro mutagenesis, using the MutaGene kit (Bio-Rad) Deletion of rfc2 from the chromosome is lethal; in marked according to the manufacturer’s instructions, to make plasmid contrast to the cell cycle arrest phenotype seen with pol3Δ, cdc1Δ pTZ19R-Rfc2Sma (oligonucleotide: 5′-GTTTACCACTAAA- or pcn1Δ cells (32–34), rfc2Δ cells proceed into mitosis with CTCCCGGGGTTATGTTTAAATGT-3′, SmaI site underlined). incompletely replicated DNA, indicating that rfc2 in fission Next the rfc2 ORF was excised from this plasmid (EcoRV–SmaI yeast is required for DNA replication checkpoint function as well fragment) and transferred into SmaI-digested pREP3X, to make as for DNA replication itself. These results suggest a simple pREP3X-Rfc2. An intron-less form of rfc2 was created by in model in which primer recognition by RF-C is the last step vitro mutagenesis of pTZ19R-Rfc2Sma (oligonucleotide: 5′-TCC- required during replication fork maturation for establishment of AATGTCTTGGGACGATAAAGCTCAACCCAAGGT-3′). The a checkpoint-competent state. artificial cDNA was then cloned into pREP3X (EcoRV–SmaI fragment, as above) to create plasmid pREP3X-Rfc2c. The MATERIALS AND METHODS function of this was tested by transformation into the rfc2 /rfc2Δ diploid described below. Yeast strains and methods All the S.pombe strains used in this study have been described + Deletion of rfc2 previously, except where indicated. For deletion of the rfc2 gene the sporulating diploid leu1-32/leu1-32 ura4-D18/ura4-D18 To delete the rfc2 gene, a 1.2 kb EcoRV–XbaI fragment – + + ade6-M210/ade6-M216 h /h was used (37). The wild-type encompassing the entire rfc2 ORF (Fig. 1) was excised from control used in the spore germination experiments was plasmid pTZ19R-Rfc2 and replaced with a BamHI adapter by + – + leu1-32/leu1-32 ura4 /ura4-D18 ade6-M210/ade6-M216 h /h . ligation of an oligonucleotide duplex (oligonucleotide sequences, 5′→3′: 1, CTGGATCC; 2, CTAGGGATCCAG) to make plasmid Transformation of S.pombe was achieved by electroporation (38). pTZ19R-Rfc2ΔB. Next the 1.8 kb BamHI ura4 fragment from Tetrad analysis was performed using a Singer micromanipulator. plasmid pON163 (41) was ligated into this unique BamHI site to make plasmid pTZ19R-Rfc2ΔBU. The 4.4 kb EcoRI–HindIII Molecular cloning fragment from this plasmid, comprising the flanking regions of + + Standard molecular cloning methods (39) were used throughout, the rfc2 gene separated by the ura4 selectable marker, was then except where indicated. DNA sequencing was performed using used to transform a leu1-32/leu1-32 ura4-D18/ura4-D18 – + + the ABI PRISM sequencing kit; samples were run on an ABI 377 ade6-M210/ade6-M216 h /h strain and ura transformants sequencer. In vitro mutagenesis was carried out using either the selected on EMM medium supplemented with leucine. Five stable Mutagene In Vitro Mutagenesis kit (Bio-Rad) or the Altered Sites ura isolates were chosen for further analysis. Chromosomal DNA kit (Promega) as indicated. Restriction and modification enzymes was prepared from these by standard methods, digested with were purchased from New England Biolabs, Boehringer Mannheim HindIII and EcoRI, subjected to agarose gel electrophoresis and or Promega and used according to the manufacturers’ instructions. then blotted onto GeneScreen Plus (NEN) according to the Oligonucleotides for sequencing and mutagenesis were synthesised manufacturer’s instructions. The membrane was then probed by Applied Biosystems. using an rfc2 probe (linearised pTZ19R-Rfc2 labelled with [α- P]dCTP using the Boehringer Mannheim HiPrime kit + according to the manufacturer’s instructions). Three of the five Analysis of rfc2 cDNA diploids analysed by this method displayed hybridisation patterns To confirm that the predicted intron in the rfc2 gene was spliced, entirely consistent with deletion of the rfc2 gene from one a partial rfc2 cDNA was amplified from an S.pombe cDNA chromosome; this was confirmed by probing the same blot, after library (40) by PCR with primers flanking the putative splice stripping of the first probe, with the EcoRV–XbaI rfc2 ORF donor and acceptor sites (oligonucleotide sequences, 5′→3′: fragment from pTZ19R-Rfc2 (data not shown). 1, ATGTCTTTCTTTGCTCCA; 2, CACACAACTGAAATA- GAA) and the amplification product cloned into pGEM-T* Analysis of rfc2Δ cells (Promega) and sequenced using primers located within the vector + + sequences. The cDNA sequence was consistent with the splicing One of the five rfc2 /rfc2::ura4 diploids identified by Southern of a 52 base intron from the rfc2 transcript, as predicted. blotting was chosen for further analysis. Following sporulation on Subsequent cloning and sequencing of a full-length rfc2 cDNA malt extract medium, asci from this strain were dissected on yeast confirmed that the ORF was interrupted by this intron only (not extract plates (supplemented with adenine and uracil) using a shown). micromanipulator (Singer). Each ascus gave rise to two viable Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 464 Nucleic Acids Research, 1999, Vol. 27, No. 2 Each mutant allele was then sub-cloned into pREP3X (EcoRV– SmaI rfc2 fragment into SmaI-digested pREP3X, as described above for construction of pREP3X-Rfc2c) for expression in S.pombe. For this purpose each mutant was transformed into the + + rfc2 /rfc2::ura4 diploid described above and transformants obtained on EMM medium containing 5 μg/ml thiamine (to repress expression from the nmt1 promoter in pREP3X). Following sporulation on malt extract plates, spores were plated onto Figure 1. The rfc2 gene region. (Upper) Map of cosmid SPAC23D3 (EMBL accession no. Z64354) showing positions of HindIII sites (vertical bars). EMM medium supplemented with adenine with/without uracil and SPAC23D3 is 42097 bp long; the rfc2 gene spans nt 1668–2742, the two black thiamine and incubated at 30C for several days. Putative boxes corresponding to exons 1 and 2. (Lower) The rfc2 gene (ORF indicated rfc2::ura4 (pREP3X-Rfc2) haploid colonies on EMM adenine by a black box) is located on a 4030 bp HindIII fragment. Enzymes: H, HindIII; plates were picked and analysed further to confirm their genotype. K, KpnI; V, EcoRV; X, XbaI. RESULTS – + (ura ) and two inviable (by implication, ura ) products, indicating that rfc2 is an essential gene. The rfc2Δ spores were capable of rfc2 : chromosomal position, gene structure and germination and three to four divisions but arrested growth with relatedness to yeast Rfc2 and human hRFC37 proteins 10–20 cells/microcolony. The rfc2 gene was identified during the sequencing of S.pombe For analysis of the rfc2Δ phenotype in liquid culture, spores + + chromosome I at the Sanger Center (Cambridge, UK) on cosmid were prepared from the rfc2 /rfc2::ura4 leu1-32/leu1-32 + – + SPAC23D3 (EMBL accession no. Z63354). The gene is located ura4 /ura4-D18 ade6-M210/ade6-M216 h /h and leu1-32/leu1-32 + – + at nt 1668–2742. Figure 1 shows the structure of the rfc2 gene ura4 /ura4-D18 ade6-M210/ade6-M216 h /h diploid strains in region. A single 52 bp intron was predicted in this region, parallel. Following inoculation of the spores (to an OD of 600 nm encompassing nt 1742–1793; confirmation that this intron is 0.15) into EMM medium supplemented with leucine and adenine spliced was obtained by sequencing the corresponding region of and growth at 30C, samples were taken for cell number an rfc2 cDNA. The spliced ORF, which is fully functional in vivo determination, flow cytometry and DAPI staining according to (Materials and Methods), encodes a protein of 340 amino acids previously published methods (42). that is 53% identical to both the budding yeast Rfc2p and human hRFC37 proteins (Fig. 2A). Database searches identified an Construction and analysis of a cdc27Δ rfc2Δ strain additional member of the Rfc2 sub-family (Fig. 2B) from the + nematode worm Caenorhabditis elegans. CeRfc2 is 37% identical The 4.4 kb rfc2::ura4 fragment from pTZ19R-Rfc2-ΔBU + + to SpRfc2. All seven conserved protein sequence motifs found in described above was transformed into a cdc27 /cdc27::his7 the small RF-C subunits are present in fission yeast Rfc2 (18). leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 – + Rfc2 is also distantly related to the fission yeast Rad17 protein his7-366/his7-366 h /h diploid strain (S.A.MacNeill, unpublished (43) and its budding yeast homologue Rad24p (Discussion). results) and transformants obtained on EMM plates supplemented with leucine. Thirteen stable isolates were analysed, six of which were analysed by Southern blotting of HindIII-digested chromo- Deletion of rfc2 somal DNA (as above). Three of these were found to have deleted + + + + + the rfc2 gene. One cdc27 /cdc27::his7 rfc2 /rfc2::ura4 In order to investigate the effects of inactivating rfc2 , we + + leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 constructed an rfc2 /rfc2::ura4 diploid strain using the one-step – + his7-366/his7-366 h /h strain was analysed by tetrad dissection gene disruption method (44; Materials and Methods). This strain, following sporulation on malt extract medium. For analysis in in which the entire rfc2 ORF was deleted from one chromosome, liquid culture (as above) spores were inoculated into EMM was then sporulated and tetrads dissected using a micromanipulator. + + medium supplemented with leucine and adenine and grown at In all 14 rfc2 /rfc2::ura4 -derived tetrads were analysed. In each + – 30C, with samples taken every hour for cell number determination, case only rfc2 (ura ) spore products were viable. Microscopic flow cytometry and DAPI staining according to previously examination showed that the inviable rfc2Δ (ura ) spores were published methods (42). capable of germination but arrested growth as microcolonies of 10–20 small cells. To confirm that this phenotype was due solely to the loss of Construction and analysis of rfc2 mutants + + + rfc2 function we transformed the rfc2 /rfc2::ura4 diploid strain + + Six mutant alleles of rfc2 were constructed by site-directed with plasmid pREP3X-Rfc2, which contains the rfc2 ORF mutagenesis of the rfc2 ORF. To achieve this the intron-less downstream of the thiamine-repressible nmt1 promoter (Materials rfc2 ORF (XhoI–SmaI fragment from plasmid pTZ19R-Rfc2c) and Methods). Transformant colonies were sporulated and the was cloned into SalI- and SmaI-digested pALTER1 (Promega). spores plated onto EMM medium supplemented with adenine Oligonucleotides (mutated codon underlined): 012, CTTGCTA- with or without thiamine to select for haploid rfc2Δ CAGCGAGCGCTAAGAGGATC, mutates Ser172→Ala; 013, (pREP3X-Rfc2) isolates. Numerous such haploid isolates were ATACTTGCTACATTTACTGCTAAGAGG, Arg173→Lys; 014, identified by this procedure, irrespective of the presence or CATAGAATCTGCTTGATCCAAAATTAT, Glu131→Gln; 015, absence of thiamine in the medium. (Note that there is a low AGTACCAGGAGATACATAAAACAACAT, Gly59→Val; 016, constitutive level of transcription from the nmt1 promoter even TAGAATGGTTGAATTCTTTCCAGTACC, Thr66→Asn; 017, in the presence of thiamine.) This indicates that that the lethality CTGAGTCATAGAGTGTGCCTCATCCAA, Asp133→His. observed was due solely to loss of rfc2 function. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 465 Nucleic Acids Research, 1999, Vol. 27, No. 2 465 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 2. (A) Protein sequence alignment of S.pombe Rfc2 (Swissprot accession no. Q09843), human hRFC37 (P35249) and S.cerevisiae Rfc2p (P40348). Identical residues are shaded. (B) Phylogenetic analysis of the small RF-C subunits. Included alongside S.pombe Rfc2 are the four small subunits from both budding yeast and human cells, together with C.elegans Rfc5 and Rfc2 homologues and Drosophila (19) and chicken Rfc4 homologues. Sequence alignment and phylogenetic tree construction was performed using PILEUP, DISTANCES and GROWTREE, parts of the Wisconsin Package v.9.1 (Genetics Computer Group, Madison, WI). To examine the phenotype of rfc2Δ cells in greater detail, large examination of the rfc2Δ cells stained with DAPI revealed the scale spore preparations were obtained by sporulating the presence of significant numbers of cells displaying nuclear + + rfc2 /rfc2::ura4 diploid strain in liquid culture (42). Spores were abnormalities in the rfc2Δ samples (Fig. 3C and D). Two aberrant then inoculated into EMM medium lacking uracil, which only phenotypes were seen, making up ~ 10% of the total population: allows germination of spores carrying the rfc2Δ allele, which are cells in which the septum appeared to have cleaved the nucleus prototrophic for uracil, and incubated at 30C (Materials and in two (cut phenotype, ~ 3%) and anucleate cells (~ 7%). By 30 h, + + Methods). As a control, spores prepared from a rfc2 /rfc2 this figure had risen to 23% (Fig. 3D). diploid strain heterozygous for ura4 (i.e. ura4 /ura4-D18) were To ask whether this phenotype was confined to the cell cycles processed in parallel. Hourly samples were taken from both immediately after spore germination we performed a plasmid loss cultures (beginning 4 h after inoculation into minimal medium) experiment. Haploid rfc2::ura4 (pREP3X–Rfc2) colonies were and either stained with propidium iodide and subjected to flow transferred to non-selective conditions (EMM medium supplem- cytometric analysis to determine DNA content or stained with ented with leucine, adenine and thiamine) to allow loss of the DAPI and examined by fluorescence microscopy to follow the plasmid and examined by DAPI staining after 48 h growth at behaviour of the nuclear material (Materials and Methods). The 30C. Similar phenotypes to those observed following rfc2Δ cell number of each culture was determined at hourly intervals. spore germination were seen in ~ 10% of cells at this time point, + + In the control culture (rfc2 /rfc2 ) the cell number remained indicating that loss of checkpoint control is not confined merely constant until 12–14 h after inoculation into fresh medium and to the early cell cycles following spore germination. increased exponentially thereafter (Fig. 3A). DNA replication in this culture was initiated 8–10 h post-inoculation and was effectively + rfc2 is required for cell cycle arrest of cdc27Δ cells complete (>90% of cells with a 2C DNA content) by 16 h (Fig. 3B and data not shown). At later time points (up to 24 h) only the 2C The results described above indicate that the DNA replication peak typical of exponentially growing S.pombe cells was seen (42). checkpoint is not activated in rfc2Δ cells. However, they do not + + Cell number in the rfc2 /rfc2::ura4 culture began to increase address the issue of whether the checkpoint can still be activated ~ 14 h after inoculation into fresh medium and over the next 8–10 h in rfc2Δ cells if DNA replication is blocked in some other way. the rate of cell number increase paralleled that seen with the To investigate this we tested the effects of combining the rfc2Δ control culture (Fig. 3A). At 20–22 h post-inoculation, however, allele with a cdc27Δ allele. cdc27 encodes the essential 54 kDa the rate of increase began to slow with the result that over the subunit of the DNA polymerase δ complex in fission yeast period 26–32 h cell number increased by <20% (compared with (11,33). As noted in the Introduction, cdc27 is not required for a >5-fold increase in the wild-type culture over the same period). checkpoint function; cdc27Δ cells undergo checkpoint-mediated + + The first round of DNA replication in the rfc2 /rfc2::ura4 cell cycle arrest following spore germination, as do pol3Δ and cdc1Δ cells (32,33). culture was initiated 8–10 h after re-inoculation and was ~ 80% + + + + We constructed a cdc27 /cdc27::his7 rfc2 /rfc2::ura4 diploid complete by 16 h (Fig. 3B and data not shown), suggesting that sufficient RF-C was carried over from the parental diploid to strain (Materials and Methods) and analysed meiotic products, support at least one round of replication in the rfc2Δ cells. initially by tetrad dissection. In total, 50 tetrads were dissected, However, by 20 h after inoculation, a large fraction of the allowing the tentative identification of 34 tetratypes and 15 ditypes population had a ≤2C DNA content, indicating that rfc2Δ cells are (details in Table 1). The ditype tetrads fell into two classes, defective in DNA replication. Cells with <1C DNA content were equivalent to the parental and non-parental ditypes arising from also detected in the 28 and 32 h samples, suggestive of an unequal a conventional cross between two haploid parents. As can be seen division of genetic material between daughter cells. No cells with in Table 1, the pseudo-non-parental ditypes displayed 2:2 <2C DNA content are seen in the wild-type culture at these time viable:inviable products; both viable colonies were auxotrophic + + points (legend to Fig. 3). By 24 h after inoculation, microscopic for uracil and histidine and therefore genotypically cdc27 rfc2 . Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 466 Nucleic Acids Research, 1999, Vol. 27, No. 2 Thus by inference the non-viable products in this class are his + + + ura , i.e. cdc27::his7 rfc2::ura4 double deletion haploids. Spores in this class were capable of germination and underwent several divisions before arresting as microcolonies of 10–20 predominantly small cells. Some cell elongation was observed, particularly at earlier time points, suggesting that cells may become depleted of Cdc27 before becoming depleted of Rfc2, presumably because the amounts of the two proteins carried over from the parental diploid, relative to the amounts required for DNA replication to proceed unaffected, are different. Nevertheless, the absence of significant numbers of elongated cells amongst the rfc2Δ cdc27Δ products, in contrast to the situation with cdc27Δ alone, where elongated cells are the predominant species (33), suggests that the rfc2Δ cdc27Δ double deletion cells are checkpoint defective, i.e. that Rfc2 is required for the cell cycle arrest seen with cdc27Δ cells. Table 1. rfc2Δ cdc27Δ progeny *The terms PD and NPD refer to ditype tetrads (parental and non-parental, respectively) equivalent to those generated in a conventional genetic cross between two haploid parents (i.e. cdc27Δ × rfc2Δ). **Microcolonies of 10–20 normal sized cells. TT, tetratype; PD, parental ditype; NPD, non-parental ditype. To confirm this, we compared the properties of cdc27Δ rfc2Δ cells with rfc2Δ and cdc27Δ cells following spore germination in liquid culture. Figure 3D shows the number of abnormal mitoses observed following DAPI staining of cells from the three cultures sampled over the period 12–30 h; representative cells are show in Figure 3E. Following spore germination cdc27Δ cells arrest with a single nucleus and become highly elongated (33); the number of mitotic abnormalities observed in the cdc27Δ culture over the period 12–22 h was ~ 1%, rising to 3% by 30 h (Fig. 3D). In contrast, few elongated cells were observed in the rfc2Δ culture, even at later Figure 3. (A) Cell number (arbitrary units) per ml of culture (y-axis, log scale) time points, and the number of cells displaying mitotic abnormalities + + versus time in hours (x-axis, linear scale) following inoculation of rfc2 /rfc2 rose from ≤2% at 12–16 h to >20% at 30 h, by which time cell (open circles) and rfc2 /rfc2Δ spores (filled circles) into supplemented minimal medium at time 0 and growth at 30C. (B) Flow cytometric analysis of division in the culture had all but ceased (Fig. 3A). In the cdc27Δ + + + propidium iodide stained cells from the rfc2 /rfc2 and rfc2 /rfc2Δ cultures rfc2Δ culture, the number of abnormal mitoses observed at 16 h described above. The 8, 12, 16, 20, 24, 28 and 32 h time points are shown; the was 2%, increasing slowly to 8% at 21 h, then increasing more positions of the 1C and 2C DNA peaks are indicated. By 28 h post-inoculation + rapidly to 28% at 30 h. Thus, 30 h post-inoculation, the number a significant shoulder of cells with <1C DNA content is seen in the rfc2 /rfc2Δ + + + culture only. Note that: (i) the wild-type rfc2 /rfc2 cells, like rfc2 /rfc2Δ, are of abnormal mitotic figures in the cdc27Δ rfc2Δ double deletion + + also heterozygous for ura4 (i.e. ura4 /ura4-D18); (ii) following scanning, the was ~ 10 times greater than that seen with cdc27Δ alone, data collected from both cultures was gated to remove ungerminated (ura ) + indicating that rfc2 function is required for the normal cell cycle spores from the analysis on the basis of their low forward scatter. (C) Examples arrest seen with cdc27Δ cells. That the proportion of abnormal of rfc2Δ cells with nuclear abnormalities revealed by DAPI staining. (Upper mitoses increases earlier in the cdc27Δ rfc2Δ double deletion culture and center) Cell division leading to unequal partitioning of the nuclear material. (Lower) Cell division leading to production of anucleate cells. Scale bar 10 μm. compared with rfc2Δ alone suggests that there may be an increased (D) Quantitation of mitotic abnormalities revealed by DAPI staining (y-axis, %) requirement for RF-C when Pol δ function is compromised by versus time in hours (x-axis) following inoculation of rfc2 /rfc2Δ, depletion of Cdc27. + + + cdc27 /cdc27Δ and rfc2 /rfc2Δ cdc27 /cdc27Δ spores into supplemented Further evidence suggesting that rfc2 is required for checkpoint minimal medium at time 0 and growth at 30C. (E) Examples of rfc2Δ cdc27Δ function came from treating rfc2Δ cells with the DNA synthesis (centre and left) and cdc27Δ (right) cells with/without nuclear abnormalities as revealed by DAPI staining. Scale bar 10 μm. (Details in text.) inhibitor hydroxyurea. We found that the proportion of rfc2Δ cells Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 467 Nucleic Acids Research, 1999, Vol. 27, No. 2 467 Nucleic Acids Research, 1994, Vol. 22, No. 1 Rfc2-N66, contains a mutation in the P-loop, part of the putative nucleotide binding site of Rfc2, such that Thr66 is replaced by Asn. The corresponding mutation in several other P-loop-containing ras proteins such as p21 , eIF4A and the splicing factor Prp2 confer dominant negative properties on the mutant proteins (45) but no such phenotype was observed with Rfc2-N66 (even when expressed to a high level in wild-type cells; data not shown). The second mutant, Rfc2-A172, contains a mutation in the SRC motif (sub-domain VII), which is characteristic of the small RF-C subunits but which is absent in the large subunit of the human or budding yeast RF-C complexes (18). Ser172 in Rfc2 is replaced Figure 4. Sequence motifs in RF-C subunits and mutations in Rfc2. by Ala, to give the sequence ARC rather than SRC. Despite being (A) Location of conserved sub-domains in the Rfc2 protein (18). (B) The conserved across evolution, however, it is clear that Ser172, like mutants constructed and analysed in this study mapped to sub-domains III Thr66, is not absolutely required for Rfc2 function in vivo. (G59V, T66N), V (E131Q, D133H) and VII (S172A, R173K). However, it should be noted that the level of these mutant Rfc2 proteins present in cells under conditions when the nmt promoter is turned off (i.e. during growth in thiamine) may still exceed the displaying nuclear abnormalities at 24 h, following addition of normal level of the endogenous Rfc2 protein in wild-type cells, hydroxyurea at 16 and 20 h, was undiminished at ~ 10%, so that it is not possible to conclude that Rfc2-N66 and indicating that hydroxyurea treatment cannot prevent entry into Rfc2-A172 have truly wild-type Rfc2 activity. mitosis in these circumstances (data not shown). Two of the six mutant proteins, Rfc2-V59 and Rfc2-H133, were unable to rescue rfc2Δ cells even when expressed to high Functional analysis of mutant Rfc2 proteins level (i.e. with the nmt promoter fully derepressed in the absence Protein sequence alignment of the RF-C subunits identifies a of thiamine). The former has Gly59 in the P-loop replaced by Val, number of sequence motifs that are conserved across the family while the latter has Asp133 in the DEAD box replaced by His (Figs 2 and 4A). These include the putative nucleotide binding (Fig. 4B). As with the mutation in the Rfc2-N66 protein, the site (P-loop) and the DEAD box motif. To test the importance of replacement of Gly59 with Val was intended to generate a these residues for Rfc2 protein function we constructed two dominant negative Rfc2 protein (45), but once again no effect was mutations (Fig. 4B) in each of the following three sub-domains: seen even when Rfc2-V59 was expressed to a high level in the P-loop (sub-domain III), the DEAD box (sub-domain V) and wild-type cells. the SRC motif (sub-domain VII). Each mutant allele was cloned The final two mutant proteins, Rfc2-Q131 and Rfc2-K173, into plasmid pREP3X, 3′ of the regulatable nmt promoter, and the could only rescue the rfc2Δ phenotype when expressed to a high + + resulting plasmids transformed into the rfc2 /rfc2::ura4 diploid level and even then the degree of rescue was reduced compared strain. Transformant colonies were then sporulated and the with that conferred by the wild-type protein. rfc2Δ cells rescued properties of the meiotic products examined following growth on by either Rfc2-Q131 or Rfc2-K173 grew more slowly than cells minimal medium in the presence or absence of thiamine, i.e. with rescued by expression of wild-type Rfc2. Microscopic examination the nmt promoter either repressed or derepressed (Materials and of the rescued cells stained with DAPI (not shown) revealed the Methods). The results of this analysis are summarised in Table 2. presence of a significant number of cells displaying nuclear abnormalities (~ 10% of the population of rfc2Δ cells rescued by Table 2. In vivo function of Rfc2 mutants Rfc2-Q131 and growing under selective conditions). The mitotic abnormalities seen were similar to those observed with the rfc2Δ deletion (i.e. anucleate and cut cells), suggesting that the checkpoint function is compromised under these conditions. DISCUSSION RF-C is a five subunit DNA polymerase auxiliary factor that acts as a primer recognition factor for DNA polymerases δ and ε. RF-C was first identified on the basis of its requirement for replication of SV40 viral DNA in vitro (2). In this system RF-C promotes the polymerase switching, from Pol α to Pol δ, which The level of function of each of the mutant is essential for leading strand replication and for the initiation of proteins is indicated as: ++, good comple- each Okazaki fragment on the lagging strand (46). RF-C binds mentation, equivalent to cells expressing primers synthesised by Pol α and promotes loading of Pol δ. wild-type Rfc2; +, growth, but poorer than In this paper we describe our initial genetic analysis of the rfc2 that observed with cells expressing wild-type Rfc2; –, no rescued rfc2Δ haploids recovered. gene of the fission yeast S.pombe. rfc2 encodes a 340 amino acid protein with an equally high level of primary sequence identity (53%) to S.cerevisiae Rfc2 and human hRFC37 proteins (Fig. 2), Two of the six mutant proteins, Rfc2-N66 and Rfc2-A172, had suggesting that the Rfc2 protein is likely to be a component of properties that were indistinguishable from the wild-type Rfc2 RF-C in S.pombe. The rfc2 gene was identified during the protein under all conditions tested (below). The first of these, sequencing of the fission yeast genome at the Sanger Centre and Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 468 Nucleic Acids Research, 1999, Vol. 27, No. 2 genes encoding Pcn1 (fission yeast PCNA) or any of the essential subunits of Pol δ or Pol ε characterised to date undergo cell cycle arrest and become highly elongated (cdc phenotype) (32–36). In contrast, inhibition of origin recognition and unwinding or Pol α–primase function (step 1) does not result in checkpoint activation; instead cells deleted for the genes encoding the ORC components Orp1 or Orp2 (27,28,47) or the single-stranded DNA binding protein Rpa1/Rad11 (48) or the catalytic subunit of Pol α, Pol1 (31), have been shown to proceed into mitosis with unreplicated DNA (cut phenotype). In this paper we show that inhibition of RF-C function (Fig. 5, step 2) by deletion of the rfc2 gene results in similar behaviour to that seen with cells in which either origin recognition and unwinding or Pol α–primase function (step 1) is blocked, indicating that RF-C is required both for DNA replication and for DNA replication checkpoint function in fission yeast. This is in marked contrast to the situation reported for Pcn1 (PCNA), which Figure 5. Temporal order of events at the replication fork following origin although required for DNA replication is not required for recognition and unwinding (polymerase switching model). Step 1, synthesis of RNA–DNA primer by Pol α–primase complex; step 2, recognition of the 3′-end replication checkpoint function (34,49). Taken together, these of the primer by RF-C complex; step 3, ATP-dependent loading of trimeric results imply that RF-C must have two distinct cellular functions, PCNA complex onto the DNA by RF-C; step 4, PCNA-dependent loading of being required both for Pcn1 loading at the replication fork (a step DNA polymerase δ or ε facilitating processive DNA synthesis extending from that has no bearing on the function of the checkpoint, since Pcn1 the primer. (Left) Effects of inhibiting steps 2–4 on DNA replication checkpoint function. Blocking steps 3 or 4 does not prevent checkpoint function; blocking itself is not required for checkpoint function; 34,49) and also for steps 1 or 2, or the proceeding steps, prevents replication checkpoint sensing permitting checkpoint sensing. To investigate this further, we are (Discussion). currently screening for mutants that uncouple the two functions of Rfc2. Such mutants might be either replication-competent but checkpoint-defective (cut phenotype displayed when DNA was predicted to give rise to a spliced mRNA (Fig. 1); we have replication blocked by, for example, hydroxyurea) or mutants that shown that the predicted intron is absent from an rfc2 cDNA and are replication-defective but checkpoint-competent (conditional that an rfc2 gene lacking the intron is fully functional in vivo. The lethal mutants that undergo cell cycle arrest under restrictive Rfc2 protein contains all the sequence motifs characteristic of conditions). RF-C subunits in general and Rfc2 sub-family members in Taking into consideration the temporal order of events at the particular (18). We have shown that mutation of certain of these replication fork outlined above and shown in Figure 5, our results conserved residues abolishes or reduces the ability of the mutant suggest that RF-C loading is the last step required in this pathway proteins to rescue an rfc2Δ strain, underscoring their importance in order to permit checkpoint sensing. If that were the case then for Rfc2 function (Fig. 4 and Table 2). We have deleted the rfc2 the inability of cells defective in origin recognition and unwinding gene, demonstrating that rfc2 encodes an essential function, in or Pol α–primase function to undergo checkpoint-mediated cell common with each of the RFC1–RFC5 genes in budding yeast (18). cycle arrest may simply reflect the fact that primer recognition by Analysis of SV40 DNA replication in vitro has shown that, RF-C is prevented in these circumstances. This implies that the following replication origin recognition and unwinding, the components of ORC, for example, or the ORC regulator Cdc18 need pathway leading to formation of a mature, processive replication not be themselves directly involved in replication checkpoint fork comprises four distinct steps in a process called polymerase function, contrary to previous models (50,51). switching (Fig. 5; 46). Firstly, Pol α–primase synthesises a short A key question be to addressed is how does RF-C function to RNA–DNA primer (Fig. 5, step 1). Next, the 3′-OH of the primer permit the establishment of a checkpoint-competent state? In this is recognised by RF-C (step 2) which promotes the loading of regard it is interesting to note that the fission yeast Rad17 protein, PCNA onto the DNA (step 3). Following PCNA loading, DNA an essential component of the checkpoint whose function is Pol δ is assembled onto the DNA to catalyse processive DNA disrupted in rfc2Δ cells, displays limited sequence similarity to synthesis (step 4). For leading strand synthesis, it is necessary for members of the RF-C family, suggesting that the two proteins these events to occur only once at each fork, whereas for lagging have similar biochemical functions or share common interacting strand synthesis steps 1–4 occur repeatedly to initiate synthesis of elements (43). Whilst Rad17 is not part of RF-C as defined each Okazaki fragment (46). biochemically, it is tempting to speculate that the function of In fission yeast it has previously been shown that inhibiting Rad17 may be dependent upon it associating with RF-C at the origin recognition and unwinding or any of steps 1, 3 or 4 is replication fork, in which case either inactivation of RF-C (as sufficient to inhibit DNA replication in vivo (25). However, the occurs in rfc2Δ cells described here) or failure to synthesise a cellular consequences of preventing DNA replication by inhibiting primer that can be recognised by RF-C (as presumably occurs in either origin recognition and unwinding or Pol α–primase orp1Δ, cdc18Δ or pol1Δ cells) would result in loss of Rad17 function (step 1) are very different from the consequences of preventing DNA replication by inhibiting PCNA loading (step 3) function and disruption of the checkpoint. In support of such a or Pol δ/Pol ε function (step 4). In the latter case, inhibition of model Sugimoto and co-workers (52) have recently demonstrated DNA replication leads to activation of a checkpoint that prevents a physical association between the S.cerevisiae Rfc2 and Rfc5 subsequent entry into mitosis. Thus cells deleted for one of the proteins and the Rad17 homologue Rad24p. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 469 Nucleic Acids Research, 1999, Vol. 27, No. 2 469 Nucleic Acids Research, 1994, Vol. 22, No. 1 21 Sugimoto,K., Shimomura,T., Hashimoto,K., Araki,H., Sugino,A. and ACKNOWLEDGEMENTS Matsumoto,K. (1996) Proc. Natl Acad. Sci. USA, 93, 7048–7052. 22 Sugimoto,K., Ando,S., Shimomura,T. and Matsumoto,K. (1997) We would like to thank our friends and colleagues in Edinburgh and Mol. Cell. Biol., 17, 5905–5914. elsewhere for their assistance during the course of this work. In 23 Noskov,V.N., Araki,H. and Sugino,A. (1998) Mol. Cell. Biol., 18, 4914–4923. particular we are are grateful to Dr K.Hentschel (RZLB, Berlin) for 24 Hartwell,L.H. and Weinert,T.A. (1989) Science, 246, 629–634. 25 MacNeill,S.A. and Nurse,P. (1997) In Pringle,J.R., Broach,J.R. and the rfc2 cosmid, A.Sanderson (ICAPB, University of Edinburgh) Jones,E.W. (eds), The Molecular and Cellular Biology of the Yeast for FACScan analysis, J.Davidson for media preparation, Saccharomyces: Cell Cycle and Cell Biology. Cold Spring Harbor Dr K.Sugimoto (University of Nagoya) for helpful discussions Laboratory Press, Cold Spring Harbor, NY, Vol. 3, pp. 697–763. and Professor J.Beggs (ICMB, University of Edinburgh) for 26 Grallert,B. and Nurse,P. (1996) Genes Dev., 10, 2644–2654. 27 Muzi-Falconi,M. and Kelly,T.J. (1995) Proc. Natl Acad. Sci. USA, 92, advice concerning DEAD box proteins. N.R. and S.M. are 12475–12479. supported by the Wellcome Trust. 28 Leatherwood,J., LopezGirona,A. and Russell,P. (1996) Nature, 379, 360–363. 29 Masai,H., Miyake,T. and Arai,K. (1995) EMBO J., 14, 3094–3104. 30 Kelly,T.J., Martin,G.S., Forsburg,S.L., Stephen,R.J., Russo,A. and Nurse,P. REFERENCES (1993) Cell, 74, 371–382. 31 D’Urso,G., Grallert,B. and Nurse,P. (1995) J. Cell Sci., 108, 3109–3118. 1 Fairman,M.P. and Stillman,B. (1988) EMBO J., 7, 1211–1218. 32 Francesconi,S., Park,H. and Wang,T.S.F. (1993) Nucleic Acids Res., 21, 2 Tsurimoto,T. and Stillman,B. (1989) Mol. Cell. Biol., 9, 609–619. 3821–3828. 3 Stillman,B. (1994) Cell, 78, 725–728. 33 MacNeill,S.A., Moreno,S., Reynolds,N., Nurse,P. and Fantes,P.A. (1996) 4 Stillman,B. (1996) In DePamphilis,M.L. (ed.), DNA Replication in EMBO J., 15, 4613–4628. Eukaryotic Cells. Cold Spring Harbor Laboratory Press, 34 Waseem,N.H., Labib,K., Nurse,P. and Lane,D.P. (1992) EMBO J., 11, Cold Spring Harbor, NY, pp. 435–460. 5111–5120. 5 Lee,S.H., Kwong,A.D., Pan,Z.Q. and Hurwitz,J. (1991) J. Biol. Chem., 35 D’Urso,G. and Nurse,P. (1997) Proc. Natl Acad. Sci. USA, 94, 12491–12496. 266, 594–602. 36 Sugino,A., Ohara,T., Sebastian,J., Nakashima,N. and Araki,H. (1998) 6 Podust,V.N., Georgaki,A., Strack,B. and Hubscher,U. (1992) Genes Cells, 3, 99–110. Nucleic Acids Res., 20, 4159–4165. 37 Moreno,S., Klar,A. and Nurse,P. (1991) Methods Enzymol., 194, 795–823. 7 Pan,Z.Q., Chen,M. and Hurwitz,J. (1993) Proc. Natl Acad. Sci. USA, 90, 38 Prentice,H.L. (1992) Nucleic Acids Res., 20, 621. 6–10. 39 Sambrook,J., Fritsch,E.F. and Maniatas,T. (1989) Molecular Cloning: 8 Fien,K. and Stillman,B. (1992) Mol. Cell. Biol., 12, 155–163. A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, 9 Yoder,B.L. and Burgers,P.M.J. (1991) J. Biol. Chem., 266, 22689–22697. Cold Spring Harbor, NY. 10 Burgers,P.M.J. (1991) J. Biol. Chem., 266, 22698–22706. 40 Fikes,J.D., Becker,D.M., Winston,F. and Guarente,L. (1990) Nature, 346, 11 Zuo,S.J., Gibbs,E., Kelman,Z., Wang,T.S.F., O’Donnell,M., MacNeill,S.A. 291–294. and Hurwitz,J. (1997) Proc. Natl Acad. Sci. USA, 94, 11244–11249. 41 Weilguny,D., Praetorius,M., Carr,A., Egel,R. and Nielsen,O. (1991) Gene, 12 Fotedar,R., Mossi,R., Fitzgerald,P., Rousselle,T., Maga,G., Brickner,H., 99, 47–54. Messier,H., Kasibhatla,S., Hubscher,U. and Fotedar,A. (1996) EMBO J., 42 MacNeill,S.A. and Fantes,P.A. (1997) Methods Enzymol., 283, 440–459. 15, 4423–4433. 43 Griffiths,D.J.F., Barbet,N.C., McCready,S., Lehmann,A.R. and Carr,A.M. 13 Montecucco,A., Rossi,R., Levin,D.S., Gary,R., Park,M.S., Motycka,T.A., (1995) EMBO J., 14, 5812–5823. Ciarrocchi,G., Villa,A., Biamonti,G. and Tomkinson,A.E. (1998) EMBO J., 44 Rothstein,R.J. (1983) Methods Enzymol., 101, 202–211. 17, 3786–3795. 45 Pause,A., Methot,N., Svitkin,Y., Merrick,W.C. and Sonenberg,N. (1994) 14 Chen,M., Pan,Z.Q. and Hurwitz,J. (1992) Proc. Natl Acad. Sci. USA, 89, EMBO J., 13, 1205–1215. 5211–5215. 46 Waga,S. and Stillman,B. (1994) Nature, 369, 207–212. 15 Chen,M., Pan,Z.Q. and Hurwitz,J. (1992) Proc. Natl Acad. Sci. USA, 89, 47 Grallert,B. and Nurse,P. (1996) Genes Dev., 10, 2644–2654. 2516–2520. 48 Parker,A.E., Clyne,R.K., Carr,A.M. and Kelly,T.J. (1997) Mol. Cell. Biol., 16 Noskov,V., Maki,S., Kawasaki,Y., Leem,S.H., Ono,B.I., Araki,H., 17, 2381–2390. Pavlov,Y. and Sugino,A. (1994) Nucleic Acids Res., 22, 1527–1535. 49 Arroyo,M.P., Downey,K.M., So,A.G. and Wang,T.S.F. (1996) 17 Gary,S.L. and Burgers,P.M.J. (1995) Nucleic Acids Res., 23, 4986–4991. J. Biol. Chem., 271, 15971–15980. 18 Cullmann,G., Fien,K., Kobayashi,R. and Stillman,B. (1995) Mol. Cell. Biol., 50 Kelly,T.J., Nurse,P. and Forsburg,S.L. (1993) Cold Spring Harbor Symp. 15, 4661–4671. Quant. Biol., 58, 637–644. 19 Harrison,S.D., Solomon,N. and Rubin,G.M. (1995) Genetics, 139, 51 Nishitani,H. and Nurse,P. (1995) Cell, 83, 397–405. 1701–1709. 52 Shimomura,T., Ando,S., Matsumoto,K. and Sugimoto,K. (1998) 20 Edgell,D.R. and Doolittle,W.F. (1997) Cell, 89, 995–998. Mol. Cell. Biol., 18, 5485–5491. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

A key role for replication factor C in DNA replication checkpoint function in fission yeast

Download PDF
8 pages

Loading next page...
 
/lp/oxford-university-press/a-key-role-for-replication-factor-c-in-dna-replication-checkpoint-Yeq0b9o6Gs

References (48)

Publisher
Oxford University Press
Copyright
© 1999 Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/27.2.462
Publisher site
See Article on Publisher Site

Abstract

462–469 Nucleic Acids Research, 1999, Vol. 27, No. 2  1999 Oxford University Press A key role for replication factor C in DNA replication checkpoint function in fission yeast Nicola Reynolds, Peter A. Fantes and Stuart A. MacNeill* Institute of Cell and Molecular Biology, University of Edinburgh, King’s Buildings, Mayfield Road, Edinburgh EH9 3JR, UK Received October 8, 1998; Revised and Accepted November 13, 1998 ABSTRACT budding yeast (16–18), as is the putative Rfc4 protein in Drosophila (19), indicating that although the individual subunits Replication factor C (RF-C) is a five subunit DNA are structurally related to one another, presumably as a result of polymerase (Pol) δ/ε accessory factor required at the being descended from a common ancestor, their functions are not replication fork for loading the essential processivity interchangeable. factor PCNA onto the 3′-ends of nascent DNA strands. Although RF-C is specifically a eukaryotic replication factor, Here we describe the genetic analysis of the rfc2 gene the function it performs appears to be universally conserved. A of the fission yeast Schizosaccharomyces pombe structurally related complex in Escherichia coli (the γ complex) encoding a structural homologue of the budding yeast acts to load the PCNA-like β sliding clamp onto DNA for Rfc2p and human hRFC37 proteins. Deletion of the processive synthesis of chromosomal DNA by Pol III, while rfc2 gene from the chromosome is lethal but does not phage T4 DNA replication relies upon the RF-C-like gp44/62 result in the checkpoint-dependent cell cycle arrest seen complex loading the gp45 processivity factor (akin to PCNA) in cells deleted for the gene encoding PCNA or for those onto DNA (reviewed in 4). In addition, putative RF-C and PCNA genes encoding subunits of either Pol δ or Pol ε. Instead, homologues have recently been identified in archeal species (20). rfc2Δ cells proceed into mitosis with incompletely In addition to being required for successful DNA replication, replicated DNA, indicating that the DNA replication two of the five subunits of S.cerevisiae RF-C have also been checkpoint is inactive under these conditions. Taken shown to be required for DNA replication checkpoint function together with recent results, these observations (21–23). In the absence of complete DNA replication or when suggest a simple model in which assembly of the RF-C DNA is damaged, checkpoints are activated that prevent entry complex onto the 3′-end of the nascent RNA–DNA into mitosis until replication is completed and/or the damaged primer is the last step required for the establishment of DNA is repaired (24). In the yeasts S.cerevisiae and S.pombe this a checkpoint-competent state. phenomenon is most clearly seen either when cells are treated with the DNA replication inhibitor hydroxyurea, which acts by blocking nucleotide precursor synthesis catalysed by ribonucleotide INTRODUCTION reductase, or when certain DNA replication functions are Replication factor C (RF-C, previously also known as activator-1) inactivated by mutation. Under these circumstances, cell cycle is a five subunit auxiliary factor for DNA polymerases (Pol) δ and progression is halted, with the result that the cells accumulate in ε that was first identified on the basis of its requirement for the interphase and do not enter mitosis (reviewed in 25). Analysis of replication of SV40 viral DNA in vitro by mammalian cell temperature-sensitive budding yeast mutants rfc5-5 and rfc2-1, proteins (1,2). In the presence of ATP, RF-C recognises and binds however, has shown that although DNA replication is blocked when these cells are shifted to the restrictive temperature, entry to the 3′-end of primers synthesised by the Pol α–primase into mitosis is not inhibited, indicating that the DNA replication complex and through ATP hydrolysis facilitates the loading of the trimeric processivity factor PCNA onto DNA. Subsequently checkpoint is non-functional (21,23). This has led to the either Pol δ or Pol ε is loaded onto the DNA template, thus conclusion that RF-C function is required for both DNA permitting highly processive DNA synthesis (3,4). replication and for DNA replication checkpoint function in RF-C has been purified from a number of sources, including budding yeast. various mammalian cells (2,5–7) and the yeasts Saccharomyces In the fission yeast S.pombe several proteins have been cerevisiae (8–10) and Schizosaccharomyces pombe (11). In each identified that, like Rfc2 and Rfc5 in S.cerevisiae, are required case the RF-C complex comprises one large (95–130 kDa) and both for DNA replication and for replication checkpoint function. four small (35–40 kDa) subunits. All five proteins are related to These include the origin recognition complex (ORC) components one another at the primary sequence level. The large subunit Orp1/Cdc30 and Orp2, the regulatory proteins Cdc18 and Hsk1 interacts directly with PCNA and with DNA (12,13) and one or and the catalytic subunit of Pol α, Pol1 (26–31). Cells carrying more of the small subunits are also likely to contact PCNA deletions of any of these genes fail to complete DNA replication (7,14,15). Each subunit is essential for growth and division in satisfactorily yet are still able to enter mitosis. This is in sharp *To whom correspondence should be addressed. Tel: +44 131 650 7088; Fax: +44 131 650 8650; Email: [email protected] Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 463 Nucleic Acids Research, 1999, Vol. 27, No. 2 463 Nucleic Acids Research, 1994, Vol. 22, No. 1 contrast to the behaviour of cells carrying deletions of any of the Subcloning of rfc2 genes encoding the essential subunits of Pol δ (Pol3/Cdc6, Cdc1 The rfc2 gene is located on cosmid SPAC23D3 at nucleotide and Cdc27), the catalytic subunit of Pol ε (Cdc20/Pol2) or PCNA positions 1668–2742. To allow convenient manipulation of the rfc2 (Pcn1) (32–36). Deletion of any of the latter genes leads to cell gene, a 3.8 kb MscI–HindIII fragment (nt 402–4242 inclusive) cycle arrest prior to entry into mitosis, indicating that checkpoint encompassing the entire rfc2 ORF was sub-cloned into pTZ19R function is not compromised by loss of any of these functions. (Pharmacia) using the SmaI and HindIII sites in this vector, to In order to understand better the function of the RF-C complex make plasmid pTZ19R-Rfc2. in DNA replication and checkpoint control, we have embarked For expression in S.pombe the rfc2 ORF was cloned into upon a study of the cellular roles of the RF-C complex in the pREP3X to make pREP3X-Rfc2 by the following method. First, fission yeast S.pombe. Here we describe our initial genetic the XbaI site located beyond the 3′-end of the rfc2 ORF in analysis of the rfc2 gene which encodes a protein related to the pTZ19R-Rfc2 was mutated to a SmaI site by oligonucleotide- budding yeast Rfc2p and human hRFC37 proteins (16,18,23). directed in vitro mutagenesis, using the MutaGene kit (Bio-Rad) Deletion of rfc2 from the chromosome is lethal; in marked according to the manufacturer’s instructions, to make plasmid contrast to the cell cycle arrest phenotype seen with pol3Δ, cdc1Δ pTZ19R-Rfc2Sma (oligonucleotide: 5′-GTTTACCACTAAA- or pcn1Δ cells (32–34), rfc2Δ cells proceed into mitosis with CTCCCGGGGTTATGTTTAAATGT-3′, SmaI site underlined). incompletely replicated DNA, indicating that rfc2 in fission Next the rfc2 ORF was excised from this plasmid (EcoRV–SmaI yeast is required for DNA replication checkpoint function as well fragment) and transferred into SmaI-digested pREP3X, to make as for DNA replication itself. These results suggest a simple pREP3X-Rfc2. An intron-less form of rfc2 was created by in model in which primer recognition by RF-C is the last step vitro mutagenesis of pTZ19R-Rfc2Sma (oligonucleotide: 5′-TCC- required during replication fork maturation for establishment of AATGTCTTGGGACGATAAAGCTCAACCCAAGGT-3′). The a checkpoint-competent state. artificial cDNA was then cloned into pREP3X (EcoRV–SmaI fragment, as above) to create plasmid pREP3X-Rfc2c. The MATERIALS AND METHODS function of this was tested by transformation into the rfc2 /rfc2Δ diploid described below. Yeast strains and methods All the S.pombe strains used in this study have been described + Deletion of rfc2 previously, except where indicated. For deletion of the rfc2 gene the sporulating diploid leu1-32/leu1-32 ura4-D18/ura4-D18 To delete the rfc2 gene, a 1.2 kb EcoRV–XbaI fragment – + + ade6-M210/ade6-M216 h /h was used (37). The wild-type encompassing the entire rfc2 ORF (Fig. 1) was excised from control used in the spore germination experiments was plasmid pTZ19R-Rfc2 and replaced with a BamHI adapter by + – + leu1-32/leu1-32 ura4 /ura4-D18 ade6-M210/ade6-M216 h /h . ligation of an oligonucleotide duplex (oligonucleotide sequences, 5′→3′: 1, CTGGATCC; 2, CTAGGGATCCAG) to make plasmid Transformation of S.pombe was achieved by electroporation (38). pTZ19R-Rfc2ΔB. Next the 1.8 kb BamHI ura4 fragment from Tetrad analysis was performed using a Singer micromanipulator. plasmid pON163 (41) was ligated into this unique BamHI site to make plasmid pTZ19R-Rfc2ΔBU. The 4.4 kb EcoRI–HindIII Molecular cloning fragment from this plasmid, comprising the flanking regions of + + Standard molecular cloning methods (39) were used throughout, the rfc2 gene separated by the ura4 selectable marker, was then except where indicated. DNA sequencing was performed using used to transform a leu1-32/leu1-32 ura4-D18/ura4-D18 – + + the ABI PRISM sequencing kit; samples were run on an ABI 377 ade6-M210/ade6-M216 h /h strain and ura transformants sequencer. In vitro mutagenesis was carried out using either the selected on EMM medium supplemented with leucine. Five stable Mutagene In Vitro Mutagenesis kit (Bio-Rad) or the Altered Sites ura isolates were chosen for further analysis. Chromosomal DNA kit (Promega) as indicated. Restriction and modification enzymes was prepared from these by standard methods, digested with were purchased from New England Biolabs, Boehringer Mannheim HindIII and EcoRI, subjected to agarose gel electrophoresis and or Promega and used according to the manufacturers’ instructions. then blotted onto GeneScreen Plus (NEN) according to the Oligonucleotides for sequencing and mutagenesis were synthesised manufacturer’s instructions. The membrane was then probed by Applied Biosystems. using an rfc2 probe (linearised pTZ19R-Rfc2 labelled with [α- P]dCTP using the Boehringer Mannheim HiPrime kit + according to the manufacturer’s instructions). Three of the five Analysis of rfc2 cDNA diploids analysed by this method displayed hybridisation patterns To confirm that the predicted intron in the rfc2 gene was spliced, entirely consistent with deletion of the rfc2 gene from one a partial rfc2 cDNA was amplified from an S.pombe cDNA chromosome; this was confirmed by probing the same blot, after library (40) by PCR with primers flanking the putative splice stripping of the first probe, with the EcoRV–XbaI rfc2 ORF donor and acceptor sites (oligonucleotide sequences, 5′→3′: fragment from pTZ19R-Rfc2 (data not shown). 1, ATGTCTTTCTTTGCTCCA; 2, CACACAACTGAAATA- GAA) and the amplification product cloned into pGEM-T* Analysis of rfc2Δ cells (Promega) and sequenced using primers located within the vector + + sequences. The cDNA sequence was consistent with the splicing One of the five rfc2 /rfc2::ura4 diploids identified by Southern of a 52 base intron from the rfc2 transcript, as predicted. blotting was chosen for further analysis. Following sporulation on Subsequent cloning and sequencing of a full-length rfc2 cDNA malt extract medium, asci from this strain were dissected on yeast confirmed that the ORF was interrupted by this intron only (not extract plates (supplemented with adenine and uracil) using a shown). micromanipulator (Singer). Each ascus gave rise to two viable Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 464 Nucleic Acids Research, 1999, Vol. 27, No. 2 Each mutant allele was then sub-cloned into pREP3X (EcoRV– SmaI rfc2 fragment into SmaI-digested pREP3X, as described above for construction of pREP3X-Rfc2c) for expression in S.pombe. For this purpose each mutant was transformed into the + + rfc2 /rfc2::ura4 diploid described above and transformants obtained on EMM medium containing 5 μg/ml thiamine (to repress expression from the nmt1 promoter in pREP3X). Following sporulation on malt extract plates, spores were plated onto Figure 1. The rfc2 gene region. (Upper) Map of cosmid SPAC23D3 (EMBL accession no. Z64354) showing positions of HindIII sites (vertical bars). EMM medium supplemented with adenine with/without uracil and SPAC23D3 is 42097 bp long; the rfc2 gene spans nt 1668–2742, the two black thiamine and incubated at 30C for several days. Putative boxes corresponding to exons 1 and 2. (Lower) The rfc2 gene (ORF indicated rfc2::ura4 (pREP3X-Rfc2) haploid colonies on EMM adenine by a black box) is located on a 4030 bp HindIII fragment. Enzymes: H, HindIII; plates were picked and analysed further to confirm their genotype. K, KpnI; V, EcoRV; X, XbaI. RESULTS – + (ura ) and two inviable (by implication, ura ) products, indicating that rfc2 is an essential gene. The rfc2Δ spores were capable of rfc2 : chromosomal position, gene structure and germination and three to four divisions but arrested growth with relatedness to yeast Rfc2 and human hRFC37 proteins 10–20 cells/microcolony. The rfc2 gene was identified during the sequencing of S.pombe For analysis of the rfc2Δ phenotype in liquid culture, spores + + chromosome I at the Sanger Center (Cambridge, UK) on cosmid were prepared from the rfc2 /rfc2::ura4 leu1-32/leu1-32 + – + SPAC23D3 (EMBL accession no. Z63354). The gene is located ura4 /ura4-D18 ade6-M210/ade6-M216 h /h and leu1-32/leu1-32 + – + at nt 1668–2742. Figure 1 shows the structure of the rfc2 gene ura4 /ura4-D18 ade6-M210/ade6-M216 h /h diploid strains in region. A single 52 bp intron was predicted in this region, parallel. Following inoculation of the spores (to an OD of 600 nm encompassing nt 1742–1793; confirmation that this intron is 0.15) into EMM medium supplemented with leucine and adenine spliced was obtained by sequencing the corresponding region of and growth at 30C, samples were taken for cell number an rfc2 cDNA. The spliced ORF, which is fully functional in vivo determination, flow cytometry and DAPI staining according to (Materials and Methods), encodes a protein of 340 amino acids previously published methods (42). that is 53% identical to both the budding yeast Rfc2p and human hRFC37 proteins (Fig. 2A). Database searches identified an Construction and analysis of a cdc27Δ rfc2Δ strain additional member of the Rfc2 sub-family (Fig. 2B) from the + nematode worm Caenorhabditis elegans. CeRfc2 is 37% identical The 4.4 kb rfc2::ura4 fragment from pTZ19R-Rfc2-ΔBU + + to SpRfc2. All seven conserved protein sequence motifs found in described above was transformed into a cdc27 /cdc27::his7 the small RF-C subunits are present in fission yeast Rfc2 (18). leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 – + Rfc2 is also distantly related to the fission yeast Rad17 protein his7-366/his7-366 h /h diploid strain (S.A.MacNeill, unpublished (43) and its budding yeast homologue Rad24p (Discussion). results) and transformants obtained on EMM plates supplemented with leucine. Thirteen stable isolates were analysed, six of which were analysed by Southern blotting of HindIII-digested chromo- Deletion of rfc2 somal DNA (as above). Three of these were found to have deleted + + + + + the rfc2 gene. One cdc27 /cdc27::his7 rfc2 /rfc2::ura4 In order to investigate the effects of inactivating rfc2 , we + + leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 constructed an rfc2 /rfc2::ura4 diploid strain using the one-step – + his7-366/his7-366 h /h strain was analysed by tetrad dissection gene disruption method (44; Materials and Methods). This strain, following sporulation on malt extract medium. For analysis in in which the entire rfc2 ORF was deleted from one chromosome, liquid culture (as above) spores were inoculated into EMM was then sporulated and tetrads dissected using a micromanipulator. + + medium supplemented with leucine and adenine and grown at In all 14 rfc2 /rfc2::ura4 -derived tetrads were analysed. In each + – 30C, with samples taken every hour for cell number determination, case only rfc2 (ura ) spore products were viable. Microscopic flow cytometry and DAPI staining according to previously examination showed that the inviable rfc2Δ (ura ) spores were published methods (42). capable of germination but arrested growth as microcolonies of 10–20 small cells. To confirm that this phenotype was due solely to the loss of Construction and analysis of rfc2 mutants + + + rfc2 function we transformed the rfc2 /rfc2::ura4 diploid strain + + Six mutant alleles of rfc2 were constructed by site-directed with plasmid pREP3X-Rfc2, which contains the rfc2 ORF mutagenesis of the rfc2 ORF. To achieve this the intron-less downstream of the thiamine-repressible nmt1 promoter (Materials rfc2 ORF (XhoI–SmaI fragment from plasmid pTZ19R-Rfc2c) and Methods). Transformant colonies were sporulated and the was cloned into SalI- and SmaI-digested pALTER1 (Promega). spores plated onto EMM medium supplemented with adenine Oligonucleotides (mutated codon underlined): 012, CTTGCTA- with or without thiamine to select for haploid rfc2Δ CAGCGAGCGCTAAGAGGATC, mutates Ser172→Ala; 013, (pREP3X-Rfc2) isolates. Numerous such haploid isolates were ATACTTGCTACATTTACTGCTAAGAGG, Arg173→Lys; 014, identified by this procedure, irrespective of the presence or CATAGAATCTGCTTGATCCAAAATTAT, Glu131→Gln; 015, absence of thiamine in the medium. (Note that there is a low AGTACCAGGAGATACATAAAACAACAT, Gly59→Val; 016, constitutive level of transcription from the nmt1 promoter even TAGAATGGTTGAATTCTTTCCAGTACC, Thr66→Asn; 017, in the presence of thiamine.) This indicates that that the lethality CTGAGTCATAGAGTGTGCCTCATCCAA, Asp133→His. observed was due solely to loss of rfc2 function. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 465 Nucleic Acids Research, 1999, Vol. 27, No. 2 465 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 2. (A) Protein sequence alignment of S.pombe Rfc2 (Swissprot accession no. Q09843), human hRFC37 (P35249) and S.cerevisiae Rfc2p (P40348). Identical residues are shaded. (B) Phylogenetic analysis of the small RF-C subunits. Included alongside S.pombe Rfc2 are the four small subunits from both budding yeast and human cells, together with C.elegans Rfc5 and Rfc2 homologues and Drosophila (19) and chicken Rfc4 homologues. Sequence alignment and phylogenetic tree construction was performed using PILEUP, DISTANCES and GROWTREE, parts of the Wisconsin Package v.9.1 (Genetics Computer Group, Madison, WI). To examine the phenotype of rfc2Δ cells in greater detail, large examination of the rfc2Δ cells stained with DAPI revealed the scale spore preparations were obtained by sporulating the presence of significant numbers of cells displaying nuclear + + rfc2 /rfc2::ura4 diploid strain in liquid culture (42). Spores were abnormalities in the rfc2Δ samples (Fig. 3C and D). Two aberrant then inoculated into EMM medium lacking uracil, which only phenotypes were seen, making up ~ 10% of the total population: allows germination of spores carrying the rfc2Δ allele, which are cells in which the septum appeared to have cleaved the nucleus prototrophic for uracil, and incubated at 30C (Materials and in two (cut phenotype, ~ 3%) and anucleate cells (~ 7%). By 30 h, + + Methods). As a control, spores prepared from a rfc2 /rfc2 this figure had risen to 23% (Fig. 3D). diploid strain heterozygous for ura4 (i.e. ura4 /ura4-D18) were To ask whether this phenotype was confined to the cell cycles processed in parallel. Hourly samples were taken from both immediately after spore germination we performed a plasmid loss cultures (beginning 4 h after inoculation into minimal medium) experiment. Haploid rfc2::ura4 (pREP3X–Rfc2) colonies were and either stained with propidium iodide and subjected to flow transferred to non-selective conditions (EMM medium supplem- cytometric analysis to determine DNA content or stained with ented with leucine, adenine and thiamine) to allow loss of the DAPI and examined by fluorescence microscopy to follow the plasmid and examined by DAPI staining after 48 h growth at behaviour of the nuclear material (Materials and Methods). The 30C. Similar phenotypes to those observed following rfc2Δ cell number of each culture was determined at hourly intervals. spore germination were seen in ~ 10% of cells at this time point, + + In the control culture (rfc2 /rfc2 ) the cell number remained indicating that loss of checkpoint control is not confined merely constant until 12–14 h after inoculation into fresh medium and to the early cell cycles following spore germination. increased exponentially thereafter (Fig. 3A). DNA replication in this culture was initiated 8–10 h post-inoculation and was effectively + rfc2 is required for cell cycle arrest of cdc27Δ cells complete (>90% of cells with a 2C DNA content) by 16 h (Fig. 3B and data not shown). At later time points (up to 24 h) only the 2C The results described above indicate that the DNA replication peak typical of exponentially growing S.pombe cells was seen (42). checkpoint is not activated in rfc2Δ cells. However, they do not + + Cell number in the rfc2 /rfc2::ura4 culture began to increase address the issue of whether the checkpoint can still be activated ~ 14 h after inoculation into fresh medium and over the next 8–10 h in rfc2Δ cells if DNA replication is blocked in some other way. the rate of cell number increase paralleled that seen with the To investigate this we tested the effects of combining the rfc2Δ control culture (Fig. 3A). At 20–22 h post-inoculation, however, allele with a cdc27Δ allele. cdc27 encodes the essential 54 kDa the rate of increase began to slow with the result that over the subunit of the DNA polymerase δ complex in fission yeast period 26–32 h cell number increased by <20% (compared with (11,33). As noted in the Introduction, cdc27 is not required for a >5-fold increase in the wild-type culture over the same period). checkpoint function; cdc27Δ cells undergo checkpoint-mediated + + The first round of DNA replication in the rfc2 /rfc2::ura4 cell cycle arrest following spore germination, as do pol3Δ and cdc1Δ cells (32,33). culture was initiated 8–10 h after re-inoculation and was ~ 80% + + + + We constructed a cdc27 /cdc27::his7 rfc2 /rfc2::ura4 diploid complete by 16 h (Fig. 3B and data not shown), suggesting that sufficient RF-C was carried over from the parental diploid to strain (Materials and Methods) and analysed meiotic products, support at least one round of replication in the rfc2Δ cells. initially by tetrad dissection. In total, 50 tetrads were dissected, However, by 20 h after inoculation, a large fraction of the allowing the tentative identification of 34 tetratypes and 15 ditypes population had a ≤2C DNA content, indicating that rfc2Δ cells are (details in Table 1). The ditype tetrads fell into two classes, defective in DNA replication. Cells with <1C DNA content were equivalent to the parental and non-parental ditypes arising from also detected in the 28 and 32 h samples, suggestive of an unequal a conventional cross between two haploid parents. As can be seen division of genetic material between daughter cells. No cells with in Table 1, the pseudo-non-parental ditypes displayed 2:2 <2C DNA content are seen in the wild-type culture at these time viable:inviable products; both viable colonies were auxotrophic + + points (legend to Fig. 3). By 24 h after inoculation, microscopic for uracil and histidine and therefore genotypically cdc27 rfc2 . Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 466 Nucleic Acids Research, 1999, Vol. 27, No. 2 Thus by inference the non-viable products in this class are his + + + ura , i.e. cdc27::his7 rfc2::ura4 double deletion haploids. Spores in this class were capable of germination and underwent several divisions before arresting as microcolonies of 10–20 predominantly small cells. Some cell elongation was observed, particularly at earlier time points, suggesting that cells may become depleted of Cdc27 before becoming depleted of Rfc2, presumably because the amounts of the two proteins carried over from the parental diploid, relative to the amounts required for DNA replication to proceed unaffected, are different. Nevertheless, the absence of significant numbers of elongated cells amongst the rfc2Δ cdc27Δ products, in contrast to the situation with cdc27Δ alone, where elongated cells are the predominant species (33), suggests that the rfc2Δ cdc27Δ double deletion cells are checkpoint defective, i.e. that Rfc2 is required for the cell cycle arrest seen with cdc27Δ cells. Table 1. rfc2Δ cdc27Δ progeny *The terms PD and NPD refer to ditype tetrads (parental and non-parental, respectively) equivalent to those generated in a conventional genetic cross between two haploid parents (i.e. cdc27Δ × rfc2Δ). **Microcolonies of 10–20 normal sized cells. TT, tetratype; PD, parental ditype; NPD, non-parental ditype. To confirm this, we compared the properties of cdc27Δ rfc2Δ cells with rfc2Δ and cdc27Δ cells following spore germination in liquid culture. Figure 3D shows the number of abnormal mitoses observed following DAPI staining of cells from the three cultures sampled over the period 12–30 h; representative cells are show in Figure 3E. Following spore germination cdc27Δ cells arrest with a single nucleus and become highly elongated (33); the number of mitotic abnormalities observed in the cdc27Δ culture over the period 12–22 h was ~ 1%, rising to 3% by 30 h (Fig. 3D). In contrast, few elongated cells were observed in the rfc2Δ culture, even at later Figure 3. (A) Cell number (arbitrary units) per ml of culture (y-axis, log scale) time points, and the number of cells displaying mitotic abnormalities + + versus time in hours (x-axis, linear scale) following inoculation of rfc2 /rfc2 rose from ≤2% at 12–16 h to >20% at 30 h, by which time cell (open circles) and rfc2 /rfc2Δ spores (filled circles) into supplemented minimal medium at time 0 and growth at 30C. (B) Flow cytometric analysis of division in the culture had all but ceased (Fig. 3A). In the cdc27Δ + + + propidium iodide stained cells from the rfc2 /rfc2 and rfc2 /rfc2Δ cultures rfc2Δ culture, the number of abnormal mitoses observed at 16 h described above. The 8, 12, 16, 20, 24, 28 and 32 h time points are shown; the was 2%, increasing slowly to 8% at 21 h, then increasing more positions of the 1C and 2C DNA peaks are indicated. By 28 h post-inoculation + rapidly to 28% at 30 h. Thus, 30 h post-inoculation, the number a significant shoulder of cells with <1C DNA content is seen in the rfc2 /rfc2Δ + + + culture only. Note that: (i) the wild-type rfc2 /rfc2 cells, like rfc2 /rfc2Δ, are of abnormal mitotic figures in the cdc27Δ rfc2Δ double deletion + + also heterozygous for ura4 (i.e. ura4 /ura4-D18); (ii) following scanning, the was ~ 10 times greater than that seen with cdc27Δ alone, data collected from both cultures was gated to remove ungerminated (ura ) + indicating that rfc2 function is required for the normal cell cycle spores from the analysis on the basis of their low forward scatter. (C) Examples arrest seen with cdc27Δ cells. That the proportion of abnormal of rfc2Δ cells with nuclear abnormalities revealed by DAPI staining. (Upper mitoses increases earlier in the cdc27Δ rfc2Δ double deletion culture and center) Cell division leading to unequal partitioning of the nuclear material. (Lower) Cell division leading to production of anucleate cells. Scale bar 10 μm. compared with rfc2Δ alone suggests that there may be an increased (D) Quantitation of mitotic abnormalities revealed by DAPI staining (y-axis, %) requirement for RF-C when Pol δ function is compromised by versus time in hours (x-axis) following inoculation of rfc2 /rfc2Δ, depletion of Cdc27. + + + cdc27 /cdc27Δ and rfc2 /rfc2Δ cdc27 /cdc27Δ spores into supplemented Further evidence suggesting that rfc2 is required for checkpoint minimal medium at time 0 and growth at 30C. (E) Examples of rfc2Δ cdc27Δ function came from treating rfc2Δ cells with the DNA synthesis (centre and left) and cdc27Δ (right) cells with/without nuclear abnormalities as revealed by DAPI staining. Scale bar 10 μm. (Details in text.) inhibitor hydroxyurea. We found that the proportion of rfc2Δ cells Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 467 Nucleic Acids Research, 1999, Vol. 27, No. 2 467 Nucleic Acids Research, 1994, Vol. 22, No. 1 Rfc2-N66, contains a mutation in the P-loop, part of the putative nucleotide binding site of Rfc2, such that Thr66 is replaced by Asn. The corresponding mutation in several other P-loop-containing ras proteins such as p21 , eIF4A and the splicing factor Prp2 confer dominant negative properties on the mutant proteins (45) but no such phenotype was observed with Rfc2-N66 (even when expressed to a high level in wild-type cells; data not shown). The second mutant, Rfc2-A172, contains a mutation in the SRC motif (sub-domain VII), which is characteristic of the small RF-C subunits but which is absent in the large subunit of the human or budding yeast RF-C complexes (18). Ser172 in Rfc2 is replaced Figure 4. Sequence motifs in RF-C subunits and mutations in Rfc2. by Ala, to give the sequence ARC rather than SRC. Despite being (A) Location of conserved sub-domains in the Rfc2 protein (18). (B) The conserved across evolution, however, it is clear that Ser172, like mutants constructed and analysed in this study mapped to sub-domains III Thr66, is not absolutely required for Rfc2 function in vivo. (G59V, T66N), V (E131Q, D133H) and VII (S172A, R173K). However, it should be noted that the level of these mutant Rfc2 proteins present in cells under conditions when the nmt promoter is turned off (i.e. during growth in thiamine) may still exceed the displaying nuclear abnormalities at 24 h, following addition of normal level of the endogenous Rfc2 protein in wild-type cells, hydroxyurea at 16 and 20 h, was undiminished at ~ 10%, so that it is not possible to conclude that Rfc2-N66 and indicating that hydroxyurea treatment cannot prevent entry into Rfc2-A172 have truly wild-type Rfc2 activity. mitosis in these circumstances (data not shown). Two of the six mutant proteins, Rfc2-V59 and Rfc2-H133, were unable to rescue rfc2Δ cells even when expressed to high Functional analysis of mutant Rfc2 proteins level (i.e. with the nmt promoter fully derepressed in the absence Protein sequence alignment of the RF-C subunits identifies a of thiamine). The former has Gly59 in the P-loop replaced by Val, number of sequence motifs that are conserved across the family while the latter has Asp133 in the DEAD box replaced by His (Figs 2 and 4A). These include the putative nucleotide binding (Fig. 4B). As with the mutation in the Rfc2-N66 protein, the site (P-loop) and the DEAD box motif. To test the importance of replacement of Gly59 with Val was intended to generate a these residues for Rfc2 protein function we constructed two dominant negative Rfc2 protein (45), but once again no effect was mutations (Fig. 4B) in each of the following three sub-domains: seen even when Rfc2-V59 was expressed to a high level in the P-loop (sub-domain III), the DEAD box (sub-domain V) and wild-type cells. the SRC motif (sub-domain VII). Each mutant allele was cloned The final two mutant proteins, Rfc2-Q131 and Rfc2-K173, into plasmid pREP3X, 3′ of the regulatable nmt promoter, and the could only rescue the rfc2Δ phenotype when expressed to a high + + resulting plasmids transformed into the rfc2 /rfc2::ura4 diploid level and even then the degree of rescue was reduced compared strain. Transformant colonies were then sporulated and the with that conferred by the wild-type protein. rfc2Δ cells rescued properties of the meiotic products examined following growth on by either Rfc2-Q131 or Rfc2-K173 grew more slowly than cells minimal medium in the presence or absence of thiamine, i.e. with rescued by expression of wild-type Rfc2. Microscopic examination the nmt promoter either repressed or derepressed (Materials and of the rescued cells stained with DAPI (not shown) revealed the Methods). The results of this analysis are summarised in Table 2. presence of a significant number of cells displaying nuclear abnormalities (~ 10% of the population of rfc2Δ cells rescued by Table 2. In vivo function of Rfc2 mutants Rfc2-Q131 and growing under selective conditions). The mitotic abnormalities seen were similar to those observed with the rfc2Δ deletion (i.e. anucleate and cut cells), suggesting that the checkpoint function is compromised under these conditions. DISCUSSION RF-C is a five subunit DNA polymerase auxiliary factor that acts as a primer recognition factor for DNA polymerases δ and ε. RF-C was first identified on the basis of its requirement for replication of SV40 viral DNA in vitro (2). In this system RF-C promotes the polymerase switching, from Pol α to Pol δ, which The level of function of each of the mutant is essential for leading strand replication and for the initiation of proteins is indicated as: ++, good comple- each Okazaki fragment on the lagging strand (46). RF-C binds mentation, equivalent to cells expressing primers synthesised by Pol α and promotes loading of Pol δ. wild-type Rfc2; +, growth, but poorer than In this paper we describe our initial genetic analysis of the rfc2 that observed with cells expressing wild-type Rfc2; –, no rescued rfc2Δ haploids recovered. gene of the fission yeast S.pombe. rfc2 encodes a 340 amino acid protein with an equally high level of primary sequence identity (53%) to S.cerevisiae Rfc2 and human hRFC37 proteins (Fig. 2), Two of the six mutant proteins, Rfc2-N66 and Rfc2-A172, had suggesting that the Rfc2 protein is likely to be a component of properties that were indistinguishable from the wild-type Rfc2 RF-C in S.pombe. The rfc2 gene was identified during the protein under all conditions tested (below). The first of these, sequencing of the fission yeast genome at the Sanger Centre and Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 468 Nucleic Acids Research, 1999, Vol. 27, No. 2 genes encoding Pcn1 (fission yeast PCNA) or any of the essential subunits of Pol δ or Pol ε characterised to date undergo cell cycle arrest and become highly elongated (cdc phenotype) (32–36). In contrast, inhibition of origin recognition and unwinding or Pol α–primase function (step 1) does not result in checkpoint activation; instead cells deleted for the genes encoding the ORC components Orp1 or Orp2 (27,28,47) or the single-stranded DNA binding protein Rpa1/Rad11 (48) or the catalytic subunit of Pol α, Pol1 (31), have been shown to proceed into mitosis with unreplicated DNA (cut phenotype). In this paper we show that inhibition of RF-C function (Fig. 5, step 2) by deletion of the rfc2 gene results in similar behaviour to that seen with cells in which either origin recognition and unwinding or Pol α–primase function (step 1) is blocked, indicating that RF-C is required both for DNA replication and for DNA replication checkpoint function in fission yeast. This is in marked contrast to the situation reported for Pcn1 (PCNA), which Figure 5. Temporal order of events at the replication fork following origin although required for DNA replication is not required for recognition and unwinding (polymerase switching model). Step 1, synthesis of RNA–DNA primer by Pol α–primase complex; step 2, recognition of the 3′-end replication checkpoint function (34,49). Taken together, these of the primer by RF-C complex; step 3, ATP-dependent loading of trimeric results imply that RF-C must have two distinct cellular functions, PCNA complex onto the DNA by RF-C; step 4, PCNA-dependent loading of being required both for Pcn1 loading at the replication fork (a step DNA polymerase δ or ε facilitating processive DNA synthesis extending from that has no bearing on the function of the checkpoint, since Pcn1 the primer. (Left) Effects of inhibiting steps 2–4 on DNA replication checkpoint function. Blocking steps 3 or 4 does not prevent checkpoint function; blocking itself is not required for checkpoint function; 34,49) and also for steps 1 or 2, or the proceeding steps, prevents replication checkpoint sensing permitting checkpoint sensing. To investigate this further, we are (Discussion). currently screening for mutants that uncouple the two functions of Rfc2. Such mutants might be either replication-competent but checkpoint-defective (cut phenotype displayed when DNA was predicted to give rise to a spliced mRNA (Fig. 1); we have replication blocked by, for example, hydroxyurea) or mutants that shown that the predicted intron is absent from an rfc2 cDNA and are replication-defective but checkpoint-competent (conditional that an rfc2 gene lacking the intron is fully functional in vivo. The lethal mutants that undergo cell cycle arrest under restrictive Rfc2 protein contains all the sequence motifs characteristic of conditions). RF-C subunits in general and Rfc2 sub-family members in Taking into consideration the temporal order of events at the particular (18). We have shown that mutation of certain of these replication fork outlined above and shown in Figure 5, our results conserved residues abolishes or reduces the ability of the mutant suggest that RF-C loading is the last step required in this pathway proteins to rescue an rfc2Δ strain, underscoring their importance in order to permit checkpoint sensing. If that were the case then for Rfc2 function (Fig. 4 and Table 2). We have deleted the rfc2 the inability of cells defective in origin recognition and unwinding gene, demonstrating that rfc2 encodes an essential function, in or Pol α–primase function to undergo checkpoint-mediated cell common with each of the RFC1–RFC5 genes in budding yeast (18). cycle arrest may simply reflect the fact that primer recognition by Analysis of SV40 DNA replication in vitro has shown that, RF-C is prevented in these circumstances. This implies that the following replication origin recognition and unwinding, the components of ORC, for example, or the ORC regulator Cdc18 need pathway leading to formation of a mature, processive replication not be themselves directly involved in replication checkpoint fork comprises four distinct steps in a process called polymerase function, contrary to previous models (50,51). switching (Fig. 5; 46). Firstly, Pol α–primase synthesises a short A key question be to addressed is how does RF-C function to RNA–DNA primer (Fig. 5, step 1). Next, the 3′-OH of the primer permit the establishment of a checkpoint-competent state? In this is recognised by RF-C (step 2) which promotes the loading of regard it is interesting to note that the fission yeast Rad17 protein, PCNA onto the DNA (step 3). Following PCNA loading, DNA an essential component of the checkpoint whose function is Pol δ is assembled onto the DNA to catalyse processive DNA disrupted in rfc2Δ cells, displays limited sequence similarity to synthesis (step 4). For leading strand synthesis, it is necessary for members of the RF-C family, suggesting that the two proteins these events to occur only once at each fork, whereas for lagging have similar biochemical functions or share common interacting strand synthesis steps 1–4 occur repeatedly to initiate synthesis of elements (43). Whilst Rad17 is not part of RF-C as defined each Okazaki fragment (46). biochemically, it is tempting to speculate that the function of In fission yeast it has previously been shown that inhibiting Rad17 may be dependent upon it associating with RF-C at the origin recognition and unwinding or any of steps 1, 3 or 4 is replication fork, in which case either inactivation of RF-C (as sufficient to inhibit DNA replication in vivo (25). However, the occurs in rfc2Δ cells described here) or failure to synthesise a cellular consequences of preventing DNA replication by inhibiting primer that can be recognised by RF-C (as presumably occurs in either origin recognition and unwinding or Pol α–primase orp1Δ, cdc18Δ or pol1Δ cells) would result in loss of Rad17 function (step 1) are very different from the consequences of preventing DNA replication by inhibiting PCNA loading (step 3) function and disruption of the checkpoint. In support of such a or Pol δ/Pol ε function (step 4). In the latter case, inhibition of model Sugimoto and co-workers (52) have recently demonstrated DNA replication leads to activation of a checkpoint that prevents a physical association between the S.cerevisiae Rfc2 and Rfc5 subsequent entry into mitosis. Thus cells deleted for one of the proteins and the Rad17 homologue Rad24p. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018 469 Nucleic Acids Research, 1999, Vol. 27, No. 2 469 Nucleic Acids Research, 1994, Vol. 22, No. 1 21 Sugimoto,K., Shimomura,T., Hashimoto,K., Araki,H., Sugino,A. and ACKNOWLEDGEMENTS Matsumoto,K. (1996) Proc. Natl Acad. Sci. USA, 93, 7048–7052. 22 Sugimoto,K., Ando,S., Shimomura,T. and Matsumoto,K. (1997) We would like to thank our friends and colleagues in Edinburgh and Mol. Cell. Biol., 17, 5905–5914. elsewhere for their assistance during the course of this work. In 23 Noskov,V.N., Araki,H. and Sugino,A. (1998) Mol. Cell. Biol., 18, 4914–4923. particular we are are grateful to Dr K.Hentschel (RZLB, Berlin) for 24 Hartwell,L.H. and Weinert,T.A. (1989) Science, 246, 629–634. 25 MacNeill,S.A. and Nurse,P. (1997) In Pringle,J.R., Broach,J.R. and the rfc2 cosmid, A.Sanderson (ICAPB, University of Edinburgh) Jones,E.W. (eds), The Molecular and Cellular Biology of the Yeast for FACScan analysis, J.Davidson for media preparation, Saccharomyces: Cell Cycle and Cell Biology. Cold Spring Harbor Dr K.Sugimoto (University of Nagoya) for helpful discussions Laboratory Press, Cold Spring Harbor, NY, Vol. 3, pp. 697–763. and Professor J.Beggs (ICMB, University of Edinburgh) for 26 Grallert,B. and Nurse,P. (1996) Genes Dev., 10, 2644–2654. 27 Muzi-Falconi,M. and Kelly,T.J. (1995) Proc. Natl Acad. Sci. USA, 92, advice concerning DEAD box proteins. N.R. and S.M. are 12475–12479. supported by the Wellcome Trust. 28 Leatherwood,J., LopezGirona,A. and Russell,P. (1996) Nature, 379, 360–363. 29 Masai,H., Miyake,T. and Arai,K. (1995) EMBO J., 14, 3094–3104. 30 Kelly,T.J., Martin,G.S., Forsburg,S.L., Stephen,R.J., Russo,A. and Nurse,P. REFERENCES (1993) Cell, 74, 371–382. 31 D’Urso,G., Grallert,B. and Nurse,P. (1995) J. Cell Sci., 108, 3109–3118. 1 Fairman,M.P. and Stillman,B. (1988) EMBO J., 7, 1211–1218. 32 Francesconi,S., Park,H. and Wang,T.S.F. (1993) Nucleic Acids Res., 21, 2 Tsurimoto,T. and Stillman,B. (1989) Mol. Cell. Biol., 9, 609–619. 3821–3828. 3 Stillman,B. (1994) Cell, 78, 725–728. 33 MacNeill,S.A., Moreno,S., Reynolds,N., Nurse,P. and Fantes,P.A. (1996) 4 Stillman,B. (1996) In DePamphilis,M.L. (ed.), DNA Replication in EMBO J., 15, 4613–4628. Eukaryotic Cells. Cold Spring Harbor Laboratory Press, 34 Waseem,N.H., Labib,K., Nurse,P. and Lane,D.P. (1992) EMBO J., 11, Cold Spring Harbor, NY, pp. 435–460. 5111–5120. 5 Lee,S.H., Kwong,A.D., Pan,Z.Q. and Hurwitz,J. (1991) J. Biol. Chem., 35 D’Urso,G. and Nurse,P. (1997) Proc. Natl Acad. Sci. USA, 94, 12491–12496. 266, 594–602. 36 Sugino,A., Ohara,T., Sebastian,J., Nakashima,N. and Araki,H. (1998) 6 Podust,V.N., Georgaki,A., Strack,B. and Hubscher,U. (1992) Genes Cells, 3, 99–110. Nucleic Acids Res., 20, 4159–4165. 37 Moreno,S., Klar,A. and Nurse,P. (1991) Methods Enzymol., 194, 795–823. 7 Pan,Z.Q., Chen,M. and Hurwitz,J. (1993) Proc. Natl Acad. Sci. USA, 90, 38 Prentice,H.L. (1992) Nucleic Acids Res., 20, 621. 6–10. 39 Sambrook,J., Fritsch,E.F. and Maniatas,T. (1989) Molecular Cloning: 8 Fien,K. and Stillman,B. (1992) Mol. Cell. Biol., 12, 155–163. A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, 9 Yoder,B.L. and Burgers,P.M.J. (1991) J. Biol. Chem., 266, 22689–22697. Cold Spring Harbor, NY. 10 Burgers,P.M.J. (1991) J. Biol. Chem., 266, 22698–22706. 40 Fikes,J.D., Becker,D.M., Winston,F. and Guarente,L. (1990) Nature, 346, 11 Zuo,S.J., Gibbs,E., Kelman,Z., Wang,T.S.F., O’Donnell,M., MacNeill,S.A. 291–294. and Hurwitz,J. (1997) Proc. Natl Acad. Sci. USA, 94, 11244–11249. 41 Weilguny,D., Praetorius,M., Carr,A., Egel,R. and Nielsen,O. (1991) Gene, 12 Fotedar,R., Mossi,R., Fitzgerald,P., Rousselle,T., Maga,G., Brickner,H., 99, 47–54. Messier,H., Kasibhatla,S., Hubscher,U. and Fotedar,A. (1996) EMBO J., 42 MacNeill,S.A. and Fantes,P.A. (1997) Methods Enzymol., 283, 440–459. 15, 4423–4433. 43 Griffiths,D.J.F., Barbet,N.C., McCready,S., Lehmann,A.R. and Carr,A.M. 13 Montecucco,A., Rossi,R., Levin,D.S., Gary,R., Park,M.S., Motycka,T.A., (1995) EMBO J., 14, 5812–5823. Ciarrocchi,G., Villa,A., Biamonti,G. and Tomkinson,A.E. (1998) EMBO J., 44 Rothstein,R.J. (1983) Methods Enzymol., 101, 202–211. 17, 3786–3795. 45 Pause,A., Methot,N., Svitkin,Y., Merrick,W.C. and Sonenberg,N. (1994) 14 Chen,M., Pan,Z.Q. and Hurwitz,J. (1992) Proc. Natl Acad. Sci. USA, 89, EMBO J., 13, 1205–1215. 5211–5215. 46 Waga,S. and Stillman,B. (1994) Nature, 369, 207–212. 15 Chen,M., Pan,Z.Q. and Hurwitz,J. (1992) Proc. Natl Acad. Sci. USA, 89, 47 Grallert,B. and Nurse,P. (1996) Genes Dev., 10, 2644–2654. 2516–2520. 48 Parker,A.E., Clyne,R.K., Carr,A.M. and Kelly,T.J. (1997) Mol. Cell. Biol., 16 Noskov,V., Maki,S., Kawasaki,Y., Leem,S.H., Ono,B.I., Araki,H., 17, 2381–2390. Pavlov,Y. and Sugino,A. (1994) Nucleic Acids Res., 22, 1527–1535. 49 Arroyo,M.P., Downey,K.M., So,A.G. and Wang,T.S.F. (1996) 17 Gary,S.L. and Burgers,P.M.J. (1995) Nucleic Acids Res., 23, 4986–4991. J. Biol. Chem., 271, 15971–15980. 18 Cullmann,G., Fien,K., Kobayashi,R. and Stillman,B. (1995) Mol. Cell. Biol., 50 Kelly,T.J., Nurse,P. and Forsburg,S.L. (1993) Cold Spring Harbor Symp. 15, 4661–4671. Quant. Biol., 58, 637–644. 19 Harrison,S.D., Solomon,N. and Rubin,G.M. (1995) Genetics, 139, 51 Nishitani,H. and Nurse,P. (1995) Cell, 83, 397–405. 1701–1709. 52 Shimomura,T., Ando,S., Matsumoto,K. and Sugimoto,K. (1998) 20 Edgell,D.R. and Doolittle,W.F. (1997) Cell, 89, 995–998. Mol. Cell. Biol., 18, 5485–5491. Downloaded from https://academic.oup.com/nar/article-abstract/27/2/462/1058408 by Ed 'DeepDyve' Gillespie user on 06 February 2018

Journal

Nucleic Acids Research – Oxford University Press

Published: Jan 1, 1999

There are no references for this article.