Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Isolation and Characterization of the cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase

Isolation and Characterization of the cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 18, Issue of May 2, pp. 11895–11901, 1997 © 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Isolation and Characterization of the cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase* (Received for publication, January 9, 1997, and in revised form, February 24, 1997) Wensheng Lin‡§¶, Jean-Christophe Ame ´ ‡§, Nasreen Aboul-Elai, Elaine L. Jacobson**‡‡, and Myron K. Jacobson‡ ‡‡§§ From the ‡Division of Medicinal Chemistry and Pharmaceutics, College of Pharmacy, the **Department of Clinical Sciences, and the ‡‡Lucille P. Markey Cancer Center, University of Kentucky, Lexington, Kentucky 40536 The synthesis and rapid turnover of ADP-ribose poly- ribose) polymerase (PARP) by DNA strand breaks (2). PARP mers is an immediate cellular response to DNA damage. catalyzes the conversion of NAD to multibranched polymers We report here the isolation and characterization of containing up to 200 ADP-ribose residues (3). Increases in cDNA encoding poly(ADP-ribose) glycohydrolase polymer levels of more than 100-fold may occur within minutes (PARG), the enzyme responsible for polymer turnover. (4). PARP is a major acceptor for ADP-ribose polymers in an PARG was isolated from bovine thymus, yielding a pro- automodification reaction (5–7), while histones and other DNA tein of approximately 59 kDa. Based on the sequence of binding proteins also are modified to a lesser extent (8, 9). Once oligopeptides derived from the enzyme, polymerase synthesized, polymers are rapidly turned over (10, 11), being chain reaction products and partial cDNA clones were converted to free ADP-ribose by the action of poly(ADP-ribose) isolated and used to construct a putative full-length glycohydrolase (PARG) (12, 13). An ADP-ribosyl protein lyase cDNA. The cDNA of approximately 4.1 kilobase pairs has been proposed to catalyze removal of protein-proximal predicted expression of a protein of approximately 111 ADP-ribose monomers (14). kDa, nearly twice the size of the isolated protein. A While the changes in chromatin structure that accompany single transcript of approximately 4.3 kilobase pairs was the rapid synthesis and turnover of this large polyanion are detected in bovine kidney poly(A) RNA, consistent with still poorly understood, ADP-ribose polymer metabolism has expression of a protein of 111 kDa. Expression of the been linked to the enhancement of DNA repair (15–18), limi- cDNA in Escherichia coli resulted in an enzymatically tation of malignant transformation (19 –21), enhancement of active protein of 111 kDa and an active fragment of 59 necrotic cell death (22), and involvement in programmed cell kDa. Analysis of restriction endonuclease fragments death (23, 24). To date, studies of the structure and function of from bovine DNA by Southern hybridization indicated the enzymes of ADP-ribose polymer metabolism have been that PARG is encoded by a single copy gene. Taken together, the results indicate that previous reports of mainly limited to PARP (25). PARG has been isolated to ap- multiple PARGs can be explained by proteolysis of an parent homogeneity from bovine thymus (26, 27), guinea pig 111-kDa enzyme. The deduced amino acid sequence of liver (28), and human placenta (29), and basic enzymatic fea- the bovine PARG shares little or no homology with other tures have been established (26). However, the structure of the known proteins. However, it contains a putative bipar- protein has not been elucidated. We report here the isolation tite nuclear location signal as would be predicted for a and characterization of the cDNA encoding bovine PARG. The nuclear protein. The availability of cDNA clones for availability of cDNA clones for PARG should facilitate detailed PARG should facilitate structure-function studies of the studies of the enzyme and the involvement of ADP-ribose poly- enzyme and its involvement in cellular responses to mer metabolism in cellular responses to DNA damage. genomic damage. EXPERIMENTAL PROCEDURES Purification of PARG—PARG was purified from bovine thymus tis- sue (Pel-Freez) by modifications of previously published procedures (26, The biological consequences of genomic damage include re- 27). The enzyme was isolated up to the polyethylene glycol (PEG)-6,000 covery of normal cell function, cellular survival leading to ma- fractionation step as described previously (27). However, DNA-agarose lignant transformation, or cell death by necrosis or apoptosis and heparin-Sepharose chromatographic steps used previously were (1). Among the many variables that can affect the ultimate omitted, and the PEG-6,000 fraction was applied directly to an affinity biological consequence of DNA damage to a particular cell are matrix of poly(ADP-ribose)-dihydroxyboronyl-Sepharose (PADPR DHB- (i) the amount, type, and location of the DNA damage and (ii) Sepharose). The active fractions eluted from PADPR DHB-Sepharose (25 ml) were pooled, placed in dialysis tubing, concentrated against dry the cellular response elicited by the damage. An immediate PEG-20,000 to approximately 12 ml, and dialyzed against 2 liters of 20 cellular response to DNA damage is the activation of poly(ADP- mM potassium phosphate buffer, pH 8.0, 0.1% Triton X-100, 5 mM b-mercaptoethanol, 0.1 mM thioglycolic acid, 0.4 M KCl (buffer A). The sample was loaded onto a 1.0 3 11-cm Toyopearl AF-Red (Supelco) * This work was supported in part by National Institutes of Health column, and PARG was eluted with an 80-ml linear gradient of 0.4 –2 M Grant CA43894. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The abbreviations used are: PARP, poly(ADP-ribose) polymerase § The first two authors contributed equally to this work. (EC 2.4.2.30); GSH-Sepharose, glutathione-Sepharose 4B; GST, gluta- ¶ Present address: Graduate Center for Toxicology, Health Science thione S-transferase; IPTG, isopropyl-b-D-thiogalactoside; NLS, nu- Research Building, University of Kentucky, Lexington, KY 40536. clear location signal; PAGE, polyacrylamide-gel electrophoresis; PARG, i Present address: Alcon Laboratories, Conner Center, R2– 41, 6201 poly(ADP-ribose) glycohydrolase; PCR, polymerase chain reaction; S. Freeway, Fort Worth, TX 76134. PEG, polyethylene glycol; PADPR DHB-Sepharose, poly(ADP-ribose)- §§ To whom correspondence should be addressed: College of Phar- dihydroxyboronyl-Sepharose; HPLC, high pressure liquid chromatogra- macy, University of Kentucky, Lexington, KY 40536-0082. Tel.: 606- phy; bp, base pair(s); kb, kilobase pair(s); MDBK, Madin-Darby bovine 257-5283; Fax: 606-257-7585; E-mail: [email protected]. kidney cells. This paper is available on line at http://www-jbc.stanford.edu/jbc/ 11895 This is an Open Access article under the CC BY license. 11896 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase TABLE I Purification of poly(ADP-ribose) glycohydrolase from bovine thymus Step Protein Total activity Specific activity Yield Purification mg units units/mg protein % -fold Crude extract 27,800 57,400 2.06 100 1.0 Protamine sulfate 12,500 58,000 4.64 101 2.3 Ammonium sulfate 4,480 30,000 6.70 52 3.3 CM-Sepharose 171 19,100 112 33 55 PEG 6000 23.0 7,530 327 13 160 PADPR-DHB-Sepharose 1.30 6,730 5,180 12 2,500 Toyopearl AF-Red 0.023 2,260 98,300 4 48,000 KCl in buffer A. The active fractions, eluting at approximately 1.25 M KCl, were pooled, placed in dialysis tubing, concentrated against solid sucrose to approximately 9 ml, and dialyzed against 20 mM potassium phosphate buffer, pH 7.2, 0.75 M KCl, 0.1% Triton X-100, 10% glycerol, 5mM b-mercaptoethanol, 0.1 mM thioglycolic acid. PARG activity was determined as described by Me ´ nard and Poirier (30), and protein con- tent was determined by the method of Bradford (31). The final prepa- ration was quantified by SDS-PAGE (32) and Coomassie Blue staining to compare the intensity of the protein band with a known amount of bovine serum albumin (33). The purification procedure for the bovine thymus PARG summarized in Table I is typical for results obtained from six separate preparations of the enzyme. Purification from 500 g of bovine thymus achieved approximately 50,000-fold purification and yielded approximately 20 mg of purified protein. Analysis of the final preparation by SDS-PAGE FIG.1. Analysis of purified bovine thymus PARG by SDS- revealed that more than 95% of the protein migrated at an apparent PAGE. An aliquot of the purified enzyme was precipitated by trichlo- molecular mass of approximately 59 kDa (Fig. 1). roacetic acid, washed with acetone, resuspended in SDS-PAGE sample Peptide Sequencing—Prior to proteolytic fragmentation, the purified buffer, separated on a 10% SDS-PAGE gel, and stained with Coomassie PARG (40 mgin100 mlof0.4 M ammonium bicarbonate buffer, pH 8.0, Blue. The positions of molecular weight marker proteins are shown. 8 M urea) was incubated in a final concentration of 2.2 mM dithiothreitol at 56 °C for 15 min. Iodoacetamide was added to a final concentration of TABLE II 2.0 mM, and the sample was incubated at 25 °C for 15 min. After Amino acid sequence of oligopeptides derived from dilution with an equal volume of water, 1.5 units of immobilized L-1- poly(ADP-ribose) glycohydrolase tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin (Pierce) Oligopeptide Amino acid sequence was added, and the sample was incubated at 37 °C for 18 h with gentle rotary shaking. Finally, the mixture was subjected to centrifugation at 10 20 30 16,000 3 g for 5 min to separate the tryptic fragments from the immo- 68 LFTEVLDHNE CLIITGTEQY SEYTGYAETY R bilized trypsin. The tryptic fragments were adjusted to 0.05% in triflu- 63 AYCGFLRPGV SSENLSAVAT GNXGCGAFG oroacetic acid and separated on a 4.6 mm 3 25 cm, Microsorb MV, C 61 FLINPELIVS R reversed-phase HPLC column (Rainin) eluted with an 80-min linear 75 IALXLPNIXT QPIPLL gradient from 4 to 44% acetonitrile in 0.05% trifluoroacetic acid. Four oligopeptide fractions, with approximate elution times of 61, 63, 68, and 75 min, were selected for peptide sequence analysis by the Edman EcoRI-HindIII fragment from PCR product 2 was used as a probe to degradation method (34). Amino acid sequence data of four oligopep- screen approximately 1 3 10 independent clones from the bovine tides, designated by their approximate HPLC elution times from the thymus library. Two positive cDNA clones (clones 1 and 2) were iso- reversed-phase column, are shown in Table II. lated, which overlapped PCR products 1 and 2. However, attempts to cDNA Cloning—To obtain cDNA clones encoding bovine PARG, PCR obtain clones from the bovine thymus library that contained sequence amplification experiments were followed by the screening of two differ- 59 to clone 2 were unsuccessful. Thus, a 231-bp EcoRI-KpnI fragment ent bovine cDNA libraries. Fig. 2 depicts two PCR products and eight from clone 2 was used as a probe to screen approximately 5 3 10 cDNA clones that were isolated to provide a putative full-length cDNA independent clones of the bovine kidney 59 stretch plus cDNA lgt11 clone encoding bovine PARG. For each of the cDNA inserts character- library BL3001b (CLONTECH). Three positive cDNA clones (clones ized, the sequence of both strands was determined by the dideoxynucle- 3–5) were obtained, all of which contained sequence 59 to clone 2. Each otide chain termination method (35) using Sequenase from U.S. Bio- of these clones also contained sequence encoding oligopeptide 75. chemical Corp. Clones 1–5 provided multiple overlapping sequences in the 39-terminal The first step leading to the isolation of cDNA clones was to synthe- portion of a consensus cDNA, but additional clones were sought to size two multidegenerate 17-mer primers, GAYCAYAAYGARTGYYT obtain overlapping sequences for the 59-terminal region. Thus, a 436-bp and CKRTANGTYTCNGCRTA (where Y represents T/C, R is A/G, K is EcoRI-KpnI fragment located at the 59 end of clone 3 was used as a T/G, and N is A/T/C/G), based on two regions of the oligopeptide 68 probe to screen approximately 6 3 10 independent clones of the bovine sequence (DHNECL and YATEYR, Table II). Using the multidegener- kidney library. Clones 6 – 8 provided overlapping sequences for the ate primers and an oligo(dT)-primed bovine thymus cDNA lgt11 library 59-terminal region. The full-length cDNA was constructed by ligating a BL1019b (CLONTECH), PCR amplification generated a 74-bp DNA 3.9-kb XbaI-NsiI fragment from pWL11 (clone 1 cDNA insert in pTZ18R fragment with a deduced amino acid sequence identical to the corre- (36)) and a 3.0-kb NsiI-XbaI fragment from pWL13 (clone 4 cDNA insert sponding region of oligopeptide 68. Next, two specific 24-mer oligonu- in pTZ18R). The resulting plasmid, termed pWL30, contained the cleotide primers (ATCATCACAGGTACTGAGCAGTAC and GCCTGT- 4,070-bp full-length cDNA. GTATTCACTGTACTGCTC) based on the sequence of this 74-bp DNA Expression of PARG in Escherichia coli—PARG was expressed using were used in combination with lgt11 forward and reverse primers to two different bacterial expression systems, the pTrcHis Xpress System amplify PCR products 1 and 2 from the bovine thymus library. PCR (Invitrogen), in which the expressed protein contains a leader polyhis- product 1 contained 231 bp of sequence including the region encoding tidine sequence, and the glutathione S-transferase (GST) gene fusion the N-terminal region of oligopeptide 68 and the entire sequence of system (Pharmacia Biotech Inc.). For expression in the pTrcHis Xpress oligopeptide 61. PCR product 2 contained 757 bp, which included se- system, three different DNA fragments were amplified and inserted quence encoding the C-terminal region of oligopeptide 68 and the entire into the pTrcHis expression plasmid. Construct A, containing the cDNA sequence of oligopeptide 63. The sequence information obtained from sequence 23 to 2,946, was prepared by subcloning a 2.9-kb XhoI-EcoRI PCR products 1 and 2 was used to isolate cDNA clones obtained by the DNA fragment amplified from pWL30 with primers WIN34 (GCT- screening of bovine thymus and bovine kidney cDNA libraries. A 518-bp GCGGGTCTCGAGCATGAGTGCGGGC) and WIN15 (GCGTCTAGAA- The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11897 FIG.2. Alignment of the DNA se- quences of two PCR products and eight lgt11 cDNA clones used to iden- tify the cDNA coding for bovine PARG. The two PCR products and clones 1 and 2 were obtained from the bovine thymus cDNA library. Clones 3– 8 were obtained from the bovine kidney cDNA library. The positions of restriction sites used in this study are shown, and the top diagram shows the consensus clone, de- noting the relative location of the coding regions for oligopeptides 75, 61, 68, and 63 as well as the open reading frame and noncoding regions. TTCACTTGGCTCCTCAGGC). Construct B, containing the cDNA sequ- above (39). Prehybridizations and hybridizations were carried out at ence 23 to 3,813, was prepared by subcloning a 3.8-kb XhoI-EcoRI DNA 42 °C in 50% formamide, 0.25 M sodium phosphate buffer, pH 7.2, 0.25 fragment amplified from pWL30 with primers WIN34 and WIN33 (CC- M NaCl, 7% SDS, 1 mM EDTA. GGAATTCGGGTTTTTTGTTAATGAAAATTTATTAAC). Construct C, containing cDNA sequence 964 –2,946, was prepared by subcloning a RESULTS 2.0-kb DNA fragment amplified from pWL13 with primers WIN14 Isolation of cDNA Clones Encoding Bovine PARG—The com- (TCAGAGCAGATGAACTCGAGCAGTCCAGG) and WIN15. Con- bined nucleotide sequence of clones 1– 8 (Fig. 2) predicted a structs A, B, and C were used to transform E. coli TOP10 cells for expression experiments. full-length cDNA clone of 4,070 bp containing 257 bp of 59- For expression of PARG as a GST fusion protein, an insert containing noncoding sequence, a single open reading frame of 2,931 bp, the cDNA sequence from position 1138 to 2946 was prepared by sub- anda39-noncoding region of 882 bp. Fig. 3 shows the complete cloning a 1.8-kb EcoRI-EcoRI fragment amplified from pWL30 with the TM nucleotide sequence (GenBank accession number U78975) oligonucleotide CCAATTTGAAGGAGGAATTCCCGCCGCCACCATG- and the deduced amino acid sequence, which predicts a protein AATGATGTGAATGCCAAACGACCTGGA and WIN15 as primers. The of 977 amino acids and a molecular mass of 110.8 kDa. resulting DNA fragment was inserted into the EcoRI site of the pGEX-2T expression vector, and the plasmid was used to transform E. Northern Blot Analysis of Bovine Kidney RNA—An unex- coli NM522 cells. pected feature of the consensus full-length cDNA clone was For expression experiments, bacterial cultures were grown at 37 °C that it predicted the expression of a protein of approximately in 1% Bacto-tryptone, 0.5% yeast extract, and 0.5% NaCl to approxi- 111 kDa (Figs. 2 and 3), while the enzymatically active PARG mately 0.6 A /ml and were induced with 1 mM isopropyl-b-D-thiogal- from thymus had a molecular mass of approximately 59 kDa actoside (IPTG). Cells were collected by centrifugation, and crude ex- (Fig. 1). To determine the size of the RNA transcript for PARG, tracts were prepared by sonication (10 A /ml) in 10 mM sodium phosphate buffer, pH 7.2, 150 mM NaCl, 0.5 mg/ml lysozyme, 0.1 mg/ml total RNA and poly(A) RNA were isolated from MDBK cells phenylmethylsulfonyl fluoride, 1 mM EDTA, 0.7 mg/ml pepstatin A, 0.5 and annealed using clone 4 as the hybridization probe. A single mg/ml leupeptin, and 1 mg/ml aprotinin. Cell extracts were subjected to 1 transcript of approximately 4.3 kb was detected in the poly(A) centrifugation, and the supernatant fraction was used for assay. PARG RNA (Fig. 4B, lane 2). Thus, the transcript size was consistent assay conditions were as described previously (30). Following incuba- with the expression of a 111-kDa PARG protein. tions, portions of reaction mixture were analyzed by thin layer chroma- Expression of PARG in E. coli—To determine whether the tography (30) or subjected to anion exchange HPLC. Anion exchange HPLC utilized a Whatman Partisil SAX column equilibrated with 7 mM isolated cDNA encoded PARG, three different constructs con- potassium phosphate buffer, pH 4.0, at a flow rate of 1 ml/min. The taining specific regions of the cDNA were inserted into the sample was diluted in the same buffer, applied to the column, and pTrcHisB expression vector. Constructs A and B contained the eluted with a 30-min linear gradient from 7 mM potassium phosphate entire open reading frame of 110.8 kDa, which together with buffer, pH 4.0, to 250 mM potassium phosphate buffer, 0.5 M KCl, pH the fusion partner predicted a protein of approximately 115 4.0. Activity gel assays for PARG were done by casting polyacrylamide kDa. Construct B also contained the 39-untranslated region of gels with automodified PARP containing [ P]ADP-ribose polymers as described previously (37). Following electrophoresis, PARG was rena- the clone. Since the isolated PARG of approximately 59 kDa tured by incubating the gels at 25 °C in 5 volumes of 50 mM sodium contained enzymatic activity, construct C contained only the phosphate buffer, pH 7.5, 50 mM NaCl, 10% glycerol, 1% Triton X-100, 75-kDa carboxyl-terminal region of the PARG, which predicted 10 mM b-mercaptoethanol, changing the buffer every 3 h for a total of a fusion protein of approximately 79 kDa. Following transfor- five changes. After an additional incubation at 37 °C for 3 h, gels were mation of cells with the three expression constructs, cell ex- dried, and PARG activity was detected following autoradiography as a clear band on a black background. Cell extracts containing PARG fused tracts were examined for PARG activity using three different to GST were examined for binding to glutathione-Sepharose 4B (GSH- assay methods. Using a thin layer chromatography assay that 32 32 Sepharose) (Pharmacia Biotech Inc.) according to the specifications of measures release of [ P]ADP-ribose from [ P]ADP-ribose the manufacturer. polymers (30), PARG activity was detected in extracts from Northern and Southern Blot Analysis—Total cytoplasmic RNA and 1 cells transformed by each of the constructs. Fig. 5A shows poly(A) RNA were isolated from bovine kidney MDBK cells (ATCC results obtained with constructs B and C. No activity was CCL22) using TRIzol reagent (Life Technologies, Inc.) following the manufacturer’s recommendations. RNA was fractionated on denaturing detected in cells transformed with the empty vector, but activ- agarose gels (38), transferred to nylon membranes, and hybridized with ity was detectable without induction by IPTG, indicating a clone 4 (Fig. 2) radiolabeled by a random hexamer priming method (39). leaky lac promoter. The addition of IPTG resulted in a time- Total genomic DNA was prepared from bovine thymus tissue as de- dependent increase of up to approximately 4.5-fold in enzy- scribed previously (38), and DNA (10 mg) was digested with EcoRI, matic activity. Fig. 5A also shows that the enzymatic activity BglII, XbaIor PstI, fractionated on a 1% agarose gel, transferred to a was strongly inhibited by the presence of ADP-hydroxymeth- nylon membrane (Hybond N1, Amersham), and hybridized using an 828-bp HindIII fragment of clone 1 radiolabeled as described for clone 4 ylpyrrolidine diol, a specific inhibitor of PARG (40, 41). The 11898 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase FIG.3. The nucleotide sequence of cDNA coding for bovine PARG. The open reading frame is shown in uppercase letters, and the 59- and 39-noncoding regions are shown in lowercase letters. The deduced amino acid sequence of the enzyme is shown and the underlined sequence identifies the four oligopeptides sequenced from purified enzyme. activity gel assay (37) was used. With construct A, activity was observed at approximately 115 and 59 kDa (Fig. 5C). No bands were produced from extracts from the IPTG-induced pTrcHisB vector that did not contain an insert. Extracts from cells trans- formed with construct B showed bands at approximately 115 and 59 kDa, and extracts from cells transformed with construct C showed bands at approximately 79 and 59 kDa (data not shown). During storage at 4 °C, cell extracts lost activity mi- grating at the higher molecular weight, while the activity at approximately 59 kDa increased (data not shown). Expression of PARG in the pTrcHisB expression vector did not result in detectable amounts of protein by staining with Coomassie Blue. Thus, another construction was designed to overexpress a FIG.4. Northern blot analysis of transcripts from bovine kid- 69-kDa carboxyl-terminal region of the PARG as a fusion with ney cells. Total RNA and poly(A) RNA were isolated from bovine GST, which allows convenient protein purification by affinity kidney MDBK cells as described under “Experimental Procedures.” chromatography on a GSH-Sepharose column. Two hours after Total RNA (5 mg, lanes 1A and 1B) and poly(A) RNA (4 mg, lanes 2A induction with IPTG, strong expression of a protein migrating and 2B) were separated on a denaturing agarose gel. Panel A shows the ethidium bromide-stained gel, and panel B shows the autoradiogram of at approximately 90 kDa was observed (Fig. 5D). This protein a Northern blot analysis using a random primed, P-labeled DNA bound to GSH-Sepharose and was eluted by GSH. The con- probe constructed from clone 4 (Fig. 2). struct contained a thrombin cleavage site between the GST and the 69-kDa region of PARG, and treatment of the material bound to GSH-Sepharose with thrombin resulted in the release material released from ADP-ribose polymers was shown to be of a protein that migrated at approximately 59 kDa. This result exclusively ADP-ribose by strong anion exchange HPLC (Fig. suggests that the protein purified from the bovine thymus may 5B), demonstrating that the cell extracts did not contain any other ADP-ribose polymer-degrading enzymes such as phos- be larger than suggested by its migration on SDS-PAGE. At- tempts to obtain high level expression of the full-length protein phodiesterase, which catalyzes the formation of AMP and phos- phoribosyl-AMP (42). were unsuccessful. To determine the size of the expressed enzymatic activity, an Southern Blot Analysis of PARG Genomic Complexity—Pre- The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11899 FIG.6. Southern blot analysis of bovine DNA probed with PARG cDNA. Bovine genomic DNA from thymus was digested with EcoRI (lane 1), BglII (lane 2), XbaI(lane 3), and PstI(lane 4), subjected to electrophoresis on a 1% agarose gel, and blotted to nylon filters. The blot was annealed with a P-labeled DNA probe corresponding to the carboxyl-terminal region of the PARG protein as described under “Experimental Procedures.” vious studies have reported that PARG isolated from nuclear fractions had a molecular mass of approximately 75 kDa (28, 29), while PARG isolated from whole cell homogenates or post- nuclear supernatant fractions had a molecular mass of approx- imately 59 kDa (26, 27, 43). These results suggest either that two or more genes may code for PARG or that proteolysis generates lower molecular weight forms from higher molecular weight forms. The cDNA isolated encoded a protein consider- ably larger than any PARG proteins previously described, con- sistent with the possibility that the different forms of PARG are derived from a single form by proteolytic cleavage. To test the hypothesis that PARG is encoded by a single copy gene, the genomic complexity of the PARG gene was analyzed by a Southern hybridization experiment. Genomic DNA was di- gested with four different restriction enzymes, which did not contain restriction sites within the carboxyl-terminal region of the PARG cDNA. Following electrophoresis, the restriction di- gests were subjected to hybridization with a probe that corre- sponded to the carboxyl-terminal region of the PARG cDNA. The analysis displayed in Fig. 6 shows that, in each restriction rolidine diol (40, 41). Panel B, analysis of material released from ADP- ribose polymers by anion exchange HPLC. Extracts from a strain con- taining construct B were incubated with [ P]ADP-ribose polymers (30), and a portion was analyzed by anion exchange HPLC as described under “Experimental Procedures.” The elution times for AMP, ADPR, and PR-AMP are indicated by arrows. Panel C, analysis of PARG activity following SDS-PAGE. Crude extracts (1 ml each) of cells trans- formed by pTrcHis without an insert (lane A) or containing construct A (lane B) were analyzed by an activity gel assay in which the gel was incubated following electrophoresis in 50 mM sodium phosphate buffer, pH 7.5, 50 mM NaCl, 10% glycerol, 1% Triton X-100, 10 mM b-mercap- toethanol to allow renaturation of PARG activity (37). The positions of FIG.5. Expression of PARG in E. coli. Panel A, analysis of bacte- molecular weight marker proteins are shown. Panel D, expression of a rial extracts using a thin layer chromatography assay (30). Reaction carboxyl-terminal region of PARG cDNA as a fusion protein with GST. mixtures contained approximately 15,000 cpm of [ P]ADP-ribose poly- A construct corresponding to a 69-kDa carboxyl-terminal region of the mers, and the cpm shown represent ADP-ribose released from the PARG cDNA was prepared and used to transform E. coli NM522 cells as ADP-ribose polymers. Bar 1, a strain transformed by pTrcHis without described under “Experimental Procedures.” Cell extracts were sub- an insert but induced with 1 mM IPTG for5hat37 °C.A strain jected to SDS-PAGE, and proteins were stained by Coomassie Blue. containing construct B is shown without the addition of IPTG (bar 2)or Lane 1, extract from uninduced cells; lane 2, extract from cells induced after the addition of 1 mM IPTG for 1.5 h (bar 3)or5h(bar 4). A strain with 1 mM IPTG for 2 h; lane 3, proteins in extracts from cells shown in containing constructC5h after induction by IPTG is shown in the lane 2 that bound to GSH-Sepharose; lane 4, material released from absence (bar 5) and presence (bar 6)of167 mM ADP-hydroxymethylpyr- GSH-Sepharose by treatment with thrombin. 11900 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase digest, the probe hybridized primarily with a single restriction fragment. The fainter signals probably reflect the presence of introns in the PARG gene. This result indicates that PARG is encoded by a single copy gene in the bovine genome. DISCUSSION The rapid synthesis of ADP-ribose polymers that occurs in response to DNA strand breaks is accompanied by very rapid polymer turnover (4, 10, 11), indicating that PARP and PARG activities are closely coordinated as cells respond to DNA dam- age. While PARP has been widely studied, information con- FIG.7. Alignment of the putative bipartite NLS of bovine, hu- cerning structure and function relationships of PARG is much man, and murine PARG and comparison with the bipartite NLS more limited. of PARP from different organisms. Conserved residues are noted in boldface type, and the amino acid distances are from the amino-termi- The isolation of partial PARG cDNA clones (Fig. 2) has nal methionine residue. Abbreviations and references for the sequences allowed the construction of a cDNA clone that codes for the shown are as follows: bPARG, bovine PARG (this work); hPARP, human sequence of all four oligopeptide sequences present in the iso- 2 2 2 PARG ; mPARG, murine PARG ; CePARG, C. elegans PARG (47) ; lated protein (Table II, Fig. 3) and contains PARG activity hPARP, human PARP (54 –56); mPARP, murine PARP (57); bPARP, bovine PARP (58); aPARP, chicken PAR (59); XlPARP, Xenopus laevis when expressed in E. coli (Fig. 5). The cDNA clone (Fig. 3) has PARP (60); DmPARP, Drosophila melanogaster PARP (61); SpPARP, features typical of cDNAs that code for mammalian proteins. Sarcophaga peregrina PARP (52). These include (i) an oligo A (putative poly(A) ) sequence at the 39 end, (ii) a polyadenylation signal (AATAAA) (44) 12 bp up- carboxyl-terminal portion of the cDNA resulted in enzymatic stream from the oligo A sequence, (iii) a sequence of ATTTA in activity (Fig. 5). (ii) All of the oligopeptides sequenced were the 39-untranslated region thought to play a role in selective located in the carboxyl-terminal half of the protein (Figs. 2 and mRNA degradation in mammalian cells (45), (iv) a single open 3). (iii) The only protein, other than the 59-kDa protein de- reading frame, and (v) a nucleotide sequence around the first tected in the thymus preparation was approximately 111 kDa start codon commonly found at known sites of initiation of (Fig. 1). (iv) The PARG activity expressed in bacteria was translation (46). The likelihood that the cDNA clone con- sensitive to proteolysis, yielding a protein of approximately 59 structed represents a full-length or nearly full-length clone for kDa (Fig. 5). (v) The cleavage site in PARG is in the region of PARG is supported by the observation that hybridization of 1 the putative NLS, and the PARP NLS is located in a protease- poly(A) RNA from bovine kidney cells with the cDNA showed sensitive site (24). Taken together with the data suggesting a single band of hybridization of approximately the same size that bovine PARG appears to be coded for by a single copy gene as the cDNA (Fig. 4). (Fig. 6), proteolysis seems likely to explain the presence of The nucleotide sequence encoding bovine PARG indicates PARG activity with a molecular mass of approximately 74 and that PARG shares little or no homology with other known 59 kDa in bovine thymus preparations (51). Likewise, a similar sequences. A search of sequence data banks has failed to reveal mechanism could explain previous reports of a PARG of 74 kDa significant homology with any sequences coding for known isolated from nuclear fractions of guinea pig liver and human proteins. A strong sequence homology has been observed with placenta (28, 29) and a PARG of 59 kDa isolated from post- human and rat cDNA clones that likely represent partial clones nuclear fractions of guinea pig liver (43). for PARG from these species. Examination of protein sequence While proteolysis of a larger protein to yield smaller proteins data bases also has shown that the deduced amino acid se- retaining PARG activity seems likely to explain the size heter- quence of PARG lacks any sequence homology with known ogeneity of PARG previously reported, it remains to be deter- proteins. However, the amino acid sequence shares a signifi- mined if proteolysis normally occurs in vivo or whether it cant homology with a protein sequence from Caenorhabditis occurs during purification of the enzyme. While our results elegans that may represent the PARG protein from this orga- show that a full-length protein can be expressed containing nism (47). The deduced amino acid sequence of PARG has been PARG activity (Fig. 5C), the molecular size of PARG in vivo examined for a number of structural motifs that can be pre- also remains to be determined. If PARG occurs as a larger dicted from the primary amino acid sequence. We have noted protein, an interesting possibility is that the amino-terminal that the expressed PARG protein can form dimers stable to region may be involved in the regulation of enzymatic activity. SDS-PAGE conditions. In that regard, residues 871–907 show The availability of cDNA clones coding for PARG should significant homologies to known leucine zipper dimerization facilitate studies of structural and functional aspects of this sequences (48). Another motif identified is a putative bipartite enzyme and the metabolic pathway in which it is involved. The nuclear location signal (NLS) (49). It is interesting that PARP isolation and characterization of cDNAs encoding PARG from also contains a bipartite NLS (50). Fig. 7 compares deduced other sources will allow information concerning changes in the amino acid sequences in the NLS region of the bovine PARG structure of the protein during evolution. Studies in progress of and homologous regions of putative PARG sequences from hu- cDNA clones from human and mouse indicate that PARG is man, mouse, and C. elegans with the NLS region of PARP from highly conserved in mammals. The availability of PARP cDNA seven different organisms. The putative NLS of PARG fulfills has allowed a number of molecular genetic approaches to study the criteria for bipartite NLS in that it contains conserved the function(s) of ADP-ribose polymer metabolism, and the acidic and basic amino acid residues at two different locations availability of PARG cDNA should allow the design of addi- each within the region of homology to the NLS of PARP (50). tional molecular genetic approaches for studying this metabo- An intriguing finding was that the PARG cDNA clone codes lism. Recently, a mouse strain containing a genetic inactivation for a protein of approximately 111 kDa, which is nearly twice of the gene encoding PARP has been reported (53). Although the size of the PARG protein isolated from bovine thymus (Fig. not extensively characterized, mice homozygous for the dis- 1). It seems likely that PARG contains a protease sensitive site that, following proteolysis, yields a protein fragment of approx- imately 59 kDa that still retains enzymatic activity. Several J.-C. Ame ´ , A. Huang, E. L. Jacobson, and M. K. Jacobson, unpub- pieces of evidence favor this possibility. (i) Expression of the lished data. The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11901 (1986) Carcinogenesis 7, 327–330 rupted PARP gene are viable, indicating that the absence of 22. Berger, N. A. (1985) Radiat. Res. 101, 4 –15 PARP (and ADP-ribose polymers) has no major consequences 23. Kaufmann, S. H., Desnoyers, S., Ottaviano, Y., Davidson, N. E., and Poirier, G. G. (1993) Cancer Res. 53, 3976 –3985 for development. Disruption of the gene encoding PARG in 24. Lazebnik, Y. A., Kaufmann, S. H., Desnoyer, S., Poirier, G. G., and Earnshaw, mice containing a normal PARP gene will allow the determi- W. C. (1994) Nature 371, 346 –347 nation of whether other cellular enzymes can replace PARG in 25. de Murcia, G., and Me ´ nissier-de Murcia, J. (1994) Trends Biochem. Sci. 19, 172–176 the turnover of ADP-ribose polymers and/or whether develop- 26. Hatakeyama, K., Nemoto, Y., Ueda, K., and Hayaishi, O. (1986) J. Biol. Chem. ment will occur in the absence of PARG. Alternatively, disrup- 261, 14902–14911 tion of the PARG gene in mice containing a disrupted PARP 27. Thomassin, H., Jacobson, M. K., Guay, J., Verreault, A., Aboul-Ela, N., Me ´ nard, L., and Poirier, G. G. (1990) Nucleic Acids Res. 18, 4691– 4694 gene may provide insights for the coordinated function of PARP 28. Tanuma, S., Kawashima, K., and Endo, H. (1986) J. Biol. Chem. 261, 965–969 and PARG. 29. Uchida, K., Suzuki, H., Maruta, H., Abe, H., Aoki, K., Miwa, M., and Tanuma, S. (1993) J. Biol. Chem. 268, 3194 –3200 Understanding the involvement of ADP-ribose polymer me- 30. Me ´ nard, L., and Poirier, G. G. (1987) Biochem. Cell Biol. 65, 668 – 673 tabolism in determining the frequency of alternative cellular 31. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254 outcomes of DNA damage may also have a therapeutic benefit. 32. Laemmli, U. K. (1970) Nature 227, 680 – 685 33. Peterson, G. L. (1983) Methods Enzymol. 91, 95–119 For example, the efficacy of many antitumor agents appears to 34. Edman, P., and Begg, G. (1967) Eur. J. Biochem. 1, 80 –90 be closely related to the ability to increase the frequency of 35. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. apoptosis (1, 23). The ability of inhibitors of PARP to chemo- 74, 5463–5467 36. Mead, D. A., Szczesna-Skorupa, E., and Kemper, B. (1986) Protein Eng. 1, sensitize specifically cycling cells to the cytotoxic effects of 67–74 DNA-damaging agents has demonstrated the potential of tar- 37. Brochu, G., Shah, G. M., and Poirier, G. G. (1994) Anal. Biochem. 218, 265–272 38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1982) Molecular Cloning: A geting ADP-ribose polymer metabolism for cancer therapy (16). Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, In that regard, PARG is a potentially attractive target due to New York its low abundance, its structurally unique substrate, and the 39. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6 –13 40. Slama, J. T., Aboul-Ela, N., Goli, D. M., Cheesman, B. V., Simmons, A. M., and high turnover of ADP-ribose polymers that occurs following Jacobson, M. K. (1995) J. Med. Chem. 38, 389 –393 DNA damage. Modulation of PARG activity by chemical inhib- 41. Slama, J. T., Aboul-Ela, N., and Jacobson, M. K. (1995) J. Med. Chem. 38, 4332– 4336 itors or by molecular genetic approaches should allow assess- 42. Althaus, F. R., and Richter, C. (1987) Molecular Biology, Biochemistry and ment of the value of PARG as a new target for therapeutic Biophysics, Vol. 37, Springer-Verlag, Berlin development. 43. Maruta, H., Inageda, K., Aoki, T., Nishina, H., and Tanuma, S. (1991) Biochemistry 30, 5907–5912 44. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263, 211–214 Acknowledgments—We thank Donna Coyle for excellent technical 45. Shaw, G., and Kamen, R. (1986) Cell 46, 659 – 667 assistance, Arnold Huang for growth of MDBK cells, and Dr. Guy 46. Kozak, M. (1987) Nucleic Acids Res. 15, 8125– 8148 Poirier for many helpful discussions. The PARG inhibitor ADP-hy- 47. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., droxymethylpyrrolidine diol was a gift from Dr. James Slama. Peptide Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., sequence determinations were done by the University of Kentucky Dear, S., Du, Z., Durbin, R., Favello, A., Fulton, L., Gardner, A., Green, P., Molecular Structure and Analysis Facility directed by Dr. Thomas Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Vannaman. Kirsten, J., Laister, N., Latreille, P., Lightning, J., Lloyd, C., McMurray, A., Mortimore, B., O’Callaghan, M., Parsons, J., Percy, C., Rifken, L., Roopra, REFERENCES A., Saunders, D., Shownkeen, R., Smaldon, N., Smith, N., Sonnhammer, A., Staden, E., Sulston, R., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, 1. Thompson, C. B. (1995) Science 267, 1456 –1462 K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and 2. Lautier, D., Lagueux, J., Thibodeau, J., Me ´ nard, L., and Poirier, G. G. (1993) Wohldman, P. (1994) Nature 368, 32–38 Mol. Cell. Biochem. 122, 171–193 48. Brendel, V., Bucher, P., Nourbakhsh, I. R., Blaisdell, B. E., and Karlin, S. 3. Alvarez-Gonzalez, R., and Jacobson, M. K. (1987) Biochemistry 26, 3218 –3224 (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2002–2006 4. Juarez-Salinas, H., Sims, J. L., and Jacobson, M. K. (1979) Nature 282, 49. Robbins, J., Dilworth, S. M., Laskey, R. A., and Dingwall, C. (1991) Cell 64, 740 –741 615– 623 5. Adamietz, P. (1987) Eur. J. Biochem 169, 365–372 50. Schreiber, V., Molinete, M., Boeuf, H., de Murcia, G., and Me ´ nissier-de Murcia, 6. Krupitza, G., and Cerutti, P. (1989) Biochemistry 28, 2034 –2040 J. (1992) EMBO J. 11, 3263–3269 7. Krupitza, G., and Cerutti, P. (1989) Biochemistry 28, 4054 – 4060 51. Brochu, G., Duchaine, C., Thibeault, L., Lagueux, J., Shah, G. M., and Poirier, 8. Adamietz, P., and Rudolph, A. (1984) J. Biol. Chem. 259, 6841– 6846 G. G. (1994) Biochim. Biophys. Acta 1219, 342–350 9. Kreimeyer, A., Wielckens, K., Adamietz, P., and Hilz, H. (1984) J. Biol. Chem. 52. Masutani, M., Nozaki, T., Hitomi, Y., Ikejima, M., Nagasaki, K., Prati, A. C., 259, 890 – 896 Kurata, S., Natori, S., Sugimura, T., and Esumi, H. (1994) Eur. J. Biochem. 10. Wielckens, K., Schmidt, A., George, E., Bredehorst, R., and Hilz, H. (1982) 220, 607– 614 J. Biol. Chem. 257, 12872–12877 53. Wang, Z.-Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Schweiger, 11. Jacobson, E. L., Antol, K. M., Juarez-Salinas, H., and Jacobson, M. K. (1983) M., and Wagner, E. F. (1995) Genes & Dev. 9, 509 –520 J. Biol. Chem. 258, 103–107 54. Uchida, K., Morita, T., Sato, T., Ogura, T., Yamashita, R., Nogushi, S., Suzuki, 12. Miwa, M., and Sugimura, T. (1971) J. Biol. Chem. 246, 6362– 6364 H., Nyunoya, H., Miwa, M., and Sugimura, T. (1987) Biochem. Biophys. Res. 13. Ueda, K., Oka, J., Narumiya, S., Miyakawa, N., and Hayaishi, O. (1972) Commun. 148, 617– 622 Biochem. Biophys. Res. Commun. 46, 516 –523 55. Cherney, B. W., McBride, O. W., Chen, D., Alkhatib, H., Bhatia, K., Hensley, 14. Oka, J., Ueda, K., Hayaishi, O., Komura, H., and Nakanishi, K. (1984) J. Biol. P., and Smulson, M. E. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8370 – 8374 Chem. 259, 986 –995 56. Kurosaki, T., Ushiro, H., Mitsuuchi, Y., Suzuki, S., Matsuda, M., Matsuda, Y., 15. Nudka, N., Skidmore, C. J., and Shall, S. (1980) Eur. J. Biochem. 105, 525–530 Katunuma, N., Kangawa, K., Matsuo, H., Hirose, T., Inayama, S., and 16. Jacobson, E. L., Smith, J. Y., Wielckens, K., Hilz, H., and Jacobson, M. K. Shizuta, Y. (1987) J. Biol. Chem. 262, 15990 –15997 (1985) Carcinogenesis 6, 715–718 57. Huppi, K., Bhatia, K., Siwarski, D., Klinman, D., Cherney, B., and Smulson, 17. Ku ¨ pper, J. H., de Murcia, G., and Bu ¨ rkle, A. (1990) J. Biol. Chem. 265, M. (1989) Nucleic Acids Res. 17, 3387–3401 18721–18724 58. Saito, I., Hatakeyama, K., Kido, T., Ohkubo, H., Nakanishi, S., and Ueda, K. 18. Ding, R., Pommier, Y., Kang, V. H., and Smulson, M. (1992) J. Biol. Chem. 267, (1990) Gene (Amst.) 90, 249 –254 12804 –12812 19. Jacobson, E. L., Smith, J. Y., Nunbhakdi, V., and Smith, D. G. (1985) in 59. Ittel, M.-E., Garnier, J.-M., Jeltsch, J.-M., and Niedergang, C. (1991) Gene (Amst.) 102, 157–164 ADP-ribosylation of Proteins (Althaus, F. R., Hilz, H., and Shall, S., eds) pp. 277–283, Springer-Verlag, Berlin 60. Saulier-Le Drean, B. M. (1992) Poly(ADP-ribose) Polymerase in Xenopus lae- vis, Ph.D. thesis, Universite ´ De Rennes, France 20. Lubet, R. A., McCarvill, J. T., Schwartz, J. L., Putman, D. L., and Schechtman, L. M. (1986) Carcinogenesis 7, 71–75 61. Uchida, K., Hanai, S., Ishikawa, K.-I., Ozawa, Y.-I., Uchida, M., Sugimura, T., and Miwa, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3481–3485 21. Kasid, U. N., Stefanik, D. F., Lubet, R. A., Dritschilo, A., and Smulson, M. E. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Isolation and Characterization of the cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase

Download PDF
7 pages

Loading next page...
 
/lp/unpaywall/isolation-and-characterization-of-the-cdna-encoding-bovine-poly-adp-VRpsY3JLNk

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.272.18.11895
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 18, Issue of May 2, pp. 11895–11901, 1997 © 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Isolation and Characterization of the cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase* (Received for publication, January 9, 1997, and in revised form, February 24, 1997) Wensheng Lin‡§¶, Jean-Christophe Ame ´ ‡§, Nasreen Aboul-Elai, Elaine L. Jacobson**‡‡, and Myron K. Jacobson‡ ‡‡§§ From the ‡Division of Medicinal Chemistry and Pharmaceutics, College of Pharmacy, the **Department of Clinical Sciences, and the ‡‡Lucille P. Markey Cancer Center, University of Kentucky, Lexington, Kentucky 40536 The synthesis and rapid turnover of ADP-ribose poly- ribose) polymerase (PARP) by DNA strand breaks (2). PARP mers is an immediate cellular response to DNA damage. catalyzes the conversion of NAD to multibranched polymers We report here the isolation and characterization of containing up to 200 ADP-ribose residues (3). Increases in cDNA encoding poly(ADP-ribose) glycohydrolase polymer levels of more than 100-fold may occur within minutes (PARG), the enzyme responsible for polymer turnover. (4). PARP is a major acceptor for ADP-ribose polymers in an PARG was isolated from bovine thymus, yielding a pro- automodification reaction (5–7), while histones and other DNA tein of approximately 59 kDa. Based on the sequence of binding proteins also are modified to a lesser extent (8, 9). Once oligopeptides derived from the enzyme, polymerase synthesized, polymers are rapidly turned over (10, 11), being chain reaction products and partial cDNA clones were converted to free ADP-ribose by the action of poly(ADP-ribose) isolated and used to construct a putative full-length glycohydrolase (PARG) (12, 13). An ADP-ribosyl protein lyase cDNA. The cDNA of approximately 4.1 kilobase pairs has been proposed to catalyze removal of protein-proximal predicted expression of a protein of approximately 111 ADP-ribose monomers (14). kDa, nearly twice the size of the isolated protein. A While the changes in chromatin structure that accompany single transcript of approximately 4.3 kilobase pairs was the rapid synthesis and turnover of this large polyanion are detected in bovine kidney poly(A) RNA, consistent with still poorly understood, ADP-ribose polymer metabolism has expression of a protein of 111 kDa. Expression of the been linked to the enhancement of DNA repair (15–18), limi- cDNA in Escherichia coli resulted in an enzymatically tation of malignant transformation (19 –21), enhancement of active protein of 111 kDa and an active fragment of 59 necrotic cell death (22), and involvement in programmed cell kDa. Analysis of restriction endonuclease fragments death (23, 24). To date, studies of the structure and function of from bovine DNA by Southern hybridization indicated the enzymes of ADP-ribose polymer metabolism have been that PARG is encoded by a single copy gene. Taken together, the results indicate that previous reports of mainly limited to PARP (25). PARG has been isolated to ap- multiple PARGs can be explained by proteolysis of an parent homogeneity from bovine thymus (26, 27), guinea pig 111-kDa enzyme. The deduced amino acid sequence of liver (28), and human placenta (29), and basic enzymatic fea- the bovine PARG shares little or no homology with other tures have been established (26). However, the structure of the known proteins. However, it contains a putative bipar- protein has not been elucidated. We report here the isolation tite nuclear location signal as would be predicted for a and characterization of the cDNA encoding bovine PARG. The nuclear protein. The availability of cDNA clones for availability of cDNA clones for PARG should facilitate detailed PARG should facilitate structure-function studies of the studies of the enzyme and the involvement of ADP-ribose poly- enzyme and its involvement in cellular responses to mer metabolism in cellular responses to DNA damage. genomic damage. EXPERIMENTAL PROCEDURES Purification of PARG—PARG was purified from bovine thymus tis- sue (Pel-Freez) by modifications of previously published procedures (26, The biological consequences of genomic damage include re- 27). The enzyme was isolated up to the polyethylene glycol (PEG)-6,000 covery of normal cell function, cellular survival leading to ma- fractionation step as described previously (27). However, DNA-agarose lignant transformation, or cell death by necrosis or apoptosis and heparin-Sepharose chromatographic steps used previously were (1). Among the many variables that can affect the ultimate omitted, and the PEG-6,000 fraction was applied directly to an affinity biological consequence of DNA damage to a particular cell are matrix of poly(ADP-ribose)-dihydroxyboronyl-Sepharose (PADPR DHB- (i) the amount, type, and location of the DNA damage and (ii) Sepharose). The active fractions eluted from PADPR DHB-Sepharose (25 ml) were pooled, placed in dialysis tubing, concentrated against dry the cellular response elicited by the damage. An immediate PEG-20,000 to approximately 12 ml, and dialyzed against 2 liters of 20 cellular response to DNA damage is the activation of poly(ADP- mM potassium phosphate buffer, pH 8.0, 0.1% Triton X-100, 5 mM b-mercaptoethanol, 0.1 mM thioglycolic acid, 0.4 M KCl (buffer A). The sample was loaded onto a 1.0 3 11-cm Toyopearl AF-Red (Supelco) * This work was supported in part by National Institutes of Health column, and PARG was eluted with an 80-ml linear gradient of 0.4 –2 M Grant CA43894. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The abbreviations used are: PARP, poly(ADP-ribose) polymerase § The first two authors contributed equally to this work. (EC 2.4.2.30); GSH-Sepharose, glutathione-Sepharose 4B; GST, gluta- ¶ Present address: Graduate Center for Toxicology, Health Science thione S-transferase; IPTG, isopropyl-b-D-thiogalactoside; NLS, nu- Research Building, University of Kentucky, Lexington, KY 40536. clear location signal; PAGE, polyacrylamide-gel electrophoresis; PARG, i Present address: Alcon Laboratories, Conner Center, R2– 41, 6201 poly(ADP-ribose) glycohydrolase; PCR, polymerase chain reaction; S. Freeway, Fort Worth, TX 76134. PEG, polyethylene glycol; PADPR DHB-Sepharose, poly(ADP-ribose)- §§ To whom correspondence should be addressed: College of Phar- dihydroxyboronyl-Sepharose; HPLC, high pressure liquid chromatogra- macy, University of Kentucky, Lexington, KY 40536-0082. Tel.: 606- phy; bp, base pair(s); kb, kilobase pair(s); MDBK, Madin-Darby bovine 257-5283; Fax: 606-257-7585; E-mail: [email protected]. kidney cells. This paper is available on line at http://www-jbc.stanford.edu/jbc/ 11895 This is an Open Access article under the CC BY license. 11896 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase TABLE I Purification of poly(ADP-ribose) glycohydrolase from bovine thymus Step Protein Total activity Specific activity Yield Purification mg units units/mg protein % -fold Crude extract 27,800 57,400 2.06 100 1.0 Protamine sulfate 12,500 58,000 4.64 101 2.3 Ammonium sulfate 4,480 30,000 6.70 52 3.3 CM-Sepharose 171 19,100 112 33 55 PEG 6000 23.0 7,530 327 13 160 PADPR-DHB-Sepharose 1.30 6,730 5,180 12 2,500 Toyopearl AF-Red 0.023 2,260 98,300 4 48,000 KCl in buffer A. The active fractions, eluting at approximately 1.25 M KCl, were pooled, placed in dialysis tubing, concentrated against solid sucrose to approximately 9 ml, and dialyzed against 20 mM potassium phosphate buffer, pH 7.2, 0.75 M KCl, 0.1% Triton X-100, 10% glycerol, 5mM b-mercaptoethanol, 0.1 mM thioglycolic acid. PARG activity was determined as described by Me ´ nard and Poirier (30), and protein con- tent was determined by the method of Bradford (31). The final prepa- ration was quantified by SDS-PAGE (32) and Coomassie Blue staining to compare the intensity of the protein band with a known amount of bovine serum albumin (33). The purification procedure for the bovine thymus PARG summarized in Table I is typical for results obtained from six separate preparations of the enzyme. Purification from 500 g of bovine thymus achieved approximately 50,000-fold purification and yielded approximately 20 mg of purified protein. Analysis of the final preparation by SDS-PAGE FIG.1. Analysis of purified bovine thymus PARG by SDS- revealed that more than 95% of the protein migrated at an apparent PAGE. An aliquot of the purified enzyme was precipitated by trichlo- molecular mass of approximately 59 kDa (Fig. 1). roacetic acid, washed with acetone, resuspended in SDS-PAGE sample Peptide Sequencing—Prior to proteolytic fragmentation, the purified buffer, separated on a 10% SDS-PAGE gel, and stained with Coomassie PARG (40 mgin100 mlof0.4 M ammonium bicarbonate buffer, pH 8.0, Blue. The positions of molecular weight marker proteins are shown. 8 M urea) was incubated in a final concentration of 2.2 mM dithiothreitol at 56 °C for 15 min. Iodoacetamide was added to a final concentration of TABLE II 2.0 mM, and the sample was incubated at 25 °C for 15 min. After Amino acid sequence of oligopeptides derived from dilution with an equal volume of water, 1.5 units of immobilized L-1- poly(ADP-ribose) glycohydrolase tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin (Pierce) Oligopeptide Amino acid sequence was added, and the sample was incubated at 37 °C for 18 h with gentle rotary shaking. Finally, the mixture was subjected to centrifugation at 10 20 30 16,000 3 g for 5 min to separate the tryptic fragments from the immo- 68 LFTEVLDHNE CLIITGTEQY SEYTGYAETY R bilized trypsin. The tryptic fragments were adjusted to 0.05% in triflu- 63 AYCGFLRPGV SSENLSAVAT GNXGCGAFG oroacetic acid and separated on a 4.6 mm 3 25 cm, Microsorb MV, C 61 FLINPELIVS R reversed-phase HPLC column (Rainin) eluted with an 80-min linear 75 IALXLPNIXT QPIPLL gradient from 4 to 44% acetonitrile in 0.05% trifluoroacetic acid. Four oligopeptide fractions, with approximate elution times of 61, 63, 68, and 75 min, were selected for peptide sequence analysis by the Edman EcoRI-HindIII fragment from PCR product 2 was used as a probe to degradation method (34). Amino acid sequence data of four oligopep- screen approximately 1 3 10 independent clones from the bovine tides, designated by their approximate HPLC elution times from the thymus library. Two positive cDNA clones (clones 1 and 2) were iso- reversed-phase column, are shown in Table II. lated, which overlapped PCR products 1 and 2. However, attempts to cDNA Cloning—To obtain cDNA clones encoding bovine PARG, PCR obtain clones from the bovine thymus library that contained sequence amplification experiments were followed by the screening of two differ- 59 to clone 2 were unsuccessful. Thus, a 231-bp EcoRI-KpnI fragment ent bovine cDNA libraries. Fig. 2 depicts two PCR products and eight from clone 2 was used as a probe to screen approximately 5 3 10 cDNA clones that were isolated to provide a putative full-length cDNA independent clones of the bovine kidney 59 stretch plus cDNA lgt11 clone encoding bovine PARG. For each of the cDNA inserts character- library BL3001b (CLONTECH). Three positive cDNA clones (clones ized, the sequence of both strands was determined by the dideoxynucle- 3–5) were obtained, all of which contained sequence 59 to clone 2. Each otide chain termination method (35) using Sequenase from U.S. Bio- of these clones also contained sequence encoding oligopeptide 75. chemical Corp. Clones 1–5 provided multiple overlapping sequences in the 39-terminal The first step leading to the isolation of cDNA clones was to synthe- portion of a consensus cDNA, but additional clones were sought to size two multidegenerate 17-mer primers, GAYCAYAAYGARTGYYT obtain overlapping sequences for the 59-terminal region. Thus, a 436-bp and CKRTANGTYTCNGCRTA (where Y represents T/C, R is A/G, K is EcoRI-KpnI fragment located at the 59 end of clone 3 was used as a T/G, and N is A/T/C/G), based on two regions of the oligopeptide 68 probe to screen approximately 6 3 10 independent clones of the bovine sequence (DHNECL and YATEYR, Table II). Using the multidegener- kidney library. Clones 6 – 8 provided overlapping sequences for the ate primers and an oligo(dT)-primed bovine thymus cDNA lgt11 library 59-terminal region. The full-length cDNA was constructed by ligating a BL1019b (CLONTECH), PCR amplification generated a 74-bp DNA 3.9-kb XbaI-NsiI fragment from pWL11 (clone 1 cDNA insert in pTZ18R fragment with a deduced amino acid sequence identical to the corre- (36)) and a 3.0-kb NsiI-XbaI fragment from pWL13 (clone 4 cDNA insert sponding region of oligopeptide 68. Next, two specific 24-mer oligonu- in pTZ18R). The resulting plasmid, termed pWL30, contained the cleotide primers (ATCATCACAGGTACTGAGCAGTAC and GCCTGT- 4,070-bp full-length cDNA. GTATTCACTGTACTGCTC) based on the sequence of this 74-bp DNA Expression of PARG in Escherichia coli—PARG was expressed using were used in combination with lgt11 forward and reverse primers to two different bacterial expression systems, the pTrcHis Xpress System amplify PCR products 1 and 2 from the bovine thymus library. PCR (Invitrogen), in which the expressed protein contains a leader polyhis- product 1 contained 231 bp of sequence including the region encoding tidine sequence, and the glutathione S-transferase (GST) gene fusion the N-terminal region of oligopeptide 68 and the entire sequence of system (Pharmacia Biotech Inc.). For expression in the pTrcHis Xpress oligopeptide 61. PCR product 2 contained 757 bp, which included se- system, three different DNA fragments were amplified and inserted quence encoding the C-terminal region of oligopeptide 68 and the entire into the pTrcHis expression plasmid. Construct A, containing the cDNA sequence of oligopeptide 63. The sequence information obtained from sequence 23 to 2,946, was prepared by subcloning a 2.9-kb XhoI-EcoRI PCR products 1 and 2 was used to isolate cDNA clones obtained by the DNA fragment amplified from pWL30 with primers WIN34 (GCT- screening of bovine thymus and bovine kidney cDNA libraries. A 518-bp GCGGGTCTCGAGCATGAGTGCGGGC) and WIN15 (GCGTCTAGAA- The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11897 FIG.2. Alignment of the DNA se- quences of two PCR products and eight lgt11 cDNA clones used to iden- tify the cDNA coding for bovine PARG. The two PCR products and clones 1 and 2 were obtained from the bovine thymus cDNA library. Clones 3– 8 were obtained from the bovine kidney cDNA library. The positions of restriction sites used in this study are shown, and the top diagram shows the consensus clone, de- noting the relative location of the coding regions for oligopeptides 75, 61, 68, and 63 as well as the open reading frame and noncoding regions. TTCACTTGGCTCCTCAGGC). Construct B, containing the cDNA sequ- above (39). Prehybridizations and hybridizations were carried out at ence 23 to 3,813, was prepared by subcloning a 3.8-kb XhoI-EcoRI DNA 42 °C in 50% formamide, 0.25 M sodium phosphate buffer, pH 7.2, 0.25 fragment amplified from pWL30 with primers WIN34 and WIN33 (CC- M NaCl, 7% SDS, 1 mM EDTA. GGAATTCGGGTTTTTTGTTAATGAAAATTTATTAAC). Construct C, containing cDNA sequence 964 –2,946, was prepared by subcloning a RESULTS 2.0-kb DNA fragment amplified from pWL13 with primers WIN14 Isolation of cDNA Clones Encoding Bovine PARG—The com- (TCAGAGCAGATGAACTCGAGCAGTCCAGG) and WIN15. Con- bined nucleotide sequence of clones 1– 8 (Fig. 2) predicted a structs A, B, and C were used to transform E. coli TOP10 cells for expression experiments. full-length cDNA clone of 4,070 bp containing 257 bp of 59- For expression of PARG as a GST fusion protein, an insert containing noncoding sequence, a single open reading frame of 2,931 bp, the cDNA sequence from position 1138 to 2946 was prepared by sub- anda39-noncoding region of 882 bp. Fig. 3 shows the complete cloning a 1.8-kb EcoRI-EcoRI fragment amplified from pWL30 with the TM nucleotide sequence (GenBank accession number U78975) oligonucleotide CCAATTTGAAGGAGGAATTCCCGCCGCCACCATG- and the deduced amino acid sequence, which predicts a protein AATGATGTGAATGCCAAACGACCTGGA and WIN15 as primers. The of 977 amino acids and a molecular mass of 110.8 kDa. resulting DNA fragment was inserted into the EcoRI site of the pGEX-2T expression vector, and the plasmid was used to transform E. Northern Blot Analysis of Bovine Kidney RNA—An unex- coli NM522 cells. pected feature of the consensus full-length cDNA clone was For expression experiments, bacterial cultures were grown at 37 °C that it predicted the expression of a protein of approximately in 1% Bacto-tryptone, 0.5% yeast extract, and 0.5% NaCl to approxi- 111 kDa (Figs. 2 and 3), while the enzymatically active PARG mately 0.6 A /ml and were induced with 1 mM isopropyl-b-D-thiogal- from thymus had a molecular mass of approximately 59 kDa actoside (IPTG). Cells were collected by centrifugation, and crude ex- (Fig. 1). To determine the size of the RNA transcript for PARG, tracts were prepared by sonication (10 A /ml) in 10 mM sodium phosphate buffer, pH 7.2, 150 mM NaCl, 0.5 mg/ml lysozyme, 0.1 mg/ml total RNA and poly(A) RNA were isolated from MDBK cells phenylmethylsulfonyl fluoride, 1 mM EDTA, 0.7 mg/ml pepstatin A, 0.5 and annealed using clone 4 as the hybridization probe. A single mg/ml leupeptin, and 1 mg/ml aprotinin. Cell extracts were subjected to 1 transcript of approximately 4.3 kb was detected in the poly(A) centrifugation, and the supernatant fraction was used for assay. PARG RNA (Fig. 4B, lane 2). Thus, the transcript size was consistent assay conditions were as described previously (30). Following incuba- with the expression of a 111-kDa PARG protein. tions, portions of reaction mixture were analyzed by thin layer chroma- Expression of PARG in E. coli—To determine whether the tography (30) or subjected to anion exchange HPLC. Anion exchange HPLC utilized a Whatman Partisil SAX column equilibrated with 7 mM isolated cDNA encoded PARG, three different constructs con- potassium phosphate buffer, pH 4.0, at a flow rate of 1 ml/min. The taining specific regions of the cDNA were inserted into the sample was diluted in the same buffer, applied to the column, and pTrcHisB expression vector. Constructs A and B contained the eluted with a 30-min linear gradient from 7 mM potassium phosphate entire open reading frame of 110.8 kDa, which together with buffer, pH 4.0, to 250 mM potassium phosphate buffer, 0.5 M KCl, pH the fusion partner predicted a protein of approximately 115 4.0. Activity gel assays for PARG were done by casting polyacrylamide kDa. Construct B also contained the 39-untranslated region of gels with automodified PARP containing [ P]ADP-ribose polymers as described previously (37). Following electrophoresis, PARG was rena- the clone. Since the isolated PARG of approximately 59 kDa tured by incubating the gels at 25 °C in 5 volumes of 50 mM sodium contained enzymatic activity, construct C contained only the phosphate buffer, pH 7.5, 50 mM NaCl, 10% glycerol, 1% Triton X-100, 75-kDa carboxyl-terminal region of the PARG, which predicted 10 mM b-mercaptoethanol, changing the buffer every 3 h for a total of a fusion protein of approximately 79 kDa. Following transfor- five changes. After an additional incubation at 37 °C for 3 h, gels were mation of cells with the three expression constructs, cell ex- dried, and PARG activity was detected following autoradiography as a clear band on a black background. Cell extracts containing PARG fused tracts were examined for PARG activity using three different to GST were examined for binding to glutathione-Sepharose 4B (GSH- assay methods. Using a thin layer chromatography assay that 32 32 Sepharose) (Pharmacia Biotech Inc.) according to the specifications of measures release of [ P]ADP-ribose from [ P]ADP-ribose the manufacturer. polymers (30), PARG activity was detected in extracts from Northern and Southern Blot Analysis—Total cytoplasmic RNA and 1 cells transformed by each of the constructs. Fig. 5A shows poly(A) RNA were isolated from bovine kidney MDBK cells (ATCC results obtained with constructs B and C. No activity was CCL22) using TRIzol reagent (Life Technologies, Inc.) following the manufacturer’s recommendations. RNA was fractionated on denaturing detected in cells transformed with the empty vector, but activ- agarose gels (38), transferred to nylon membranes, and hybridized with ity was detectable without induction by IPTG, indicating a clone 4 (Fig. 2) radiolabeled by a random hexamer priming method (39). leaky lac promoter. The addition of IPTG resulted in a time- Total genomic DNA was prepared from bovine thymus tissue as de- dependent increase of up to approximately 4.5-fold in enzy- scribed previously (38), and DNA (10 mg) was digested with EcoRI, matic activity. Fig. 5A also shows that the enzymatic activity BglII, XbaIor PstI, fractionated on a 1% agarose gel, transferred to a was strongly inhibited by the presence of ADP-hydroxymeth- nylon membrane (Hybond N1, Amersham), and hybridized using an 828-bp HindIII fragment of clone 1 radiolabeled as described for clone 4 ylpyrrolidine diol, a specific inhibitor of PARG (40, 41). The 11898 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase FIG.3. The nucleotide sequence of cDNA coding for bovine PARG. The open reading frame is shown in uppercase letters, and the 59- and 39-noncoding regions are shown in lowercase letters. The deduced amino acid sequence of the enzyme is shown and the underlined sequence identifies the four oligopeptides sequenced from purified enzyme. activity gel assay (37) was used. With construct A, activity was observed at approximately 115 and 59 kDa (Fig. 5C). No bands were produced from extracts from the IPTG-induced pTrcHisB vector that did not contain an insert. Extracts from cells trans- formed with construct B showed bands at approximately 115 and 59 kDa, and extracts from cells transformed with construct C showed bands at approximately 79 and 59 kDa (data not shown). During storage at 4 °C, cell extracts lost activity mi- grating at the higher molecular weight, while the activity at approximately 59 kDa increased (data not shown). Expression of PARG in the pTrcHisB expression vector did not result in detectable amounts of protein by staining with Coomassie Blue. Thus, another construction was designed to overexpress a FIG.4. Northern blot analysis of transcripts from bovine kid- 69-kDa carboxyl-terminal region of the PARG as a fusion with ney cells. Total RNA and poly(A) RNA were isolated from bovine GST, which allows convenient protein purification by affinity kidney MDBK cells as described under “Experimental Procedures.” chromatography on a GSH-Sepharose column. Two hours after Total RNA (5 mg, lanes 1A and 1B) and poly(A) RNA (4 mg, lanes 2A induction with IPTG, strong expression of a protein migrating and 2B) were separated on a denaturing agarose gel. Panel A shows the ethidium bromide-stained gel, and panel B shows the autoradiogram of at approximately 90 kDa was observed (Fig. 5D). This protein a Northern blot analysis using a random primed, P-labeled DNA bound to GSH-Sepharose and was eluted by GSH. The con- probe constructed from clone 4 (Fig. 2). struct contained a thrombin cleavage site between the GST and the 69-kDa region of PARG, and treatment of the material bound to GSH-Sepharose with thrombin resulted in the release material released from ADP-ribose polymers was shown to be of a protein that migrated at approximately 59 kDa. This result exclusively ADP-ribose by strong anion exchange HPLC (Fig. suggests that the protein purified from the bovine thymus may 5B), demonstrating that the cell extracts did not contain any other ADP-ribose polymer-degrading enzymes such as phos- be larger than suggested by its migration on SDS-PAGE. At- tempts to obtain high level expression of the full-length protein phodiesterase, which catalyzes the formation of AMP and phos- phoribosyl-AMP (42). were unsuccessful. To determine the size of the expressed enzymatic activity, an Southern Blot Analysis of PARG Genomic Complexity—Pre- The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11899 FIG.6. Southern blot analysis of bovine DNA probed with PARG cDNA. Bovine genomic DNA from thymus was digested with EcoRI (lane 1), BglII (lane 2), XbaI(lane 3), and PstI(lane 4), subjected to electrophoresis on a 1% agarose gel, and blotted to nylon filters. The blot was annealed with a P-labeled DNA probe corresponding to the carboxyl-terminal region of the PARG protein as described under “Experimental Procedures.” vious studies have reported that PARG isolated from nuclear fractions had a molecular mass of approximately 75 kDa (28, 29), while PARG isolated from whole cell homogenates or post- nuclear supernatant fractions had a molecular mass of approx- imately 59 kDa (26, 27, 43). These results suggest either that two or more genes may code for PARG or that proteolysis generates lower molecular weight forms from higher molecular weight forms. The cDNA isolated encoded a protein consider- ably larger than any PARG proteins previously described, con- sistent with the possibility that the different forms of PARG are derived from a single form by proteolytic cleavage. To test the hypothesis that PARG is encoded by a single copy gene, the genomic complexity of the PARG gene was analyzed by a Southern hybridization experiment. Genomic DNA was di- gested with four different restriction enzymes, which did not contain restriction sites within the carboxyl-terminal region of the PARG cDNA. Following electrophoresis, the restriction di- gests were subjected to hybridization with a probe that corre- sponded to the carboxyl-terminal region of the PARG cDNA. The analysis displayed in Fig. 6 shows that, in each restriction rolidine diol (40, 41). Panel B, analysis of material released from ADP- ribose polymers by anion exchange HPLC. Extracts from a strain con- taining construct B were incubated with [ P]ADP-ribose polymers (30), and a portion was analyzed by anion exchange HPLC as described under “Experimental Procedures.” The elution times for AMP, ADPR, and PR-AMP are indicated by arrows. Panel C, analysis of PARG activity following SDS-PAGE. Crude extracts (1 ml each) of cells trans- formed by pTrcHis without an insert (lane A) or containing construct A (lane B) were analyzed by an activity gel assay in which the gel was incubated following electrophoresis in 50 mM sodium phosphate buffer, pH 7.5, 50 mM NaCl, 10% glycerol, 1% Triton X-100, 10 mM b-mercap- toethanol to allow renaturation of PARG activity (37). The positions of FIG.5. Expression of PARG in E. coli. Panel A, analysis of bacte- molecular weight marker proteins are shown. Panel D, expression of a rial extracts using a thin layer chromatography assay (30). Reaction carboxyl-terminal region of PARG cDNA as a fusion protein with GST. mixtures contained approximately 15,000 cpm of [ P]ADP-ribose poly- A construct corresponding to a 69-kDa carboxyl-terminal region of the mers, and the cpm shown represent ADP-ribose released from the PARG cDNA was prepared and used to transform E. coli NM522 cells as ADP-ribose polymers. Bar 1, a strain transformed by pTrcHis without described under “Experimental Procedures.” Cell extracts were sub- an insert but induced with 1 mM IPTG for5hat37 °C.A strain jected to SDS-PAGE, and proteins were stained by Coomassie Blue. containing construct B is shown without the addition of IPTG (bar 2)or Lane 1, extract from uninduced cells; lane 2, extract from cells induced after the addition of 1 mM IPTG for 1.5 h (bar 3)or5h(bar 4). A strain with 1 mM IPTG for 2 h; lane 3, proteins in extracts from cells shown in containing constructC5h after induction by IPTG is shown in the lane 2 that bound to GSH-Sepharose; lane 4, material released from absence (bar 5) and presence (bar 6)of167 mM ADP-hydroxymethylpyr- GSH-Sepharose by treatment with thrombin. 11900 The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase digest, the probe hybridized primarily with a single restriction fragment. The fainter signals probably reflect the presence of introns in the PARG gene. This result indicates that PARG is encoded by a single copy gene in the bovine genome. DISCUSSION The rapid synthesis of ADP-ribose polymers that occurs in response to DNA strand breaks is accompanied by very rapid polymer turnover (4, 10, 11), indicating that PARP and PARG activities are closely coordinated as cells respond to DNA dam- age. While PARP has been widely studied, information con- FIG.7. Alignment of the putative bipartite NLS of bovine, hu- cerning structure and function relationships of PARG is much man, and murine PARG and comparison with the bipartite NLS more limited. of PARP from different organisms. Conserved residues are noted in boldface type, and the amino acid distances are from the amino-termi- The isolation of partial PARG cDNA clones (Fig. 2) has nal methionine residue. Abbreviations and references for the sequences allowed the construction of a cDNA clone that codes for the shown are as follows: bPARG, bovine PARG (this work); hPARP, human sequence of all four oligopeptide sequences present in the iso- 2 2 2 PARG ; mPARG, murine PARG ; CePARG, C. elegans PARG (47) ; lated protein (Table II, Fig. 3) and contains PARG activity hPARP, human PARP (54 –56); mPARP, murine PARP (57); bPARP, bovine PARP (58); aPARP, chicken PAR (59); XlPARP, Xenopus laevis when expressed in E. coli (Fig. 5). The cDNA clone (Fig. 3) has PARP (60); DmPARP, Drosophila melanogaster PARP (61); SpPARP, features typical of cDNAs that code for mammalian proteins. Sarcophaga peregrina PARP (52). These include (i) an oligo A (putative poly(A) ) sequence at the 39 end, (ii) a polyadenylation signal (AATAAA) (44) 12 bp up- carboxyl-terminal portion of the cDNA resulted in enzymatic stream from the oligo A sequence, (iii) a sequence of ATTTA in activity (Fig. 5). (ii) All of the oligopeptides sequenced were the 39-untranslated region thought to play a role in selective located in the carboxyl-terminal half of the protein (Figs. 2 and mRNA degradation in mammalian cells (45), (iv) a single open 3). (iii) The only protein, other than the 59-kDa protein de- reading frame, and (v) a nucleotide sequence around the first tected in the thymus preparation was approximately 111 kDa start codon commonly found at known sites of initiation of (Fig. 1). (iv) The PARG activity expressed in bacteria was translation (46). The likelihood that the cDNA clone con- sensitive to proteolysis, yielding a protein of approximately 59 structed represents a full-length or nearly full-length clone for kDa (Fig. 5). (v) The cleavage site in PARG is in the region of PARG is supported by the observation that hybridization of 1 the putative NLS, and the PARP NLS is located in a protease- poly(A) RNA from bovine kidney cells with the cDNA showed sensitive site (24). Taken together with the data suggesting a single band of hybridization of approximately the same size that bovine PARG appears to be coded for by a single copy gene as the cDNA (Fig. 4). (Fig. 6), proteolysis seems likely to explain the presence of The nucleotide sequence encoding bovine PARG indicates PARG activity with a molecular mass of approximately 74 and that PARG shares little or no homology with other known 59 kDa in bovine thymus preparations (51). Likewise, a similar sequences. A search of sequence data banks has failed to reveal mechanism could explain previous reports of a PARG of 74 kDa significant homology with any sequences coding for known isolated from nuclear fractions of guinea pig liver and human proteins. A strong sequence homology has been observed with placenta (28, 29) and a PARG of 59 kDa isolated from post- human and rat cDNA clones that likely represent partial clones nuclear fractions of guinea pig liver (43). for PARG from these species. Examination of protein sequence While proteolysis of a larger protein to yield smaller proteins data bases also has shown that the deduced amino acid se- retaining PARG activity seems likely to explain the size heter- quence of PARG lacks any sequence homology with known ogeneity of PARG previously reported, it remains to be deter- proteins. However, the amino acid sequence shares a signifi- mined if proteolysis normally occurs in vivo or whether it cant homology with a protein sequence from Caenorhabditis occurs during purification of the enzyme. While our results elegans that may represent the PARG protein from this orga- show that a full-length protein can be expressed containing nism (47). The deduced amino acid sequence of PARG has been PARG activity (Fig. 5C), the molecular size of PARG in vivo examined for a number of structural motifs that can be pre- also remains to be determined. If PARG occurs as a larger dicted from the primary amino acid sequence. We have noted protein, an interesting possibility is that the amino-terminal that the expressed PARG protein can form dimers stable to region may be involved in the regulation of enzymatic activity. SDS-PAGE conditions. In that regard, residues 871–907 show The availability of cDNA clones coding for PARG should significant homologies to known leucine zipper dimerization facilitate studies of structural and functional aspects of this sequences (48). Another motif identified is a putative bipartite enzyme and the metabolic pathway in which it is involved. The nuclear location signal (NLS) (49). It is interesting that PARP isolation and characterization of cDNAs encoding PARG from also contains a bipartite NLS (50). Fig. 7 compares deduced other sources will allow information concerning changes in the amino acid sequences in the NLS region of the bovine PARG structure of the protein during evolution. Studies in progress of and homologous regions of putative PARG sequences from hu- cDNA clones from human and mouse indicate that PARG is man, mouse, and C. elegans with the NLS region of PARP from highly conserved in mammals. The availability of PARP cDNA seven different organisms. The putative NLS of PARG fulfills has allowed a number of molecular genetic approaches to study the criteria for bipartite NLS in that it contains conserved the function(s) of ADP-ribose polymer metabolism, and the acidic and basic amino acid residues at two different locations availability of PARG cDNA should allow the design of addi- each within the region of homology to the NLS of PARP (50). tional molecular genetic approaches for studying this metabo- An intriguing finding was that the PARG cDNA clone codes lism. Recently, a mouse strain containing a genetic inactivation for a protein of approximately 111 kDa, which is nearly twice of the gene encoding PARP has been reported (53). Although the size of the PARG protein isolated from bovine thymus (Fig. not extensively characterized, mice homozygous for the dis- 1). It seems likely that PARG contains a protease sensitive site that, following proteolysis, yields a protein fragment of approx- imately 59 kDa that still retains enzymatic activity. Several J.-C. Ame ´ , A. Huang, E. L. Jacobson, and M. K. Jacobson, unpub- pieces of evidence favor this possibility. (i) Expression of the lished data. The cDNA Encoding Bovine Poly(ADP-ribose) Glycohydrolase 11901 (1986) Carcinogenesis 7, 327–330 rupted PARP gene are viable, indicating that the absence of 22. Berger, N. A. (1985) Radiat. Res. 101, 4 –15 PARP (and ADP-ribose polymers) has no major consequences 23. Kaufmann, S. H., Desnoyers, S., Ottaviano, Y., Davidson, N. E., and Poirier, G. G. (1993) Cancer Res. 53, 3976 –3985 for development. Disruption of the gene encoding PARG in 24. Lazebnik, Y. A., Kaufmann, S. H., Desnoyer, S., Poirier, G. G., and Earnshaw, mice containing a normal PARP gene will allow the determi- W. C. (1994) Nature 371, 346 –347 nation of whether other cellular enzymes can replace PARG in 25. de Murcia, G., and Me ´ nissier-de Murcia, J. (1994) Trends Biochem. Sci. 19, 172–176 the turnover of ADP-ribose polymers and/or whether develop- 26. Hatakeyama, K., Nemoto, Y., Ueda, K., and Hayaishi, O. (1986) J. Biol. Chem. ment will occur in the absence of PARG. Alternatively, disrup- 261, 14902–14911 tion of the PARG gene in mice containing a disrupted PARP 27. Thomassin, H., Jacobson, M. K., Guay, J., Verreault, A., Aboul-Ela, N., Me ´ nard, L., and Poirier, G. G. (1990) Nucleic Acids Res. 18, 4691– 4694 gene may provide insights for the coordinated function of PARP 28. Tanuma, S., Kawashima, K., and Endo, H. (1986) J. Biol. Chem. 261, 965–969 and PARG. 29. Uchida, K., Suzuki, H., Maruta, H., Abe, H., Aoki, K., Miwa, M., and Tanuma, S. (1993) J. Biol. Chem. 268, 3194 –3200 Understanding the involvement of ADP-ribose polymer me- 30. Me ´ nard, L., and Poirier, G. G. (1987) Biochem. Cell Biol. 65, 668 – 673 tabolism in determining the frequency of alternative cellular 31. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254 outcomes of DNA damage may also have a therapeutic benefit. 32. Laemmli, U. K. (1970) Nature 227, 680 – 685 33. Peterson, G. L. (1983) Methods Enzymol. 91, 95–119 For example, the efficacy of many antitumor agents appears to 34. Edman, P., and Begg, G. (1967) Eur. J. Biochem. 1, 80 –90 be closely related to the ability to increase the frequency of 35. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. apoptosis (1, 23). The ability of inhibitors of PARP to chemo- 74, 5463–5467 36. Mead, D. A., Szczesna-Skorupa, E., and Kemper, B. (1986) Protein Eng. 1, sensitize specifically cycling cells to the cytotoxic effects of 67–74 DNA-damaging agents has demonstrated the potential of tar- 37. Brochu, G., Shah, G. M., and Poirier, G. G. (1994) Anal. Biochem. 218, 265–272 38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1982) Molecular Cloning: A geting ADP-ribose polymer metabolism for cancer therapy (16). Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, In that regard, PARG is a potentially attractive target due to New York its low abundance, its structurally unique substrate, and the 39. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6 –13 40. Slama, J. T., Aboul-Ela, N., Goli, D. M., Cheesman, B. V., Simmons, A. M., and high turnover of ADP-ribose polymers that occurs following Jacobson, M. K. (1995) J. Med. Chem. 38, 389 –393 DNA damage. Modulation of PARG activity by chemical inhib- 41. Slama, J. T., Aboul-Ela, N., and Jacobson, M. K. (1995) J. Med. Chem. 38, 4332– 4336 itors or by molecular genetic approaches should allow assess- 42. Althaus, F. R., and Richter, C. (1987) Molecular Biology, Biochemistry and ment of the value of PARG as a new target for therapeutic Biophysics, Vol. 37, Springer-Verlag, Berlin development. 43. Maruta, H., Inageda, K., Aoki, T., Nishina, H., and Tanuma, S. (1991) Biochemistry 30, 5907–5912 44. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263, 211–214 Acknowledgments—We thank Donna Coyle for excellent technical 45. Shaw, G., and Kamen, R. (1986) Cell 46, 659 – 667 assistance, Arnold Huang for growth of MDBK cells, and Dr. Guy 46. Kozak, M. (1987) Nucleic Acids Res. 15, 8125– 8148 Poirier for many helpful discussions. The PARG inhibitor ADP-hy- 47. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., droxymethylpyrrolidine diol was a gift from Dr. James Slama. Peptide Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., sequence determinations were done by the University of Kentucky Dear, S., Du, Z., Durbin, R., Favello, A., Fulton, L., Gardner, A., Green, P., Molecular Structure and Analysis Facility directed by Dr. Thomas Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Vannaman. Kirsten, J., Laister, N., Latreille, P., Lightning, J., Lloyd, C., McMurray, A., Mortimore, B., O’Callaghan, M., Parsons, J., Percy, C., Rifken, L., Roopra, REFERENCES A., Saunders, D., Shownkeen, R., Smaldon, N., Smith, N., Sonnhammer, A., Staden, E., Sulston, R., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, 1. Thompson, C. B. (1995) Science 267, 1456 –1462 K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and 2. Lautier, D., Lagueux, J., Thibodeau, J., Me ´ nard, L., and Poirier, G. G. (1993) Wohldman, P. (1994) Nature 368, 32–38 Mol. Cell. Biochem. 122, 171–193 48. Brendel, V., Bucher, P., Nourbakhsh, I. R., Blaisdell, B. E., and Karlin, S. 3. Alvarez-Gonzalez, R., and Jacobson, M. K. (1987) Biochemistry 26, 3218 –3224 (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2002–2006 4. Juarez-Salinas, H., Sims, J. L., and Jacobson, M. K. (1979) Nature 282, 49. Robbins, J., Dilworth, S. M., Laskey, R. A., and Dingwall, C. (1991) Cell 64, 740 –741 615– 623 5. Adamietz, P. (1987) Eur. J. Biochem 169, 365–372 50. Schreiber, V., Molinete, M., Boeuf, H., de Murcia, G., and Me ´ nissier-de Murcia, 6. Krupitza, G., and Cerutti, P. (1989) Biochemistry 28, 2034 –2040 J. (1992) EMBO J. 11, 3263–3269 7. Krupitza, G., and Cerutti, P. (1989) Biochemistry 28, 4054 – 4060 51. Brochu, G., Duchaine, C., Thibeault, L., Lagueux, J., Shah, G. M., and Poirier, 8. Adamietz, P., and Rudolph, A. (1984) J. Biol. Chem. 259, 6841– 6846 G. G. (1994) Biochim. Biophys. Acta 1219, 342–350 9. Kreimeyer, A., Wielckens, K., Adamietz, P., and Hilz, H. (1984) J. Biol. Chem. 52. Masutani, M., Nozaki, T., Hitomi, Y., Ikejima, M., Nagasaki, K., Prati, A. C., 259, 890 – 896 Kurata, S., Natori, S., Sugimura, T., and Esumi, H. (1994) Eur. J. Biochem. 10. Wielckens, K., Schmidt, A., George, E., Bredehorst, R., and Hilz, H. (1982) 220, 607– 614 J. Biol. Chem. 257, 12872–12877 53. Wang, Z.-Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Schweiger, 11. Jacobson, E. L., Antol, K. M., Juarez-Salinas, H., and Jacobson, M. K. (1983) M., and Wagner, E. F. (1995) Genes & Dev. 9, 509 –520 J. Biol. Chem. 258, 103–107 54. Uchida, K., Morita, T., Sato, T., Ogura, T., Yamashita, R., Nogushi, S., Suzuki, 12. Miwa, M., and Sugimura, T. (1971) J. Biol. Chem. 246, 6362– 6364 H., Nyunoya, H., Miwa, M., and Sugimura, T. (1987) Biochem. Biophys. Res. 13. Ueda, K., Oka, J., Narumiya, S., Miyakawa, N., and Hayaishi, O. (1972) Commun. 148, 617– 622 Biochem. Biophys. Res. Commun. 46, 516 –523 55. Cherney, B. W., McBride, O. W., Chen, D., Alkhatib, H., Bhatia, K., Hensley, 14. Oka, J., Ueda, K., Hayaishi, O., Komura, H., and Nakanishi, K. (1984) J. Biol. P., and Smulson, M. E. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8370 – 8374 Chem. 259, 986 –995 56. Kurosaki, T., Ushiro, H., Mitsuuchi, Y., Suzuki, S., Matsuda, M., Matsuda, Y., 15. Nudka, N., Skidmore, C. J., and Shall, S. (1980) Eur. J. Biochem. 105, 525–530 Katunuma, N., Kangawa, K., Matsuo, H., Hirose, T., Inayama, S., and 16. Jacobson, E. L., Smith, J. Y., Wielckens, K., Hilz, H., and Jacobson, M. K. Shizuta, Y. (1987) J. Biol. Chem. 262, 15990 –15997 (1985) Carcinogenesis 6, 715–718 57. Huppi, K., Bhatia, K., Siwarski, D., Klinman, D., Cherney, B., and Smulson, 17. Ku ¨ pper, J. H., de Murcia, G., and Bu ¨ rkle, A. (1990) J. Biol. Chem. 265, M. (1989) Nucleic Acids Res. 17, 3387–3401 18721–18724 58. Saito, I., Hatakeyama, K., Kido, T., Ohkubo, H., Nakanishi, S., and Ueda, K. 18. Ding, R., Pommier, Y., Kang, V. H., and Smulson, M. (1992) J. Biol. Chem. 267, (1990) Gene (Amst.) 90, 249 –254 12804 –12812 19. Jacobson, E. L., Smith, J. Y., Nunbhakdi, V., and Smith, D. G. (1985) in 59. Ittel, M.-E., Garnier, J.-M., Jeltsch, J.-M., and Niedergang, C. (1991) Gene (Amst.) 102, 157–164 ADP-ribosylation of Proteins (Althaus, F. R., Hilz, H., and Shall, S., eds) pp. 277–283, Springer-Verlag, Berlin 60. Saulier-Le Drean, B. M. (1992) Poly(ADP-ribose) Polymerase in Xenopus lae- vis, Ph.D. thesis, Universite ´ De Rennes, France 20. Lubet, R. A., McCarvill, J. T., Schwartz, J. L., Putman, D. L., and Schechtman, L. M. (1986) Carcinogenesis 7, 71–75 61. Uchida, K., Hanai, S., Ishikawa, K.-I., Ozawa, Y.-I., Uchida, M., Sugimura, T., and Miwa, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3481–3485 21. Kasid, U. N., Stefanik, D. F., Lubet, R. A., Dritschilo, A., and Smulson, M. E.

Journal

Journal of Biological Chemistry – Unpaywall

Published: May 1, 1997

There are no references for this article.