Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Mechanism of origin unwinding: sequential binding of DnaA to double‐ and single‐stranded DNA

Mechanism of origin unwinding: sequential binding of DnaA to double‐ and single‐stranded DNA The EMBO Journal Vol. 20 No. 6 pp. 1469-1476, 2001 Mechanism of origin unwinding: sequential binding of DnaA to double- and single-stranded DNA 1 2 DnaA is required for the unwinding reaction, and the Christian Speck and Walter Messer biochemical mechanism for this basic step in the initiation Max-Planck-Institut fiir molekulare Genetik, Ihnestrasse 73, of replication is unknown. D-14195 Berlin, Germany ADP- and ATP-DnaA bind similarly to 9mer DnaA 'Present address: Cold Spring Harbor Laboratory, Cold Spring Harbor, boxes (Schaper and Messer, 1995). We have shown NY 11724, USA recently that ATP-DnaA, in addition, has a binding Corresponding author specificity for a 6mer consensus sequence, 5'-AGatct, e-mail: [email protected] not seen with ADP-DnaA (Speck et al., 1999), which we called an ATP-DnaA box. ATP-DnaA boxes are low­ The initiator protein DnaA of Escherichia coli binds affinity binding sites, and binding to them requires the to a 9mer consensus sequence, the DnaA box presence of a 9mer high-affinity binding site close by. In (5'-TT /TNCACA). If complexed with ATP it adopts the dnaA promoter region, cooperative binding of ATP­ a new binding specificity for a 6mer consensus DnaA to 9mer DnaA boxes and 6mer ATP-DnaA boxes is sequence, the ATP-DnaA box (5'-AGatct). Using required for efficient repression (Speck et al., 1999). In DNase footprinting and surface plasmon resonance we this paper we analyze the interaction of ATP-DnaA protein show that binding to ATP-DnaA boxes in the AT-rich with the AT-rich region of oriC. We show that ATP-DnaA region of oriC of E.coli requires binding to the 9mer binds sequentially to the 9mer DnaA box Rl, to the AT­ DnaA box Rl. Cooperative binding of ATP-DnaA to rich region, and to single-stranded ATP-DnaA boxes in the AT-rich region results in its unwinding. ATP­ this sequence. We incorporate the results in a model for the DnaA subsequently binds to the single-stranded unwinding reaction. region, thereby stabilizing it. This demonstrates an additional binding specificity of DnaA protein to single-stranded ATP-DnaA boxes. Binding affinities, Results as judged by the DnaA concentrations required for site protection in footprinting, were ~ 1 nM for DnaA A TP- and ADP-DnaA bind differently to the AT-rich box Rl, 400 nM for double-stranded ATP-DnaA boxes region in oriC and 40 nM for single-stranded ATP-DnaA boxes, The AT-rich region in the replication origin oriC of E.coli respectively. We propose that sequential recognition contains three 13mer repeats and the so-called AT cluster of high- and low-affinity sites, and binding to single­ adjacent to DnaA box Rl (Bramhill and Komberg, 1988; stranded origin DNA may be general properties of Asai et al., 1990). Within this fragment are four sequences initiator proteins in initiation complexes. that conform to the consensus sequence for ATP-DnaA Keywords: DNA unwinding element/ariC/protein-DNA boxes. Each of the 13mer repeats starts with a GATC Dam interaction/replication initiation/surface plasmon recognition site that is also part of a potential ATP-DnaA resonance box. Binding of ATP- and ADP-DnaA to this fragment was analyzed by DNase I footprinting. A 428 bp PCR fragment containing DnaA box Rl and Introduction the AT-rich region of oriC was generated using primer Bacterial initiation of replication is characterized by Prl, 5'-end-labeled with P, and primer Pr2, respectively. sequential steps (Komberg and Baker, 1992). The initiator The labeled fragment was incubated with increasing protein DnaA binds to 9mer DnaA boxes, five in the case concentrations of ATP- or ADP-DnaA, probed with of Escherichia coli and 15 for Bacillus subtilis. In the DNase I, and subjected to electrophoresis on a sequencing presence of DNA-structuring proteins HU or IHF, and gel (see Materials and methods). As shown in Figure 1, provided that DnaA protein is complexed with ATP, this both ADP- and ATP-DnaA already protected the DnaA leads to a local unwinding of the AT-rich region in the box Rl at the lowest DnaA concentration (150 nM). vicinity of the DnaA boxes (Bramhill and Komberg, 1988; ADP-DnaA did not show any additional protection, even Gille and Messer, 1991; Hwang and Komberg, 1992; at the highest concentration (600 nM). ATP-DnaA, on Krause et al., 1997). The unwound region provides the the contrary, bound to the AT-rich region, starting at substrate for the loading of the replicative helicase, DnaB 300 nM, and showed partial protection of the whole in the case of E.coli, and the landing zone for all other segment from the AT cluster to the rightmost 13mer proteins that form the replication fork (Fang et al., 1999). starting at 400 nM. This suggests a cooperative binding of Initially 28 bp are unwound, both in E.coli and in B.subtilis ATP-DnaA to the AT-rich region. A concentration of oriC, followed by 16-25 additional base pairs upon 400 nM corresponds approximately to the in viva ATP­ addition of single-stranded DNA-binding (SSB) protein DnaA concentration at the time of initiation (Hansen et al., (Krause and Messer, 1999). So far, it is not clear why ATP- 1991; Kurokawa et al., 1999). © European Molecular Biology Organization 1469 C.Speck and W.Messer (i) Kinetic constants can only be determined for 1: 1 DnaA-ADP D11aA -ATP interactions, using the Langmuir binding model, since correct assignment of a binding model is too error prone for more complex reactions. It is, however, possible to recognize a complex, potentially cooperative interaction from the shape of the sensorgrams. (ii) Escherichia coli DnaA tends to bind non-specifically to the carboxymethyl dextran matrix of the sensor chips, since it is a very basic protein. Therefore, we can not probe concentrations > 100 nM. In contrast, we used 600 nM as the highest concentration for the DNase I footprints. Oligonucleotides with variants of DnaA box Rl were analyzed for their binding kinetics and stoichiometry with ATP-and ADP-DnaA protein. Representative binding experiments are shown in Figure 2. ADP-DnaA bound to a fragment with a wild-type DnaA box Rl with 1:1 kinetics and a stoichiometry of 1. The equilibrium dissociation constant was 3 nM, which is similar to results found by band-shift experiments (Schaper and Messer, 1995). ATP­ DnaA showed complex binding kinetics, compatible with cooperative binding, and a stoichiometry ;;,,2, although saturation of the binding reaction was not reached. When saturation of a reaction is approached, the injection of higher protein concentrations does not result in the binding of proportionally more protein to the DNA. This is visible as compression of the curves in the sensorgrams, which is seen with ADP-DnaA, but clearly not in the sensorgrams of ATP-DnaA shown in Figure 2. If DnaA box Rl was scrambled, ADP-DnaA could not bind and ATP-DnaA bound very inefficiently. Surprisingly, inversion of DnaA box Rl gave similar results to the wild-type configuration. The results show that ATP-DnaA, but not ADP-DnaA, can Fi g . 1. DNase I footprint of the AT-rich region. DNase I footprinting was performed using a 5'-end-labeled 428 bp PCR DNA fragment. bind to the AT-rich region in a presumably cooperative Increasing amounts of ATP- or ADP-DnaA were added, giving final manner. A wild-type DnaA box Rl is required for the concentrations of 150, 300, 350, 400, 450, 500, 550 and 600 nM. reaction as an anchor point, in agreement with genetic Incubation was for 10 min at 37 C. DnaA box Rl, the AT cluster and experiments (Langer et al., 1996). the three 13mers are indicated by bars; the lower strands are shown. The 13mer region contains several GATC recognition sites for Dam methyltransferase, and methylation of these Binding of A TP-DnaA to the AT-rich region sites is required for efficient replication initiation (Messer requires the presence of DnaA box R1 et al., 1985). In order to analyze whether methylated ATP­ For a more detailed analysis of complex formation at the DnaA boxes are a better substrate for ATP-DnaA, we AT-rich region of oriC, we determined the kinetics and the methylated the fragment with Dam methyltransferase stoichiometry of the complexes using surface plasmon in vitro, and subjected it to the same SPR analysis as resonance (SPR) with the BIAcore instrument. SPR shown in Figure 2. ATP-DnaA bound to the methylated measures the change in mass at the surface of a chip. fragment with an approximately three times higher Details of the technique as used for DnaA-DNA inter­ stoichiometry than to the unmethylated one (7:1 versus action have been described recently (Speck et al., 1999). 2: 1 at 75 nM DnaA). For SPR analysis we used a DNA fragment from oriC containing the AT-rich region, the AT cluster, all three A TP-DnaA also binds to the AT-rich region when it 13mers and DnaA box Rl (oriC coordinates 8-94; all oriC is single stranded coordinates refer to Buhk and Messer, 1983; Figure 2). DnaA-mediated unwinding is only observed with super­ Oligonucleotides were chemically synthesized with a coiled template. In order to be able to measure DnaA biotin label at one 5' -end, and were bound to a binding to an unwound AT-rich region, we constructed streptavidin-coated chip. A flow of ATP- or ADP-DnaA artificial substrates. In one strand, these contained the was applied past the chip. The major advantage of this E.coli sequence of the whole AT-rich region and DnaA technique is that protein-DNA interactions can be moni­box Rl. In the other strand, the M and R 13mers were tored in real time, very accurately and very sensitively. replaced by the corresponding region from B.subtilis oriC A response of 1 RU (resonance unit) corresponds to (Krause and Messer, 1999), thereby avoiding hybridiz­ 2 2 1 pg/mmprotein or 0.73 pg/mmDNA, respectively ation in this segment ('bubble' substrate; Figure 3). (Speck et al., 1999). Since the BIAcore measures mass ADP-DnaA bound to all fragments that contained a differences, one can calculate the mean stoichiometry of wild-type DnaA box Rl with a stoichiometry of 1, the complexes at any given DnaA protein concentration. demonstrating that it binds to the double-stranded DnaA Limitations of the BIAcore technique are as follows. box but to no other part of the substrate. For ATP-DnaA 1470 Origin unwinding by DnaA 13-mers DnaAbox ATP-DnaA protein oligonucleotide ADP-DnaA protein senso:r ram ~ 0.5 - 75 nM sensor ram ~ 0.5 - 75 nM RU RU 200 200 1 2 170 170 140 140 R1 _____ I 1: I I: I !lO (2 2.0 If 20 -10 i---- -10 1-- - --- - �0 -+--,.-t--+-,-+-�t---,--+- ----i �-+----< �0 -.-t---t--.-+--t---+--.-<--+----i 0 100 20IJ 300 400 500 ,500 700 !IOO 0 100 200 300 400 500 600 700 BOO s 'Tim• 0.5 ® 0 1R 1 2.5 i i Fi . 2. Binding reactions of ATP- and ADP-DnaA protein to the AT-rich region of oriC as measured by SPR. The fragment used in these measurements is shown at the top. DnaA box Rl is indicated in light gray, ATP-DnaA boxes are in bold. The three 13mer repeats are boxed. The stoichiometry of the complexes obtained at a protein concentration of 75 nM is indicated in the figure as x:1 (protein:DNA). ATP- and ADP-DnaA protein binding is shown for the wild type (Rl), a DnaA box Rl mutant (M) and a fragment that contains an inverted DnaA box Rl (indicated as lR). One resonance unit corresponds to a change in mass of 1 pg/mm . Within each sensorgram, individual curves were obtained with protein concentrations (bottom to top) of 1.2, 2.3, 4.7, 9.4, 18.8, 37.5 and 75 nM. the binding kinetics and the stoichiometry were very region is clearly required for ATP-DnaA binding. The similar to a double-stranded fragment if the E.coli results, summarized in Figure 3, show that ATP-DnaA sequence was in the 'lower' strand, indicating that ATP­ binds cooperatively and with sequence specificity to DnaA can bind to single-stranded ATP-DnaA boxes. If the single-stranded DNA of the AT-rich region of oriC. E.coli sequence was in the 'upper' strand, cooperative binding seemed to be extreme. The stoichiometry was ;;;.6 DnaA domain 1 is not required for binding to at a DnaA concentration far from saturation. The dis­ ATP-DnaA boxes sociation rate was very slow, as seen from the slow It has been suggested that a truncated form of DnaA decrease of the curves after the protein flow was replaced protein without domain 1 is able to perform the unwinding by buffer. A similar fragment but with a scrambled reaction (Sutton et al., 1998). Domain 1 has been shown to sequence flanking the bubble, including a scrambled DnaA mediate oligomerization of DnaA (Weigel et al., 1999), box Rl, had similar binding characteristics. The 'lower' and it is involved in loading ofDnaB helicase (Sutton et al., strand also contained a scrambled sequence in this 1998; Seitz et al., 2000). DnaA without the oligomeriza­ fragment at the M and R 13mers (Figure 3, E.c./N's tion domain 1 can, however, bind cooperatively to Rl -). This means that once the region is unwound, i.e. for adjacent DnaA boxes (Messer et al., 1999; Jakimowicz DnaA binding to single-stranded 13mers, the anchor point et al., 2000; Majka et al., 2001). For an analysis of the at Rl is no longer required. If both the flanking region and binding characteristics of DnaA protein lacking domain 1, the bubble contained a scrambled sequence, and no E.coli­ DnaA[87--467] with an N-terminal His tag, we deter­ specific 13mers but an intact DnaA box Rl (Figure 3, mined the stoichiometry of binding using the double­ N' s/N' s ), both forms of DnaA bound with a stoichiometry stranded oriC substrate used in the experiment shown in of only 1, i.e. to the DnaA box Rl. This means that the Figure 2. Table I shows that this DnaA deletion derivative specific E.coli or B.subtilis sequence in the single-stranded bound identically to wild type, with a higher stoichiometry 1471 1.4 C.Speck and W.Messer olligonucleot1ide ADP-DnaA protein ATP-DnaA protei sensor ram ~ 0.5 - 75 nM sensor ram ~ 0.5 - 75 nM RU RU 280 280 B.s ./E.c. 200 200 GI .. � 120 120 80 60 I I 40 40 a: 0- -to -<40 --i- -1 --,--.-, �-;- -,-- ( 0 100 200 300 ,400 500 600 700 800 D 100 200 JOO <100 500 600 700 800 Time s Time s RU RU 700 700 E.cJB.s. • 380 ., 380 ;u l 220 -100 +--+---r--+-+-.-,. - �t O 100 200 300 400 500 600 700 800 o 100 200 300 400 &ID 600 700 800 s Time N's/N's E.c./N's R1- J& Fig. 3. Binding reactions of ATP- and ADP-DnaA protein to an artificial bubble as measured by SPR. At the top, a version of the artificial bubble DNA is indicated. The DnaA box Rl is indicated in gray, the three 13mers are boxed and the ATP-DnaA boxes are shown in bold. The upper strand corresponds to the E.coli sequence. In the lower strand, the M and R 13mers were replaced by the corresponding region from B.subtilis oriC (Krause and Messer, 1999), thereby avoiding hybridization in this segment. The stoichiometry of the complexes obtained at a protein concentration of 75 nM is indicated in the figure as x: 1 (protein:DNA). Fragments that contain scrambled sequences in the lower or upper strand of the bubble or in the flanking sequence are indicated by N's. One resonance unit corresponds to a change in mass of 1 pg/mm . Within each sensorgrarn, individual curves were obtained with protein concentrations (bottom to top) of 1.2, 2.3, 4.7, 9.4, 18.8, 37.5 and 75 nM. for the ATP form. A derivative containing the DNA single-strand specific nuclease PI (Figure 4, tracks without binding domain 4 only bound with a stoichiometry of 1: 1. ATP-DnaA). In order to determine DnaA protein binding This is not surprising since this protein lacks the ATP­ to single-stranded DNA by an independent method, we binding site. developed a nuclease PI footprinting technique. ATP­ DnaA already protected the 'bubble' at a concentration of DnaA protein protects the single-stranded AT-rich 40 nM, both in the 'upper' and in the 'lower' strand region against cleavage by nuclease P1 (Figure 4 ). Protection of the 'upper' strand extended over The non-complementary 'bubble' region of the E.coli­ the middle and right 13mer, covering nearly the whole B.subtilis hybrid substrate is susceptible to cleavage by the single-stranded region. On the 'lower' strand, only a part 1472 Origin unwinding by DnaA AT L M R R1 Table I. Stoichiometry of DnaA derivatives with the AT-rich region Protein ADP form ATP form Wild-type DnaA 1:1 2.2:1 DnaA[87--467]-His 1:1 2.2:1 DnaA[335--467]• 1:1 •Numbers in square brackets indicate expressed amino acid residues. ATP-DnaA ATP·OnaA ''1! 1'? I R1 �! •5!.,� Fig. 5. A model describing the DnaA-dependent unwinding reaction at oriC. The DnaA box Rl and the three 13mers are labeled. The six R ATP-DnaA boxes are indicated by small gray boxes. Initially, DnaA protein binds with a high affinity to DnaA box Rl. This complex B serves as an anchor for cooperative binding of ATP-DnaA to the ATP­ DnaA boxes, positioning the protein to the region of unwinding. The formation of this complex needs high concentrations of ATP-DnaA protein and can be considered, therefore, as the rate-limiting reaction in unwinding. Single-stranded DNA resulting from unwinding will then be stabilized by cooperative binding of ATP-DnaA. The affinity of ATP-DnaA is higher to single-stranded ATP-DnaA boxes than to double-stranded ATP-DnaA boxes. AT-rich part and two just left of it (Figure 5). Also, B.subtilis oriC has several ATP-DnaA boxes in its AT-rich region with about the same spacing but a slightly different sequence. We have probed this chromosome segment by DNase I footprinting, SPR and nuclease Pl footprinting. DNase I footprinting shows that ATP-DnaA, but not ADP­ DnaA, binds to the AT-rich region of E.coli oriC with high AT cooperativity. Protection against digestion was obtained with 300-400 nM ATP-DnaA. This is about the in viva lO'M!r strand upper strand concentration of ATP-DnaA at the time of initiation (Hansen et al., 1991; Kurokawa et al., 1999). This is Fig. 4. Nuclease Pl footprint of the artificial bubble substrate and compatible with the notion that the concentration of ATP­ ATP-DnaA. Nuclease PI footprinting was performed using the DNA fragment shown in Figure 3 (top). The DNA was 5'-end-labeled. DnaA regulates initiation. Increasing amounts of ATP-DnaA were added, giving final concen­ SPR analysis allowed a definition of the quantitative trations of 10, 40, 75, 100 and 150 nM. Incubation was for 10 min ° aspects of complex formation between the oriC AT-rich C. DnaA box Rl, the AT cluster, the three 13mers (L, M and R) at 37 region and DnaA. ADP-DnaA bound to the single 9mer and the single-stranded region (B) are indicated by bars. DnaA box on the fragment used for the analysis with simple 1: 1 kinetics and a 1: 1 stoichiometry, and to no other part of the region. ATP-DnaA bound with a stoichiometry of the right 13mer and the middle 13mer were protected, >2 and exhibited complex binding kinetics suggesting and in only -50% of the DNA strands. In both strands a cooperative binding. Although for ATP-DnaA we could few single nucleotides were especially sensitive to the not reach the saturation level of the binding reaction, it is nuclease with and without DnaA. Binding of ATP-DnaA very clear that the stoichiometry was >2: 1. A wild-type also protected the single-stranded 'upper' strand of the 9mer DnaA box Rl was required, supporting the model AT-rich region against the action of DNase I (H.Seitz and that DnaA bound to Rl is used as an anchor that directs W.Messer, unpublished). cooperative binding of several additional ATP-DnaA molecules to the ATP-DnaA boxes in the vicinity. Until Discussion now there has been only an isolated and indirect obser­ The AT-rich region of E.coli oriC contains three 13mer vation suggesting binding of DnaA to this region. DnaA repeats, each of them starting with a GATC site that is part binding to oriC, as measured by filter binding, could of a potential ATP-DnaA box. In total, there are six be competed by a 13mer-containing double-stranded potential ATP-DnaA boxes in this region, four within the oligonucleotide (Yung and Komberg, 1989). 1473 C.Speck and W.Messer In E.coli and other Enterobacteriaceae, Dam methyl­ stabilize the unwound DNA. Factors that influence the ation of GATC sites regulates replication initiation in two stability of base pairing in the AT-rich region are the ways. Shortly after replication, origins are exempt from temperature and the degree of supercoiling of the origin re-initiation because hemimethylated oriC DNA is seques­ domain, which is in part influenced by divergent tran­ tered (Ogden et al., 1988; Campbell and Kleckner, 1990) . scription, i.e. transcriptional activation. The spatial In addition, fully methylated GATC sites are required for arrangement of the different binding sites is also import­ optimal oriC function (Messer et al., 1985). Our obser­ ant, as is the ability of the initiator protein to bind vation that the Dam-methylated AT-rich region binds sequentially to high- and low-affinity sites, as shown here. ATP-DnaA with higher stoichiometry at non-saturating The importance of all these factors has been demonstrated concentrations, i.e. with higher affinity, may be an for E.coli oriC and for other origins. The DUE is an explanation for the latter effect. essential cis-acting element of oriC (Kowalski and Eddy, ATP-DnaA bound with especially high cooperativity to 1989), the degree of supercoiling determines the initiation single-stranded DNA from the AT-rich region. The 9mer competence of oriC (for review see Messer and Weigel, DnaA box Rl was no longer required. However, the 1996) , and transcriptional activation is required in viva specific sequence of the AT-rich region was essential. (Messer, 1972) and under near-physiological conditions Substrates with the E.coli sequence in the top strand in vitro (Skarstad et al., 1990) . DnaA box Rl is essential were more effective than the complementary substrates. (Langer et al., 1996), as is its precise distance to the AT­ ATP-DnaA could protect both strands of an artificial rich region (Hsu et al., 1994) . Finally, as shown here, the single-strand 'bubble' substrate against cleavage by ability of DnaA protein to acquire additional binding specificities upon interaction with ATP, binding to double­ single-strand-specific nuclease Pl. Protection was detec­ ted at a concentration of 40 nM. In comparison, ATP­ stranded 6mer ATP-DnaA boxes and to single-stranded DnaA boxes in the double-st randed form were protected at ones, ensures that the DnaA-oriC complex is assembled much higher concentrations, 400 nM, indicating a higher first at the five high-affinity DnaA boxes and then becomes affinity of ATP-DnaA for single-stranded DNA. activated at the correct time in the cell cycle. Once the All these experiments, footprints and SPR analysis show correct number of ATP-DnaA monomers has assembled, unambiguously that ATP-DnaA binds to the AT-rich low affinity of double-stranded and moderate affinity of region in single-and double-st randed form. single-st randed recognition sites follow s. We suggest that From these results we propose a new model for the such a sequential recognition and cooperative interaction mechanism of origin unwinding (Figure 5). Initial binding may be a general method to accomplish specific position­ is directed to the high-affinity 9mer DnaA boxes. One of ing of complexes on sequences with low binding affinity, these, DnaA box Rl, is most important since it serves as an like the 13mer repeats. anchor for cooperative binding of ATP-DnaA to the 6mer The crucial role of the ATP form of DnaA allows a ATP-DnaA boxes in the still double-stranded AT-rich cyclic regulation. Upon synthesis, DnaA protein is likely region. Interaction with the ATP-DnaA boxes depends on to be in its ATP form since the cellular ATP concentration a high ATP-DnaA concentration. DNA unwinding was is high. In this form, it is initiation competent and active as detected in vitro at a concentration similar to that at which an autorepressor (Speck et al., 1999). At the end of the we found moderate protection of the AT-rich region. This initiation cycle, the ATPase activity of DnaA is induced suggests that binding to ATP-DnaA boxes reflects a by the loading of the �-subunit of DNA polymerase III, molecular barrier for the following steps, and with that thereby inactivating DnaA protein for further initiation presumably regulates the time point of initiation. The AT­ (Katayama et al., 1998). rich region overlaps with a sequence that is thermo­ We propose that the mechanism of origin unwinding dynamically unstable, as seen in vitro by an opening of the outlined here is universal throughout all organisms. All 2+ DNA helix in the absence of Mg ions. This sequence has eubacteria have DnaA proteins, and many bacteriophages been called a DNA unwinding element (DUE) (Kowalski (Dodson et al., 1986) and plasmids (Helinski et al., 1996) have comparable origins and initiator proteins. Eukaryotic and Eddy, 1989) . The ATP-DnaA-13mer complex viruses like SV 40, polyoma or papilloma have origins with destabilizes the DNA helix such that it promotes unwind­ ing under physiological salt conditions. This could be by a initiator binding sites, a DUE element and AT-rich regions breathing of the region or by a sudden unwinding of the (DePamphilis, 1996) . Their initiator proteins are func­ whole segment (Kowalski et al., 1988). The unwound tional equivalents of DnaA protein in the sense that they region is then stabilized by binding of additional ATP­ recognize the origin, unwind DNA and initially stabilize DnaA molecules to single-st randed ATP-DnaA boxes. The the single-stranded DNA before further stabilization by affinity of ATP-DnaA for single-stranded ATP-DnaA replication protein A (RPA) (Wessel et al., 1992). Yeast boxes is -10 times higher than for double-st randed ATP­ is the paradigm for origins active in the initiation of DnaA boxes, as judged from the footprints. In addition, the eukaryotic genome replication. Here also, AT-rich regions ATP-DnaA-single- stranded ATP-DnaA box complex is and a DUE are associated with an initiator binding site characterized by a very slow dissociation rate (Figure 3). that accepts a six-protein origin recognition complex Therefore, the single-st randed nature of the complex is (ORC) . In addition, ORC binds like DnaA to single­ guaranteed. The model is illustrated in Figure 5. stranded DNA, and a change in the double- and The critical elements of a replication origin are, thus, the single-strand-specific conformation of ORC is associated presence of the initial initiator binding site(s), secondary with an ATP/ADP switch (Lee and Bell, 2000 ; Lee et al., binding sites (e.g. ATP-DnaA boxes) that augment the 2000) . ORCs and corresponding origins, which may thermodynamic instability of a DUE, and a tertiary (Abdurashidova et al., 2000) or may not be AT rich binding site(s) within the single-stranded DNA to finally (Delgado et al., 1998), have been found in all metazoa that 1474 Origin unwinding by DnaA CTCTTATTTCCTAGCGTGACGGGACACCTATTGTTCCT; Mut all, have been studied, e.g. Drosophila, Xenopus and mam­ bubble wt lo, 5'-AGGAACAATAGGTGTCCCGTCACGCTAGGA­ mals (for review see DePamphilis, 1999; Ritzi and ATTACTTCTACTATTTTTTATAAATATGATTTATTTATCTAGA­ Knippers, 2000). It seems to be common to all initiator AGAAAAATTATGGG. proteins that they recognize a double-stranded binding Nuclease P1 protection assays site, build a larger complex that promotes helical instabil­ Nuclease Pl footprints were performed similarly to the DNase I ity, and finally stabilize the unwound region by binding to protection assays. DNA fragments were generated by annealing two the single-stranded DNA (e.g. DnaA, SV40 and probably complementary oligonucleotides, including an artificial single-stranded ORC). It is not yet clear whether all initiator proteins have region as shown in Figure 3. Before annealing, oligonucleotides were a weaker affinity for the double-stranded AT-rich region, 5' -end-labeled with P and T4 polynucleotide kinase. Binding reactions were carried out with 0.2 ng of labeled double-stranded DNA in 20 µI of as shown here for the DnaA protein, but it seems to be the binding buffer (25 mM HEPES pH 7.6, 100 mM potassium acetate, favorable to bring the initiator into close proximity to the 5 mM magnesium acetate, 4 mM dithiothreitol, 0.2% Triton X-100, unwound region in order to quickly stabilize the unwound 0.5 mg/ml bovine serum albumin, 100 µM ATP or ADP) and the DNA for subsequent helicase loading. indicated amounts of ATP- or ADP-DnaA. Mixtures were incubated at 37 C for 10 min, nuclease Pl (0.00005 U) was added, and samples were incubated at 37 C for 4 min. After addition of an equal volume of stop Materials and methods buffer (1 % SDS, 200 mM NaCl, 20 mM EDTA pH 8.0, 1 mg/ml glycogen), the samples were purified by phenol/chloroform extraction, Chemical s, proteins and oligonucleotides DNA was precipitated with ethanol and resuspended in 1 µI of TE buffer Standard chemicals were obtained from Sigma (St Louis, MO) or Merck (10 mM Tris-HCI pH 8.0, 0.1 mM EDT A). Following the addition of 5 µl (Darmstadt, Germany), and radioactive [y- P]ATP (3000 Ci/mmol) from of sequencing gel loading buffer (98% formamide, 0.025% bromophenol Amersham (Little Chalfant, UK). Restriction enzymes were supplied by blue, 0.025% xylene cyanol), samples were incubated at 96 C for 5 min Roche Molecular Biochemicals (Mannheim, Germany) or New England and loaded onto 8% sequencing gels. After electrophoresis, gels were Biolabs (Beverly, MA). Oligonucleotides used for PCR and BIAcore dried and analyzed in a Phosphorlmager (Molecular Dynamics). were chemically synthesized (Metabion, Martinsried, Germany). Nuclease PI was from Roche Molecular Biochemicals (Mannheim, Germany). DnaA[87--467]-His protein was constructed by inserting into Acknowledgements the Sall and PstI sites of pdnaA116DnaA[87--467] (Weigel et al., 1999) a double-stranded oligonucleotide (upper, 5'-TCGAGCCATCATCAT­ We thank F.Blaesing, I.Majka, J.Nardmann, H.Seitz and C.Weigel for CATCATCATCATGCA; lower, 5' -GATGATGATGATGATGATGGC) many stimulating discussions. This work was supported by grant Me 659/ encoding a His tag. Wild-type DnaA and DnaA[87--467]-His protein 6 6 6-1 of the Deutsche Forschungsgemeinschaft. were overexpressed from plasmid pdnaA116 and purified as described (Krause et al., 1997). DnaA[335--467]-His was a gift from S.Schaper. Standard methods were used for DNA manipulations (Sambrook et al., 1989). References Abdurashidova,G., Deganuto,M., Klima,R., Riva,S., Biamonti,G., DNase I protection assays Giacca,M. and Falaschi,A. (2000) Start sites of bidirectional DNA DNase I protection assays were performed as described (Galas and synthesis at the human Jamin B2 origin. Science, 287, 2023-2026. Schmitz, 1978). The DNA fragment used in the footprints was amplified Asai,T., Takanami,M. and Imai,M. (1990) The AT richness and gid using the primers Prl (5'-GCCTTTGAGTGAGCTGATACCGCT­ transcription determine the left border of the replication origin of the TCCTTGTTATCCACAGGGCAGTGCG) and Pr2 (5'-CGAGCGCAG­ 32 E. coli chromosome. EMBO J. , 9, 4065--4072. CGAGTCAGTGAG). Primer Prl was 5'-end-labeled with P; Brarnhill,D. and Komberg,A. (1988) Duplex opening by dnaA protein at nucleotides 1-25 represent a sequence not present in ori C to provide a novel sequences in initiation of replication at the origin of the E.coli neutral spacer between the 5'-end label and DnaA box Rl. chromosome. Cell, 52, 743-755. Buhk,H.J. and Messer,W. (1983) Replication origin region of Surface plasmon resonance Escherichia coli: nucleotide sequence and functional units. Gene, SPR was determined using a BIAcore 2000 instrument (BIAcore AB, 24, 265-279. Uppsala, Sweden) as described, with minor modifications (Speck et al., Campbell,J.L. and Kleckner,N. (1990) E.coli ori C and the dnaA gene 1999). Samples in a concentration range of 1.2-75 nM DnaA were promoter are sequestered from dam methyltransferase following the injected using the Kinj ect command defining an association time of 140 s passage of the chromosomal replication fork. Cell, 62, 967-979. and a dissociation time of 450 s. Reactions were at 22 C. For data analysis Delgado,S., Gomez,M., Bird,A. and Antequera,F. (1998) Initiation of we used the BIAevaluation 3.0 program (BIAcore AB, Sweden, Uppsala). DNA replication at CpG islands in mammalian chromosomes. The following oligonucleotides were used (for oligonucleotides that EMBO J., 17, 2426-2435. base pair completely only the biotinylated strand is shown): wt up, DePamphilis,M.L. (1996) Origins of DNA replication. In 5'-GGGTATTAAAAAGAAGATCTATTTATTTAGAGATCTGTTCT­ DePamphilis,M.L. (ed.), DNA Replication in Eukaryotic Cells. Cold ATTGTGATCTCTTATTAGGATCGCACTGCCCTGTGGATAACAA­ Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 45-86. GGA; Rl Mut up, 5'-GGGTATTAAAAAGAAGATCTATTTATTTAG­ DePamphilis,M.L. (1999) Replication origins in metazoan chromo­ AGATCTGTTCTATTGTGATCTCTTATTAGGATCGCACTGCCCG­ somes: fact or fiction? BioEs says, 21, 5-16. CAAGGAAGCAAGGA; Rl inv up, 5'-GGGTATTAAAAAGAA Dodson,M., Echols,H., Wickner,S., Alfano,C., Mensa-Wilmot,K., GATCTATTTATTTAGAGATCTGTTCTATTGTGATCTCTTATTA Gomes,B., LeBowitz,J., Roberts,J.D. and McMacken,R. (1986) GGATCGCACTGCCCTTATCCACACAAGGA; B.s. in bubble up, Specialized nucleoprotein structures at the origin of replication of 5'-GGGTATTAAAAAGAAGATCTATTTATTTAGATATTTATAA­ bacteriophage A: localized unwinding of duplex DNA by a six-protein AAAATAGTAGAAGTAATAGGATCGCACTGCCCTGTGGATA­ reaction. Proc. Natl Acad. Sci. USA, 83, 7638-7642. ACA AGGA; B.s. in bubble lo, 5'-TCCTTGTTATCCACAGGGCAG­ TGCGATCCTATTACTTCTACTATTTTTTATAAATATCTAAAT­ Fang,L.H., Davey,M.J. and O' Donnell,M. (1999) Replisome assembly at oriC, the replication origin of E. coli, reveals an explanation for AAATAGATCTTCTTTTTAATACCC. initiation sites outside an origin. Mol. Cell, 4, 541-553. In order to scramble sequences flanking the bubble and/or within the bubble but keep the AT ratio, we used the lower strand 3'-sequence as the Galas,D. and Schmitz,A. (1978) Dnase footprinting: a simple method for upper strand 5'-sequence: Mut all bubble, Rl wt up, 5'-CCCATA­ determining protein-DNA binding specificity. Nucleic Acids Res., 5, ATTTTTCTTCTAGATAAATAAATCACGGTTACGCTAGCGTAGG­ 3157-3170. TGACTGACTCCTAGCGTCTGCCCTGTGGATAACAAGGA ;Mut all Gille,H. and Messer,W. (1991) Localized unwinding and structural bubble, Rl wt lo, 5'-TCCTTGTTATCCACAGGGCAGACGCTAGGA­ perturbations in the origin of replication, oriC, of Escherichia coli CATTCGACGAGCGTACGAGCGTCAGCGGATTTATTTATCTAG­ in vitro and in viva. EMBO J., 10, 1579-1584. AAGAAAAATTATGGG; Mut all, bubble wt up, 5'-CCCATA­ Hansen,F.G., Atlung,T., Braun,R.E., Wright.A., Hughes,P. and ATTTTTCTTCTAGATAAATAAATCAGATCTGT TCTATTGTGAT- Kohiyama,M. (1991) Initiator (DnaA) protein concentration as a 1475 C.Speck and W.Messer function of growth rate in Escherichia coli and Salmonella the DnaA and DnaB replication proteins of Escherichia coli. Mol. typ himurium. J. Bacterial., 173, 5194-5199. Micro bial., 37, 1270-1279. Skarstad,K., Baker,T.A. and Komberg,A. (1990) Strand separation Helinski,D.R., Toukdarian,A.E. and Novick,R.P. (1996) Replication required for initiation of replication at the chromosomal origin of control and other stable maintenance mechanisms of plasmids. In E.coli is facilitated by a distant RNA-DNA hybrid. EMBO J., 9, Neidhardt,F.C. et al. (eds), Escherichia coli and Salmonella: Cellular 2341-2348. and Molecular Biology. ASM Press, Washington, DC, pp. 2295-2324. Speck,C., Weigel,C. and Messer,W. (1999) ATP- and ADP-DnaA Hsu,J., Bramhill,D. and Thompson,C.M. (1994) Open complex protein, a molecular switch in gene regulation. EMBO J., 18, formation by DnaA initiation protein at the E.coli chromosomal 6169-6176. origin requires the 13-mers precisely spaced relative to the 9-mers. Sutton,M.D., Carr,K.M., Vicente,M. and Kaguni,J.M. (1998) Mol. Micro bial., 11, 903-911. Escherichia coli DnaA protein. The N-terminal domain and loading Hwang,D.S. and Komberg,A. (1992) Opening of the replication origin of of DnaB helicase at the E.coli chromosomal origin. J. Biol. Chem., Escherichia coli by DnaA protein with protein HU or IHF. J. Biol. 273, 34255-34262. Chem., 267, 23083-23086. Weigel,C., Schrnidt,A., Seitz,H., Tuengler,D., Welzeck,M. and Jakimowicz,D., Maj ka,J., Konopa,G., Wegrzyn,G., Messer,W., Messer,W. (1999) The N-terminus promotes oligomerisation of the Schrempf,H. and Zakrzewska-Czerwinska,J. (2000) Architecture of Escherichia coli initiator protein DnaA. Mol. Micro bial., 34, 53-66. the Streptomyces lividans DnaA protein-replication origin complexes. Wessel,R., Schweizer,]. and Stahl,H. (1992) Simian virus T-antigen J. Mol. Biol. , 298, 351-364. DNA helicase is a hexamer which forms a binary complex during Katayama,T., Kubota,T., Kurokawa,K., Crooke,E. and Sekimizu,K. bidirectional unwinding from the viral origin of DNA replication. (1998) The initiator function of DnaA protein is negatively J. Viral. , 66, 804-815. regulated by the sliding clamp of the E.coli chromosomal replicase. Yung,B.Y.M. and Komberg,A. (1989) The dnaA initiator protein binds Cell, 94, 61-71. separate domains in the replication origin of Escherichia coli. J. Biol. Komberg,A. and Baker,T.A. (1992) DNA Replicati on. W.H.Freeman and Chem., 264, 6146--6150. Co., New York, NY. Kowalski,D. and Eddy,M.J. (1989) The DNA unwinding element: a Received December 14, 2000; revised and accepted January 29, 2001 novel, cis-acting component that facilitates opening of the Escherichia coli replication origin. EMBO J., 8, 4335-4344. Kowalski,D., Natale,D.A. and Eddy,M.J. (1988) Stable DNA unwinding, not 'breathing' accounts for single-strand-specific nuclease hypersensitivity of specific A+T-rich sequences. Proc. Natl Acad. Sci. USA, 85, 9464-9468. Krause,M. and Messer,W. (1999) DnaA proteins of Escherichia coli and Bacillus subtilis: coordinate actions with single-stranded DNA­ binding protein and interspecies inhibition during open complex formation at the replication origins. Gene, 228, 123-132. Krause,M., Lurz,R., Riickert,B. and Messer,W. (1997) Complexes at the replication origin of Bacillus subtilis with homologous and heterologous DnaA protein. J. Mo/. Biol. , 274, 365-380. Kurokawa,K., Nishida,S., Emoto,A., Sekimizu,K. and Katayama,T. (1999) Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli. EMBO J., 18, 6642-6652. Langer,U., Richter,S., Roth,A., Weigel,C. and Messer,W. (1996) A comprehensive set of DnaA box mutations in the replication origin, oriC, of Escherichia coli. Mol. Micro bial., 21, 301-311. Lee,D.G. and Bell,S.P. (2000) ATPase switches controlling DNA replication initiation. Curr. Opin. Cell Biol. , 12, 280--285. Lee,D.G., Makhov,A.M., Klemm,R.D., Griffith,J.D. and Bell,S.P. (2000) Regulation of origin recognition complex conformation and ATPase activity: differential effects of single-stranded and double-stranded DNA binding. EMBO J., 19, 4774-4782. Majka,J., Zakrzewska-Czerwinska,J. and Messer,W. (2001) Sequence recognition, cooperative interaction and dimerization of the initiator protein DnaA of Streptomyces. J. Biol. Chem., in press. Messer,W. (1972) Initiation of DNA replication in E.coli Bir. Chronology of events and transcriptional control of initiation. J. Bacterial., 112, 7-12. Messer,W. and Weigel,C. (1996) Initation of chromosome replication. In Neidhardt,F.C. et al. (eds), Escherichia coli and Salmonella: Cellular and Molecular Biology. ASM Press, Washington, DC, pp. 1579-1601. Messer,W., Bellekes,U. and Lother,H. (1985) Effect of dam-methylation on the activity of the replication origin, oriC. EMBO J., 4, 1327-1332. Messer,W. et al. (1999) Functional domains of DnaA proteins. Biochimie, 81, 819-825. Ogden,G.B., Pratt,M.J. and Schaechter,M. (1988) The replicative origin of the E.coli chromosome binds to cell membranes only when hemimethylated. Cell, 54, 127-135. Ritzi,M. and Knippers,R. (2000) Initiation of genome replication: assembly and disassembly of replication-competent chromatin. Gene, 245, 13-20. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Clo ning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schaper,S. and Messer,W. (1995) Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem., 270, 17622-17626. Seitz,H., Weigel,C. and Messer,W. (2000) The interaction domains of http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Mechanism of origin unwinding: sequential binding of DnaA to double‐ and single‐stranded DNA

Speck, Christian; Messer, Walter
The EMBO Journal , Volume 20 (6) – Mar 15, 2001
Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/mechanism-of-origin-unwinding-sequential-binding-of-dnaa-to-double-and-XcL06s4pIR

References (63)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 2001
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1093/emboj/20.6.1469
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal Vol. 20 No. 6 pp. 1469-1476, 2001 Mechanism of origin unwinding: sequential binding of DnaA to double- and single-stranded DNA 1 2 DnaA is required for the unwinding reaction, and the Christian Speck and Walter Messer biochemical mechanism for this basic step in the initiation Max-Planck-Institut fiir molekulare Genetik, Ihnestrasse 73, of replication is unknown. D-14195 Berlin, Germany ADP- and ATP-DnaA bind similarly to 9mer DnaA 'Present address: Cold Spring Harbor Laboratory, Cold Spring Harbor, boxes (Schaper and Messer, 1995). We have shown NY 11724, USA recently that ATP-DnaA, in addition, has a binding Corresponding author specificity for a 6mer consensus sequence, 5'-AGatct, e-mail: [email protected] not seen with ADP-DnaA (Speck et al., 1999), which we called an ATP-DnaA box. ATP-DnaA boxes are low­ The initiator protein DnaA of Escherichia coli binds affinity binding sites, and binding to them requires the to a 9mer consensus sequence, the DnaA box presence of a 9mer high-affinity binding site close by. In (5'-TT /TNCACA). If complexed with ATP it adopts the dnaA promoter region, cooperative binding of ATP­ a new binding specificity for a 6mer consensus DnaA to 9mer DnaA boxes and 6mer ATP-DnaA boxes is sequence, the ATP-DnaA box (5'-AGatct). Using required for efficient repression (Speck et al., 1999). In DNase footprinting and surface plasmon resonance we this paper we analyze the interaction of ATP-DnaA protein show that binding to ATP-DnaA boxes in the AT-rich with the AT-rich region of oriC. We show that ATP-DnaA region of oriC of E.coli requires binding to the 9mer binds sequentially to the 9mer DnaA box Rl, to the AT­ DnaA box Rl. Cooperative binding of ATP-DnaA to rich region, and to single-stranded ATP-DnaA boxes in the AT-rich region results in its unwinding. ATP­ this sequence. We incorporate the results in a model for the DnaA subsequently binds to the single-stranded unwinding reaction. region, thereby stabilizing it. This demonstrates an additional binding specificity of DnaA protein to single-stranded ATP-DnaA boxes. Binding affinities, Results as judged by the DnaA concentrations required for site protection in footprinting, were ~ 1 nM for DnaA A TP- and ADP-DnaA bind differently to the AT-rich box Rl, 400 nM for double-stranded ATP-DnaA boxes region in oriC and 40 nM for single-stranded ATP-DnaA boxes, The AT-rich region in the replication origin oriC of E.coli respectively. We propose that sequential recognition contains three 13mer repeats and the so-called AT cluster of high- and low-affinity sites, and binding to single­ adjacent to DnaA box Rl (Bramhill and Komberg, 1988; stranded origin DNA may be general properties of Asai et al., 1990). Within this fragment are four sequences initiator proteins in initiation complexes. that conform to the consensus sequence for ATP-DnaA Keywords: DNA unwinding element/ariC/protein-DNA boxes. Each of the 13mer repeats starts with a GATC Dam interaction/replication initiation/surface plasmon recognition site that is also part of a potential ATP-DnaA resonance box. Binding of ATP- and ADP-DnaA to this fragment was analyzed by DNase I footprinting. A 428 bp PCR fragment containing DnaA box Rl and Introduction the AT-rich region of oriC was generated using primer Bacterial initiation of replication is characterized by Prl, 5'-end-labeled with P, and primer Pr2, respectively. sequential steps (Komberg and Baker, 1992). The initiator The labeled fragment was incubated with increasing protein DnaA binds to 9mer DnaA boxes, five in the case concentrations of ATP- or ADP-DnaA, probed with of Escherichia coli and 15 for Bacillus subtilis. In the DNase I, and subjected to electrophoresis on a sequencing presence of DNA-structuring proteins HU or IHF, and gel (see Materials and methods). As shown in Figure 1, provided that DnaA protein is complexed with ATP, this both ADP- and ATP-DnaA already protected the DnaA leads to a local unwinding of the AT-rich region in the box Rl at the lowest DnaA concentration (150 nM). vicinity of the DnaA boxes (Bramhill and Komberg, 1988; ADP-DnaA did not show any additional protection, even Gille and Messer, 1991; Hwang and Komberg, 1992; at the highest concentration (600 nM). ATP-DnaA, on Krause et al., 1997). The unwound region provides the the contrary, bound to the AT-rich region, starting at substrate for the loading of the replicative helicase, DnaB 300 nM, and showed partial protection of the whole in the case of E.coli, and the landing zone for all other segment from the AT cluster to the rightmost 13mer proteins that form the replication fork (Fang et al., 1999). starting at 400 nM. This suggests a cooperative binding of Initially 28 bp are unwound, both in E.coli and in B.subtilis ATP-DnaA to the AT-rich region. A concentration of oriC, followed by 16-25 additional base pairs upon 400 nM corresponds approximately to the in viva ATP­ addition of single-stranded DNA-binding (SSB) protein DnaA concentration at the time of initiation (Hansen et al., (Krause and Messer, 1999). So far, it is not clear why ATP- 1991; Kurokawa et al., 1999). © European Molecular Biology Organization 1469 C.Speck and W.Messer (i) Kinetic constants can only be determined for 1: 1 DnaA-ADP D11aA -ATP interactions, using the Langmuir binding model, since correct assignment of a binding model is too error prone for more complex reactions. It is, however, possible to recognize a complex, potentially cooperative interaction from the shape of the sensorgrams. (ii) Escherichia coli DnaA tends to bind non-specifically to the carboxymethyl dextran matrix of the sensor chips, since it is a very basic protein. Therefore, we can not probe concentrations > 100 nM. In contrast, we used 600 nM as the highest concentration for the DNase I footprints. Oligonucleotides with variants of DnaA box Rl were analyzed for their binding kinetics and stoichiometry with ATP-and ADP-DnaA protein. Representative binding experiments are shown in Figure 2. ADP-DnaA bound to a fragment with a wild-type DnaA box Rl with 1:1 kinetics and a stoichiometry of 1. The equilibrium dissociation constant was 3 nM, which is similar to results found by band-shift experiments (Schaper and Messer, 1995). ATP­ DnaA showed complex binding kinetics, compatible with cooperative binding, and a stoichiometry ;;,,2, although saturation of the binding reaction was not reached. When saturation of a reaction is approached, the injection of higher protein concentrations does not result in the binding of proportionally more protein to the DNA. This is visible as compression of the curves in the sensorgrams, which is seen with ADP-DnaA, but clearly not in the sensorgrams of ATP-DnaA shown in Figure 2. If DnaA box Rl was scrambled, ADP-DnaA could not bind and ATP-DnaA bound very inefficiently. Surprisingly, inversion of DnaA box Rl gave similar results to the wild-type configuration. The results show that ATP-DnaA, but not ADP-DnaA, can Fi g . 1. DNase I footprint of the AT-rich region. DNase I footprinting was performed using a 5'-end-labeled 428 bp PCR DNA fragment. bind to the AT-rich region in a presumably cooperative Increasing amounts of ATP- or ADP-DnaA were added, giving final manner. A wild-type DnaA box Rl is required for the concentrations of 150, 300, 350, 400, 450, 500, 550 and 600 nM. reaction as an anchor point, in agreement with genetic Incubation was for 10 min at 37 C. DnaA box Rl, the AT cluster and experiments (Langer et al., 1996). the three 13mers are indicated by bars; the lower strands are shown. The 13mer region contains several GATC recognition sites for Dam methyltransferase, and methylation of these Binding of A TP-DnaA to the AT-rich region sites is required for efficient replication initiation (Messer requires the presence of DnaA box R1 et al., 1985). In order to analyze whether methylated ATP­ For a more detailed analysis of complex formation at the DnaA boxes are a better substrate for ATP-DnaA, we AT-rich region of oriC, we determined the kinetics and the methylated the fragment with Dam methyltransferase stoichiometry of the complexes using surface plasmon in vitro, and subjected it to the same SPR analysis as resonance (SPR) with the BIAcore instrument. SPR shown in Figure 2. ATP-DnaA bound to the methylated measures the change in mass at the surface of a chip. fragment with an approximately three times higher Details of the technique as used for DnaA-DNA inter­ stoichiometry than to the unmethylated one (7:1 versus action have been described recently (Speck et al., 1999). 2: 1 at 75 nM DnaA). For SPR analysis we used a DNA fragment from oriC containing the AT-rich region, the AT cluster, all three A TP-DnaA also binds to the AT-rich region when it 13mers and DnaA box Rl (oriC coordinates 8-94; all oriC is single stranded coordinates refer to Buhk and Messer, 1983; Figure 2). DnaA-mediated unwinding is only observed with super­ Oligonucleotides were chemically synthesized with a coiled template. In order to be able to measure DnaA biotin label at one 5' -end, and were bound to a binding to an unwound AT-rich region, we constructed streptavidin-coated chip. A flow of ATP- or ADP-DnaA artificial substrates. In one strand, these contained the was applied past the chip. The major advantage of this E.coli sequence of the whole AT-rich region and DnaA technique is that protein-DNA interactions can be moni­box Rl. In the other strand, the M and R 13mers were tored in real time, very accurately and very sensitively. replaced by the corresponding region from B.subtilis oriC A response of 1 RU (resonance unit) corresponds to (Krause and Messer, 1999), thereby avoiding hybridiz­ 2 2 1 pg/mmprotein or 0.73 pg/mmDNA, respectively ation in this segment ('bubble' substrate; Figure 3). (Speck et al., 1999). Since the BIAcore measures mass ADP-DnaA bound to all fragments that contained a differences, one can calculate the mean stoichiometry of wild-type DnaA box Rl with a stoichiometry of 1, the complexes at any given DnaA protein concentration. demonstrating that it binds to the double-stranded DnaA Limitations of the BIAcore technique are as follows. box but to no other part of the substrate. For ATP-DnaA 1470 Origin unwinding by DnaA 13-mers DnaAbox ATP-DnaA protein oligonucleotide ADP-DnaA protein senso:r ram ~ 0.5 - 75 nM sensor ram ~ 0.5 - 75 nM RU RU 200 200 1 2 170 170 140 140 R1 _____ I 1: I I: I !lO (2 2.0 If 20 -10 i---- -10 1-- - --- - �0 -+--,.-t--+-,-+-�t---,--+- ----i �-+----< �0 -.-t---t--.-+--t---+--.-<--+----i 0 100 20IJ 300 400 500 ,500 700 !IOO 0 100 200 300 400 500 600 700 BOO s 'Tim• 0.5 ® 0 1R 1 2.5 i i Fi . 2. Binding reactions of ATP- and ADP-DnaA protein to the AT-rich region of oriC as measured by SPR. The fragment used in these measurements is shown at the top. DnaA box Rl is indicated in light gray, ATP-DnaA boxes are in bold. The three 13mer repeats are boxed. The stoichiometry of the complexes obtained at a protein concentration of 75 nM is indicated in the figure as x:1 (protein:DNA). ATP- and ADP-DnaA protein binding is shown for the wild type (Rl), a DnaA box Rl mutant (M) and a fragment that contains an inverted DnaA box Rl (indicated as lR). One resonance unit corresponds to a change in mass of 1 pg/mm . Within each sensorgram, individual curves were obtained with protein concentrations (bottom to top) of 1.2, 2.3, 4.7, 9.4, 18.8, 37.5 and 75 nM. the binding kinetics and the stoichiometry were very region is clearly required for ATP-DnaA binding. The similar to a double-stranded fragment if the E.coli results, summarized in Figure 3, show that ATP-DnaA sequence was in the 'lower' strand, indicating that ATP­ binds cooperatively and with sequence specificity to DnaA can bind to single-stranded ATP-DnaA boxes. If the single-stranded DNA of the AT-rich region of oriC. E.coli sequence was in the 'upper' strand, cooperative binding seemed to be extreme. The stoichiometry was ;;;.6 DnaA domain 1 is not required for binding to at a DnaA concentration far from saturation. The dis­ ATP-DnaA boxes sociation rate was very slow, as seen from the slow It has been suggested that a truncated form of DnaA decrease of the curves after the protein flow was replaced protein without domain 1 is able to perform the unwinding by buffer. A similar fragment but with a scrambled reaction (Sutton et al., 1998). Domain 1 has been shown to sequence flanking the bubble, including a scrambled DnaA mediate oligomerization of DnaA (Weigel et al., 1999), box Rl, had similar binding characteristics. The 'lower' and it is involved in loading ofDnaB helicase (Sutton et al., strand also contained a scrambled sequence in this 1998; Seitz et al., 2000). DnaA without the oligomeriza­ fragment at the M and R 13mers (Figure 3, E.c./N's tion domain 1 can, however, bind cooperatively to Rl -). This means that once the region is unwound, i.e. for adjacent DnaA boxes (Messer et al., 1999; Jakimowicz DnaA binding to single-stranded 13mers, the anchor point et al., 2000; Majka et al., 2001). For an analysis of the at Rl is no longer required. If both the flanking region and binding characteristics of DnaA protein lacking domain 1, the bubble contained a scrambled sequence, and no E.coli­ DnaA[87--467] with an N-terminal His tag, we deter­ specific 13mers but an intact DnaA box Rl (Figure 3, mined the stoichiometry of binding using the double­ N' s/N' s ), both forms of DnaA bound with a stoichiometry stranded oriC substrate used in the experiment shown in of only 1, i.e. to the DnaA box Rl. This means that the Figure 2. Table I shows that this DnaA deletion derivative specific E.coli or B.subtilis sequence in the single-stranded bound identically to wild type, with a higher stoichiometry 1471 1.4 C.Speck and W.Messer olligonucleot1ide ADP-DnaA protein ATP-DnaA protei sensor ram ~ 0.5 - 75 nM sensor ram ~ 0.5 - 75 nM RU RU 280 280 B.s ./E.c. 200 200 GI .. � 120 120 80 60 I I 40 40 a: 0- -to -<40 --i- -1 --,--.-, �-;- -,-- ( 0 100 200 300 ,400 500 600 700 800 D 100 200 JOO <100 500 600 700 800 Time s Time s RU RU 700 700 E.cJB.s. • 380 ., 380 ;u l 220 -100 +--+---r--+-+-.-,. - �t O 100 200 300 400 500 600 700 800 o 100 200 300 400 &ID 600 700 800 s Time N's/N's E.c./N's R1- J& Fig. 3. Binding reactions of ATP- and ADP-DnaA protein to an artificial bubble as measured by SPR. At the top, a version of the artificial bubble DNA is indicated. The DnaA box Rl is indicated in gray, the three 13mers are boxed and the ATP-DnaA boxes are shown in bold. The upper strand corresponds to the E.coli sequence. In the lower strand, the M and R 13mers were replaced by the corresponding region from B.subtilis oriC (Krause and Messer, 1999), thereby avoiding hybridization in this segment. The stoichiometry of the complexes obtained at a protein concentration of 75 nM is indicated in the figure as x: 1 (protein:DNA). Fragments that contain scrambled sequences in the lower or upper strand of the bubble or in the flanking sequence are indicated by N's. One resonance unit corresponds to a change in mass of 1 pg/mm . Within each sensorgrarn, individual curves were obtained with protein concentrations (bottom to top) of 1.2, 2.3, 4.7, 9.4, 18.8, 37.5 and 75 nM. for the ATP form. A derivative containing the DNA single-strand specific nuclease PI (Figure 4, tracks without binding domain 4 only bound with a stoichiometry of 1: 1. ATP-DnaA). In order to determine DnaA protein binding This is not surprising since this protein lacks the ATP­ to single-stranded DNA by an independent method, we binding site. developed a nuclease PI footprinting technique. ATP­ DnaA already protected the 'bubble' at a concentration of DnaA protein protects the single-stranded AT-rich 40 nM, both in the 'upper' and in the 'lower' strand region against cleavage by nuclease P1 (Figure 4 ). Protection of the 'upper' strand extended over The non-complementary 'bubble' region of the E.coli­ the middle and right 13mer, covering nearly the whole B.subtilis hybrid substrate is susceptible to cleavage by the single-stranded region. On the 'lower' strand, only a part 1472 Origin unwinding by DnaA AT L M R R1 Table I. Stoichiometry of DnaA derivatives with the AT-rich region Protein ADP form ATP form Wild-type DnaA 1:1 2.2:1 DnaA[87--467]-His 1:1 2.2:1 DnaA[335--467]• 1:1 •Numbers in square brackets indicate expressed amino acid residues. ATP-DnaA ATP·OnaA ''1! 1'? I R1 �! •5!.,� Fig. 5. A model describing the DnaA-dependent unwinding reaction at oriC. The DnaA box Rl and the three 13mers are labeled. The six R ATP-DnaA boxes are indicated by small gray boxes. Initially, DnaA protein binds with a high affinity to DnaA box Rl. This complex B serves as an anchor for cooperative binding of ATP-DnaA to the ATP­ DnaA boxes, positioning the protein to the region of unwinding. The formation of this complex needs high concentrations of ATP-DnaA protein and can be considered, therefore, as the rate-limiting reaction in unwinding. Single-stranded DNA resulting from unwinding will then be stabilized by cooperative binding of ATP-DnaA. The affinity of ATP-DnaA is higher to single-stranded ATP-DnaA boxes than to double-stranded ATP-DnaA boxes. AT-rich part and two just left of it (Figure 5). Also, B.subtilis oriC has several ATP-DnaA boxes in its AT-rich region with about the same spacing but a slightly different sequence. We have probed this chromosome segment by DNase I footprinting, SPR and nuclease Pl footprinting. DNase I footprinting shows that ATP-DnaA, but not ADP­ DnaA, binds to the AT-rich region of E.coli oriC with high AT cooperativity. Protection against digestion was obtained with 300-400 nM ATP-DnaA. This is about the in viva lO'M!r strand upper strand concentration of ATP-DnaA at the time of initiation (Hansen et al., 1991; Kurokawa et al., 1999). This is Fig. 4. Nuclease Pl footprint of the artificial bubble substrate and compatible with the notion that the concentration of ATP­ ATP-DnaA. Nuclease PI footprinting was performed using the DNA fragment shown in Figure 3 (top). The DNA was 5'-end-labeled. DnaA regulates initiation. Increasing amounts of ATP-DnaA were added, giving final concen­ SPR analysis allowed a definition of the quantitative trations of 10, 40, 75, 100 and 150 nM. Incubation was for 10 min ° aspects of complex formation between the oriC AT-rich C. DnaA box Rl, the AT cluster, the three 13mers (L, M and R) at 37 region and DnaA. ADP-DnaA bound to the single 9mer and the single-stranded region (B) are indicated by bars. DnaA box on the fragment used for the analysis with simple 1: 1 kinetics and a 1: 1 stoichiometry, and to no other part of the region. ATP-DnaA bound with a stoichiometry of the right 13mer and the middle 13mer were protected, >2 and exhibited complex binding kinetics suggesting and in only -50% of the DNA strands. In both strands a cooperative binding. Although for ATP-DnaA we could few single nucleotides were especially sensitive to the not reach the saturation level of the binding reaction, it is nuclease with and without DnaA. Binding of ATP-DnaA very clear that the stoichiometry was >2: 1. A wild-type also protected the single-stranded 'upper' strand of the 9mer DnaA box Rl was required, supporting the model AT-rich region against the action of DNase I (H.Seitz and that DnaA bound to Rl is used as an anchor that directs W.Messer, unpublished). cooperative binding of several additional ATP-DnaA molecules to the ATP-DnaA boxes in the vicinity. Until Discussion now there has been only an isolated and indirect obser­ The AT-rich region of E.coli oriC contains three 13mer vation suggesting binding of DnaA to this region. DnaA repeats, each of them starting with a GATC site that is part binding to oriC, as measured by filter binding, could of a potential ATP-DnaA box. In total, there are six be competed by a 13mer-containing double-stranded potential ATP-DnaA boxes in this region, four within the oligonucleotide (Yung and Komberg, 1989). 1473 C.Speck and W.Messer In E.coli and other Enterobacteriaceae, Dam methyl­ stabilize the unwound DNA. Factors that influence the ation of GATC sites regulates replication initiation in two stability of base pairing in the AT-rich region are the ways. Shortly after replication, origins are exempt from temperature and the degree of supercoiling of the origin re-initiation because hemimethylated oriC DNA is seques­ domain, which is in part influenced by divergent tran­ tered (Ogden et al., 1988; Campbell and Kleckner, 1990) . scription, i.e. transcriptional activation. The spatial In addition, fully methylated GATC sites are required for arrangement of the different binding sites is also import­ optimal oriC function (Messer et al., 1985). Our obser­ ant, as is the ability of the initiator protein to bind vation that the Dam-methylated AT-rich region binds sequentially to high- and low-affinity sites, as shown here. ATP-DnaA with higher stoichiometry at non-saturating The importance of all these factors has been demonstrated concentrations, i.e. with higher affinity, may be an for E.coli oriC and for other origins. The DUE is an explanation for the latter effect. essential cis-acting element of oriC (Kowalski and Eddy, ATP-DnaA bound with especially high cooperativity to 1989), the degree of supercoiling determines the initiation single-stranded DNA from the AT-rich region. The 9mer competence of oriC (for review see Messer and Weigel, DnaA box Rl was no longer required. However, the 1996) , and transcriptional activation is required in viva specific sequence of the AT-rich region was essential. (Messer, 1972) and under near-physiological conditions Substrates with the E.coli sequence in the top strand in vitro (Skarstad et al., 1990) . DnaA box Rl is essential were more effective than the complementary substrates. (Langer et al., 1996), as is its precise distance to the AT­ ATP-DnaA could protect both strands of an artificial rich region (Hsu et al., 1994) . Finally, as shown here, the single-strand 'bubble' substrate against cleavage by ability of DnaA protein to acquire additional binding specificities upon interaction with ATP, binding to double­ single-strand-specific nuclease Pl. Protection was detec­ ted at a concentration of 40 nM. In comparison, ATP­ stranded 6mer ATP-DnaA boxes and to single-stranded DnaA boxes in the double-st randed form were protected at ones, ensures that the DnaA-oriC complex is assembled much higher concentrations, 400 nM, indicating a higher first at the five high-affinity DnaA boxes and then becomes affinity of ATP-DnaA for single-stranded DNA. activated at the correct time in the cell cycle. Once the All these experiments, footprints and SPR analysis show correct number of ATP-DnaA monomers has assembled, unambiguously that ATP-DnaA binds to the AT-rich low affinity of double-stranded and moderate affinity of region in single-and double-st randed form. single-st randed recognition sites follow s. We suggest that From these results we propose a new model for the such a sequential recognition and cooperative interaction mechanism of origin unwinding (Figure 5). Initial binding may be a general method to accomplish specific position­ is directed to the high-affinity 9mer DnaA boxes. One of ing of complexes on sequences with low binding affinity, these, DnaA box Rl, is most important since it serves as an like the 13mer repeats. anchor for cooperative binding of ATP-DnaA to the 6mer The crucial role of the ATP form of DnaA allows a ATP-DnaA boxes in the still double-stranded AT-rich cyclic regulation. Upon synthesis, DnaA protein is likely region. Interaction with the ATP-DnaA boxes depends on to be in its ATP form since the cellular ATP concentration a high ATP-DnaA concentration. DNA unwinding was is high. In this form, it is initiation competent and active as detected in vitro at a concentration similar to that at which an autorepressor (Speck et al., 1999). At the end of the we found moderate protection of the AT-rich region. This initiation cycle, the ATPase activity of DnaA is induced suggests that binding to ATP-DnaA boxes reflects a by the loading of the �-subunit of DNA polymerase III, molecular barrier for the following steps, and with that thereby inactivating DnaA protein for further initiation presumably regulates the time point of initiation. The AT­ (Katayama et al., 1998). rich region overlaps with a sequence that is thermo­ We propose that the mechanism of origin unwinding dynamically unstable, as seen in vitro by an opening of the outlined here is universal throughout all organisms. All 2+ DNA helix in the absence of Mg ions. This sequence has eubacteria have DnaA proteins, and many bacteriophages been called a DNA unwinding element (DUE) (Kowalski (Dodson et al., 1986) and plasmids (Helinski et al., 1996) have comparable origins and initiator proteins. Eukaryotic and Eddy, 1989) . The ATP-DnaA-13mer complex viruses like SV 40, polyoma or papilloma have origins with destabilizes the DNA helix such that it promotes unwind­ ing under physiological salt conditions. This could be by a initiator binding sites, a DUE element and AT-rich regions breathing of the region or by a sudden unwinding of the (DePamphilis, 1996) . Their initiator proteins are func­ whole segment (Kowalski et al., 1988). The unwound tional equivalents of DnaA protein in the sense that they region is then stabilized by binding of additional ATP­ recognize the origin, unwind DNA and initially stabilize DnaA molecules to single-st randed ATP-DnaA boxes. The the single-stranded DNA before further stabilization by affinity of ATP-DnaA for single-stranded ATP-DnaA replication protein A (RPA) (Wessel et al., 1992). Yeast boxes is -10 times higher than for double-st randed ATP­ is the paradigm for origins active in the initiation of DnaA boxes, as judged from the footprints. In addition, the eukaryotic genome replication. Here also, AT-rich regions ATP-DnaA-single- stranded ATP-DnaA box complex is and a DUE are associated with an initiator binding site characterized by a very slow dissociation rate (Figure 3). that accepts a six-protein origin recognition complex Therefore, the single-st randed nature of the complex is (ORC) . In addition, ORC binds like DnaA to single­ guaranteed. The model is illustrated in Figure 5. stranded DNA, and a change in the double- and The critical elements of a replication origin are, thus, the single-strand-specific conformation of ORC is associated presence of the initial initiator binding site(s), secondary with an ATP/ADP switch (Lee and Bell, 2000 ; Lee et al., binding sites (e.g. ATP-DnaA boxes) that augment the 2000) . ORCs and corresponding origins, which may thermodynamic instability of a DUE, and a tertiary (Abdurashidova et al., 2000) or may not be AT rich binding site(s) within the single-stranded DNA to finally (Delgado et al., 1998), have been found in all metazoa that 1474 Origin unwinding by DnaA CTCTTATTTCCTAGCGTGACGGGACACCTATTGTTCCT; Mut all, have been studied, e.g. Drosophila, Xenopus and mam­ bubble wt lo, 5'-AGGAACAATAGGTGTCCCGTCACGCTAGGA­ mals (for review see DePamphilis, 1999; Ritzi and ATTACTTCTACTATTTTTTATAAATATGATTTATTTATCTAGA­ Knippers, 2000). It seems to be common to all initiator AGAAAAATTATGGG. proteins that they recognize a double-stranded binding Nuclease P1 protection assays site, build a larger complex that promotes helical instabil­ Nuclease Pl footprints were performed similarly to the DNase I ity, and finally stabilize the unwound region by binding to protection assays. DNA fragments were generated by annealing two the single-stranded DNA (e.g. DnaA, SV40 and probably complementary oligonucleotides, including an artificial single-stranded ORC). It is not yet clear whether all initiator proteins have region as shown in Figure 3. Before annealing, oligonucleotides were a weaker affinity for the double-stranded AT-rich region, 5' -end-labeled with P and T4 polynucleotide kinase. Binding reactions were carried out with 0.2 ng of labeled double-stranded DNA in 20 µI of as shown here for the DnaA protein, but it seems to be the binding buffer (25 mM HEPES pH 7.6, 100 mM potassium acetate, favorable to bring the initiator into close proximity to the 5 mM magnesium acetate, 4 mM dithiothreitol, 0.2% Triton X-100, unwound region in order to quickly stabilize the unwound 0.5 mg/ml bovine serum albumin, 100 µM ATP or ADP) and the DNA for subsequent helicase loading. indicated amounts of ATP- or ADP-DnaA. Mixtures were incubated at 37 C for 10 min, nuclease Pl (0.00005 U) was added, and samples were incubated at 37 C for 4 min. After addition of an equal volume of stop Materials and methods buffer (1 % SDS, 200 mM NaCl, 20 mM EDTA pH 8.0, 1 mg/ml glycogen), the samples were purified by phenol/chloroform extraction, Chemical s, proteins and oligonucleotides DNA was precipitated with ethanol and resuspended in 1 µI of TE buffer Standard chemicals were obtained from Sigma (St Louis, MO) or Merck (10 mM Tris-HCI pH 8.0, 0.1 mM EDT A). Following the addition of 5 µl (Darmstadt, Germany), and radioactive [y- P]ATP (3000 Ci/mmol) from of sequencing gel loading buffer (98% formamide, 0.025% bromophenol Amersham (Little Chalfant, UK). Restriction enzymes were supplied by blue, 0.025% xylene cyanol), samples were incubated at 96 C for 5 min Roche Molecular Biochemicals (Mannheim, Germany) or New England and loaded onto 8% sequencing gels. After electrophoresis, gels were Biolabs (Beverly, MA). Oligonucleotides used for PCR and BIAcore dried and analyzed in a Phosphorlmager (Molecular Dynamics). were chemically synthesized (Metabion, Martinsried, Germany). Nuclease PI was from Roche Molecular Biochemicals (Mannheim, Germany). DnaA[87--467]-His protein was constructed by inserting into Acknowledgements the Sall and PstI sites of pdnaA116DnaA[87--467] (Weigel et al., 1999) a double-stranded oligonucleotide (upper, 5'-TCGAGCCATCATCAT­ We thank F.Blaesing, I.Majka, J.Nardmann, H.Seitz and C.Weigel for CATCATCATCATGCA; lower, 5' -GATGATGATGATGATGATGGC) many stimulating discussions. This work was supported by grant Me 659/ encoding a His tag. Wild-type DnaA and DnaA[87--467]-His protein 6 6 6-1 of the Deutsche Forschungsgemeinschaft. were overexpressed from plasmid pdnaA116 and purified as described (Krause et al., 1997). DnaA[335--467]-His was a gift from S.Schaper. Standard methods were used for DNA manipulations (Sambrook et al., 1989). References Abdurashidova,G., Deganuto,M., Klima,R., Riva,S., Biamonti,G., DNase I protection assays Giacca,M. and Falaschi,A. (2000) Start sites of bidirectional DNA DNase I protection assays were performed as described (Galas and synthesis at the human Jamin B2 origin. Science, 287, 2023-2026. Schmitz, 1978). The DNA fragment used in the footprints was amplified Asai,T., Takanami,M. and Imai,M. (1990) The AT richness and gid using the primers Prl (5'-GCCTTTGAGTGAGCTGATACCGCT­ transcription determine the left border of the replication origin of the TCCTTGTTATCCACAGGGCAGTGCG) and Pr2 (5'-CGAGCGCAG­ 32 E. coli chromosome. EMBO J. , 9, 4065--4072. CGAGTCAGTGAG). Primer Prl was 5'-end-labeled with P; Brarnhill,D. and Komberg,A. (1988) Duplex opening by dnaA protein at nucleotides 1-25 represent a sequence not present in ori C to provide a novel sequences in initiation of replication at the origin of the E.coli neutral spacer between the 5'-end label and DnaA box Rl. chromosome. Cell, 52, 743-755. Buhk,H.J. and Messer,W. (1983) Replication origin region of Surface plasmon resonance Escherichia coli: nucleotide sequence and functional units. Gene, SPR was determined using a BIAcore 2000 instrument (BIAcore AB, 24, 265-279. Uppsala, Sweden) as described, with minor modifications (Speck et al., Campbell,J.L. and Kleckner,N. (1990) E.coli ori C and the dnaA gene 1999). Samples in a concentration range of 1.2-75 nM DnaA were promoter are sequestered from dam methyltransferase following the injected using the Kinj ect command defining an association time of 140 s passage of the chromosomal replication fork. Cell, 62, 967-979. and a dissociation time of 450 s. Reactions were at 22 C. For data analysis Delgado,S., Gomez,M., Bird,A. and Antequera,F. (1998) Initiation of we used the BIAevaluation 3.0 program (BIAcore AB, Sweden, Uppsala). DNA replication at CpG islands in mammalian chromosomes. The following oligonucleotides were used (for oligonucleotides that EMBO J., 17, 2426-2435. base pair completely only the biotinylated strand is shown): wt up, DePamphilis,M.L. (1996) Origins of DNA replication. In 5'-GGGTATTAAAAAGAAGATCTATTTATTTAGAGATCTGTTCT­ DePamphilis,M.L. (ed.), DNA Replication in Eukaryotic Cells. Cold ATTGTGATCTCTTATTAGGATCGCACTGCCCTGTGGATAACAA­ Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 45-86. GGA; Rl Mut up, 5'-GGGTATTAAAAAGAAGATCTATTTATTTAG­ DePamphilis,M.L. (1999) Replication origins in metazoan chromo­ AGATCTGTTCTATTGTGATCTCTTATTAGGATCGCACTGCCCG­ somes: fact or fiction? BioEs says, 21, 5-16. CAAGGAAGCAAGGA; Rl inv up, 5'-GGGTATTAAAAAGAA Dodson,M., Echols,H., Wickner,S., Alfano,C., Mensa-Wilmot,K., GATCTATTTATTTAGAGATCTGTTCTATTGTGATCTCTTATTA Gomes,B., LeBowitz,J., Roberts,J.D. and McMacken,R. (1986) GGATCGCACTGCCCTTATCCACACAAGGA; B.s. in bubble up, Specialized nucleoprotein structures at the origin of replication of 5'-GGGTATTAAAAAGAAGATCTATTTATTTAGATATTTATAA­ bacteriophage A: localized unwinding of duplex DNA by a six-protein AAAATAGTAGAAGTAATAGGATCGCACTGCCCTGTGGATA­ reaction. Proc. Natl Acad. Sci. USA, 83, 7638-7642. ACA AGGA; B.s. in bubble lo, 5'-TCCTTGTTATCCACAGGGCAG­ TGCGATCCTATTACTTCTACTATTTTTTATAAATATCTAAAT­ Fang,L.H., Davey,M.J. and O' Donnell,M. (1999) Replisome assembly at oriC, the replication origin of E. coli, reveals an explanation for AAATAGATCTTCTTTTTAATACCC. initiation sites outside an origin. Mol. Cell, 4, 541-553. In order to scramble sequences flanking the bubble and/or within the bubble but keep the AT ratio, we used the lower strand 3'-sequence as the Galas,D. and Schmitz,A. (1978) Dnase footprinting: a simple method for upper strand 5'-sequence: Mut all bubble, Rl wt up, 5'-CCCATA­ determining protein-DNA binding specificity. Nucleic Acids Res., 5, ATTTTTCTTCTAGATAAATAAATCACGGTTACGCTAGCGTAGG­ 3157-3170. TGACTGACTCCTAGCGTCTGCCCTGTGGATAACAAGGA ;Mut all Gille,H. and Messer,W. (1991) Localized unwinding and structural bubble, Rl wt lo, 5'-TCCTTGTTATCCACAGGGCAGACGCTAGGA­ perturbations in the origin of replication, oriC, of Escherichia coli CATTCGACGAGCGTACGAGCGTCAGCGGATTTATTTATCTAG­ in vitro and in viva. EMBO J., 10, 1579-1584. AAGAAAAATTATGGG; Mut all, bubble wt up, 5'-CCCATA­ Hansen,F.G., Atlung,T., Braun,R.E., Wright.A., Hughes,P. and ATTTTTCTTCTAGATAAATAAATCAGATCTGT TCTATTGTGAT- Kohiyama,M. (1991) Initiator (DnaA) protein concentration as a 1475 C.Speck and W.Messer function of growth rate in Escherichia coli and Salmonella the DnaA and DnaB replication proteins of Escherichia coli. Mol. typ himurium. J. Bacterial., 173, 5194-5199. Micro bial., 37, 1270-1279. Skarstad,K., Baker,T.A. and Komberg,A. (1990) Strand separation Helinski,D.R., Toukdarian,A.E. and Novick,R.P. (1996) Replication required for initiation of replication at the chromosomal origin of control and other stable maintenance mechanisms of plasmids. In E.coli is facilitated by a distant RNA-DNA hybrid. EMBO J., 9, Neidhardt,F.C. et al. (eds), Escherichia coli and Salmonella: Cellular 2341-2348. and Molecular Biology. ASM Press, Washington, DC, pp. 2295-2324. Speck,C., Weigel,C. and Messer,W. (1999) ATP- and ADP-DnaA Hsu,J., Bramhill,D. and Thompson,C.M. (1994) Open complex protein, a molecular switch in gene regulation. EMBO J., 18, formation by DnaA initiation protein at the E.coli chromosomal 6169-6176. origin requires the 13-mers precisely spaced relative to the 9-mers. Sutton,M.D., Carr,K.M., Vicente,M. and Kaguni,J.M. (1998) Mol. Micro bial., 11, 903-911. Escherichia coli DnaA protein. The N-terminal domain and loading Hwang,D.S. and Komberg,A. (1992) Opening of the replication origin of of DnaB helicase at the E.coli chromosomal origin. J. Biol. Chem., Escherichia coli by DnaA protein with protein HU or IHF. J. Biol. 273, 34255-34262. Chem., 267, 23083-23086. Weigel,C., Schrnidt,A., Seitz,H., Tuengler,D., Welzeck,M. and Jakimowicz,D., Maj ka,J., Konopa,G., Wegrzyn,G., Messer,W., Messer,W. (1999) The N-terminus promotes oligomerisation of the Schrempf,H. and Zakrzewska-Czerwinska,J. (2000) Architecture of Escherichia coli initiator protein DnaA. Mol. Micro bial., 34, 53-66. the Streptomyces lividans DnaA protein-replication origin complexes. Wessel,R., Schweizer,]. and Stahl,H. (1992) Simian virus T-antigen J. Mol. Biol. , 298, 351-364. DNA helicase is a hexamer which forms a binary complex during Katayama,T., Kubota,T., Kurokawa,K., Crooke,E. and Sekimizu,K. bidirectional unwinding from the viral origin of DNA replication. (1998) The initiator function of DnaA protein is negatively J. Viral. , 66, 804-815. regulated by the sliding clamp of the E.coli chromosomal replicase. Yung,B.Y.M. and Komberg,A. (1989) The dnaA initiator protein binds Cell, 94, 61-71. separate domains in the replication origin of Escherichia coli. J. Biol. Komberg,A. and Baker,T.A. (1992) DNA Replicati on. W.H.Freeman and Chem., 264, 6146--6150. Co., New York, NY. Kowalski,D. and Eddy,M.J. (1989) The DNA unwinding element: a Received December 14, 2000; revised and accepted January 29, 2001 novel, cis-acting component that facilitates opening of the Escherichia coli replication origin. EMBO J., 8, 4335-4344. Kowalski,D., Natale,D.A. and Eddy,M.J. (1988) Stable DNA unwinding, not 'breathing' accounts for single-strand-specific nuclease hypersensitivity of specific A+T-rich sequences. Proc. Natl Acad. Sci. USA, 85, 9464-9468. Krause,M. and Messer,W. (1999) DnaA proteins of Escherichia coli and Bacillus subtilis: coordinate actions with single-stranded DNA­ binding protein and interspecies inhibition during open complex formation at the replication origins. Gene, 228, 123-132. Krause,M., Lurz,R., Riickert,B. and Messer,W. (1997) Complexes at the replication origin of Bacillus subtilis with homologous and heterologous DnaA protein. J. Mo/. Biol. , 274, 365-380. Kurokawa,K., Nishida,S., Emoto,A., Sekimizu,K. and Katayama,T. (1999) Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli. EMBO J., 18, 6642-6652. Langer,U., Richter,S., Roth,A., Weigel,C. and Messer,W. (1996) A comprehensive set of DnaA box mutations in the replication origin, oriC, of Escherichia coli. Mol. Micro bial., 21, 301-311. Lee,D.G. and Bell,S.P. (2000) ATPase switches controlling DNA replication initiation. Curr. Opin. Cell Biol. , 12, 280--285. Lee,D.G., Makhov,A.M., Klemm,R.D., Griffith,J.D. and Bell,S.P. (2000) Regulation of origin recognition complex conformation and ATPase activity: differential effects of single-stranded and double-stranded DNA binding. EMBO J., 19, 4774-4782. Majka,J., Zakrzewska-Czerwinska,J. and Messer,W. (2001) Sequence recognition, cooperative interaction and dimerization of the initiator protein DnaA of Streptomyces. J. Biol. Chem., in press. Messer,W. (1972) Initiation of DNA replication in E.coli Bir. Chronology of events and transcriptional control of initiation. J. Bacterial., 112, 7-12. Messer,W. and Weigel,C. (1996) Initation of chromosome replication. In Neidhardt,F.C. et al. (eds), Escherichia coli and Salmonella: Cellular and Molecular Biology. ASM Press, Washington, DC, pp. 1579-1601. Messer,W., Bellekes,U. and Lother,H. (1985) Effect of dam-methylation on the activity of the replication origin, oriC. EMBO J., 4, 1327-1332. Messer,W. et al. (1999) Functional domains of DnaA proteins. Biochimie, 81, 819-825. Ogden,G.B., Pratt,M.J. and Schaechter,M. (1988) The replicative origin of the E.coli chromosome binds to cell membranes only when hemimethylated. Cell, 54, 127-135. Ritzi,M. and Knippers,R. (2000) Initiation of genome replication: assembly and disassembly of replication-competent chromatin. Gene, 245, 13-20. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Clo ning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schaper,S. and Messer,W. (1995) Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem., 270, 17622-17626. Seitz,H., Weigel,C. and Messer,W. (2000) The interaction domains of

Journal

The EMBO Journal – Springer Journals

Published: Mar 15, 2001

Keywords: DNA unwinding element; oriC; protein–DNA interaction; replication initiation; surface plasmon resonance

There are no references for this article.