Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

K. Hahm; B. S. Cobb; A. S. McCarty; K. E. Brown; C. A. Klug; R. Lee; K. Akashi; I. L. Weissman; A. G. Fisher; S. T. Smale

doi:10.1101/gad.12.6.782

Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

Hahm, K.;Cobb, B. S.;McCarty, A. S.;Brown, K. E.;Klug, C. A.;Lee, R.;Akashi, K.;Weissman, I. L.;Fisher, A. G.;Smale, S. T.; 1998-03-15 00:00:00 Downloaded from Downloaded from Downloaded from Downloaded from genesdev.cshlp.org genesdev.cshlp.org genesdev.cshlp.org genesdev.cshlp.org on November 18, 2021 - Published by on November 18, 2021 - Published by on November 18, 2021 - Published by on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin 1,5 1 1 2 3,4 Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, Karen E. Brown, Christopher A. Klug, 1 3 3 2 1,6 Robert Lee, Koichi Akashi, Irving L. Weissman, Amanda G. Fisher, and Stephen T. Smale Howard Hughes Medical Institute, Molecular Biology Institute, and Department of Microbiology and Immunology, UCLA School of Medicine, Los Angeles, California 90095-1662 USA; Lymphocyte Development Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, London, W12 ONN UK; Departments of Pathology and Developmental Biology, Stanford University School of Medicine, Stanford, California 94305-5428 USA; Department of Microbiology, University of Alabama, Birmingham, Alabama 35294 USA The Ikaros gene encodes multiple protein isoforms that contribute critical functions during the development of lymphocytes and other hematopoietic cell types. The intracellular functions of Ikaros are not known, although recent studies have shown that Ikaros proteins colocalize with inactive genes and centromeric heterochromatin. In this study, Ikaros proteins were found to be components of highly stable complexes. The complexes from an immature T cell line were purified, revealing associated proteins of 70 and 30 kD. The p70 gene, named Helios, encodes two protein isoforms with zinc finger domains exhibiting considerable homology to those within Ikaros proteins. Helios and Ikaros recognize similar DNA sequences and, when overexpressed, Helios associates indiscriminately with the various Ikaros isoforms. Although Ikaros is present in most hematopoietic cells, Helios was found primarily in T cells. The relevance of the Ikaros–Helios interaction in T cells is supported by the quantitative association of Helios with a fraction of the Ikaros. Interestingly, the Ikaros–Helios complexes localize to the centromeric regions of T cell nuclei, similar to the Ikaros localization previously observed in B cells. Unlike the B cell results, however, only a fraction of the Ikaros, presumably the fraction associated with Helios, exhibited centromeric localization in T cells. These results establish immunoaffinity chromatography as a useful method for identifying Ikaros partners and suggest that Helios is a limiting regulatory subunit for Ikaros within centromeric heterochromatin. [Key Words: Ikaros; Helios; T lymphocyte; lymphocyte development; heterochromatin] Received December 8, 1997; revised version accepted January 22, 1998. The molecular mechanisms by which B and T lympho- (Ikuda et al. 1992; Morrison et al. 1995; Orkin 1995; cytes are generated from hematopoietic stem cells have Singh 1996; Georgopoulos et al. 1997). been the subject of intensive investigation. By analysis of In recent years, insight into the early regulatory events the immunoglobulin and T cell receptor (TCR) gene re- has been provided by the phenotypes of mice containing combination events and the differential expression of homozygous disruptions of genes encoding sequence- specific DNA-binding proteins (Orkin 1995; Clevers and lymphocyte-specific genes, much has been learned about the regulation of B and T cell maturation (Clevers et al. Grosschedl 1996; Singh 1996; Ting et al. 1996; Georgo- 1993; Hagman and Grosschedl 1994; Ernst and Smale poulos et al. 1997). PU.1, Ikaros, E2A, EBF, BSAP, and 1995; Clevers and Grosschedl 1996; Shortman and Wu GATA-3 are among the proteins that are critical for early 1996; Willerford et al. 1996). In contrast, little is known lymphocyte development. Most of these proteins act as about the earliest stages of lymphocyte development, in- typical transcription factors, which bind to regulatory cluding commitment to the lymphocyte lineages and the elements within specific target genes and direct gene ac- maturation events that precede gene recombination tivation. Ikaros is unusual among the above DNA-binding pro- teins as none of its targets has been clearly established Present address: Howard Hughes Medical Institute, Children’s Hospital, and its intracellular functions remain unknown. The Harvard Medical School, Boston, Massachusetts 02115 USA. Ikaros gene was first identified through an expression Corresponding author. E-MAIL [email protected]; FAX (310) 206-8623. library screen for proteins that interact with an enhancer 782 GENES & DEVELOPMENT 12:782–796 © 1998 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/98 $5.00; www.genesdev.org Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes for the TCR CD3d gene (Georgopoulos et al. 1992). The within the TdT promoter is critical for promoter activity gene was later found to encode the LyF-1 protein that in immature lymphocytes (Lo et al. 1991). Ets family interacts with a critical control element in the promoter proteins also bind this site however, and several findings for the lymphocyte-specific terminal transferase (TdT) suggest that the Ets protein Elf-1 is the functional acti- gene (Lo et al. 1991; Hahm et al. 1994). Primary Ikaros vator of TdT transcription (Ernst et al. 1993, 1996). Ika- transcripts undergo alternative pre-mRNA splicing to ros and Elf-1 cannot bind simultaneously to this element (K. Hahm, L. Trinh, P. Ernst, and S.T. Smale, in prep.), generate several protein isoforms. The isoforms vary within an amino-terminal zinc finger domain that is re- suggesting that if Ikaros contributes to TdT promoter sponsible for sequence-specific DNA binding (Hahm et activity, it does so as a repressor or competitive inhibitor al. 1994; Molnar and Georgopoulos 1994; Molnar et al. of the Elf-1 activator. 1996; Sun et al. 1996). The largest Ikaros isoform (iso- Recent studies of subnuclear localization in B cells form VI; Ik-1) contains four zinc fingers near the amino have provided further evidence that Ikaros may not be a terminus, whereas the smaller isoforms contain fewer or simple transcriptional activator, as it was found by im- no amino-terminal zinc fingers. All isoforms contain munogold electron microscopy and confocal microscopy two additional zinc finger motifs at their carboxyl ter- to localize to heterochromatin (Brown et al. 1997; Klug minus, which do not bind DNA (Hahm et al. 1994), but et al. 1998). More specifically, by combining fluores- serve as protein–protein interaction domains (Sun et al. cence in situ hybridization with confocal immunofluo- 1996). Given the apparent indiscriminate nature of the rescence assays, Ikaros colocalized with centromeric protein–protein interactions, a large number of dimeric heterochromatin and with inactive genes, which them- or multimeric species can be generated. Recently, a pro- selves migrate to foci of centromeric heterochromatin tein related to Ikaros was identifed by degenerate PCR (Brown et al. 1997). with primers complementary to sequences encoding the The centromeric localization of Ikaros makes an un- carboxy-terminal zinc fingers (Morgan et al. 1997). This derstanding of its precise intracellular functions difficult protein, Aiolos, exhibits considerable homology to Ika- to establish. The ability of the many Ikaros isoforms to ros and interacts with Ikaros through its carboxy-termi- associate with one another indiscriminately into a large nal fingers (Morgan et al. 1997). number of dimeric or multimeric species adds further Ikaros isoforms are expressed in most cells of the he- complexity, as each species may carry out a distinct matopoietic lineages, including multipotent stem cells function. Finally, the complicated phenotypes of the Ika- −/− (Georgopoulos et al. 1992; Hahm et al. 1994; Molnar and ros mice suggest that Ikaros proteins may carry out Georgopoulos 1994; Morgan et al. 1997; Klug et al. 1998). different functions in the different hematopoietic cell Many cell types express the two largest isoforms (V and lineages, perhaps in association with lineage-restricted VI), but isoform expression patterns vary to some extent partners. As an essential step toward an understanding of in a cell-specific manner. Aiolos is expressed in most of these issues, we performed a biochemical analysis of the the cell types that express Ikaros, except the earliest he- native Ikaros proteins. This analysis revealed that Ikaros matopoietic progenitors (Morgan et al. 1997). Gene dis- proteins form highly stable complexes that can be puri- ruption experiments have demonstrated that the Ikaros fied to near homogeneity by immunoaffinity chromatog- proteins are critical for multiple hematopoietic events raphy, providing a means of isolating Ikaros partners in (Georgopoulos et al. 1994; Winandy et al. 1995; Wang et various cell types. The Ikaros complexes purified from −/− al. 1996). The most striking defect in Ikaros mice is an immature T cell line contain an Ikaros-associated pro- the absence of B cells, natural killer cells, and some T tein, Helios, which possesses a zinc finger structure lineage cells, including fetal-derived T cells and some gd similar to that found in Ikaros. The restricted expression −/− T cells (Wang et al. 1996). Ikaros mice also exhibit a pattern of Helios, its presence at limiting quantities, its biased distribution and expansion of CD4 T cells and quantitative association with Ikaros, its assembly into a defects in other hematopoietic lineages (Wang et al. relatively homogeneous complex, and its specific local- 1996). A second Ikaros gene disruption, which elimi- ization to centromeres suggest that it functions as a criti- nates the DNA-binding domain, but allows expression of cal regulator of Ikaros within the centromeric hetero- smaller isoforms, results in a more severe lymphopoietic chromatin regions of the nucleus. defect; these mice contain no B or T lymphocytes or any of the known B or T cell progenitors (Georgopoulos et al. 1994). Heterozygotes of these mice contain normal lym- Results phocyte phenotypes and numbers at birth, but rapidly Expression of Ikaros isoforms by RLm11 and VL3-3M2 develop lymphoproliferative disorders (Winandy et al. T cells 1995). Ikaros-binding sites have been identified in the pro- For most of the studies described in this report, a murine moters or enhancers of several genes (Lo et al. 1991; radiation-induced thymoma cell line, RLm11, was em- Georgopoulos et al. 1992; Omori and Wall 1993; Warg- ployed. This cell line produces large quantities of TdT nier et al. 1995; Babichuk et al. 1996; Haag et al. 1996; mRNA and protein and has been used for several years to Santee and Owen-Schaub 1996; Wang et al. 1996), but study the transcriptional regulation of the TdT gene, a none of these genes has been shown to be an authentic potential Ikaros target (Lo et al. 1991; Ernst et al. 1993, Ikaros target. A well-characterized binding site for Ikaros 1996; Hahm et al. 1994). Immunoblot and RT-PCR GENES & DEVELOPMENT 783 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. analyses have demonstrated that RLm11 cells actively ments with independent extract preparations and with express 4 of the 10 Ikaros isoforms (see Fig. 1, isoforms I, column buffers at 0.1 and 0.45 M KCl, both in the pres- III, V, and VI; Hahm et al. 1994; Molnar and Georgopou- ence and absence of NP-40 detergent (data not shown). los 1994; Sun et al. 1996). All four of these isoforms have The above results raise the possibility that Ikaros pro- been detected in populations of primary immature lym- teins form an array of multimeric complexes. The results phocytes (Molnar and Georgopoulos 1994; Molnar et al. of other biochemical experiments are consistent with 1996; Klug et al. 1998). the multimer hypothesis, but some results have sug- For some experiments, another T cell line, VL3-3M2, gested that the proteins exist as highly stable dimers was used (Groves et al. 1995). This cell line expresses (A.S. McCarty, K. Hahm, R. Lee, B.S. Cobb, unpubl.). large quantities of the TdT, RAG-1, and RAG-2 mRNAs Further experiments will be needed to clarify the precise + + and exhibits properties of double-positive CD4 CD8 stoichiometry of the Ikaros complexes, but for the pur- cells (Groves et al. 1995). VL3-3M2 cells produce prima- poses of this study, the relevant findings are: (1) Ikaros rily two Ikaros isoforms, V and VI (see Fig. 8, below), the proteins appear to exist as stable dimeric or multimer two most abundant isoforms detected in primary thymo- complexes in solution, and (2) the unusually broad elu- cytes (data not shown; Molnar and Georgopoulos 1994). tion profile suggests that a given cell contains a large number of distinct complexes. This latter suggestion is consistent with previous studies in which the carboxy- Ikaros isoforms coelute in a broad peak from gel terminal zinc finger domains of Ikaros were found to fitration columns promote indiscriminate protein–protein interactions be- tween Ikaros isoforms (Sun et al. 1996; K. Hahm, un- Gel filtration chromatography was used to study the publ.). properties of the Ikaros proteins within RLm11 nuclear extracts. Immunoblot analysis of column fractions col- lected from a Superdex 200 FPLC column (Pharmacia) Purification of Ikaros complexes revealed that all four isoforms coelute in a broad peak To elucidate the intracellular functions of a protein, a between the excluded volume (exclusion limit, 1.3 × 10 critical objective is to identify other proteins with which kD) and a 232-kD molecular mass marker (Fig. 1, lanes it carries out relevant interactions. The biochemical 3–8). In contrast, Elf-1, with a calculated molecular mass properties summarized above and the complicated phe- of 76 kD (Davis and Roussel 1996), eluted in a sharp peak −/− notypes of the Ikaros mice raise the possibility that at ~200 kD (Fig. 1A, lanes 8–10). When using a gel filtra- the Ikaros isoforms stably associate with proteins that tion column with a larger exclusion limit, the four Ikaros have not been identified. Because of the apparent stabil- isoforms again coeluted with each other in a broad peak ity of the complexes, purification by immunoaffinity between 750 and 200 kD (data not shown; see Fig. 9, chromatography was an attractive method for identify- below). Similar results were obtained in several experi- ing relevant Ikaros-associated proteins. Polyclonal anti- bodies directed against the carboxy-terminal half of Ika- ros were initially used for the purification. RLm11 nuclear extracts in a buffer containing 0.45 M KCl were applied to a protein A–Sepharose column containing co- valently linked antibodies (see Materials and Methods). The column was washed extensively with 0.45 and 1 M KCl and, in some experiments, with 0 M KCl to disrupt nonspecific hydrophobic interactions. Tightly bound proteins were eluted with a buffer containing 100 mM trimethyl ethanolamine (pH 11.0). Analysis of the eluted proteins by SDS-PAGE followed by silver staining re- vealed six bands that were consistently observed at com- parable molar amounts (Fig. 2A, lanes 3–6). Four of these bands correspond to Ikaros isoforms I, III, V, and VI, based on immunoblot analysis with Ikaros antibodies (lane 7). The other two bands, which migrate at 30 and 70 kD (p30 and p70, respectively), did not interact with the Figure 1. Coelution of Ikaros isoforms in a broad peak from gel Ikaros antibodies by immunoblot analysis. These pro- filtration columns. RLm11 nuclear extracts (1 mg) were ana- teins also did not cross-react with three Ikaros antisera lyzed by Superdex 200 (Pharmacia) gel filtration chromatogra- raised against other domains of the Ikaros isoforms (data phy. Five micrograms of nuclear extract (lane 1) and 45 μl of not shown). These results suggest that p30 and p70 every other column fraction (lanes 2–13) were separated by SDS- bound to the column through specific interactions with PAGE and analyzed by immunoblotting, with antiserum di- Ikaros proteins. rected against Ikaros and Elf-1. The fractions in which standard Although denatured p30 and p70 did not interact with molecular mass markers elute are indicated by arrows at the the Ikaros antibodies by immunoblot analysis, it re- top, and the bands corresponding to Elf-1 and Ikaros isoforms I, III, V, and VI are (left). mained possible that they copurified with Ikaros because 784 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes and p30 proteins bound to this resin as efficiently as to the carboxy-terminal antibody resin. In contrast, an im- munoaffinity resin containing an unrelated antibody preparation of similar titer, directed against murine Elf- 1, did not yield detectable proteins of 30 and 70 kD (Fig. 2B, lane 2). As a final control, Ikaros was purified by DNA-affinity chromatography with a resin containing covalently linked multimers of the TdT D element, which com- prises an Ikaros-binding site (Lo et al. 1991). The DNA- affinity chromatography procedure was an improved ver- sion of the procedure used previously to purify and clone Ikaros (Hahm et al. 1994). In the previous experiments, only a single 65-kD band was observed. This band con- tained a mixture of Ikaros isoform VI and YY1, which also binds to a sequence within the D element (see Hahm et al. 1994). In the new experiment, which dimin- ished YY1 copurification, Ikaros isoforms III, V, VI, and the p70 protein, were readily detected (Fig. 2B, lane 5). Ikaros isoform I and p30 were less apparent and possibly less abundant, but were detected in some experiments (data not shown). Isolation of Helios To isolate the gene encoding p70, the immunoaffinity purification procedure was carried out with large quan- tities of RLm11 extract (see Materials and Methods). The purified fractions were then concentrated and the pro- Figure 2. Immunoaffinity purification of Ikaros complexes teins separated on a preparative SDS–polyacrylamide gel. from RLm11 nuclear extracts. (A) RLm11 nuclear extracts were After transferring to a PVDF membrane, the p70 band applied to a protein A–Sepharose column containing covalently was excised, proteolyzed with endopeptidase C, and se- linked antibodies directed against the carboxy-terminal half of quences of two peptides were obtained (Fernandez et al. Ikaros (see Materials and Methods). After washing the resin 1994). The peptide sequences (see Fig. 3) were unrelated with buffers containing 0.45 and 1 M KCl, bound proteins were to proteins or genes described in various databases (data eluted with 100 mM trimethyl ethanolamine (pH 11.0). The tri- not shown). methyl ethanolamine fractions (numbers 2 through 6, lanes 2–6) Degenerate oligonucleotides were used to isolate a were analyzed by SDS-PAGE followed by silver staining. Mo- lecular mass markers are shown in lane 1 and are indicated to 216-bp fragment of the p70 gene by RT-PCR from the left. Fraction 3 was also analyzed by immunoblotting with RLm11 mRNA. A full-length cDNA was then isolated anti-Ikaros serum (lane 7). Ikaros isoforms I, III, V, and VI are from a library prepared from newborn mouse thymus indicated between lanes 6 and 7. Two proteins, p30 and p70, mRNA (Stratagene). Subsequent studies revealed two were detected by silver staining that did not interact with the distinct cDNA products, p70A and p70B, that presum- Ikaros antibodies. (B) RLm11 extracts were applied to protein ably are generated by alternative pre-mRNA splicing. A–Sepharose columns containing covalently linked antibodies RT-PCR analysis of RLm11 mRNA revealed that the two directed against Elf-1 (lane 2), the carboxyl-terminus of Ikaros RNA products are present at comparable amounts (data (lane 3), or the amino-terminus of Ikaros (lane 4). The columns not shown). were washed and proteins eluted as described above. Portions of DNA sequencing of the p70A and p70B cDNAs re- the trimethyl ethanolamine eluates were analyzed by SDS- PAGE followed by silver-staining. Also analyzed were proteins vealed 1500- and 1578-bp ORFs, respectively, encoding purified by sequence-specific DNA-affinity chromatography proteins of 55 and 58 kD (Fig. 3). The proteins contain with a resin containing covalently linked multimers of the TdT domains with considerable homology to domains within D element (lane 5, see Materials and Methods and Hahm et al. Ikaros. Because of this homology, we named the p70 1994). Molecular mass markers are shown in lane 1 and are gene Helios. The small sizes of the Helios proteins rela- indicated at left in kD. Ikaros isoforms I, III, V, and VI, p70, and tive to their apparent molecular masses based on SDS- p30, are indicated at right. PAGE are consistent with the properties of the Ikaros proteins; the calculated molecular mass of Ikaros iso- they were recognized in their native conformations by form VI, for example, is 57 kD, whereas its apparent the antibodies. To address this possibility, immunoaffin- molecular mass by SDS-PAGE is 65 kD. The most strik- ity chromatography was performed with a resin contain- ing homology between Helios and Ikaros is within the ing an antibody preparation directed against an amino- amino- and carboxy-terminal zinc finger domains. He- terminal domain of Ikaros (Fig. 2B, lanes 3,4). The p70 lios A (which lacks the lower-case amino acids in Fig. 3) GENES & DEVELOPMENT 785 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Figure 3. Helios A and Helios B contain zinc fin- gers with homology to those in Ikaros and Aiolos. An amino acid sequence alignment compiled by use of the PILEUP program is shown. Compared are the largest isoforms of the Ikaros family members, Helios B, Ikaros isoform VI (Ik-1), and Aiolos. Low- ercase lettering in the Helios B sequence designates the sole difference between Helios B and Helios A. Amino acid sequences obtained by microsequenc- ing of purified Helios protein are indicated by a line above the Helios sequence. Shaded boxes in blue emphasize the highly conserved zinc finger motifs. Yellow bars indicate the conserved cysteines and histidines in the zinc fingers. The red box indicates the unusual cysteine in the apparent C HC finger. Overall sequence similarities are as follows: Helios B–Ikaros, 55%; Ikaros–Aiolos, 53%; Helios B–Aio- los, 50%. The four amino-terminal zinc fingers of Helios share 94% identity with the Ikaros fingers and the Aiolos fingers share 86% identity with the Ikaros fingers. The two carboxy-terminal zinc fin- gers of Helios share 85% identity with the corre- sponding Ikaros fingers, with 80% identity between the Aiolos and Ikaros fingers. The Helios cDNA and amino acid sequences have been deposited in the GenBank/Swiss Prot databases (accession nos. AF044257 and P81183, respectively). contains two C H zinc fingers (yellow) and one C HC homologous to Ikaros, called Aiolos, was isolated from a 2 2 2 zinc finger (red) near its amino terminus, similar to Ika- cDNA library by PCR with degenerate primers directed ros isoform V. Helios B (which contains the lower-case against the carboxy-terminal zinc-finger domain of Ika- amino acids in Fig. 3) contains three C H zinc fingers ros (Morgan et al. 1997). The Ikaros, Aiolos, and Helios 2 2 and one C HC zinc finger near its amino terminus, simi- zinc finger domains are highly homologous to each other lar to Ikaros isoform VI. Both Helios isoforms, like all of (Fig. 3). The stretches of Ikaros–Helios homology sur- the Ikaros isoforms, contain two carboxy-terminal zinc rounding the zinc finger domains are also homologous to Aiolos (e.g., amino acids 282–295 and 312–362). finger motifs (yellow). The Helios and Ikaros zinc finger domains are highly homologous at the amino acid level. The isolated Helios gene appears to encode the protein Surrounding the two zinc finger domains, a few short purified by immunoaffinity chromatography on the basis stretches of identity and similarity between Helios and of two criteria: First, both peptide sequences obtained Ikaros are apparent, but most of the Helios sequence ex- from the purified protein are encoded by the Helios gene hibits little homology to Ikaros. (Fig. 3, overlined). Second, immunoblot analysis of the Recently, another protein with zinc finger domains purified protein with antibodies generated against the 786 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes amino-terminal 109 amino acids of Helios, reacted Ikaros isoforms with similar efficiencies (on the basis of strongly with a protein of the expected size (Fig. 4A). a comparison on the relative protein amounts before and after immunoprecipitation). The carboxy-terminal zinc fingers are likely to be responsible for the interactions, Specific, indiscriminate protein–protein interactions given the strong homology between the Ikaros and He- between Helios and Ikaros isoforms lios domains. The above data suggest that Helios copurifies with Ika- ros by immunoaffinity chromatography because the two DNA-binding-site specificity of Helios A proteins are tightly associated with each other in RLm11 cells. To confirm that recombinant Helios can interact The above results suggest that intracellular complexes with recombinant Ikaros isoforms, an expression vector exist containing a combination of Helios and Ikaros pro- for Helios A containing a FLAG epitope tag was cotrans- teins. Helios complexes may also exist without Ikaros fected into 293T cells along with expression vectors for components, and Ikaros complexes may exist without Ikaros isoforms I, V, and/or VI. Interactions were moni- Helios components. Perhaps, the various complexes tored by immunoprecipitation with anti-FLAG antibod- carry out different functions by recognizing different ies, followed by immunoblot analysis with either Ikaros DNA sequences. To determine the DNA sequence speci- or Helios antibodies. Figure 4B shows the Helios A and ficity of Helios A, a binding-site selection–PCR ampifi- Ikaros proteins in 293T cytoplasmic and nuclear extracts cation strategy was employed with a fusion protein con- prior to immunoprecipitation. (Ikaros and Helios anti- taining the Helios A DNA-binding domain and GST bodies were added to the immunoblot to visualize the (Zweidler-McKay et al. 1996; see Materials and Meth- products of both genes, but the relative amounts of the ods). Ikaros and Helios gene products cannot be determined The selected clones revealed potential recognition se- from these data.) Epitope-tagged Helios A localized to quences that can be divided into two groups (Fig. 5A). the nucleus and migrated slightly slower than Ikaros iso- The first group, containing 19 sequences, was character- form VI (e.g., Fig. 4B, lane 14), agreeing with the migra- ized by the core sequence GGGA. The second group, tion pattern of Helios observed in the purified com- containing 30 sequences, was characterized by the core plexes. Immunoprecipitation with FLAG antibodies (Fig. sequence GGAAAA. A simple interpretation of these 4C) revealed that FLAG–Helios A interacts with all three data is that the core sequence GGA is generally suffi- Figure 4. Indiscriminate interactions between Helios A and Ikaros isoforms in 293T cells. (A) The Helios protein within an RLm11 extract (lane 1) and the immunoaffinity purified Ikaros complex (lane 2) can be detected by immunoblot analysis with antisera directed against recombinant Helios (amino acids 1–109). Molecular mass markers are indicated at right, and the location of the Helios band is indicated at left. (B) 293T cells were transfected with 10 or 15 μg of expression plasmids for various Ikaros isoforms (lanes 1–18; specific isoforms indicated above each lane), in the absence (lanes 1,2) or presence (lanes 3–18) of an expression plasmid for FLAG- tagged Helios A (5 μg). Cytoplasmic (odd-numbered lanes) and nuclear (even numbered lanes) extracts from the transfected cells were analyzed by immunoblotting with antibodies directed against both Helios and Ikaros. The bands corresponding to FLAG-tagged Helios A and Ikaros isoforms I, V, and VI are indicated to the left. (C) Interactions between Helios A and Ikaros isoforms were assessed by immunoprecipitation from the nuclear extracts shown in part B with a monoclonal antibody directed against the FLAG epitope. Proteins within the immunoprecipitated pellet were analyzed by immunoblotting with antisera directed against Helios (top) or Ikaros (bottom). The extacts used for immunoprecipitation contained (lanes 3–10) or lacked (lanes 1,2) the FLAG–Helios A protein and zero, one, two, or three Ikaros isoforms (isoforms indicated above each lane). The locations of the bands corresponding to FLAG–Helios A and Ikaros isoforms I, V, and VI are indicated to the right. GENES & DEVELOPMENT 787 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Figure 5. Helios A and Ikaros isoform V bind to similar DNA sequences. (A) High-affinity Helios A-binding sites were selected by a GST pull-down assay (Zweidler-McKay et al. 1996). DNA fragments selected by the GST–Helios A fusion protein were sequenced and tabulated. The selected sequences can be divided into two groups, both containing a core sequence of GGA. Group 1 was represented by 19 sequences and Group 2, by 30 sequences. The number of fragments containing each nucleotide at a given position following alignment are indicated for each group. Only 14 sequences are shown for the first four positions of the Group 2 sequence because the remaining 16 were derived from fragments in which these four positions were contained within the invariant primer-binding sites flanking the variable sequences. (B) Gel mobility shift assays were performed with recombinant GST–Ikaros isoform V (lanes 1–6) and recombinant Helios A (lanes 7–12) with probes containing the five sequences shown at the bottom (lanes 2–6, 8–12) and a negative control probe (lanes 1,7). The specific probes were derived from the pSP72 (Promega) multiple cloning site region (lanes 1,7), the TdT D (lanes 2,8) and D8 (lanes 3,9) elements, the Hs BS1 (i.e., Helios binding site 1; lanes 4,10) and Hs BS2 (lanes 5,11) sequences selected in this study, and the IkBS2 (lanes 6,12) sequence selected previously (Molnar and Georgopoulos 1994). cient for high-affinity DNA binding if it is flanked by a lines and murine tissues. Surprisingly, Helios mRNA guanine at the 58 end or by three adenines at the 38 end. was largely restricted to the T cell lineage. Four major The first group is very similar to a previously described transcripts were readily detected in three of four T cell consensus sequence for Ikaros isoform V (Molnar and lines tested (Fig. 6A, lanes 3–6) and in a cell line contain- Georgopoulos 1994), which is the most homologous to ing early progenitors of multiple hematopoietic lineages Helios A. The second group did not match the Ikaros (lane 2; Tsai et al. 1994). No expression was observed in consensus sequence. B lineage cell lines (lanes 7–9) or in fibroblast (lane 1) or To determine whether the two groups of Helios A con- macrophage (lane 10) lines. In contrast, the Ikaros gene sensus sequences provide a functional distinction be- was expressed at high levels in all three B cell lines and tween Ikaros and Helios, gel mobility shift assays were at lower levels in the macrophage line (data not shown). performed with a probe representative of the first group Consistent with the expression pattern in the cell lines, (Fig. 5B, lanes 6,12; Ik BS2; Molnar and Georgopoulos abundant Helios transcripts were detected in the thymus 1994), a probe representative of the second group (lanes (lane 16), with very little expression in the bone marrow 5,11; Hs BS2), and a probe containing a sequence that (lane 17) and brain (lane 11), and no detectable expression conforms to both groups (lanes 4,10; Hs BS1). A negative in spleen, liver, kidney, or muscle (lanes 12–15). By con- control was also included (lanes 1,7), along with probes trast, Ikaros transcripts were readily detected in both the containing two TdT promoter elements that are known spleen and thymus (Georgopoulos et al. 1992; data not to bind Ikaros (lanes 2,3,8,9). The results demonstrate shown). The reason for the existence of transcripts of that Ikaros isoform V and Helios A possess very similar different sizes has not been explored, but all four tran- sequence specificities, as the relative complex abun- scripts were detected when the blots were probed with dances observed with each probe were very similar for gene fragments encoding amino acids 221–292 (Fig. 6A) the two proteins. Thus, if Ikaros–Helios complexes carry or amino acids 1–109 (data not shown). out different functions from either Ikaros–Ikaros or He- Immunoblot experiments provided evidence that the lios–Helios complexes, they are likely to do so as a result Helios protein is restricted to the T cell lineage (Fig. 6B). of other functional differences between Helios and Ikaros. The expected 70-kD band was observed in four different T cell lines (Fig. 6B, lanes 2–6), but not in 5 cell lines of the B lineage (lanes 7–11) or in erythroid (lane 12), mac- T cell-restricted expression pattern of Helios rophage (lane 13), or fibroblast (lane 14) lines. The T cell- To determine the expression pattern of Helios, Northern restricted expression pattern of Helios is in striking con- blots were carried out with mRNA from transformed cell trast to the expression pattern of the Ikaros proteins, 788 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes Figure 6. Helios expression is largely re- stricted in T cells. (A) Northern blot analy- sis was used to measure Helios mRNA ex- pression in murine hematopoietic cell lines and tissues. Cell lines and tissues analyzed are indicated at the top. Twenty micrograms of total RNAs was analyzed in each lane. Nitrocellulose membranes were hybridized sequentially with a Helios probe (fragment encoding amino acids 221–292, top) and a human b-actin probe (500 bp, bottom). Positions of the 28S and 18S rRNAs are indicated. Actin transcripts and four major transcripts detected by He- lios probe are indicated. (B) Helios protein in murine cell lines was analyzed by im- munoblotting. Cell lines analyzed are in- dicated at the top. Twenty micrograms of protein from nuclear extracts estimated by Coomassie Assay (Pierce) were loaded in each lane. (p70) Protein migrating close to 70 kD and detected with anti-Helios se- rum. (C) The nuclear extracts analyzed in B were probes with antibodies directed against the carboxy-terminal half of Ika- ros. which were present in all of the hematopoietic cell lines plified in four of five samples of triple-negative cells (Fig. (Fig. 6C). 7, lanes 1–5), three of five samples of double-positive To examine Helios expression during T cell develop- cells (lanes 7–11), and only one of five samples of single- ment, primary thymocytes were sorted by FACS into positive cells (lanes 13–17). DNA sequencing of the PCR − − − + + + triple negative (CD3 4 8 ), double-positive (CD3 4 8 ), products confirmed that they contain Helios sequences. + + + − and CD4 single-positive (CD3 4 8 ) populations (see The sequences also revealed that the small size differ- Materials and Methods and Klug et al. 1998). Five differ- ence between the products in lanes 2 and 3 versus 4 and ent samples of 20 cells each were analyzed by RT–PCR 5 was attributable to the amplification of the Helios A for each population. PCR products were efficiently am- sequence in lanes 2 and 3 and the Helios B sequence in Figure 7. Helios expression in thymocyte and splenic cell subsets. Twenty cells of the indicated cell-surface phenotypes were sorted by FACS for analysis of Helios ex- pression during thymocyte maturation and in non-T-lineage cell subsets. Primers for nested PCR amplified across sequences that encode the four amino-terminal zinc fingers of Helios. The PCR products observed with the various samples exhibit slightly differ- ent migrations, which represent the ampli- fication of both the Helios A and Helios B products with predicted sizes of 712 and 790 bp, respectively. GENES & DEVELOPMENT 789 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. lanes 4 and 5 (data not shown). No PCR products were amplified from primary splenic neutrophils (Gr- + + + 1 Mac1 , lanes 19–23) or splenic B cells (B220 , lanes 25–29). These results confirm the T cell-restricted ex- pression of Helios and suggest that it might be most abundant in immature cells of the T lineage. Quantitative association of Helios with Ikaros The stability of the Ikaros–Helios interaction provides strong evidence that the interaction is relevant. To de- termine the percentage of Helios that is stably associated with Ikaros and, conversely, the percentage of Ikaros that is stably associated with Helios, quantitative immuno- precipitation experiments were performed with VL3- Figure 9. The Ikaros–Helios complexes appear to be relatively 3M2 (Fig. 8) and RLm11 (data not shown) cell extracts. homogeneous when analyzed by gel-filtration chromatography. The immunoprecipitation reactions were carried out Proteins in Superose 6 (Pharmacia) gel-filtration column frac- with increasing amounts of either Ikaros antibodies tions were separated by 10% SDS-PAGE and analyzed by West- (lanes 2–5, 11–14) or Helios antibodies (lanes 6–9, 15–18). ern blot analysis involving probing of the blot sequentially with anti-Helios serum (top) followed by anti-Ikaros serum (bottom). The amounts of Ikaros and Helios within the immuno- Four micrograms of RLm11 nuclear extracts was also analyzed precipitation pellets (lanes 1–9) and supernatants (lanes (lane 1). The fractions where standard molecular mass markers 10–18) were determined by immunoblot analysis. Ikaros migrate in Superose 6 (Pharmacia) gel-filtration chromatogra- antibodies were capable of depleting almost all of the phy are indicated by arrows on the top with their molecular Helios from the VL3-3M2 extracts, as determined by the masses. Isoforms I, III, V and VI are indicated. depletion of almost all of the Helios from the immuno- precipitation supernatants (lanes 10–14, top). This result suggests that virtually all of the Helios within the cell is ciated with Helios, and therefore that Ikaros is in con- associated with Ikaros isoforms. In contrast, Helios an- siderable excess. Similar results were obtained with tibodies depleted only a small fraction of the Ikaros RLm11 extracts (data not shown). The quantitative as- (lanes 15–18, bottom), despite the ability of these anti- sociation of Helios with Ikaros provides strong support bodies to deplete all of the Helios (lanes 15–18, top). This for the functional relevance of the Ikaros–Helios inter- result suggests that only a fraction of the Ikaros is asso- action. Helios and Ikaros exist as a relatively homogeneous complex The overexpression experiments in 293T cells suggest that the four Ikaros isoforms and two Helios isoforms present in RLm11 cells are capable of forming stable complexes with each other in an indiscriminate manner. With six different proteins interacting through highly homologous carboxy-terminal zinc finger domains, 21 different dimers could be produced. If these dimers asso- ciate into multimers, as suggested by some of the data, a much larger number of species is possible. Each species might carry out a distinct function within the cell, or many of the complexes might carry out redundant func- Figure 8. Quantitative association of Helios with a subset of tions. Alternatively, the interactions between the endog- the Ikaros within VL3-3M2 cells. Quantitative immunoprecipi- enous proteins in RLm11 cells might not be as indis- tation experiments were performed with purified IgG directed against the amino-terminal domains of either Ikaros (lanes 2– criminate as suggested by the 293T experiments. The 5,11–14) or Helios (lanes 6–9,15–18). Control immunoprecipita- relative elution profiles of Ikaros and Helios from a gel tions contained no added antibody (lanes 1,10). The proteins filtration column support this latter hypothesis (Fig. 9). present in the immunoprecipitation pellets (lanes 1–9) and su- As shown above (Fig. 1), Ikaros isoforms elute from gel pernatants (lanes 10–18) were analyzed by immunoblot, with filtration columns in a broad peak and at large molecular the membranes probed with antibodies directed against either masses. It is not known whether this elution profile ac- Helios (top) or Ikaros (bottom). The two isoforms predomi- curately reflects the sizes of the complexes, but the nantly expressed in VL3-3M2 cells are indicated to the left of broad peak suggests that the complexes are quite heter- the bottom panel. The amounts of anti-Ikaros or anti-Helios ogeneous. Surprisingly, Helios eluted as a sharp peak IgGs used in the immunoprecipitations were as follows: 1.5 μg from a Superose 6 gel filtration column, coeluting with (lanes 2,6,11,,15), 4.5 μg (lanes 3,7,12,16), 15 μg (lanes 4,8,13,,17), and 45 μg (lanes 5,9,14,,18). the largest of the Ikaros complexes (Fig. 9, lanes 6–8). 790 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes This sharp elution profile suggests that Helios is not as- function as a simple transcriptional repressor in either sembled into the same heterogeneous array of complexes transient or stable transfection experiments (data not as Ikaros, but rather is assembled into one discrete com- shown). plex, or at least a much more homogeneous set of com- Confocal microscopy was employed to examine plexes than Ikaros. whether the subnuclear localization of Helios and Ikaros in T cells is similar to the centromeric localization of The gel filtration result raises the possibility that He- Ikaros observed in B cells (Brown et al. 1997). For these lios is a limiting regulatory molecule that dictates the function of Ikaros isoforms. The apparently homoge- experiments, VL3-3M2 and primary activated lymph neous complex containing Helios and Ikaros might carry node T cells were used. Surprisingly, with both T cell out a specific function. The excess Ikaros that is not sources, Ikaros was distributed throughout the nucleo- associated with Helios might assemble into specific plasm and did not exhibit the predominant centromeric complexes with other Ikaros-related proteins, such as localization that had been observed in B cells. These re- the p30 protein (Fig. 2A). Indeed, a partial peptide se- sults are apparent in Figure 10 (g,h,i), which shows a quence of p30 has revealed that it is another member of single optical section of a representative lymph node T the Ikaros family (B.S. Cobb, unpubl.). Some of the ex- cell stained with an Ikaros antibody (h) and with a fluo- cess Ikaros might instead exist as partially formed com- rescent DNA probe for gamma satellite repeats (g), plexes that lack subunits essential for function. which are found primarily at centromeric regions of chromosomes (see Materials and Methods and Brown et al. 1997). The costained image (i) reveals patches of Ika- Selective association of complexes containing Helios ros staining at the edges of the centromeric foci (yellow), with centromeric regions of T cell nuclei but most of the Ikaros was distributed throughout the nucleoplasm (green). Similar results were observed in A recent study revealed that Ikaros might not be a typi- VL3-3M2 cells (data not shown). These results are in cal transcriptional activator, as it was found in B cells to striking contrast to the results observed in B cells (j,k,l), localize primarily to centromeric heterochromatin in which the Ikaros (j) and gamma-satellite (k) staining (Brown et al. 1997). This study also revealed that a vari- patterns are very similar to each other, and closely coin- ety of inactive genes colocalize with Ikaros to the cen- cide in the costained image (l). tromeric regions, leading to the hypothesis that Ikaros Interestingly, in both the lymph node T cells (a,b,c) might play a role in recruiting genes to centromeric foci and the VL3-3M2 T cells (d,e,f), Helios colocalized with that are destined for inactivation. Consistent with the the gamma satellites at the centromeric foci, similar to hypothesis that both Helios and Ikaros are not typical the predominant localization of Ikaros in B cells. The transcriptional activators, we were unable to detect ac- colocalization is apparent by comparison of the gamma- tivation of reporter constructs containing multiple high- satellite staining pattern (a,d) with the Helios staining affinity Ikaros/Helios binding sites when various Ikaros pattern (b,e) and by examination of the costained images and/or Helios isoforms were overexpressed (data not (b,e), in which colocalization is evident by the orange shown). In addition, none of these proteins appears to Figure 10. Distribution of Helios and Ika- ros proteins within the nuclei of T and B lymphocytes. Confocal images are shown of single optical sections through the nucleus of representative individual con- cavalin-A stimulated lymph node T cells (a,b,c,g,h,i), activated VL3-3M2 T cells (d,e,f), and B3 pre-B cells (j,k,l). The cells were labeled simultaneously with a probe for gamma satellite sequences (red) and spe- cific antisera for Helios (a–f) or Ikaros (g–l) (shown in green). The red and green com- ponents of costained nuclei (bottom, c,f,i,l) are shown separately in the top (gamma satellite-red a,d,g,j) and middle (p70-green b,e, Ikaros-green h,k) rows. GENES & DEVELOPMENT 791 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. and yellow colors. The yellow color observed in cos- elucidated. One hypothesis is that Helios–Ikaros com- tained VL3-3M2 cells indicates that the intensity of He- plexes bind to DNA sequence elements within the pro- lios staining is greater than in the lymph node T cells, moters, enhancers, or silencers of genes that are destined for inactivation. Binding of Helios–Ikaros might result in which yield an orange color. It is worth noting, however, the recruitment of those genes to the centromeric foci, that the intensity of Helios staining in both of these cell where they might be assembled into inactive heterochro- types was much weaker than the intensity of Ikaros matin structures. A more extensive discussion of the staining. (The images in Fig. 10 do not reflect the lower abundance of Helios because different settings were used possible functions for these proteins at centromeric re- for the Helios images to enhance detection.) These re- gions, and a discussion of related studies of Drosophila sults are consistent with those in Figure 8, which dem- heterochromatin regulation and position effect variega- onstrate that Helios is much less abundant than Ikaros tion, can be found in Brown et al. (1997). in T cells. Because the data in Figure 8 demonstrate that The reason for the broad distribution of Ikaros in T cell Helios is quantitatively associated with a subset of the nuclei, relative to its predominant centromeric localiza- Ikaros, the most likely interpretation of the confocal re- tion in B cells, also remains unknown. Perhaps, B cells sults is that the Ikaros–Helios complexes are predomi- contain a more abundant partner for Ikaros that recruits nantly localized to the centromeric foci. In contrast, the a larger fraction of the Ikaros pool to the centromeric excess Ikaros that is not associated with Helios appears foci. Alternatively, Ikaros may be capable of localizing to to be distributed more broadly throughout the nucleo- the centromeric regions in B cells in the absence of a plasm. partner. The large pool of Ikaros in T cells that is not Although not easily apparent from the images shown localized to the centromeres may simply be excess pro- in Figure 10, the similar staining patterns of Helios and tein that carries out no specific functions. Alternatively, gamma satellite repeats may not represent true colocal- this pool may carry out one or more critical functions ization (i.e., identity of spatial location). Instead, the He- related to the activation or inactivation of specific genes, lios staining appears to extend slightly beyond the perhaps acting as a more typical activator or repressor in gamma satellite staining. Preliminary studies of decon- combination with other transcription factors, coactiva- volved images are consistent with this observation (K.E. tors, or corepressors. Although our discussion of Ikaros Brown and A.G. Fisher, unpubl.), suggesting that Helios and Helios has focused on their possible roles in tran- and gamma satellites are interlaced rather than spatially scriptional regulation, it is important to note that no identical. compelling evidence has been published demonstrating that Ikaros or Helios are actually involved, either di- rectly or indirectly, in transcription. Alternative func- tions that must be considered are involvement in Discussion nuclear structure, DNA synthesis, or mitosis. Gene disruption experiments have shown that Ikaros The discovery of a T cell-restricted member of the Ika- isoforms carry out critical functions during the develop- ros family leads to models that might explain some of ment of B and T lymphocytes, as well as other hemato- the phenotypes observed in mice containing Ikaros gene −/− poietic cell types (Georgopoulos et al. 1994; Winandy et disruptions. Ikaros mice lack all cells of the B lin- al. 1995; Wang et al. 1996). Nevertheless, in light of the eages, but exhibit less severe defects in some of the T cell centromeric heterochromatin localization that has been lineages (see introductory section; Wang et al. 1996) even observed (Brown et al. 1997; Klug et al. 1998), the precise though Ikaros normally appears to be expressed in all B intracellular functions of Ikaros almost certainly will be and T cells. Perhaps complete disruption of the Ikaros difficult to elucidate. The finding that Ikaros protein gene has relatively modest effects on T cell development complexes are sufficiently stable to allow their purifica- because Helios compensates for the absence of Ikaros. tion by immunoaffinity chromatography provides a This hypothesis is supported by the finding that Helios means of identifying relevant Ikaros partners within any and Ikaros recognize similar DNA sequences. A more given cell type or cell line, information which will be severe T cell defect was observed in mice containing a essential for fully understanding Ikaros functions. Our specific disruption of the zinc finger DNA-binding do- analysis of the complexes within the RLm11 T cell line mains of Ikaros; these mice, which retain the capacity to led to the identification of a new member of the Ikaros produce smaller Ikaros proteins containing the carboxy- family, Helios. The relevance of the Helios–Ikaros inter- terminal protein–protein interaction domain, do not pro- action was demonstrated by the quantitative association duce any progenitor or mature T cells (Georgopoulos et in the two cell lines examined. The specific functions of al. 1994). The severity of this mutation within the T cell Helios and of the Helios–Ikaros complex remain un- lineage might be due to the fact that the small Ikaros known, but the colocalization of Helios–Ikaros com- proteins act in a dominant negative manner, sequester- plexes with gamma satellites suggests that Helios might ing Helios and preventing it from compensating for the be a limiting regulatory factor that recruits a subset of loss of Ikaros. the Ikaros within a T cell to centromeric foci. Consistent with the hypothesis that Ikaros and Helios The function of the Helios–Ikaros complexes at the might not simply be transcriptional activators, we have centromeric regions, and the function of the excess Ika- been unable to detect transcriptional activation func- ros distributed throughout the nucleus, remains to be tions for either protein by standard transient and stable 792 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes cDNAs for these isoforms in the pSP72 vector (see Hahm et al. transfection assays (B.S. Cobb and K. Hahm, unpubl.). 1994) were excised with BglII and XhoI and inserted into Ikaros proteins contain a domain that functions as a pcDNA1neo cleaved with BamHI and XhoI. Plasmids for ex- strong transactivation domain when fused to a GAL4 pression in Escherichia coli of fusion proteins between Helios A DNA-binding domain (Sun et al. 1996; K. Hahm, L. and GST were prepared for antibody preparation and DNA-bind- Trinh, P. Ernst, and S.T. Smale, in prep.). Transactiva- ing studies. Fragments encoding Helios A amino acids 1–109 tion of reporter plasmids has also been reported with the (for antibody preparation) and 1–292 (for DNA-binding studies) full-length protein (Molnar and Georgopoulos 1994). In were generated by PCR from the full-length Helios A cDNA our hands, however, we have been unable to detect trans- with a primer spanning the amino-terminal coding region, 58- activation with either full-length Ikaros or Helios, or a GATAGATCTATGGAAACAGACGCAATTGA-38, and the re- combination of the two, despite efficient expression of verse primers 58-GATGAATTCGTCCATCATATGAGACTG- the proteins and despite the fact that extracts from those CATCAG-38 or 58-GATGAATTCGCCTTGAAGGTCCTGGA- CTTT-38, respectively. The 327- and 876-bp PCR products, re- cells contain the expected DNA-binding activities (B.S. spectively, were cleaved with BglII and EcoRI and inserted into Cobb and A.S. McCarty, unpubl.). Because these results pGEX 2T (Pharmacia) cleaved with BamHI and EcoRI. are negative, they can only be substantiated by the dem- The mammalian expression plasmid for FLAG-tagged Helios onstration that Ikaros and Helios carry out a different A was prepared by amplifying the protein-coding sequence with function. It remains possible that Ikaros functions as a the following PCR primers: 58-GATAGATCTATGGAAA- activator of some genes through combinatorial interac- CAGACGCAATTGA-38 and 58-GATGAATTCCTAGTGGAA- tions, yet is involved in heterochromatin formation on TGTGTGCTCCCC-38. The PCR product was cleaved with other genes at the centromeric foci. Such a function BglII and EcoRI and inserted into pSP72 cleaved with the same would be similar to that proposed for the Drosophila enzymes. The following FLAG-encoding oligonucleotide and its Hunchback protein, which contains zinc finger domains complement were then annealed, cleaved with BglII and BamHI, and inserted into the BglII-cleaved plasmid: 58-GATA- that are highly related to those in Ikaros and Helios. GATCTACCATGGACTACAAGGACGACGATGACAAGG- Hunchback acts as a simple activator during embryogen- GATCCGAT-38. Finally, the entire coding sequence was trans- esis and also has been proposed to establish silencing ferred to the pcDNA3 expression vector (InVitrogen) following complexes in Drosophila by recruiting Polycomb-group cleavage of the pSP72 plasmid with BglII and XhoI and the vec- proteins (Zhang and Bienz 1992; Poux et al. 1996). tor with BamHI and XhoI. The stoichiometry and structure of the complexes ob- served by gel filtration chromatography and other tech- Cell culture and transient transfections niques remain unknown. Some techniques strongly sug- gest that Ikaros complexes are composed of highly stable RLm11, VL3-3M2, and other cell lines were maintained as de- scribed previously (Groves et al. 1995; Ernst et al. 1996). Tran- dimers. Other techniques suggest that the complexes are sient transfections of 293T cells were performed by a calcium multimeric (see Results). Additional experiments will be phosphate coprecipitation method (Ausubel et al. 1989) with needed to clarify these results and, if multimeric com- the amounts of plasmid DNA indicated in the figure legends. plexes are indeed present in cell extracts, to determine whether these complexes are the functional species in Antibodies vivo. On the basis of all the data that has been obtained, our working model is that the complexes contain highly Ikaros antisera were generated against GST-fusion proteins con- stable dimers that associate into multimers. taining amino-terminal amino acids 1–80 of isoform I and car- The homogeneous nature of the Ikaros complexes that boxy-terminal amino acids 54–286 of isoform I. Helios antisera contain Helios, as judged by gel filtration chromatogra- were generated against a GST fusion protein containing amino- terminal amino acids 1–109. These fusion proteins were puri- phy, is particularly intriguing. Because Helios appears to fied by glutathione–Sepharose chromatography and used to im- interact indiscriminately with the various Ikaros iso- munize rabbits as described previously (Hahm et al. 1994). The forms following overexpression in 293T cells, it is not Elf-1 antiserum was described previously (Ernst et al. 1996). clear why Helios would elute in a sharper peak than IgGs from preimmune and immune sera were purified by pro- Ikaros. Apparently, within RLm11 cells, the interactions tein A–Sepharose (Pharmacia) chromatography as described by are not as indiscriminate as predicted. Perhaps, the Harlow and Lane (1988). smaller Ikaros complexes observed by gel filtration are partially assembled complexes, with Helios the final Gel filtration and DNA-affinity chromatography component added to the complex. Whatever the reason for the homogeneity of the Helios complexes, this dis- Gel filtration chromatography was performed with prepacked Superdex 200 and Superose 6 FPLC columns (Pharmacia). Ap- tinction from Ikaros is likely to rely on domains other proximately 1 mg of RLm11 nuclear extract in a volume of 500 than the zinc finger domains, since the zinc fingers are μl was applied to the column in HGED.45 buffer (20 mM HEPES extremely well conserved. at pH 7.9, 20% glycerol, 0.2 mM EDTA, 1 mM dithiothreitol, 0.1 mM PMSF, and 0.45 M KCl) containing 0.015% NP-40. Some experiments were performed with 0.15 M KCl and without NP- Materials and methods 40. Fractions (500 μl) were collected and 45 μl of each was ana- lyzed by immunoblot. Molecular size markers were thyroglob- Plasmid DNAs ulin (669 kD), ferritin (440 kD), catalase (232 kD), and albumin Mammalian expression plasmids for Ikaros isoforms I, III, V, (67 kD) (Pharmacia). and VI were prepared in the pcDNA1neo vector (InVitrogen). Sequence-specific DNA-affinity chromatography was per- GENES & DEVELOPMENT 793 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. formed with 0.5 ml of resin containing covalently linked mul- incubated with 3–6 μg of FLAG M2 monoclonal antibody (Ko- timers of the TdT D sequence as described previously (Hahm et dak IBI) for 2–4 hr at 4°C, followed by centrifugation for 10 min. al. 1994). Supernatants were transferred to a new tube and mixed with 40 μl of protein A–Sepharose (Pharmacia). The slurry was incu- bated for 1 hr at 4°C. After brief centrifugation, pellets were Purification of Ikaros complexes and peptide sequencing washed 5 times with buffer containing 10 mM HEPES (pH 7.9), Immunoaffinity columns were prepared by covalent coupling of 0.45 M KCl, 1 mM EDTA, 0.015% NP-40, 10% glycerin, and 1 antibodies to protein A–Sepharose (Pharmacia) by the method mM dithiothreitol. The washed pellets were analyzed by SDS- described in Harlow and Lane (1988). Ikaros complexes were PAGE followed by immunoblot as described previously (Hahm purified by the following method. RLm11 nuclear extracts (200 et al. 1994). mg) in buffer D (20 mM HEPES at pH 7.9, 20% glycerol, 0.2 mM The quantitative immunoprecipitations were performed with EDTA, 1 mM dithiothreitol, 0.1 mM PMSF, 0.42 M KCl) were 100 μl of RLm11 (500 μg) nuclear extract or 200 μl of VL3-3M2 applied to a precolumn containing 500 μl of unmodified protein (1.2 mg) nuclear extract. The extract was mixed with 167 μl of A–Sepharose, with the eluate flowing directly onto the bed of a a buffer containing 100 mM NaCl, 20 mM Tris (pH 8), and 0.5% 4-ml immunoaffinity column. The extract was passed through NP-40. To this mixture was added the indicated amount of IgG both columns three times. The immunoaffinity column was (against the amino terminus of either Ikaros or Helios), which then washed with 10 column volumes of HGED buffer (20 mM was diluted to 33 μl with PBS. Binding proceeded for 1 hr on ice HEPES at pH 7.9, 20% glycerol, 1 mM EDTA, 1 mM DTT, 0.1 after which 100 μl of a 50% slurry of protein A–Sepharose was mM PMSF) containing 0.45 M KCl and 1 M KCl. In some experi- added. The mixture was incubated for an additional hour at 4°C ments, the column was also washed with HGED buffer contain- on a rocker. The resin was pelleted by brief centrifugation and ing no KCl. Bound proteins were eluted in 1-ml fractions into the supernatants were transferred to a new tube. The pellets tubes containing 20 μl of 2 M Tris-HCl (pH 6.8) with 100 mM were washed four times with the above buffer. The immune trimethyl ethanolamine (pH 11.0). Fractions were analyzed by complexes and a constant proportion of the supernatants were SDS-PAGE followed by silver staining. analyzed by SDS-PAGE, followed by immunoblot analysis with To isolate the 70-kD protein for microsequencing, appropri- antisera against the carboxyl terminus of Ikaros or the amino- ate fractions from the pH 11.0 elution were pooled. After three terminus of Helios. runs of a 5-ml affinity column, ~10 μg of the 70-kD protein was obtained. The pooled proteins were precipitated by 20% trichlo- Binding-site selection analysis and gel mobility shift assays roacetic acid (Fisher), separated by SDS-PAGE, transferred to Binding-site selection assays were performed as described by PVDF membrane (Biorad), and stained with Ponceau S as de- Zweidler-McKay et al. (1996). The double-stranded oligonucleo- scribed previously (Hahm et al. 1994). The 70-kD band was tide containing random sequences was generated from the fol- excised and subjected to endopetidase C digestion followed by lowing 66-nucleotide fragment: 58-GGTAGAATTCAACTGC- peptide sequencing as described (Fernandez et al. 1994). CATCTAGGNNNNNNNNNNNNNNNNNNACACCGAG TCCAGTGGATCCTACG-38. The complementary strand was Isolation of Helios cDNAs generated by annealing the following primer and extending with the E. coli DNA polymerase Klenow fragment: 58-CGTAG- To isolate the Helios gene, first strand cDNA was generated GATCCACTGGACTCGGTG-38. The DNA fragments con- from RLm11 mRNA and used for PCR with the following de- taining random sequences were incubated with the recombi- generate primer pairs designed from the two peptide sequences; nant GST–Helios A fusion protein. Bound DNA molecules were 58-GATGAATTCCA(A/G)GA(A/G)CC(A/C/G/T)AT(T/C)A separated from unbouind molecules by incubation with GST– TGGA(C/T)AA(C/T)AA-38,58-GATGAATTCTT(C/T)TC(A/ Sepharose, followed by centrifugation (Zweidler-McKay et al. G)TA(A/C/T)GT(C/T)AG(A/G)TTCAT-38. A 216-bp PCR prod- 1996). Bound DNA molecules were eluted and amplified by uct was isolated and inserted into pSP72 (Promega) digested PCR with the above 23-mer and the following reverse primer: with BglII and EcoRI. The sequence of the insert was deter- 58-GGTAGAATTCAACTGCCA-38. After four binding cycles, mined and found to contain codons encoding the amino acids the final PCR products were digested with EcoRI and HindIII within the two original peptides that were not included in the and inserted into pSP72 (Promega). Thirty-two clones were ana- PCR primers, confirming that the fragment was derived from lyzed by sequencing. the correct gene. To isolate a full-length cDNA, the 216-bp frag- For gel mobility shift analysis, the IkBS1 probe was prepared ment was radiolabeled and used to screen a newborn thymus from a plasmid containing the following oligonucleotide and its cDNA library (Stratagene) as previously described (Hahm et al. complement inserted into the BamHI site of pSP72: 58- 1994). The resulting full-length cDNA encodes the Helios A GATCTTCAGCTTTTGGGAATCTCCTGTCAG-38. The Hs protein. The Helios B cDNA was isolated by RT-PCR with the BS1 and Hs BS2 probes were prepared from plasmids containing following primers flanking the amino-terminal zinc finger do- the following oligonucleotides and their complements inserted main. into the HindIII and EcoRI sites of pSP72: Hs BS1, 58-CGTG- Plasmids encoding Helios A–GST fusion proteins were intro- TATCCATAGGGAAAATTATCCTAGAT-38; Hs BS2, 58- duced into the SCS-1 strain of E. coli (Stratagene). Fusion pro- GATCTCGTGTGATTTTCCTAATGAGAATCCTAGATG-38. teins were then induced, purified and stored at −80°C as de- The TdT D and D8 probes were described previously (Hahm et scribed previously (Hahm et al. 1994). al. 1994). Radiolabeled probes were prepared as described previ- ously (Ernst et al. 1993) following cleavage with HindIII and Immunoprecipitation and immunoblot analyses EcoRI. The SP72 control probe was cleaved with BglII and XhoI. Binding reactions were performed as described by Lo et al. 293T cell immunoprecipitation assays were performed from cy- (1991). Samples were analyzed as described in Ernst et al. (1993). toplasmic or nuclear extracts with the following method. First, cytoplasmic and nuclear extracts were prepared from four 100- Northern blot analysis mm plates of transfected cells by Dounce homogenization as described by Lo et al. (1991). Nuclear extracts (400 μg) were RNAs from cell lines and tissues were prepared by a guanidine 794 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes thiocyanate centrifugation method (Ausubel et al. 1989). Tis- U.S. PHS grant DK43726. S.T.S. is an Associate Investigator sues used to generate RNAs were isolated from 1-month-old with the Howard Hughes Medical Institute. Balb/c mice. Northern blot probes were prepared from a 216-bp The publication costs of this article were defrayed in part by p70 fragment encoding amino acids 221–292, and were labeled payment of page charges. This article must therefore be hereby using the Prime-It Kit (Stratagene). marked ‘‘advertisement’’ in accordance with 18 USC section 1734 solely to indicate this fact. RT–PCR of Helios in thymocyte subsets and in splenic myeloid and B cell populations References − − − + + + Thymocyte subsets (CD-3 CD-4 CD-8 , CD-3 CD-4 CD-8 , Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. + + − and CD-3 CD-4 CD-8 ) were sorted by use of the following Seidman, J.A. Smith, and K. Struhl. 1989. Current protocols PE FITC combination of fluorochromes: CD-3 , CD-4 , and CD- in molecular biology. John Wiley, New York, NY. APC HI + 8 . Splenic myeloid cells were sorted as Gr-1 Mac-1 and Babichuk, C.K., B.L. Duggan, and R.C. Bleackley. 1996. In vivo splenic B cells were isolated as B220 cells. Each cell population regulation of murine granzyme B gene transcription in acti- was sorted once and then clone-sorted directly into 0.2-ml tubes vated primary T cells. J. Biol. Chem. 271: 16485–16493. containing 20 μl of RT lysis buffer [5× first strand buffer (Gibco- Brown, K.E., S.S. Guest, S.T. Smale, K. Hahm, M. Merken- BRL), 10 mM DTT, 2% Triton X-100, 0.01% BSA, 0.2 mM sper- schlager, and A.G. Fisher. 1997. Association of transcription- midine, 0.4 units of RNasin (Promega), 100 ng of RT primer, 0.5 ally silent genes with Ikaros complexes at centromeric het- mM each dNTP]. Reactions were initiated by adding 1 μl of erochromatin. Cell 91: 845–854. MMLV reverse transcriptase. Reactions were incubated for 75 Clevers, H.C. and R. Grosschedl. 1996. Transcriptional control min at 37°C. About 10%–15% of the cDNA reaction was used of lymphoid development: Lessons from gene targeting. Im- as a template for 35 cycles of PCR with the outside primers munol. Today 17: 336–343. listed below (PCR conditions: 94°C for 30 sec, 55°C for 30 sec, Clevers, H.C., M.A. Oosterwegel, and K. Georgopoulos. 1993. and 72°C for 30 sec). Five percent of the first PCR reaction was Transcription factors in early T-cell development. Immunol. used as template for a second round of 35 cycles with the inside Today 14: 591–596. primer set and the same PCR conditions described above. Prod- Davis, J.N. and M.F. Roussel. 1996. Cloning and expression of ucts were resolved on a 1.5% agarose gel and then blotted for the murine Elf-1 cDNA. Gene 171: 265–269. Southern analysis with an oligonucleotide (Helios probe) Ernst, P. and S.T. Smale. 1995. Combinatorial regulation of complementary to an exon located just upstream of the first transcription II: The immunoglobulin μ heavy chain gene. zinc finger exon in Helios. Control reactions received sorted Immunity 2: 427–438. cells but no reverse transcriptase. At least four large introns Ernst, P., K. Hahm, and S.T. Smale. 1993. Both LyF-1 and an Ets occur between the exon sequences being amplified by the inside protein interact with a critical promoter element in the mu- primer set. rine terminal transferase gene. Mol. Cell. Biol. The following oligonucleotides used for the RT-PCR and 13: 2982–2992. Southern blots are written in a 58 to 38 orientation: RT primer, Ernst, P., K. Hahm, L. Trinh, J.N. Davis, M.F. Roussel, C.W. GCATTGTTGATGGCTTGGTC; outside primers, GGG- Turck, and S.T. Smale. 1996. A potential role for Elf-1 in GAACA CGCCAATATGGC (58 end) and GCATCAGCT- terminal transferase gene regulation. Mol. Cell. Biol. CAGCCTCCTTC (38 end); inside primers, CCAATGGACAG- 16: 6121–6131. CACGCCTCG (58 end) and ATATCTGGGTAGCTGAATCGC Fernandez, J., L. Andrews, and S.M. Mische. 1994. An improved (38 end); p70 probe, CCCTGAGCCGTGAGGATGAG. procedure for enzymatic digestion of polyvinylidene difluo- ride-bound proteins for internal sequence analysis. Annal. Biochem. 218: 112. Confocal microscopy Georgopoulos, K. 1997. Transcription factors required for lym- phoid lineage commitment. Curr. Opin. Immun. 9: 222–227. Lymph node T cells were prepared as follows: Lymph nodes Georgopoulos, K., D.D. Moore, and B. Derfler. 1992. Ikaros, an were removed from a Balb/c mouse and minced in sterile me- early lymphoid-specific transcription factor and a putative dium to yield a single cell suspension. After washing, cells were mediator for T cell commitment. Science 258: 808–812. resuspended at 2.5 × 10 /ml and cultured at 37°C in AM DM Georgopoulos, K., M. Bigby, J.-H. Wang, A. Molnar, P. Wu, S. medium containing 10% FCS, antibiotics, concanavalin A (5 Winandy, and A. Sharpe. 1994. The Ikaros gene is required μg/ml) and IL-2 (20 U/ml). After 36 hr, live cells were enriched for the development of all lymphoid lineages. Cell 79: 143– by ficoll separation and cultured for a further 24 hr in 1 M DM containing 10% FCS and IL-2 (20 U/ml) at 37°C. VL3-3M2 cells Georgopoulos, K., S. Winandy, and N. Avitahl. 1997. The role of were activated with PMA (10 ng/ml) and ionomycin (250 ng/ the Ikaros gene in lymphocyte development and homeosta- ml) as described previously (Groves et al. 1995). B3 cells, the sis. Annu. Rev. Immunol. 15: 155–176. gamma satellite probe, and the immunofish protocol were de- Groves, T., P. Katis, Z. Madden, K. Manickam, D. Ramsden, G. scribed previously (Brown et al. 1997). Wu, and C.J. Guidos. 1995. In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement. J. Immunol. 154: 5011–5022. Acknowledgments Haag, F.A., G. Kuhlenbaumer, F. Koch-Nolte, E. Wingender, and K.H. and R.L. were supported by U.S. Public Health Service H.G. Thiele. 1996. Structure of the gene encoding the rat T (U.S. PHS) Training Grants GM-07104 and GM-08042, respec- cell ecto-ADP-ribosyltransferase RT6. J. Immunol. tively. C.A.K. was a fellow of the Irvington Institute, I.L.W. was 157: 2022–2030. supported by grants from the National Cancer Institute Hagman, J. and R. Grosschedl. 1994. Regulation of gene expres- (CA42551) and from SyStemix/Sandoz, A.G.F. was supported by sion at early stages of B-cell differentiation. Curr. Opin. Im- the Medical Research Council, UK, and S.T.S. was supported by munol. 6: 222–230. GENES & DEVELOPMENT 795 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Hahm, K., P. Ernst, K. Lo, G. Kim, C. Turck, and S.T. Smale. regulation of expression by type I interferons and interleu- 1994. The lymphoid transcription factor LyF-1 is encoded by kin-7. Genomics 33: 167–176. a specific, alternatively spliced mRNA derived from the Ika- Wang, J.-H., A. Nichogiannopoulou, L. Wu, L. Sun, A.H. Sharpe, ros gene. Mol. Cell. Biol. 14: 7111–7123. M. Bigby, and K. Georgopoulos. 1996. Selective defects in the Harlow, E. and D. Lane. 1988. Antibodies: A laboratory development of the fetal and adult lymphoid system in mice manual. Cold Spring Harbor Laboratory, Cold Spring Har- with an Ikaros null mutation. Immunity 5: 537–549. bor, NY. Wargnier, A., S. Legros-Maida, R. Bosselut, J.F. Bourge, C. Lafau- Ikuda, K., N. Uchida, J. Friedman, and I.L. Weissman. 1992. rie, C.J. Ghysdael, M. Sasportes, and P. Paul. 1995. Identifi- Lymphocyte development from stem cells. Annu. Rev. Im- cation of human granzyme B promoter regulatory elements munol. 10: 759–783. interacting with activated T-cell-specific proteins: Implica- Klug, C.A., S.J. Morrision, M. Masek, K. Hahm, S.T. Smale, and tion of Ikaros and CBF binding sites in promoter activation. I.L. Weissman. 1998. Hematopoietic stem cells and lym- Proc. Natl. Acad. Sci. 92: 6930–6934. phoid progenitors express different Ikaros isoforms and Ika- Willerford, D.M., W. Swat, and F.W. Alt. 1996. Developmental ros is localized to heterochromatin in immature lympho- regulation of V(D)J recombination and lymphocyte differen- cytes. Proc. Natl. Acad. Sci. 95: 657–662. tiation. Curr. Opin. Genet. Dev. 6: 603–609. Lo, K., N.R. Landau, and S.T. Smale. 1991. LyF-1, a transcrip- Winandy, S., P. Wu, and K. Georgopoulos. 1995. A dominant tional regulator that interacts with a novel class of promot- mutation in the Ikaros gene leads to rapid development of ers for lymphocyte-specific genes. Mol. Cell. Biol. 11: 5229– leukemia and lymphoma. Cell 83: 289–299. 5243. Zhang, C.C. and M. Bienz. 1992. Segmental determination in Molnar, A. and K. Georgopoulos. 1994. The Ikaros gene encodes Drosophila conferred by hunchback (hb) a repressor of the a family of functionally diverse zinc finger DNA-binding homeotic gen Ultrabithorax (Ubx). Proc. Natl. Acad. Sci. proteins. Mol. Cell. Biol. 14: 8292–8303. 89: 7511–7515. Molnar, A., P. Wu, D.A. Largespada, A. Vortkamp, S. Scherer, Zweidler-McKay, P.A., H.L. Grimes, M.M. Flubacher, and P.N. N.G. Copeland, N.A. Jenkins, G. Bruns, and K. Georgopou- Tsichlis. 1996. Gfi-1 encodes a nuclear zinc finger protein los. 1996. The Ikaros gene encodes a family of lymphocyte- that binds DNA and functions as a transcription repressor. restricted zinc finger DNA binding proteins, highly con- Mol. Cell. Biol. 16: 4024–4034. served in human and mouse. J. Immunol. 156: 585–592. Morgan, B., L. Sun, N. Avitahl, K. Andrikopoulos, T. Ikeda, E. Gonzales, P. Wu, S. Neben, and K. Georgopoulos. 1997. Aio- los, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO J. 16: 2004–2013. Morrison, S.J., N. Uchida, and I.L. Weissman. 1995. The biology of hematopoietic stem cells. Annu. Rev. Cell. Devel. Biol. 11: 35–71. Omori, S.A. and R. Wall. 1993. Multiple motifs regulate the B-cell-specific promoter of the B29 gene. Proc. Natl. Acad. Sci. 90: 11723–11727. Orkin, S.H. 1995. Hematopoiesis: How does it happen? Curr. Opin. Cell Biol. 7: 870–877. Poux, S., C. Kostic, and V. Pirrotta. 1996. Hunchback-indepen- dent silencing of the late UBX enhancers by a polycomb group response element. EMBO J. 15: 4713–4722. Santee, S.M. and L.B. Owen-Schaub. 1996. Human tumor ne- crosis factor receptor p75/80 (CD120b) gene structure and promoter characterization. J. Biol. Chem. 271: 21151–21159. Shortman, K. and L. Wu. 1996. Early T lymphocyte progenitors. Annu. Rev. Immunol. 14: 29–47. Singh, H. 1996. Gene targeting reveals a hierarchy of transcrip- tion factors regulating specification of lymphoid cell fates. Curr. Opin. Immunol. 8: 160–165. Sun, L., A. Liu, and K. Georgopoulos. 1996. Zinc finger-medi- ated protein interactions modulate Ikaros activity, a molecu- lar control of lymphocyte development. EMBO J. 15: 5358– Ting, C.N., M.C. Olson, K.P. Barton, and J.M. Leiden. 1996. Transcription factor GATA-3 is required for development of the T-cell lineage. Nature 384: 474–478. Tsai, S., S. Bartelmez, E. Sitnicka, and S. Collins. 1994. Lym- phohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid develop- ment. Genes & Dev. 8: 2831–2841. Wang, J., H. Walker, Q. Lin, N. Jenkins, N.G. Copeland, T. Watanabe, P.D. Burrows, and M.D. Cooper. 1996. The mouse BP-1 gene: Structure, chromosomal localization, and 796 GENES & DEVELOPMENT Errata Genes & Development 11: 3265–3276 (1997) The Xenopus Brachyury promoter is activated by FGF and low concentrations of activin and suppressed by high concentrations of activin and by paired-type homeodomain proteins Branko V. Latinkic ´ , Muriel Umbhauer, Kathy A. Neal, Walter Lerchner, James C. Smith, and Vincent Cunliffe The first author’s name was spelled incorrectly in this article. It is correct here. Genes & Development 12(6) March 15, 1998 The cover headline and caption for this issue were incorrect. The headline should read: Regulation of the cell division protein FtsZ in Caulobacter. The correct caption is printed below. Cover Caulobacter crescentus and the cell division initiation protein FtsZ through the cell cycle. Shown are electron micrographs of Caulobacter (top) and immunofluorescence analysis of FtsZ (bottom) at different stages through the cell cycle. The cell cycle initiates with a swarmer cell (left) that contains a single polar flagellum (wavy line), which differentiates into a stalked cell (third from left) by shedding the flagellum and synthesizing a stalk at the same pole. The predivisional cell (fourth from left) contains a single flagellum synthesized at the pole opposite the stalk. Cell division produces a swarmer cell and stalk cell (right). The replication-competent stalk cell contains FtsZ, whereas the replication-incompetent swarmer cell lacks FtsZ. (For details, see Kelly et al., p. 880.) Genes & Development 12: 782–796 (1998) Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, Karen E. Brown, Christopher A. Klug, Robert Lee, Koichi Akashi, Irving L. Weissman, Amanda G. Fisher, and Stephen T. Smale The name of Irving L. Weissman was spelled incorrectly in the Table of Contents of this issue. It is correct here. Genes & Development 12(7) The cover headline and caption for this issue were incorrect. The headline should read: Role of CBP in C. elegans embryonic differentiation The correct caption is printed below. Cover Expression and phenotypic analysis of CBP-1 in Caenorhabditis elegans. Shown are Nomarski images of wild-type (top left) and cbp-l mutant (top right) embryos. The mutant embryo produces many small cells and shows no evidence of mesodermal, endodermal, or hypodermal tissue organization. The small cells are reminiscent of neuronal cells, and immunostaining with antibodies against UNC-86, a neuronal differentiaton-specific protein, of wild-type (bottom left) and cbp-l (bottom right) reveals an increase in the number of neuronal precursors in mutant embryos. (For details, see Shi and Mello, p. 943). 1240 GENES & DEVELOPMENT 12:1240–1241 © 1998 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/98 $5.00; www.genesdev.org Erratum Genes & Development 12: 304–315 (1998) inscuteable and numb mediate asymmetric muscle progenitor cell divisions during Drosophila myogenesis Ana Carmena, Bernadette Murugasu-Oei, Devi Menon, Fernando Jime ´ nez, and William Chia Figure 6 of this article should have appeared in color. The correct figure and legend appear below. Figure 6. The fate of the progeny from P2, P15, and P17 progenitors in wild-type, P49 3 insc , and numb embryos. Embryos were double stained for Eve (red) and Kr (green). Stage 12 (A–F8) and stage 14 (G–I) P49 3 wild-type (A,G), insc (B–D,H), and nb (E–F8,I) embryos are shown. (A) Three con- secutive wild-type hemisegments at mid- to late-stage 12. At this stage, the two EPC + + (red) are already present. The Kr Eve FDA1 (yellow) and the Kr FDO1 (green) are P49 also evident. (B–D)In insc embryos, the incomplete expressivity of the mutant phe- notype is evident in different hemiseg- ments and is characterized by duplication of FDO1 (B), loss of the two EPC (C,*), and duplication of the FDA1 (D). (E–F8) The op- posite phenotype is found in nb embryos: Two FEPCs are detected at early stage 12, which are enlarging to divide (E), and no putative FDA1 and FDO1 are detected that express Eve and/or Kr. At mid-stage 12, extra EPCs are detected (F’). (F,F8) Two different focal planes of the same mutant hemisegment at mid-stage 12. (F) The FDA1 (yellow cells) is losing Eve and Kr expression; likewise, Kr expression is decaying in both siblings produced by division of P17 (arrows). (G) The P49 characteristic pattern of EPC and precursors of DA1 and DO1 in a wild-type embryo at stage 14. (H)Inan insc embryo, loss of EPC (*) and duplication of the precursors of muscles DA1 (yellow syncytia, arrows) and DO1 (green syncytia, arrows) are evident. (I) The opposite phenotype is observed in a nb embryo; extra EPCs and the absence of DA1 and DO1 muscle precursors. GENES & DEVELOPMENT 1241 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, et al. Genes Dev. 1998, 12: Errata for vol. 12, p. 782 Related Content Genes Dev. April , 1998 12: 1240 This article cites 40 articles, 18 of which can be accessed free at: References http://genesdev.cshlp.org/content/12/6/782.full.html#ref-list-1 Articles cited in: http://genesdev.cshlp.org/content/12/6/782.full.html#related-urls License Receive free email alerts when new articles cite this article - sign up in the box at the top Email Alerting right corner of the article or click here. Service Cold Spring Harbor Laboratory Press http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Genes & Development Unpaywall http://www.deepdyve.com/lp/unpaywall/helios-a-t-cell-restricted-ikaros-family-member-that-quantitatively-Xu0vTY5q3d

Loading next page...

References (41)

Harinder Singh (1996)
Gene targeting reveals a hierarchy of transcription factors regulating specification of lymphoid cell fates.
Current opinion in immunology, 8 2
S. Morrison, N. Uchida, N. Uchida, I. Weissman (1995)
The biology of hematopoietic stem cells.
Annual review of cell and developmental biology, 11
Katia Georgopoulos (1997)
Transcription factors required for lymphoid lineage commitment.
Current opinion in immunology, 9 2
C. Babichuk, B. Duggan, R. Bleackley (1996)
In Vivo Regulation of Murine Granzyme B Gene Transcription in Activated Primary T Cells*
The Journal of Biological Chemistry, 271
James Hagman, R. Grosschedl (1994)
Regulation of gene expression at early stages of B-cell differentiation.
Current opinion in immunology, 6 2
S. Winandy, P. Wu, K. Georgopoulos (1995)
A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma
Cell, 83
K. Georgopoulos, S. Winandy, N. Avitahl (1997)
The role of the Ikaros gene in lymphocyte development and homeostasis.
Annual review of immunology, 15
C. Ting, M. Olson, K. Barton, J. Leiden (1996)
Transcription factor GATA-3 is required for development of the T-cell lineage
Nature, 384
S. Tsai, S. Bartelmez, E. Sitnicka, S. Collins (1994)
Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid development.
Genes & development, 8 23
K. Hahm, P. Ernst, K. Lo, G. Kim, C. Turck, S. Smale (1994)
The lymphoid transcription factor LyF-1 is encoded by specific, alternatively spliced mRNAs derived from the Ikaros gene.
Molecular and cellular biology, 14 11
Christopher Klug, Sean Morrison, Sean Morrison, Marilyn Masek, K. Hahm, Stephen Smale, Irving Weissman (1998)
Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes.
Proceedings of the National Academy of Sciences of the United States of America, 95 2
K. Brown, S. Guest, S. Smale, K. Hahm, M. Merkenschlager, A. Fisher (1997)
Association of Transcriptionally Silent Genes with Ikaros Complexes at Centromeric Heterochromatin
Cell, 91
E. Harlow, David Lane (1988)
Antibodies: A Laboratory Manual
J. Davis, M. Roussel (1996)
Cloning and expression of the murine Elf-1 cDNA.
Gene, 171 2
T. Groves, P. Katis, Z. Madden, K. Manickam, D. Ramsden, Gillian Wu, C Guidos (1995)
In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement.
Journal of immunology, 154 10
D. Willerford, W. Swat, F. Alt (1996)
Developmental regulation of V(D)J recombination and lymphocyte differentiation.
Current opinion in genetics & development, 6 5
S. Omori, R. Wall (1993)
Multiple motifs regulate the B-cell-specific promoter of the B29 gene.
Proceedings of the National Academy of Sciences of the United States of America, 90 24
F. Haag, G. Kuhlenbäumer, F. Koch-Nolte, E. Wingender, H. Thiele (1996)
Structure of the gene encoding the rat T cell ecto-ADP-ribosyltransferase RT6.
Journal of immunology, 157 5
K. Ikuta, N. Uchida, J. Friedman, I. Weissman (1992)
Lymphocyte development from stem cells.
Annual review of immunology, 10
S. Santee, L. Owen-Schaub (1996)
Human Tumor Necrosis Factor Receptor p75/80 (CD120b) Gene Structure and Promoter Characterization*
The Journal of Biological Chemistry, 271
Á. Molnár, P. Wu, David Largespada, A. Vortkamp, Steve Scherer, N. Copeland, N. Jenkins, G. Bruns, K. Georgopoulos (1996)
The Ikaros gene encodes a family of lymphocyte-restricted zinc finger DNA binding proteins, highly conserved in human and mouse.
Journal of immunology, 156 2
B. Morgan, Lei Sun, N. Avitahl, K. Andrikopoulos, T. Ikeda, Ellen Gonzales, P. Wu, S. Neben, K. Georgopoulos (1997)
Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation
The EMBO Journal, 16
Jin-hong Wang, A. Nichogiannopoulou, Li Wu, Lei Sun, A. Sharpe, M. Bigby, K. Georgopoulos (1996)
Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation.
Immunity, 5 6
H. Clevers, M. Oosterwegel, K. Georgopoulos (1993)
Transcription factors in early T-cell development.
Immunology today, 14 12
C. Zhang, M. Bienz (1992)
Segmental determination in Drosophila conferred by hunchback (hb), a repressor of the homeotic gene Ultrabithorax (Ubx).
Proceedings of the National Academy of Sciences of the United States of America, 89
Patricia Ernst, K. Hahm, Le Trinh, J. Davis, Martine Roussel, Christoph Turck, Stephen Smale (1996)
A potential role for Elf-1 in terminal transferase gene regulation
Molecular and Cellular Biology, 16
P. Ernst, K. Hahm, S. Smale (1993)
Both LyF-1 and an Ets protein interact with a critical promoter element in the murine terminal transferase gene
Molecular and Cellular Biology, 13
P. Zweidler-McKay, H. Grimes, M. Flubacher, P. Tsichlis (1996)
Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor
Molecular and Cellular Biology, 16
K. Georgopoulos, D. Moore, B. Derfler (1992)
Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment.
Science, 258 5083
A. Wargnier, S. Legros-Maida, R. Bosselut, J. Bourge, C. Lafaurie, C. Ghysdael, M. Sasportes, P. Paul (1995)
Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.
Proceedings of the National Academy of Sciences of the United States of America, 92 15
K. Lo, N. Landau, S. Smale (1991)
LyF-1, a transcriptional regulator that interacts with a novel class of promoters for lymphocyte-specific genes
Molecular and Cellular Biology, 11
Á. Molnár, K. Georgopoulos (1994)
The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins
Molecular and Cellular Biology, 14
Hans Clevers, R. Grosschedl (1996)
Transcriptional control of lymphoid development: lessons from gene targeting.
Immunology today, 17 7
K. Georgopoulos, M. Bigby, Jin-hong Wang, Á. Molnár, P. Wu, S. Winandy, A. Sharpe (1994)
The ikaros gene is required for the development of all lymphoid lineages
Cell, 79
J. Fernandez, L. Andrews, S. Mische (1994)
An improved procedure for enzymatic digestion of polyvinylidene difluoride-bound proteins for internal sequence analysis.
Analytical biochemistry, 218 1
Lei Sun, A. Liu, K. Georgopoulos (1996)
Zinc finger‐mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development.
The EMBO Journal, 15
Stuart Orkin (1995)
Hematopoiesis: how does it happen?
Current opinion in cell biology, 7 6
J. Wang, H. Walker, Q. Lin, N. Jenkins, N. Copeland, T. Watanabe, P. Burrows, M. Cooper (1996)
The mouse BP-1 gene: structure, chromosomal localization, and regulation of expression by type I interferons and interleukin-7.
Genomics, 33 2
Patricia Ernst, Stephen Smale (1995)
Combinatorial regulation of transcription II: The immunoglobulin mu heavy chain gene.
Immunity, 2 5
S. Poux, C. Kostic, V. Pirrotta (1996)
Hunchback‐independent silencing of late Ubx enhancers by a Polycomb Group Response Element.
The EMBO Journal, 15
K. Shortman, Li Wu (1996)
Early T lymphocyte progenitors.
Annual review of immunology, 14

Publisher: Unpaywall
ISSN: 0890-9369
DOI: 10.1101/gad.12.6.782
Publisher site: See Article on Publisher Site

Abstract

Downloaded from Downloaded from Downloaded from Downloaded from genesdev.cshlp.org genesdev.cshlp.org genesdev.cshlp.org genesdev.cshlp.org on November 18, 2021 - Published by on November 18, 2021 - Published by on November 18, 2021 - Published by on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin 1,5 1 1 2 3,4 Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, Karen E. Brown, Christopher A. Klug, 1 3 3 2 1,6 Robert Lee, Koichi Akashi, Irving L. Weissman, Amanda G. Fisher, and Stephen T. Smale Howard Hughes Medical Institute, Molecular Biology Institute, and Department of Microbiology and Immunology, UCLA School of Medicine, Los Angeles, California 90095-1662 USA; Lymphocyte Development Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, London, W12 ONN UK; Departments of Pathology and Developmental Biology, Stanford University School of Medicine, Stanford, California 94305-5428 USA; Department of Microbiology, University of Alabama, Birmingham, Alabama 35294 USA The Ikaros gene encodes multiple protein isoforms that contribute critical functions during the development of lymphocytes and other hematopoietic cell types. The intracellular functions of Ikaros are not known, although recent studies have shown that Ikaros proteins colocalize with inactive genes and centromeric heterochromatin. In this study, Ikaros proteins were found to be components of highly stable complexes. The complexes from an immature T cell line were purified, revealing associated proteins of 70 and 30 kD. The p70 gene, named Helios, encodes two protein isoforms with zinc finger domains exhibiting considerable homology to those within Ikaros proteins. Helios and Ikaros recognize similar DNA sequences and, when overexpressed, Helios associates indiscriminately with the various Ikaros isoforms. Although Ikaros is present in most hematopoietic cells, Helios was found primarily in T cells. The relevance of the Ikaros–Helios interaction in T cells is supported by the quantitative association of Helios with a fraction of the Ikaros. Interestingly, the Ikaros–Helios complexes localize to the centromeric regions of T cell nuclei, similar to the Ikaros localization previously observed in B cells. Unlike the B cell results, however, only a fraction of the Ikaros, presumably the fraction associated with Helios, exhibited centromeric localization in T cells. These results establish immunoaffinity chromatography as a useful method for identifying Ikaros partners and suggest that Helios is a limiting regulatory subunit for Ikaros within centromeric heterochromatin. [Key Words: Ikaros; Helios; T lymphocyte; lymphocyte development; heterochromatin] Received December 8, 1997; revised version accepted January 22, 1998. The molecular mechanisms by which B and T lympho- (Ikuda et al. 1992; Morrison et al. 1995; Orkin 1995; cytes are generated from hematopoietic stem cells have Singh 1996; Georgopoulos et al. 1997). been the subject of intensive investigation. By analysis of In recent years, insight into the early regulatory events the immunoglobulin and T cell receptor (TCR) gene re- has been provided by the phenotypes of mice containing combination events and the differential expression of homozygous disruptions of genes encoding sequence- specific DNA-binding proteins (Orkin 1995; Clevers and lymphocyte-specific genes, much has been learned about the regulation of B and T cell maturation (Clevers et al. Grosschedl 1996; Singh 1996; Ting et al. 1996; Georgo- 1993; Hagman and Grosschedl 1994; Ernst and Smale poulos et al. 1997). PU.1, Ikaros, E2A, EBF, BSAP, and 1995; Clevers and Grosschedl 1996; Shortman and Wu GATA-3 are among the proteins that are critical for early 1996; Willerford et al. 1996). In contrast, little is known lymphocyte development. Most of these proteins act as about the earliest stages of lymphocyte development, in- typical transcription factors, which bind to regulatory cluding commitment to the lymphocyte lineages and the elements within specific target genes and direct gene ac- maturation events that precede gene recombination tivation. Ikaros is unusual among the above DNA-binding pro- teins as none of its targets has been clearly established Present address: Howard Hughes Medical Institute, Children’s Hospital, and its intracellular functions remain unknown. The Harvard Medical School, Boston, Massachusetts 02115 USA. Ikaros gene was first identified through an expression Corresponding author. E-MAIL [email protected]; FAX (310) 206-8623. library screen for proteins that interact with an enhancer 782 GENES & DEVELOPMENT 12:782–796 © 1998 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/98 $5.00; www.genesdev.org Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes for the TCR CD3d gene (Georgopoulos et al. 1992). The within the TdT promoter is critical for promoter activity gene was later found to encode the LyF-1 protein that in immature lymphocytes (Lo et al. 1991). Ets family interacts with a critical control element in the promoter proteins also bind this site however, and several findings for the lymphocyte-specific terminal transferase (TdT) suggest that the Ets protein Elf-1 is the functional acti- gene (Lo et al. 1991; Hahm et al. 1994). Primary Ikaros vator of TdT transcription (Ernst et al. 1993, 1996). Ika- transcripts undergo alternative pre-mRNA splicing to ros and Elf-1 cannot bind simultaneously to this element (K. Hahm, L. Trinh, P. Ernst, and S.T. Smale, in prep.), generate several protein isoforms. The isoforms vary within an amino-terminal zinc finger domain that is re- suggesting that if Ikaros contributes to TdT promoter sponsible for sequence-specific DNA binding (Hahm et activity, it does so as a repressor or competitive inhibitor al. 1994; Molnar and Georgopoulos 1994; Molnar et al. of the Elf-1 activator. 1996; Sun et al. 1996). The largest Ikaros isoform (iso- Recent studies of subnuclear localization in B cells form VI; Ik-1) contains four zinc fingers near the amino have provided further evidence that Ikaros may not be a terminus, whereas the smaller isoforms contain fewer or simple transcriptional activator, as it was found by im- no amino-terminal zinc fingers. All isoforms contain munogold electron microscopy and confocal microscopy two additional zinc finger motifs at their carboxyl ter- to localize to heterochromatin (Brown et al. 1997; Klug minus, which do not bind DNA (Hahm et al. 1994), but et al. 1998). More specifically, by combining fluores- serve as protein–protein interaction domains (Sun et al. cence in situ hybridization with confocal immunofluo- 1996). Given the apparent indiscriminate nature of the rescence assays, Ikaros colocalized with centromeric protein–protein interactions, a large number of dimeric heterochromatin and with inactive genes, which them- or multimeric species can be generated. Recently, a pro- selves migrate to foci of centromeric heterochromatin tein related to Ikaros was identifed by degenerate PCR (Brown et al. 1997). with primers complementary to sequences encoding the The centromeric localization of Ikaros makes an un- carboxy-terminal zinc fingers (Morgan et al. 1997). This derstanding of its precise intracellular functions difficult protein, Aiolos, exhibits considerable homology to Ika- to establish. The ability of the many Ikaros isoforms to ros and interacts with Ikaros through its carboxy-termi- associate with one another indiscriminately into a large nal fingers (Morgan et al. 1997). number of dimeric or multimeric species adds further Ikaros isoforms are expressed in most cells of the he- complexity, as each species may carry out a distinct matopoietic lineages, including multipotent stem cells function. Finally, the complicated phenotypes of the Ika- −/− (Georgopoulos et al. 1992; Hahm et al. 1994; Molnar and ros mice suggest that Ikaros proteins may carry out Georgopoulos 1994; Morgan et al. 1997; Klug et al. 1998). different functions in the different hematopoietic cell Many cell types express the two largest isoforms (V and lineages, perhaps in association with lineage-restricted VI), but isoform expression patterns vary to some extent partners. As an essential step toward an understanding of in a cell-specific manner. Aiolos is expressed in most of these issues, we performed a biochemical analysis of the the cell types that express Ikaros, except the earliest he- native Ikaros proteins. This analysis revealed that Ikaros matopoietic progenitors (Morgan et al. 1997). Gene dis- proteins form highly stable complexes that can be puri- ruption experiments have demonstrated that the Ikaros fied to near homogeneity by immunoaffinity chromatog- proteins are critical for multiple hematopoietic events raphy, providing a means of isolating Ikaros partners in (Georgopoulos et al. 1994; Winandy et al. 1995; Wang et various cell types. The Ikaros complexes purified from −/− al. 1996). The most striking defect in Ikaros mice is an immature T cell line contain an Ikaros-associated pro- the absence of B cells, natural killer cells, and some T tein, Helios, which possesses a zinc finger structure lineage cells, including fetal-derived T cells and some gd similar to that found in Ikaros. The restricted expression −/− T cells (Wang et al. 1996). Ikaros mice also exhibit a pattern of Helios, its presence at limiting quantities, its biased distribution and expansion of CD4 T cells and quantitative association with Ikaros, its assembly into a defects in other hematopoietic lineages (Wang et al. relatively homogeneous complex, and its specific local- 1996). A second Ikaros gene disruption, which elimi- ization to centromeres suggest that it functions as a criti- nates the DNA-binding domain, but allows expression of cal regulator of Ikaros within the centromeric hetero- smaller isoforms, results in a more severe lymphopoietic chromatin regions of the nucleus. defect; these mice contain no B or T lymphocytes or any of the known B or T cell progenitors (Georgopoulos et al. 1994). Heterozygotes of these mice contain normal lym- Results phocyte phenotypes and numbers at birth, but rapidly Expression of Ikaros isoforms by RLm11 and VL3-3M2 develop lymphoproliferative disorders (Winandy et al. T cells 1995). Ikaros-binding sites have been identified in the pro- For most of the studies described in this report, a murine moters or enhancers of several genes (Lo et al. 1991; radiation-induced thymoma cell line, RLm11, was em- Georgopoulos et al. 1992; Omori and Wall 1993; Warg- ployed. This cell line produces large quantities of TdT nier et al. 1995; Babichuk et al. 1996; Haag et al. 1996; mRNA and protein and has been used for several years to Santee and Owen-Schaub 1996; Wang et al. 1996), but study the transcriptional regulation of the TdT gene, a none of these genes has been shown to be an authentic potential Ikaros target (Lo et al. 1991; Ernst et al. 1993, Ikaros target. A well-characterized binding site for Ikaros 1996; Hahm et al. 1994). Immunoblot and RT-PCR GENES & DEVELOPMENT 783 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. analyses have demonstrated that RLm11 cells actively ments with independent extract preparations and with express 4 of the 10 Ikaros isoforms (see Fig. 1, isoforms I, column buffers at 0.1 and 0.45 M KCl, both in the pres- III, V, and VI; Hahm et al. 1994; Molnar and Georgopou- ence and absence of NP-40 detergent (data not shown). los 1994; Sun et al. 1996). All four of these isoforms have The above results raise the possibility that Ikaros pro- been detected in populations of primary immature lym- teins form an array of multimeric complexes. The results phocytes (Molnar and Georgopoulos 1994; Molnar et al. of other biochemical experiments are consistent with 1996; Klug et al. 1998). the multimer hypothesis, but some results have sug- For some experiments, another T cell line, VL3-3M2, gested that the proteins exist as highly stable dimers was used (Groves et al. 1995). This cell line expresses (A.S. McCarty, K. Hahm, R. Lee, B.S. Cobb, unpubl.). large quantities of the TdT, RAG-1, and RAG-2 mRNAs Further experiments will be needed to clarify the precise + + and exhibits properties of double-positive CD4 CD8 stoichiometry of the Ikaros complexes, but for the pur- cells (Groves et al. 1995). VL3-3M2 cells produce prima- poses of this study, the relevant findings are: (1) Ikaros rily two Ikaros isoforms, V and VI (see Fig. 8, below), the proteins appear to exist as stable dimeric or multimer two most abundant isoforms detected in primary thymo- complexes in solution, and (2) the unusually broad elu- cytes (data not shown; Molnar and Georgopoulos 1994). tion profile suggests that a given cell contains a large number of distinct complexes. This latter suggestion is consistent with previous studies in which the carboxy- Ikaros isoforms coelute in a broad peak from gel terminal zinc finger domains of Ikaros were found to fitration columns promote indiscriminate protein–protein interactions be- tween Ikaros isoforms (Sun et al. 1996; K. Hahm, un- Gel filtration chromatography was used to study the publ.). properties of the Ikaros proteins within RLm11 nuclear extracts. Immunoblot analysis of column fractions col- lected from a Superdex 200 FPLC column (Pharmacia) Purification of Ikaros complexes revealed that all four isoforms coelute in a broad peak To elucidate the intracellular functions of a protein, a between the excluded volume (exclusion limit, 1.3 × 10 critical objective is to identify other proteins with which kD) and a 232-kD molecular mass marker (Fig. 1, lanes it carries out relevant interactions. The biochemical 3–8). In contrast, Elf-1, with a calculated molecular mass properties summarized above and the complicated phe- of 76 kD (Davis and Roussel 1996), eluted in a sharp peak −/− notypes of the Ikaros mice raise the possibility that at ~200 kD (Fig. 1A, lanes 8–10). When using a gel filtra- the Ikaros isoforms stably associate with proteins that tion column with a larger exclusion limit, the four Ikaros have not been identified. Because of the apparent stabil- isoforms again coeluted with each other in a broad peak ity of the complexes, purification by immunoaffinity between 750 and 200 kD (data not shown; see Fig. 9, chromatography was an attractive method for identify- below). Similar results were obtained in several experi- ing relevant Ikaros-associated proteins. Polyclonal anti- bodies directed against the carboxy-terminal half of Ika- ros were initially used for the purification. RLm11 nuclear extracts in a buffer containing 0.45 M KCl were applied to a protein A–Sepharose column containing co- valently linked antibodies (see Materials and Methods). The column was washed extensively with 0.45 and 1 M KCl and, in some experiments, with 0 M KCl to disrupt nonspecific hydrophobic interactions. Tightly bound proteins were eluted with a buffer containing 100 mM trimethyl ethanolamine (pH 11.0). Analysis of the eluted proteins by SDS-PAGE followed by silver staining re- vealed six bands that were consistently observed at com- parable molar amounts (Fig. 2A, lanes 3–6). Four of these bands correspond to Ikaros isoforms I, III, V, and VI, based on immunoblot analysis with Ikaros antibodies (lane 7). The other two bands, which migrate at 30 and 70 kD (p30 and p70, respectively), did not interact with the Figure 1. Coelution of Ikaros isoforms in a broad peak from gel Ikaros antibodies by immunoblot analysis. These pro- filtration columns. RLm11 nuclear extracts (1 mg) were ana- teins also did not cross-react with three Ikaros antisera lyzed by Superdex 200 (Pharmacia) gel filtration chromatogra- raised against other domains of the Ikaros isoforms (data phy. Five micrograms of nuclear extract (lane 1) and 45 μl of not shown). These results suggest that p30 and p70 every other column fraction (lanes 2–13) were separated by SDS- bound to the column through specific interactions with PAGE and analyzed by immunoblotting, with antiserum di- Ikaros proteins. rected against Ikaros and Elf-1. The fractions in which standard Although denatured p30 and p70 did not interact with molecular mass markers elute are indicated by arrows at the the Ikaros antibodies by immunoblot analysis, it re- top, and the bands corresponding to Elf-1 and Ikaros isoforms I, III, V, and VI are (left). mained possible that they copurified with Ikaros because 784 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes and p30 proteins bound to this resin as efficiently as to the carboxy-terminal antibody resin. In contrast, an im- munoaffinity resin containing an unrelated antibody preparation of similar titer, directed against murine Elf- 1, did not yield detectable proteins of 30 and 70 kD (Fig. 2B, lane 2). As a final control, Ikaros was purified by DNA-affinity chromatography with a resin containing covalently linked multimers of the TdT D element, which com- prises an Ikaros-binding site (Lo et al. 1991). The DNA- affinity chromatography procedure was an improved ver- sion of the procedure used previously to purify and clone Ikaros (Hahm et al. 1994). In the previous experiments, only a single 65-kD band was observed. This band con- tained a mixture of Ikaros isoform VI and YY1, which also binds to a sequence within the D element (see Hahm et al. 1994). In the new experiment, which dimin- ished YY1 copurification, Ikaros isoforms III, V, VI, and the p70 protein, were readily detected (Fig. 2B, lane 5). Ikaros isoform I and p30 were less apparent and possibly less abundant, but were detected in some experiments (data not shown). Isolation of Helios To isolate the gene encoding p70, the immunoaffinity purification procedure was carried out with large quan- tities of RLm11 extract (see Materials and Methods). The purified fractions were then concentrated and the pro- Figure 2. Immunoaffinity purification of Ikaros complexes teins separated on a preparative SDS–polyacrylamide gel. from RLm11 nuclear extracts. (A) RLm11 nuclear extracts were After transferring to a PVDF membrane, the p70 band applied to a protein A–Sepharose column containing covalently was excised, proteolyzed with endopeptidase C, and se- linked antibodies directed against the carboxy-terminal half of quences of two peptides were obtained (Fernandez et al. Ikaros (see Materials and Methods). After washing the resin 1994). The peptide sequences (see Fig. 3) were unrelated with buffers containing 0.45 and 1 M KCl, bound proteins were to proteins or genes described in various databases (data eluted with 100 mM trimethyl ethanolamine (pH 11.0). The tri- not shown). methyl ethanolamine fractions (numbers 2 through 6, lanes 2–6) Degenerate oligonucleotides were used to isolate a were analyzed by SDS-PAGE followed by silver staining. Mo- lecular mass markers are shown in lane 1 and are indicated to 216-bp fragment of the p70 gene by RT-PCR from the left. Fraction 3 was also analyzed by immunoblotting with RLm11 mRNA. A full-length cDNA was then isolated anti-Ikaros serum (lane 7). Ikaros isoforms I, III, V, and VI are from a library prepared from newborn mouse thymus indicated between lanes 6 and 7. Two proteins, p30 and p70, mRNA (Stratagene). Subsequent studies revealed two were detected by silver staining that did not interact with the distinct cDNA products, p70A and p70B, that presum- Ikaros antibodies. (B) RLm11 extracts were applied to protein ably are generated by alternative pre-mRNA splicing. A–Sepharose columns containing covalently linked antibodies RT-PCR analysis of RLm11 mRNA revealed that the two directed against Elf-1 (lane 2), the carboxyl-terminus of Ikaros RNA products are present at comparable amounts (data (lane 3), or the amino-terminus of Ikaros (lane 4). The columns not shown). were washed and proteins eluted as described above. Portions of DNA sequencing of the p70A and p70B cDNAs re- the trimethyl ethanolamine eluates were analyzed by SDS- PAGE followed by silver-staining. Also analyzed were proteins vealed 1500- and 1578-bp ORFs, respectively, encoding purified by sequence-specific DNA-affinity chromatography proteins of 55 and 58 kD (Fig. 3). The proteins contain with a resin containing covalently linked multimers of the TdT domains with considerable homology to domains within D element (lane 5, see Materials and Methods and Hahm et al. Ikaros. Because of this homology, we named the p70 1994). Molecular mass markers are shown in lane 1 and are gene Helios. The small sizes of the Helios proteins rela- indicated at left in kD. Ikaros isoforms I, III, V, and VI, p70, and tive to their apparent molecular masses based on SDS- p30, are indicated at right. PAGE are consistent with the properties of the Ikaros proteins; the calculated molecular mass of Ikaros iso- they were recognized in their native conformations by form VI, for example, is 57 kD, whereas its apparent the antibodies. To address this possibility, immunoaffin- molecular mass by SDS-PAGE is 65 kD. The most strik- ity chromatography was performed with a resin contain- ing homology between Helios and Ikaros is within the ing an antibody preparation directed against an amino- amino- and carboxy-terminal zinc finger domains. He- terminal domain of Ikaros (Fig. 2B, lanes 3,4). The p70 lios A (which lacks the lower-case amino acids in Fig. 3) GENES & DEVELOPMENT 785 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Figure 3. Helios A and Helios B contain zinc fin- gers with homology to those in Ikaros and Aiolos. An amino acid sequence alignment compiled by use of the PILEUP program is shown. Compared are the largest isoforms of the Ikaros family members, Helios B, Ikaros isoform VI (Ik-1), and Aiolos. Low- ercase lettering in the Helios B sequence designates the sole difference between Helios B and Helios A. Amino acid sequences obtained by microsequenc- ing of purified Helios protein are indicated by a line above the Helios sequence. Shaded boxes in blue emphasize the highly conserved zinc finger motifs. Yellow bars indicate the conserved cysteines and histidines in the zinc fingers. The red box indicates the unusual cysteine in the apparent C HC finger. Overall sequence similarities are as follows: Helios B–Ikaros, 55%; Ikaros–Aiolos, 53%; Helios B–Aio- los, 50%. The four amino-terminal zinc fingers of Helios share 94% identity with the Ikaros fingers and the Aiolos fingers share 86% identity with the Ikaros fingers. The two carboxy-terminal zinc fin- gers of Helios share 85% identity with the corre- sponding Ikaros fingers, with 80% identity between the Aiolos and Ikaros fingers. The Helios cDNA and amino acid sequences have been deposited in the GenBank/Swiss Prot databases (accession nos. AF044257 and P81183, respectively). contains two C H zinc fingers (yellow) and one C HC homologous to Ikaros, called Aiolos, was isolated from a 2 2 2 zinc finger (red) near its amino terminus, similar to Ika- cDNA library by PCR with degenerate primers directed ros isoform V. Helios B (which contains the lower-case against the carboxy-terminal zinc-finger domain of Ika- amino acids in Fig. 3) contains three C H zinc fingers ros (Morgan et al. 1997). The Ikaros, Aiolos, and Helios 2 2 and one C HC zinc finger near its amino terminus, simi- zinc finger domains are highly homologous to each other lar to Ikaros isoform VI. Both Helios isoforms, like all of (Fig. 3). The stretches of Ikaros–Helios homology sur- the Ikaros isoforms, contain two carboxy-terminal zinc rounding the zinc finger domains are also homologous to Aiolos (e.g., amino acids 282–295 and 312–362). finger motifs (yellow). The Helios and Ikaros zinc finger domains are highly homologous at the amino acid level. The isolated Helios gene appears to encode the protein Surrounding the two zinc finger domains, a few short purified by immunoaffinity chromatography on the basis stretches of identity and similarity between Helios and of two criteria: First, both peptide sequences obtained Ikaros are apparent, but most of the Helios sequence ex- from the purified protein are encoded by the Helios gene hibits little homology to Ikaros. (Fig. 3, overlined). Second, immunoblot analysis of the Recently, another protein with zinc finger domains purified protein with antibodies generated against the 786 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes amino-terminal 109 amino acids of Helios, reacted Ikaros isoforms with similar efficiencies (on the basis of strongly with a protein of the expected size (Fig. 4A). a comparison on the relative protein amounts before and after immunoprecipitation). The carboxy-terminal zinc fingers are likely to be responsible for the interactions, Specific, indiscriminate protein–protein interactions given the strong homology between the Ikaros and He- between Helios and Ikaros isoforms lios domains. The above data suggest that Helios copurifies with Ika- ros by immunoaffinity chromatography because the two DNA-binding-site specificity of Helios A proteins are tightly associated with each other in RLm11 cells. To confirm that recombinant Helios can interact The above results suggest that intracellular complexes with recombinant Ikaros isoforms, an expression vector exist containing a combination of Helios and Ikaros pro- for Helios A containing a FLAG epitope tag was cotrans- teins. Helios complexes may also exist without Ikaros fected into 293T cells along with expression vectors for components, and Ikaros complexes may exist without Ikaros isoforms I, V, and/or VI. Interactions were moni- Helios components. Perhaps, the various complexes tored by immunoprecipitation with anti-FLAG antibod- carry out different functions by recognizing different ies, followed by immunoblot analysis with either Ikaros DNA sequences. To determine the DNA sequence speci- or Helios antibodies. Figure 4B shows the Helios A and ficity of Helios A, a binding-site selection–PCR ampifi- Ikaros proteins in 293T cytoplasmic and nuclear extracts cation strategy was employed with a fusion protein con- prior to immunoprecipitation. (Ikaros and Helios anti- taining the Helios A DNA-binding domain and GST bodies were added to the immunoblot to visualize the (Zweidler-McKay et al. 1996; see Materials and Meth- products of both genes, but the relative amounts of the ods). Ikaros and Helios gene products cannot be determined The selected clones revealed potential recognition se- from these data.) Epitope-tagged Helios A localized to quences that can be divided into two groups (Fig. 5A). the nucleus and migrated slightly slower than Ikaros iso- The first group, containing 19 sequences, was character- form VI (e.g., Fig. 4B, lane 14), agreeing with the migra- ized by the core sequence GGGA. The second group, tion pattern of Helios observed in the purified com- containing 30 sequences, was characterized by the core plexes. Immunoprecipitation with FLAG antibodies (Fig. sequence GGAAAA. A simple interpretation of these 4C) revealed that FLAG–Helios A interacts with all three data is that the core sequence GGA is generally suffi- Figure 4. Indiscriminate interactions between Helios A and Ikaros isoforms in 293T cells. (A) The Helios protein within an RLm11 extract (lane 1) and the immunoaffinity purified Ikaros complex (lane 2) can be detected by immunoblot analysis with antisera directed against recombinant Helios (amino acids 1–109). Molecular mass markers are indicated at right, and the location of the Helios band is indicated at left. (B) 293T cells were transfected with 10 or 15 μg of expression plasmids for various Ikaros isoforms (lanes 1–18; specific isoforms indicated above each lane), in the absence (lanes 1,2) or presence (lanes 3–18) of an expression plasmid for FLAG- tagged Helios A (5 μg). Cytoplasmic (odd-numbered lanes) and nuclear (even numbered lanes) extracts from the transfected cells were analyzed by immunoblotting with antibodies directed against both Helios and Ikaros. The bands corresponding to FLAG-tagged Helios A and Ikaros isoforms I, V, and VI are indicated to the left. (C) Interactions between Helios A and Ikaros isoforms were assessed by immunoprecipitation from the nuclear extracts shown in part B with a monoclonal antibody directed against the FLAG epitope. Proteins within the immunoprecipitated pellet were analyzed by immunoblotting with antisera directed against Helios (top) or Ikaros (bottom). The extacts used for immunoprecipitation contained (lanes 3–10) or lacked (lanes 1,2) the FLAG–Helios A protein and zero, one, two, or three Ikaros isoforms (isoforms indicated above each lane). The locations of the bands corresponding to FLAG–Helios A and Ikaros isoforms I, V, and VI are indicated to the right. GENES & DEVELOPMENT 787 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Figure 5. Helios A and Ikaros isoform V bind to similar DNA sequences. (A) High-affinity Helios A-binding sites were selected by a GST pull-down assay (Zweidler-McKay et al. 1996). DNA fragments selected by the GST–Helios A fusion protein were sequenced and tabulated. The selected sequences can be divided into two groups, both containing a core sequence of GGA. Group 1 was represented by 19 sequences and Group 2, by 30 sequences. The number of fragments containing each nucleotide at a given position following alignment are indicated for each group. Only 14 sequences are shown for the first four positions of the Group 2 sequence because the remaining 16 were derived from fragments in which these four positions were contained within the invariant primer-binding sites flanking the variable sequences. (B) Gel mobility shift assays were performed with recombinant GST–Ikaros isoform V (lanes 1–6) and recombinant Helios A (lanes 7–12) with probes containing the five sequences shown at the bottom (lanes 2–6, 8–12) and a negative control probe (lanes 1,7). The specific probes were derived from the pSP72 (Promega) multiple cloning site region (lanes 1,7), the TdT D (lanes 2,8) and D8 (lanes 3,9) elements, the Hs BS1 (i.e., Helios binding site 1; lanes 4,10) and Hs BS2 (lanes 5,11) sequences selected in this study, and the IkBS2 (lanes 6,12) sequence selected previously (Molnar and Georgopoulos 1994). cient for high-affinity DNA binding if it is flanked by a lines and murine tissues. Surprisingly, Helios mRNA guanine at the 58 end or by three adenines at the 38 end. was largely restricted to the T cell lineage. Four major The first group is very similar to a previously described transcripts were readily detected in three of four T cell consensus sequence for Ikaros isoform V (Molnar and lines tested (Fig. 6A, lanes 3–6) and in a cell line contain- Georgopoulos 1994), which is the most homologous to ing early progenitors of multiple hematopoietic lineages Helios A. The second group did not match the Ikaros (lane 2; Tsai et al. 1994). No expression was observed in consensus sequence. B lineage cell lines (lanes 7–9) or in fibroblast (lane 1) or To determine whether the two groups of Helios A con- macrophage (lane 10) lines. In contrast, the Ikaros gene sensus sequences provide a functional distinction be- was expressed at high levels in all three B cell lines and tween Ikaros and Helios, gel mobility shift assays were at lower levels in the macrophage line (data not shown). performed with a probe representative of the first group Consistent with the expression pattern in the cell lines, (Fig. 5B, lanes 6,12; Ik BS2; Molnar and Georgopoulos abundant Helios transcripts were detected in the thymus 1994), a probe representative of the second group (lanes (lane 16), with very little expression in the bone marrow 5,11; Hs BS2), and a probe containing a sequence that (lane 17) and brain (lane 11), and no detectable expression conforms to both groups (lanes 4,10; Hs BS1). A negative in spleen, liver, kidney, or muscle (lanes 12–15). By con- control was also included (lanes 1,7), along with probes trast, Ikaros transcripts were readily detected in both the containing two TdT promoter elements that are known spleen and thymus (Georgopoulos et al. 1992; data not to bind Ikaros (lanes 2,3,8,9). The results demonstrate shown). The reason for the existence of transcripts of that Ikaros isoform V and Helios A possess very similar different sizes has not been explored, but all four tran- sequence specificities, as the relative complex abun- scripts were detected when the blots were probed with dances observed with each probe were very similar for gene fragments encoding amino acids 221–292 (Fig. 6A) the two proteins. Thus, if Ikaros–Helios complexes carry or amino acids 1–109 (data not shown). out different functions from either Ikaros–Ikaros or He- Immunoblot experiments provided evidence that the lios–Helios complexes, they are likely to do so as a result Helios protein is restricted to the T cell lineage (Fig. 6B). of other functional differences between Helios and Ikaros. The expected 70-kD band was observed in four different T cell lines (Fig. 6B, lanes 2–6), but not in 5 cell lines of the B lineage (lanes 7–11) or in erythroid (lane 12), mac- T cell-restricted expression pattern of Helios rophage (lane 13), or fibroblast (lane 14) lines. The T cell- To determine the expression pattern of Helios, Northern restricted expression pattern of Helios is in striking con- blots were carried out with mRNA from transformed cell trast to the expression pattern of the Ikaros proteins, 788 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes Figure 6. Helios expression is largely re- stricted in T cells. (A) Northern blot analy- sis was used to measure Helios mRNA ex- pression in murine hematopoietic cell lines and tissues. Cell lines and tissues analyzed are indicated at the top. Twenty micrograms of total RNAs was analyzed in each lane. Nitrocellulose membranes were hybridized sequentially with a Helios probe (fragment encoding amino acids 221–292, top) and a human b-actin probe (500 bp, bottom). Positions of the 28S and 18S rRNAs are indicated. Actin transcripts and four major transcripts detected by He- lios probe are indicated. (B) Helios protein in murine cell lines was analyzed by im- munoblotting. Cell lines analyzed are in- dicated at the top. Twenty micrograms of protein from nuclear extracts estimated by Coomassie Assay (Pierce) were loaded in each lane. (p70) Protein migrating close to 70 kD and detected with anti-Helios se- rum. (C) The nuclear extracts analyzed in B were probes with antibodies directed against the carboxy-terminal half of Ika- ros. which were present in all of the hematopoietic cell lines plified in four of five samples of triple-negative cells (Fig. (Fig. 6C). 7, lanes 1–5), three of five samples of double-positive To examine Helios expression during T cell develop- cells (lanes 7–11), and only one of five samples of single- ment, primary thymocytes were sorted by FACS into positive cells (lanes 13–17). DNA sequencing of the PCR − − − + + + triple negative (CD3 4 8 ), double-positive (CD3 4 8 ), products confirmed that they contain Helios sequences. + + + − and CD4 single-positive (CD3 4 8 ) populations (see The sequences also revealed that the small size differ- Materials and Methods and Klug et al. 1998). Five differ- ence between the products in lanes 2 and 3 versus 4 and ent samples of 20 cells each were analyzed by RT–PCR 5 was attributable to the amplification of the Helios A for each population. PCR products were efficiently am- sequence in lanes 2 and 3 and the Helios B sequence in Figure 7. Helios expression in thymocyte and splenic cell subsets. Twenty cells of the indicated cell-surface phenotypes were sorted by FACS for analysis of Helios ex- pression during thymocyte maturation and in non-T-lineage cell subsets. Primers for nested PCR amplified across sequences that encode the four amino-terminal zinc fingers of Helios. The PCR products observed with the various samples exhibit slightly differ- ent migrations, which represent the ampli- fication of both the Helios A and Helios B products with predicted sizes of 712 and 790 bp, respectively. GENES & DEVELOPMENT 789 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. lanes 4 and 5 (data not shown). No PCR products were amplified from primary splenic neutrophils (Gr- + + + 1 Mac1 , lanes 19–23) or splenic B cells (B220 , lanes 25–29). These results confirm the T cell-restricted ex- pression of Helios and suggest that it might be most abundant in immature cells of the T lineage. Quantitative association of Helios with Ikaros The stability of the Ikaros–Helios interaction provides strong evidence that the interaction is relevant. To de- termine the percentage of Helios that is stably associated with Ikaros and, conversely, the percentage of Ikaros that is stably associated with Helios, quantitative immuno- precipitation experiments were performed with VL3- Figure 9. The Ikaros–Helios complexes appear to be relatively 3M2 (Fig. 8) and RLm11 (data not shown) cell extracts. homogeneous when analyzed by gel-filtration chromatography. The immunoprecipitation reactions were carried out Proteins in Superose 6 (Pharmacia) gel-filtration column frac- with increasing amounts of either Ikaros antibodies tions were separated by 10% SDS-PAGE and analyzed by West- (lanes 2–5, 11–14) or Helios antibodies (lanes 6–9, 15–18). ern blot analysis involving probing of the blot sequentially with anti-Helios serum (top) followed by anti-Ikaros serum (bottom). The amounts of Ikaros and Helios within the immuno- Four micrograms of RLm11 nuclear extracts was also analyzed precipitation pellets (lanes 1–9) and supernatants (lanes (lane 1). The fractions where standard molecular mass markers 10–18) were determined by immunoblot analysis. Ikaros migrate in Superose 6 (Pharmacia) gel-filtration chromatogra- antibodies were capable of depleting almost all of the phy are indicated by arrows on the top with their molecular Helios from the VL3-3M2 extracts, as determined by the masses. Isoforms I, III, V and VI are indicated. depletion of almost all of the Helios from the immuno- precipitation supernatants (lanes 10–14, top). This result suggests that virtually all of the Helios within the cell is ciated with Helios, and therefore that Ikaros is in con- associated with Ikaros isoforms. In contrast, Helios an- siderable excess. Similar results were obtained with tibodies depleted only a small fraction of the Ikaros RLm11 extracts (data not shown). The quantitative as- (lanes 15–18, bottom), despite the ability of these anti- sociation of Helios with Ikaros provides strong support bodies to deplete all of the Helios (lanes 15–18, top). This for the functional relevance of the Ikaros–Helios inter- result suggests that only a fraction of the Ikaros is asso- action. Helios and Ikaros exist as a relatively homogeneous complex The overexpression experiments in 293T cells suggest that the four Ikaros isoforms and two Helios isoforms present in RLm11 cells are capable of forming stable complexes with each other in an indiscriminate manner. With six different proteins interacting through highly homologous carboxy-terminal zinc finger domains, 21 different dimers could be produced. If these dimers asso- ciate into multimers, as suggested by some of the data, a much larger number of species is possible. Each species might carry out a distinct function within the cell, or many of the complexes might carry out redundant func- Figure 8. Quantitative association of Helios with a subset of tions. Alternatively, the interactions between the endog- the Ikaros within VL3-3M2 cells. Quantitative immunoprecipi- enous proteins in RLm11 cells might not be as indis- tation experiments were performed with purified IgG directed against the amino-terminal domains of either Ikaros (lanes 2– criminate as suggested by the 293T experiments. The 5,11–14) or Helios (lanes 6–9,15–18). Control immunoprecipita- relative elution profiles of Ikaros and Helios from a gel tions contained no added antibody (lanes 1,10). The proteins filtration column support this latter hypothesis (Fig. 9). present in the immunoprecipitation pellets (lanes 1–9) and su- As shown above (Fig. 1), Ikaros isoforms elute from gel pernatants (lanes 10–18) were analyzed by immunoblot, with filtration columns in a broad peak and at large molecular the membranes probed with antibodies directed against either masses. It is not known whether this elution profile ac- Helios (top) or Ikaros (bottom). The two isoforms predomi- curately reflects the sizes of the complexes, but the nantly expressed in VL3-3M2 cells are indicated to the left of broad peak suggests that the complexes are quite heter- the bottom panel. The amounts of anti-Ikaros or anti-Helios ogeneous. Surprisingly, Helios eluted as a sharp peak IgGs used in the immunoprecipitations were as follows: 1.5 μg from a Superose 6 gel filtration column, coeluting with (lanes 2,6,11,,15), 4.5 μg (lanes 3,7,12,16), 15 μg (lanes 4,8,13,,17), and 45 μg (lanes 5,9,14,,18). the largest of the Ikaros complexes (Fig. 9, lanes 6–8). 790 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes This sharp elution profile suggests that Helios is not as- function as a simple transcriptional repressor in either sembled into the same heterogeneous array of complexes transient or stable transfection experiments (data not as Ikaros, but rather is assembled into one discrete com- shown). plex, or at least a much more homogeneous set of com- Confocal microscopy was employed to examine plexes than Ikaros. whether the subnuclear localization of Helios and Ikaros in T cells is similar to the centromeric localization of The gel filtration result raises the possibility that He- Ikaros observed in B cells (Brown et al. 1997). For these lios is a limiting regulatory molecule that dictates the function of Ikaros isoforms. The apparently homoge- experiments, VL3-3M2 and primary activated lymph neous complex containing Helios and Ikaros might carry node T cells were used. Surprisingly, with both T cell out a specific function. The excess Ikaros that is not sources, Ikaros was distributed throughout the nucleo- associated with Helios might assemble into specific plasm and did not exhibit the predominant centromeric complexes with other Ikaros-related proteins, such as localization that had been observed in B cells. These re- the p30 protein (Fig. 2A). Indeed, a partial peptide se- sults are apparent in Figure 10 (g,h,i), which shows a quence of p30 has revealed that it is another member of single optical section of a representative lymph node T the Ikaros family (B.S. Cobb, unpubl.). Some of the ex- cell stained with an Ikaros antibody (h) and with a fluo- cess Ikaros might instead exist as partially formed com- rescent DNA probe for gamma satellite repeats (g), plexes that lack subunits essential for function. which are found primarily at centromeric regions of chromosomes (see Materials and Methods and Brown et al. 1997). The costained image (i) reveals patches of Ika- Selective association of complexes containing Helios ros staining at the edges of the centromeric foci (yellow), with centromeric regions of T cell nuclei but most of the Ikaros was distributed throughout the nucleoplasm (green). Similar results were observed in A recent study revealed that Ikaros might not be a typi- VL3-3M2 cells (data not shown). These results are in cal transcriptional activator, as it was found in B cells to striking contrast to the results observed in B cells (j,k,l), localize primarily to centromeric heterochromatin in which the Ikaros (j) and gamma-satellite (k) staining (Brown et al. 1997). This study also revealed that a vari- patterns are very similar to each other, and closely coin- ety of inactive genes colocalize with Ikaros to the cen- cide in the costained image (l). tromeric regions, leading to the hypothesis that Ikaros Interestingly, in both the lymph node T cells (a,b,c) might play a role in recruiting genes to centromeric foci and the VL3-3M2 T cells (d,e,f), Helios colocalized with that are destined for inactivation. Consistent with the the gamma satellites at the centromeric foci, similar to hypothesis that both Helios and Ikaros are not typical the predominant localization of Ikaros in B cells. The transcriptional activators, we were unable to detect ac- colocalization is apparent by comparison of the gamma- tivation of reporter constructs containing multiple high- satellite staining pattern (a,d) with the Helios staining affinity Ikaros/Helios binding sites when various Ikaros pattern (b,e) and by examination of the costained images and/or Helios isoforms were overexpressed (data not (b,e), in which colocalization is evident by the orange shown). In addition, none of these proteins appears to Figure 10. Distribution of Helios and Ika- ros proteins within the nuclei of T and B lymphocytes. Confocal images are shown of single optical sections through the nucleus of representative individual con- cavalin-A stimulated lymph node T cells (a,b,c,g,h,i), activated VL3-3M2 T cells (d,e,f), and B3 pre-B cells (j,k,l). The cells were labeled simultaneously with a probe for gamma satellite sequences (red) and spe- cific antisera for Helios (a–f) or Ikaros (g–l) (shown in green). The red and green com- ponents of costained nuclei (bottom, c,f,i,l) are shown separately in the top (gamma satellite-red a,d,g,j) and middle (p70-green b,e, Ikaros-green h,k) rows. GENES & DEVELOPMENT 791 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. and yellow colors. The yellow color observed in cos- elucidated. One hypothesis is that Helios–Ikaros com- tained VL3-3M2 cells indicates that the intensity of He- plexes bind to DNA sequence elements within the pro- lios staining is greater than in the lymph node T cells, moters, enhancers, or silencers of genes that are destined for inactivation. Binding of Helios–Ikaros might result in which yield an orange color. It is worth noting, however, the recruitment of those genes to the centromeric foci, that the intensity of Helios staining in both of these cell where they might be assembled into inactive heterochro- types was much weaker than the intensity of Ikaros matin structures. A more extensive discussion of the staining. (The images in Fig. 10 do not reflect the lower abundance of Helios because different settings were used possible functions for these proteins at centromeric re- for the Helios images to enhance detection.) These re- gions, and a discussion of related studies of Drosophila sults are consistent with those in Figure 8, which dem- heterochromatin regulation and position effect variega- onstrate that Helios is much less abundant than Ikaros tion, can be found in Brown et al. (1997). in T cells. Because the data in Figure 8 demonstrate that The reason for the broad distribution of Ikaros in T cell Helios is quantitatively associated with a subset of the nuclei, relative to its predominant centromeric localiza- Ikaros, the most likely interpretation of the confocal re- tion in B cells, also remains unknown. Perhaps, B cells sults is that the Ikaros–Helios complexes are predomi- contain a more abundant partner for Ikaros that recruits nantly localized to the centromeric foci. In contrast, the a larger fraction of the Ikaros pool to the centromeric excess Ikaros that is not associated with Helios appears foci. Alternatively, Ikaros may be capable of localizing to to be distributed more broadly throughout the nucleo- the centromeric regions in B cells in the absence of a plasm. partner. The large pool of Ikaros in T cells that is not Although not easily apparent from the images shown localized to the centromeres may simply be excess pro- in Figure 10, the similar staining patterns of Helios and tein that carries out no specific functions. Alternatively, gamma satellite repeats may not represent true colocal- this pool may carry out one or more critical functions ization (i.e., identity of spatial location). Instead, the He- related to the activation or inactivation of specific genes, lios staining appears to extend slightly beyond the perhaps acting as a more typical activator or repressor in gamma satellite staining. Preliminary studies of decon- combination with other transcription factors, coactiva- volved images are consistent with this observation (K.E. tors, or corepressors. Although our discussion of Ikaros Brown and A.G. Fisher, unpubl.), suggesting that Helios and Helios has focused on their possible roles in tran- and gamma satellites are interlaced rather than spatially scriptional regulation, it is important to note that no identical. compelling evidence has been published demonstrating that Ikaros or Helios are actually involved, either di- rectly or indirectly, in transcription. Alternative func- tions that must be considered are involvement in Discussion nuclear structure, DNA synthesis, or mitosis. Gene disruption experiments have shown that Ikaros The discovery of a T cell-restricted member of the Ika- isoforms carry out critical functions during the develop- ros family leads to models that might explain some of ment of B and T lymphocytes, as well as other hemato- the phenotypes observed in mice containing Ikaros gene −/− poietic cell types (Georgopoulos et al. 1994; Winandy et disruptions. Ikaros mice lack all cells of the B lin- al. 1995; Wang et al. 1996). Nevertheless, in light of the eages, but exhibit less severe defects in some of the T cell centromeric heterochromatin localization that has been lineages (see introductory section; Wang et al. 1996) even observed (Brown et al. 1997; Klug et al. 1998), the precise though Ikaros normally appears to be expressed in all B intracellular functions of Ikaros almost certainly will be and T cells. Perhaps complete disruption of the Ikaros difficult to elucidate. The finding that Ikaros protein gene has relatively modest effects on T cell development complexes are sufficiently stable to allow their purifica- because Helios compensates for the absence of Ikaros. tion by immunoaffinity chromatography provides a This hypothesis is supported by the finding that Helios means of identifying relevant Ikaros partners within any and Ikaros recognize similar DNA sequences. A more given cell type or cell line, information which will be severe T cell defect was observed in mice containing a essential for fully understanding Ikaros functions. Our specific disruption of the zinc finger DNA-binding do- analysis of the complexes within the RLm11 T cell line mains of Ikaros; these mice, which retain the capacity to led to the identification of a new member of the Ikaros produce smaller Ikaros proteins containing the carboxy- family, Helios. The relevance of the Helios–Ikaros inter- terminal protein–protein interaction domain, do not pro- action was demonstrated by the quantitative association duce any progenitor or mature T cells (Georgopoulos et in the two cell lines examined. The specific functions of al. 1994). The severity of this mutation within the T cell Helios and of the Helios–Ikaros complex remain un- lineage might be due to the fact that the small Ikaros known, but the colocalization of Helios–Ikaros com- proteins act in a dominant negative manner, sequester- plexes with gamma satellites suggests that Helios might ing Helios and preventing it from compensating for the be a limiting regulatory factor that recruits a subset of loss of Ikaros. the Ikaros within a T cell to centromeric foci. Consistent with the hypothesis that Ikaros and Helios The function of the Helios–Ikaros complexes at the might not simply be transcriptional activators, we have centromeric regions, and the function of the excess Ika- been unable to detect transcriptional activation func- ros distributed throughout the nucleus, remains to be tions for either protein by standard transient and stable 792 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes cDNAs for these isoforms in the pSP72 vector (see Hahm et al. transfection assays (B.S. Cobb and K. Hahm, unpubl.). 1994) were excised with BglII and XhoI and inserted into Ikaros proteins contain a domain that functions as a pcDNA1neo cleaved with BamHI and XhoI. Plasmids for ex- strong transactivation domain when fused to a GAL4 pression in Escherichia coli of fusion proteins between Helios A DNA-binding domain (Sun et al. 1996; K. Hahm, L. and GST were prepared for antibody preparation and DNA-bind- Trinh, P. Ernst, and S.T. Smale, in prep.). Transactiva- ing studies. Fragments encoding Helios A amino acids 1–109 tion of reporter plasmids has also been reported with the (for antibody preparation) and 1–292 (for DNA-binding studies) full-length protein (Molnar and Georgopoulos 1994). In were generated by PCR from the full-length Helios A cDNA our hands, however, we have been unable to detect trans- with a primer spanning the amino-terminal coding region, 58- activation with either full-length Ikaros or Helios, or a GATAGATCTATGGAAACAGACGCAATTGA-38, and the re- combination of the two, despite efficient expression of verse primers 58-GATGAATTCGTCCATCATATGAGACTG- the proteins and despite the fact that extracts from those CATCAG-38 or 58-GATGAATTCGCCTTGAAGGTCCTGGA- CTTT-38, respectively. The 327- and 876-bp PCR products, re- cells contain the expected DNA-binding activities (B.S. spectively, were cleaved with BglII and EcoRI and inserted into Cobb and A.S. McCarty, unpubl.). Because these results pGEX 2T (Pharmacia) cleaved with BamHI and EcoRI. are negative, they can only be substantiated by the dem- The mammalian expression plasmid for FLAG-tagged Helios onstration that Ikaros and Helios carry out a different A was prepared by amplifying the protein-coding sequence with function. It remains possible that Ikaros functions as a the following PCR primers: 58-GATAGATCTATGGAAA- activator of some genes through combinatorial interac- CAGACGCAATTGA-38 and 58-GATGAATTCCTAGTGGAA- tions, yet is involved in heterochromatin formation on TGTGTGCTCCCC-38. The PCR product was cleaved with other genes at the centromeric foci. Such a function BglII and EcoRI and inserted into pSP72 cleaved with the same would be similar to that proposed for the Drosophila enzymes. The following FLAG-encoding oligonucleotide and its Hunchback protein, which contains zinc finger domains complement were then annealed, cleaved with BglII and BamHI, and inserted into the BglII-cleaved plasmid: 58-GATA- that are highly related to those in Ikaros and Helios. GATCTACCATGGACTACAAGGACGACGATGACAAGG- Hunchback acts as a simple activator during embryogen- GATCCGAT-38. Finally, the entire coding sequence was trans- esis and also has been proposed to establish silencing ferred to the pcDNA3 expression vector (InVitrogen) following complexes in Drosophila by recruiting Polycomb-group cleavage of the pSP72 plasmid with BglII and XhoI and the vec- proteins (Zhang and Bienz 1992; Poux et al. 1996). tor with BamHI and XhoI. The stoichiometry and structure of the complexes ob- served by gel filtration chromatography and other tech- Cell culture and transient transfections niques remain unknown. Some techniques strongly sug- gest that Ikaros complexes are composed of highly stable RLm11, VL3-3M2, and other cell lines were maintained as de- scribed previously (Groves et al. 1995; Ernst et al. 1996). Tran- dimers. Other techniques suggest that the complexes are sient transfections of 293T cells were performed by a calcium multimeric (see Results). Additional experiments will be phosphate coprecipitation method (Ausubel et al. 1989) with needed to clarify these results and, if multimeric com- the amounts of plasmid DNA indicated in the figure legends. plexes are indeed present in cell extracts, to determine whether these complexes are the functional species in Antibodies vivo. On the basis of all the data that has been obtained, our working model is that the complexes contain highly Ikaros antisera were generated against GST-fusion proteins con- stable dimers that associate into multimers. taining amino-terminal amino acids 1–80 of isoform I and car- The homogeneous nature of the Ikaros complexes that boxy-terminal amino acids 54–286 of isoform I. Helios antisera contain Helios, as judged by gel filtration chromatogra- were generated against a GST fusion protein containing amino- terminal amino acids 1–109. These fusion proteins were puri- phy, is particularly intriguing. Because Helios appears to fied by glutathione–Sepharose chromatography and used to im- interact indiscriminately with the various Ikaros iso- munize rabbits as described previously (Hahm et al. 1994). The forms following overexpression in 293T cells, it is not Elf-1 antiserum was described previously (Ernst et al. 1996). clear why Helios would elute in a sharper peak than IgGs from preimmune and immune sera were purified by pro- Ikaros. Apparently, within RLm11 cells, the interactions tein A–Sepharose (Pharmacia) chromatography as described by are not as indiscriminate as predicted. Perhaps, the Harlow and Lane (1988). smaller Ikaros complexes observed by gel filtration are partially assembled complexes, with Helios the final Gel filtration and DNA-affinity chromatography component added to the complex. Whatever the reason for the homogeneity of the Helios complexes, this dis- Gel filtration chromatography was performed with prepacked Superdex 200 and Superose 6 FPLC columns (Pharmacia). Ap- tinction from Ikaros is likely to rely on domains other proximately 1 mg of RLm11 nuclear extract in a volume of 500 than the zinc finger domains, since the zinc fingers are μl was applied to the column in HGED.45 buffer (20 mM HEPES extremely well conserved. at pH 7.9, 20% glycerol, 0.2 mM EDTA, 1 mM dithiothreitol, 0.1 mM PMSF, and 0.45 M KCl) containing 0.015% NP-40. Some experiments were performed with 0.15 M KCl and without NP- Materials and methods 40. Fractions (500 μl) were collected and 45 μl of each was ana- lyzed by immunoblot. Molecular size markers were thyroglob- Plasmid DNAs ulin (669 kD), ferritin (440 kD), catalase (232 kD), and albumin Mammalian expression plasmids for Ikaros isoforms I, III, V, (67 kD) (Pharmacia). and VI were prepared in the pcDNA1neo vector (InVitrogen). Sequence-specific DNA-affinity chromatography was per- GENES & DEVELOPMENT 793 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. formed with 0.5 ml of resin containing covalently linked mul- incubated with 3–6 μg of FLAG M2 monoclonal antibody (Ko- timers of the TdT D sequence as described previously (Hahm et dak IBI) for 2–4 hr at 4°C, followed by centrifugation for 10 min. al. 1994). Supernatants were transferred to a new tube and mixed with 40 μl of protein A–Sepharose (Pharmacia). The slurry was incu- bated for 1 hr at 4°C. After brief centrifugation, pellets were Purification of Ikaros complexes and peptide sequencing washed 5 times with buffer containing 10 mM HEPES (pH 7.9), Immunoaffinity columns were prepared by covalent coupling of 0.45 M KCl, 1 mM EDTA, 0.015% NP-40, 10% glycerin, and 1 antibodies to protein A–Sepharose (Pharmacia) by the method mM dithiothreitol. The washed pellets were analyzed by SDS- described in Harlow and Lane (1988). Ikaros complexes were PAGE followed by immunoblot as described previously (Hahm purified by the following method. RLm11 nuclear extracts (200 et al. 1994). mg) in buffer D (20 mM HEPES at pH 7.9, 20% glycerol, 0.2 mM The quantitative immunoprecipitations were performed with EDTA, 1 mM dithiothreitol, 0.1 mM PMSF, 0.42 M KCl) were 100 μl of RLm11 (500 μg) nuclear extract or 200 μl of VL3-3M2 applied to a precolumn containing 500 μl of unmodified protein (1.2 mg) nuclear extract. The extract was mixed with 167 μl of A–Sepharose, with the eluate flowing directly onto the bed of a a buffer containing 100 mM NaCl, 20 mM Tris (pH 8), and 0.5% 4-ml immunoaffinity column. The extract was passed through NP-40. To this mixture was added the indicated amount of IgG both columns three times. The immunoaffinity column was (against the amino terminus of either Ikaros or Helios), which then washed with 10 column volumes of HGED buffer (20 mM was diluted to 33 μl with PBS. Binding proceeded for 1 hr on ice HEPES at pH 7.9, 20% glycerol, 1 mM EDTA, 1 mM DTT, 0.1 after which 100 μl of a 50% slurry of protein A–Sepharose was mM PMSF) containing 0.45 M KCl and 1 M KCl. In some experi- added. The mixture was incubated for an additional hour at 4°C ments, the column was also washed with HGED buffer contain- on a rocker. The resin was pelleted by brief centrifugation and ing no KCl. Bound proteins were eluted in 1-ml fractions into the supernatants were transferred to a new tube. The pellets tubes containing 20 μl of 2 M Tris-HCl (pH 6.8) with 100 mM were washed four times with the above buffer. The immune trimethyl ethanolamine (pH 11.0). Fractions were analyzed by complexes and a constant proportion of the supernatants were SDS-PAGE followed by silver staining. analyzed by SDS-PAGE, followed by immunoblot analysis with To isolate the 70-kD protein for microsequencing, appropri- antisera against the carboxyl terminus of Ikaros or the amino- ate fractions from the pH 11.0 elution were pooled. After three terminus of Helios. runs of a 5-ml affinity column, ~10 μg of the 70-kD protein was obtained. The pooled proteins were precipitated by 20% trichlo- Binding-site selection analysis and gel mobility shift assays roacetic acid (Fisher), separated by SDS-PAGE, transferred to Binding-site selection assays were performed as described by PVDF membrane (Biorad), and stained with Ponceau S as de- Zweidler-McKay et al. (1996). The double-stranded oligonucleo- scribed previously (Hahm et al. 1994). The 70-kD band was tide containing random sequences was generated from the fol- excised and subjected to endopetidase C digestion followed by lowing 66-nucleotide fragment: 58-GGTAGAATTCAACTGC- peptide sequencing as described (Fernandez et al. 1994). CATCTAGGNNNNNNNNNNNNNNNNNNACACCGAG TCCAGTGGATCCTACG-38. The complementary strand was Isolation of Helios cDNAs generated by annealing the following primer and extending with the E. coli DNA polymerase Klenow fragment: 58-CGTAG- To isolate the Helios gene, first strand cDNA was generated GATCCACTGGACTCGGTG-38. The DNA fragments con- from RLm11 mRNA and used for PCR with the following de- taining random sequences were incubated with the recombi- generate primer pairs designed from the two peptide sequences; nant GST–Helios A fusion protein. Bound DNA molecules were 58-GATGAATTCCA(A/G)GA(A/G)CC(A/C/G/T)AT(T/C)A separated from unbouind molecules by incubation with GST– TGGA(C/T)AA(C/T)AA-38,58-GATGAATTCTT(C/T)TC(A/ Sepharose, followed by centrifugation (Zweidler-McKay et al. G)TA(A/C/T)GT(C/T)AG(A/G)TTCAT-38. A 216-bp PCR prod- 1996). Bound DNA molecules were eluted and amplified by uct was isolated and inserted into pSP72 (Promega) digested PCR with the above 23-mer and the following reverse primer: with BglII and EcoRI. The sequence of the insert was deter- 58-GGTAGAATTCAACTGCCA-38. After four binding cycles, mined and found to contain codons encoding the amino acids the final PCR products were digested with EcoRI and HindIII within the two original peptides that were not included in the and inserted into pSP72 (Promega). Thirty-two clones were ana- PCR primers, confirming that the fragment was derived from lyzed by sequencing. the correct gene. To isolate a full-length cDNA, the 216-bp frag- For gel mobility shift analysis, the IkBS1 probe was prepared ment was radiolabeled and used to screen a newborn thymus from a plasmid containing the following oligonucleotide and its cDNA library (Stratagene) as previously described (Hahm et al. complement inserted into the BamHI site of pSP72: 58- 1994). The resulting full-length cDNA encodes the Helios A GATCTTCAGCTTTTGGGAATCTCCTGTCAG-38. The Hs protein. The Helios B cDNA was isolated by RT-PCR with the BS1 and Hs BS2 probes were prepared from plasmids containing following primers flanking the amino-terminal zinc finger do- the following oligonucleotides and their complements inserted main. into the HindIII and EcoRI sites of pSP72: Hs BS1, 58-CGTG- Plasmids encoding Helios A–GST fusion proteins were intro- TATCCATAGGGAAAATTATCCTAGAT-38; Hs BS2, 58- duced into the SCS-1 strain of E. coli (Stratagene). Fusion pro- GATCTCGTGTGATTTTCCTAATGAGAATCCTAGATG-38. teins were then induced, purified and stored at −80°C as de- The TdT D and D8 probes were described previously (Hahm et scribed previously (Hahm et al. 1994). al. 1994). Radiolabeled probes were prepared as described previ- ously (Ernst et al. 1993) following cleavage with HindIII and Immunoprecipitation and immunoblot analyses EcoRI. The SP72 control probe was cleaved with BglII and XhoI. Binding reactions were performed as described by Lo et al. 293T cell immunoprecipitation assays were performed from cy- (1991). Samples were analyzed as described in Ernst et al. (1993). toplasmic or nuclear extracts with the following method. First, cytoplasmic and nuclear extracts were prepared from four 100- Northern blot analysis mm plates of transfected cells by Dounce homogenization as described by Lo et al. (1991). Nuclear extracts (400 μg) were RNAs from cell lines and tissues were prepared by a guanidine 794 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Purification of Ikaros complexes thiocyanate centrifugation method (Ausubel et al. 1989). Tis- U.S. PHS grant DK43726. S.T.S. is an Associate Investigator sues used to generate RNAs were isolated from 1-month-old with the Howard Hughes Medical Institute. Balb/c mice. Northern blot probes were prepared from a 216-bp The publication costs of this article were defrayed in part by p70 fragment encoding amino acids 221–292, and were labeled payment of page charges. This article must therefore be hereby using the Prime-It Kit (Stratagene). marked ‘‘advertisement’’ in accordance with 18 USC section 1734 solely to indicate this fact. RT–PCR of Helios in thymocyte subsets and in splenic myeloid and B cell populations References − − − + + + Thymocyte subsets (CD-3 CD-4 CD-8 , CD-3 CD-4 CD-8 , Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. + + − and CD-3 CD-4 CD-8 ) were sorted by use of the following Seidman, J.A. Smith, and K. Struhl. 1989. Current protocols PE FITC combination of fluorochromes: CD-3 , CD-4 , and CD- in molecular biology. John Wiley, New York, NY. APC HI + 8 . Splenic myeloid cells were sorted as Gr-1 Mac-1 and Babichuk, C.K., B.L. Duggan, and R.C. Bleackley. 1996. In vivo splenic B cells were isolated as B220 cells. Each cell population regulation of murine granzyme B gene transcription in acti- was sorted once and then clone-sorted directly into 0.2-ml tubes vated primary T cells. J. Biol. Chem. 271: 16485–16493. containing 20 μl of RT lysis buffer [5× first strand buffer (Gibco- Brown, K.E., S.S. Guest, S.T. Smale, K. Hahm, M. Merken- BRL), 10 mM DTT, 2% Triton X-100, 0.01% BSA, 0.2 mM sper- schlager, and A.G. Fisher. 1997. Association of transcription- midine, 0.4 units of RNasin (Promega), 100 ng of RT primer, 0.5 ally silent genes with Ikaros complexes at centromeric het- mM each dNTP]. Reactions were initiated by adding 1 μl of erochromatin. Cell 91: 845–854. MMLV reverse transcriptase. Reactions were incubated for 75 Clevers, H.C. and R. Grosschedl. 1996. Transcriptional control min at 37°C. About 10%–15% of the cDNA reaction was used of lymphoid development: Lessons from gene targeting. Im- as a template for 35 cycles of PCR with the outside primers munol. Today 17: 336–343. listed below (PCR conditions: 94°C for 30 sec, 55°C for 30 sec, Clevers, H.C., M.A. Oosterwegel, and K. Georgopoulos. 1993. and 72°C for 30 sec). Five percent of the first PCR reaction was Transcription factors in early T-cell development. Immunol. used as template for a second round of 35 cycles with the inside Today 14: 591–596. primer set and the same PCR conditions described above. Prod- Davis, J.N. and M.F. Roussel. 1996. Cloning and expression of ucts were resolved on a 1.5% agarose gel and then blotted for the murine Elf-1 cDNA. Gene 171: 265–269. Southern analysis with an oligonucleotide (Helios probe) Ernst, P. and S.T. Smale. 1995. Combinatorial regulation of complementary to an exon located just upstream of the first transcription II: The immunoglobulin μ heavy chain gene. zinc finger exon in Helios. Control reactions received sorted Immunity 2: 427–438. cells but no reverse transcriptase. At least four large introns Ernst, P., K. Hahm, and S.T. Smale. 1993. Both LyF-1 and an Ets occur between the exon sequences being amplified by the inside protein interact with a critical promoter element in the mu- primer set. rine terminal transferase gene. Mol. Cell. Biol. The following oligonucleotides used for the RT-PCR and 13: 2982–2992. Southern blots are written in a 58 to 38 orientation: RT primer, Ernst, P., K. Hahm, L. Trinh, J.N. Davis, M.F. Roussel, C.W. GCATTGTTGATGGCTTGGTC; outside primers, GGG- Turck, and S.T. Smale. 1996. A potential role for Elf-1 in GAACA CGCCAATATGGC (58 end) and GCATCAGCT- terminal transferase gene regulation. Mol. Cell. Biol. CAGCCTCCTTC (38 end); inside primers, CCAATGGACAG- 16: 6121–6131. CACGCCTCG (58 end) and ATATCTGGGTAGCTGAATCGC Fernandez, J., L. Andrews, and S.M. Mische. 1994. An improved (38 end); p70 probe, CCCTGAGCCGTGAGGATGAG. procedure for enzymatic digestion of polyvinylidene difluo- ride-bound proteins for internal sequence analysis. Annal. Biochem. 218: 112. Confocal microscopy Georgopoulos, K. 1997. Transcription factors required for lym- phoid lineage commitment. Curr. Opin. Immun. 9: 222–227. Lymph node T cells were prepared as follows: Lymph nodes Georgopoulos, K., D.D. Moore, and B. Derfler. 1992. Ikaros, an were removed from a Balb/c mouse and minced in sterile me- early lymphoid-specific transcription factor and a putative dium to yield a single cell suspension. After washing, cells were mediator for T cell commitment. Science 258: 808–812. resuspended at 2.5 × 10 /ml and cultured at 37°C in AM DM Georgopoulos, K., M. Bigby, J.-H. Wang, A. Molnar, P. Wu, S. medium containing 10% FCS, antibiotics, concanavalin A (5 Winandy, and A. Sharpe. 1994. The Ikaros gene is required μg/ml) and IL-2 (20 U/ml). After 36 hr, live cells were enriched for the development of all lymphoid lineages. Cell 79: 143– by ficoll separation and cultured for a further 24 hr in 1 M DM containing 10% FCS and IL-2 (20 U/ml) at 37°C. VL3-3M2 cells Georgopoulos, K., S. Winandy, and N. Avitahl. 1997. The role of were activated with PMA (10 ng/ml) and ionomycin (250 ng/ the Ikaros gene in lymphocyte development and homeosta- ml) as described previously (Groves et al. 1995). B3 cells, the sis. Annu. Rev. Immunol. 15: 155–176. gamma satellite probe, and the immunofish protocol were de- Groves, T., P. Katis, Z. Madden, K. Manickam, D. Ramsden, G. scribed previously (Brown et al. 1997). Wu, and C.J. Guidos. 1995. In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement. J. Immunol. 154: 5011–5022. Acknowledgments Haag, F.A., G. Kuhlenbaumer, F. Koch-Nolte, E. Wingender, and K.H. and R.L. were supported by U.S. Public Health Service H.G. Thiele. 1996. Structure of the gene encoding the rat T (U.S. PHS) Training Grants GM-07104 and GM-08042, respec- cell ecto-ADP-ribosyltransferase RT6. J. Immunol. tively. C.A.K. was a fellow of the Irvington Institute, I.L.W. was 157: 2022–2030. supported by grants from the National Cancer Institute Hagman, J. and R. Grosschedl. 1994. Regulation of gene expres- (CA42551) and from SyStemix/Sandoz, A.G.F. was supported by sion at early stages of B-cell differentiation. Curr. Opin. Im- the Medical Research Council, UK, and S.T.S. was supported by munol. 6: 222–230. GENES & DEVELOPMENT 795 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Hahm et al. Hahm, K., P. Ernst, K. Lo, G. Kim, C. Turck, and S.T. Smale. regulation of expression by type I interferons and interleu- 1994. The lymphoid transcription factor LyF-1 is encoded by kin-7. Genomics 33: 167–176. a specific, alternatively spliced mRNA derived from the Ika- Wang, J.-H., A. Nichogiannopoulou, L. Wu, L. Sun, A.H. Sharpe, ros gene. Mol. Cell. Biol. 14: 7111–7123. M. Bigby, and K. Georgopoulos. 1996. Selective defects in the Harlow, E. and D. Lane. 1988. Antibodies: A laboratory development of the fetal and adult lymphoid system in mice manual. Cold Spring Harbor Laboratory, Cold Spring Har- with an Ikaros null mutation. Immunity 5: 537–549. bor, NY. Wargnier, A., S. Legros-Maida, R. Bosselut, J.F. Bourge, C. Lafau- Ikuda, K., N. Uchida, J. Friedman, and I.L. Weissman. 1992. rie, C.J. Ghysdael, M. Sasportes, and P. Paul. 1995. Identifi- Lymphocyte development from stem cells. Annu. Rev. Im- cation of human granzyme B promoter regulatory elements munol. 10: 759–783. interacting with activated T-cell-specific proteins: Implica- Klug, C.A., S.J. Morrision, M. Masek, K. Hahm, S.T. Smale, and tion of Ikaros and CBF binding sites in promoter activation. I.L. Weissman. 1998. Hematopoietic stem cells and lym- Proc. Natl. Acad. Sci. 92: 6930–6934. phoid progenitors express different Ikaros isoforms and Ika- Willerford, D.M., W. Swat, and F.W. Alt. 1996. Developmental ros is localized to heterochromatin in immature lympho- regulation of V(D)J recombination and lymphocyte differen- cytes. Proc. Natl. Acad. Sci. 95: 657–662. tiation. Curr. Opin. Genet. Dev. 6: 603–609. Lo, K., N.R. Landau, and S.T. Smale. 1991. LyF-1, a transcrip- Winandy, S., P. Wu, and K. Georgopoulos. 1995. A dominant tional regulator that interacts with a novel class of promot- mutation in the Ikaros gene leads to rapid development of ers for lymphocyte-specific genes. Mol. Cell. Biol. 11: 5229– leukemia and lymphoma. Cell 83: 289–299. 5243. Zhang, C.C. and M. Bienz. 1992. Segmental determination in Molnar, A. and K. Georgopoulos. 1994. The Ikaros gene encodes Drosophila conferred by hunchback (hb) a repressor of the a family of functionally diverse zinc finger DNA-binding homeotic gen Ultrabithorax (Ubx). Proc. Natl. Acad. Sci. proteins. Mol. Cell. Biol. 14: 8292–8303. 89: 7511–7515. Molnar, A., P. Wu, D.A. Largespada, A. Vortkamp, S. Scherer, Zweidler-McKay, P.A., H.L. Grimes, M.M. Flubacher, and P.N. N.G. Copeland, N.A. Jenkins, G. Bruns, and K. Georgopou- Tsichlis. 1996. Gfi-1 encodes a nuclear zinc finger protein los. 1996. The Ikaros gene encodes a family of lymphocyte- that binds DNA and functions as a transcription repressor. restricted zinc finger DNA binding proteins, highly con- Mol. Cell. Biol. 16: 4024–4034. served in human and mouse. J. Immunol. 156: 585–592. Morgan, B., L. Sun, N. Avitahl, K. Andrikopoulos, T. Ikeda, E. Gonzales, P. Wu, S. Neben, and K. Georgopoulos. 1997. Aio- los, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO J. 16: 2004–2013. Morrison, S.J., N. Uchida, and I.L. Weissman. 1995. The biology of hematopoietic stem cells. Annu. Rev. Cell. Devel. Biol. 11: 35–71. Omori, S.A. and R. Wall. 1993. Multiple motifs regulate the B-cell-specific promoter of the B29 gene. Proc. Natl. Acad. Sci. 90: 11723–11727. Orkin, S.H. 1995. Hematopoiesis: How does it happen? Curr. Opin. Cell Biol. 7: 870–877. Poux, S., C. Kostic, and V. Pirrotta. 1996. Hunchback-indepen- dent silencing of the late UBX enhancers by a polycomb group response element. EMBO J. 15: 4713–4722. Santee, S.M. and L.B. Owen-Schaub. 1996. Human tumor ne- crosis factor receptor p75/80 (CD120b) gene structure and promoter characterization. J. Biol. Chem. 271: 21151–21159. Shortman, K. and L. Wu. 1996. Early T lymphocyte progenitors. Annu. Rev. Immunol. 14: 29–47. Singh, H. 1996. Gene targeting reveals a hierarchy of transcrip- tion factors regulating specification of lymphoid cell fates. Curr. Opin. Immunol. 8: 160–165. Sun, L., A. Liu, and K. Georgopoulos. 1996. Zinc finger-medi- ated protein interactions modulate Ikaros activity, a molecu- lar control of lymphocyte development. EMBO J. 15: 5358– Ting, C.N., M.C. Olson, K.P. Barton, and J.M. Leiden. 1996. Transcription factor GATA-3 is required for development of the T-cell lineage. Nature 384: 474–478. Tsai, S., S. Bartelmez, E. Sitnicka, and S. Collins. 1994. Lym- phohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid develop- ment. Genes & Dev. 8: 2831–2841. Wang, J., H. Walker, Q. Lin, N. Jenkins, N.G. Copeland, T. Watanabe, P.D. Burrows, and M.D. Cooper. 1996. The mouse BP-1 gene: Structure, chromosomal localization, and 796 GENES & DEVELOPMENT Errata Genes & Development 11: 3265–3276 (1997) The Xenopus Brachyury promoter is activated by FGF and low concentrations of activin and suppressed by high concentrations of activin and by paired-type homeodomain proteins Branko V. Latinkic ´ , Muriel Umbhauer, Kathy A. Neal, Walter Lerchner, James C. Smith, and Vincent Cunliffe The first author’s name was spelled incorrectly in this article. It is correct here. Genes & Development 12(6) March 15, 1998 The cover headline and caption for this issue were incorrect. The headline should read: Regulation of the cell division protein FtsZ in Caulobacter. The correct caption is printed below. Cover Caulobacter crescentus and the cell division initiation protein FtsZ through the cell cycle. Shown are electron micrographs of Caulobacter (top) and immunofluorescence analysis of FtsZ (bottom) at different stages through the cell cycle. The cell cycle initiates with a swarmer cell (left) that contains a single polar flagellum (wavy line), which differentiates into a stalked cell (third from left) by shedding the flagellum and synthesizing a stalk at the same pole. The predivisional cell (fourth from left) contains a single flagellum synthesized at the pole opposite the stalk. Cell division produces a swarmer cell and stalk cell (right). The replication-competent stalk cell contains FtsZ, whereas the replication-incompetent swarmer cell lacks FtsZ. (For details, see Kelly et al., p. 880.) Genes & Development 12: 782–796 (1998) Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, Karen E. Brown, Christopher A. Klug, Robert Lee, Koichi Akashi, Irving L. Weissman, Amanda G. Fisher, and Stephen T. Smale The name of Irving L. Weissman was spelled incorrectly in the Table of Contents of this issue. It is correct here. Genes & Development 12(7) The cover headline and caption for this issue were incorrect. The headline should read: Role of CBP in C. elegans embryonic differentiation The correct caption is printed below. Cover Expression and phenotypic analysis of CBP-1 in Caenorhabditis elegans. Shown are Nomarski images of wild-type (top left) and cbp-l mutant (top right) embryos. The mutant embryo produces many small cells and shows no evidence of mesodermal, endodermal, or hypodermal tissue organization. The small cells are reminiscent of neuronal cells, and immunostaining with antibodies against UNC-86, a neuronal differentiaton-specific protein, of wild-type (bottom left) and cbp-l (bottom right) reveals an increase in the number of neuronal precursors in mutant embryos. (For details, see Shi and Mello, p. 943). 1240 GENES & DEVELOPMENT 12:1240–1241 © 1998 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/98 $5.00; www.genesdev.org Erratum Genes & Development 12: 304–315 (1998) inscuteable and numb mediate asymmetric muscle progenitor cell divisions during Drosophila myogenesis Ana Carmena, Bernadette Murugasu-Oei, Devi Menon, Fernando Jime ´ nez, and William Chia Figure 6 of this article should have appeared in color. The correct figure and legend appear below. Figure 6. The fate of the progeny from P2, P15, and P17 progenitors in wild-type, P49 3 insc , and numb embryos. Embryos were double stained for Eve (red) and Kr (green). Stage 12 (A–F8) and stage 14 (G–I) P49 3 wild-type (A,G), insc (B–D,H), and nb (E–F8,I) embryos are shown. (A) Three con- secutive wild-type hemisegments at mid- to late-stage 12. At this stage, the two EPC + + (red) are already present. The Kr Eve FDA1 (yellow) and the Kr FDO1 (green) are P49 also evident. (B–D)In insc embryos, the incomplete expressivity of the mutant phe- notype is evident in different hemiseg- ments and is characterized by duplication of FDO1 (B), loss of the two EPC (C,*), and duplication of the FDA1 (D). (E–F8) The op- posite phenotype is found in nb embryos: Two FEPCs are detected at early stage 12, which are enlarging to divide (E), and no putative FDA1 and FDO1 are detected that express Eve and/or Kr. At mid-stage 12, extra EPCs are detected (F’). (F,F8) Two different focal planes of the same mutant hemisegment at mid-stage 12. (F) The FDA1 (yellow cells) is losing Eve and Kr expression; likewise, Kr expression is decaying in both siblings produced by division of P17 (arrows). (G) The P49 characteristic pattern of EPC and precursors of DA1 and DO1 in a wild-type embryo at stage 14. (H)Inan insc embryo, loss of EPC (*) and duplication of the precursors of muscles DA1 (yellow syncytia, arrows) and DO1 (green syncytia, arrows) are evident. (I) The opposite phenotype is observed in a nb embryo; extra EPCs and the absence of DA1 and DO1 muscle precursors. GENES & DEVELOPMENT 1241 Downloaded from genesdev.cshlp.org on November 18, 2021 - Published by Cold Spring Harbor Laboratory Press Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin Kyungmin Hahm, Bradley S. Cobb, Aaron S. McCarty, et al. Genes Dev. 1998, 12: Errata for vol. 12, p. 782 Related Content Genes Dev. April , 1998 12: 1240 This article cites 40 articles, 18 of which can be accessed free at: References http://genesdev.cshlp.org/content/12/6/782.full.html#ref-list-1 Articles cited in: http://genesdev.cshlp.org/content/12/6/782.full.html#related-urls License Receive free email alerts when new articles cite this article - sign up in the box at the top Email Alerting right corner of the article or click here. Service Cold Spring Harbor Laboratory Press

Journal

Genes & Development – Unpaywall

Published: Mar 15, 1998

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin

References (41)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies