Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

Amy H. Buck; Gillian Coakley; Fabio Simbari; Henry J. McSorley; Juan F. Quintana; Thierry Le Bihan; Sujai Kumar; Cei Abreu-Goodger; Marissa Lear; Yvonne Harcus; Alessandro Ceroni; Simon A. Babayan; Mark Blaxter; Alasdair Ivens; Rick M. Maizels

doi:10.1038/ncomms6488

Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

Buck, Amy H.; Coakley, Gillian; Simbari, Fabio; McSorley, Henry J.; Quintana, Juan F.; Le Bihan, Thierry; Kumar, Sujai; Abreu-Goodger, Cei; Lear, Marissa; Harcus, Yvonne; Ceroni, Alessandro; Babayan, Simon A.; Blaxter, Mark; Ivens, Alasdair; Maizels, Rick M. 2014-11-25 00:00:00 ARTICLE Received 8 Sep 2014 | Accepted 6 Oct 2014 | Published 25 Nov 2014 DOI: 10.1038/ncomms6488 OPEN Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity 1,2 1,2, 1,2, 1,2 1,2 Amy H. Buck , Gillian Coakley *, Fabio Simbari *, Henry J. McSorley , Juan F. Quintana , Thierry Le 2,3 4 5 1,2 1,2 1,w Bihan , Sujai Kumar , Cei Abreu-Goodger , Marissa Lear , Yvonne Harcus , Alessandro Ceroni , 2,w 2,3,6 2 1,2 Simon A. Babayan , Mark Blaxter , Alasdair Ivens & Rick M. Maizels In mammalian systems RNA can move between cells via vesicles. Here we demonstrate that the gastrointestinal nematode Heligmosomoides polygyrus, which infects mice, secretes vesi- cles containing microRNAs (miRNAs) and Y RNAs as well as a nematode Argonaute protein. These vesicles are of intestinal origin and are enriched for homologues of mammalian exo- some proteins. Administration of the nematode exosomes to mice suppresses Type 2 innate responses and eosinophilia induced by the allergen Alternaria. Microarray analysis of mouse cells incubated with nematode exosomes in vitro identiﬁes Il33r and Dusp1 as suppressed genes, and Dusp1 can be repressed by nematode miRNAs based on a reporter assay. We further identify miRNAs from the ﬁlarial nematode Litomosoides sigmodontis in the serum of infected mice, suggesting that miRNA secretion into host tissues is conserved among parasitic nematodes. These results reveal exosomes as another mechanism by which helminths manipulate their hosts and provide a mechanistic framework for RNA transfer between animal species. 1 2 Institute of Immunology and Infection Research, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Centre for Immunity, Infection and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. SynthSys, Centre for Synthetic and Systems Biology, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3BF, UK. Institute of Evolutionary Biology, School of Biological Sciences, University of ´ ´ Edinburgh, Edinburgh EH9 3FL, UK. Laboratorio Nacional de Genomica para la Biodiversidad, Langebio-CINVESTAV, Irapuato 36821, Guanajuato, Mexico. Edinburgh Genomics, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. * These authors contributed equally to this work. w Present addresses: Target Discovery Institute, University of Oxford, Nufﬁeld Department of Medicine Research Building, Oxford OX3 7FZ, UK. (A.C.); Institute of Biodiversity, Animal Health and Comparative Medicine, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ, UK (S.A.B.). Correspondence and requests for materials should be addressed to A.H.B. (email: [email protected]). NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 arasitic nematodes are ubiquitous pathogens of plants and DUSP1. This work identiﬁes exosomes as a new class of animals, including species that infect over 2 billion people immunomodulatory complex produced by helminths and Pand generally reside in extracellular niches in their hosts. provides the ﬁrst steps towards a mechanistic framework for H. polygyrus is a parasite related to human hookworm that RNA-mediated communication between animal species. naturally infects mice, and is in the same nematode clade as Caenorhabditis elegans . Within the mouse host, the parasite life cycle is exclusively intestinal: following ingestion, the larvae Results invade the small intestine, moult into adult worms and emerge Small RNAs in H. polygyrus secretory products. Total RNA was into the lumen of the duodenum to mate and to produce eggs extracted from the secretory products of H. polygyrus and com- expelled in the faeces. The infection induces Type 2 innate and pared with the proﬁle of small RNAs in adult nematodes, eggs adaptive (Th2) immune responses in parallel with a large and infective larvae. A heterogeneous population of small RNAs expansion of regulatory cells that mediate immunosuppressive o25 nucleotides (nt) was observed in all samples and several 2–4 effects , some of which have beneﬁcial properties in allergy and additional species between 25 and 30 nt were apparent in the auto-immunity . Immune suppression has been shown to be secretion product (Fig. 1a). Small RNA sequencing (o30 nt) mediated in part by a suite of immunomodulatory proteins identiﬁed miRNAs as the dominant class of secreted parasite 6,7 actively secreted by the nematodes . Given the burgeoning body small RNA (Fig. 1b) and also identiﬁed RNA fragments mapping of data detailing extracellular small RNAs in mammalian systems, to nematode stem-bulge RNAs, herein referred to as Y RNAs and emerging evidence that these can mediate cell-to-cell based on their recognized homology to this class of small RNA communication , it is intriguing to think this mechanism could (Fig. 1b). In contrast, piRNAs (or ‘21-U’ RNAs) were exclusively also be used by parasites. Small RNAs derived from bacteria, identiﬁed in the adult library (B14% of reads; Supplementary 9–12 plants and parasites have been detected in human body ﬂuids ; Fig. 1 and Supplementary Data set 1) with no evidence of however, the mechanism by which these are secreted or excreted secretion. RNAs between 70 and 100 nt were also present in the is unknown, and the meaning of their extracellular existence secreted product (Fig. 1a) and sequencing identiﬁed full-length unclear . We show here that H. polygyrus secretes a speciﬁc set Y RNAs as the major component of this fraction, with two of miRNAs and full-length Y RNAs that are stabilized against predominant classes of structure identiﬁed (Fig. 1c and degradation by encapsulation within vesicles. The vesicles are of Supplementary Fig. 2). intestinal origin and are enriched for homologues of mammalian A total of 263 ‘high conﬁdence’ miRNAs were classiﬁed from proteins found in exosomes, including heat shock proteins, the combined libraries based on representation of reads from tetraspanins and ALIX, a protein associated with exosome both 5p and 3p arms of the hairpin and/or homology with known 14,15 biogenesis as well as a nematode Argonaute (Ago) protein. miRNAs in other nematodes (Supplementary Data set 1). Each of Local administration of the nematode exosomes to mice by the these matches DNA sequences in the H. polygyrus whole genome intranasal route suppresses Type 2 innate responses and currently under assembly. Many also show stage-speciﬁc expres- eosinophilia induced by the allergen Alternaria in vivo. The sion patterns: for example, miR-35 family members are nematode vesicles are internalized by mouse intestinal epithelial exclusively expressed in the egg library, consistent with their cells in vitro and suppress genes involved in inﬂammation and functions in embryogenesis (Fig. 2a, boxed). The secretory immunity, including the receptor for the alarmin IL-33 and a key products are dominated by miRNAs with identical seed sites to regulator of mitogen-activated protein kinase (MAPK) signalling, mouse miRNAs, many of which are ancient: six are shared among Adult library H. polygyrus (<30 nt) full-length Y RNAs Uncharacterized 22% Y RNA 0.05% MicroRNA piRNA 55% 100 14% Full-length Y RNAs rRNA Other rfram 8% <1% tRNA <1% Secretion library (<30 nt) Uncharacterized 10% Y RNA 1% Other rfram <1% Small RNAs tRNA sequenced rRNA <1% 9% in (b) MicroRNA 78% Figure 1 | H. polygyrus secretory products contain miRNAs and Y RNAs. (a) Size distribution of 3 -end labelled (pCp) total RNA extracted from the life stages (1mg total RNA) or secretion product of H. polygyrus (total RNA from equivalent of 15mg protein secretion product). (b) Proportion of H. polygyrus small RNA biotypes (o30 nt) identiﬁed in sequencing libraries from adult worms and the secretion product. (c) Predicted secondary structures of the two families of Y RNA identiﬁed in H. polygyrus secretion products based on RNAfold, the conserved UUAUC motif is noted in blue. 2 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. Eggs L3 Adult Secretion AC UUUA UA A 5′ GC - UU C U GCGC GGUC GG GUCG AGGG UC UC 3′- CGCG CCAG UC CAGC UCCC AG G U UUA G C C G A A C AA G U U C 5′- C A AUC C GC UU UU UCAGGU CG GUUAGAGGG AU AU UCCC 3′-AGUUCA GC CGGUCUCCC UA AGGG UU A A A NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Eumetazoa Bilateria 0 miRNA name 10,000 r.p.m. Protostomia Nematoda Eggs L3 Adult Sec Nematode Mouse miR-87 -- P miR-63 miR-425 ** miR-79 miR-9 B miR-100 miR-100 E miR-190 miR-190 B miR-235 miR-25 B miR-87 -- P miR-87 -- P miR-63 miR-425 ** miR-63 miR-425 miR-250 -- N miR-239 -- N miR-83 miR-29 B lin-4 miR-125a E bantam -- P bantam -- P bantam -- P bantam -- P miR-60 -- P let-7 let-7 B let-7 let-7 B miR-100 miR-100 E miR-100 miR-100 E miR-263 miR-183 B miR-100 miR-100 E miR-100 miR-100 E bantam -- P miR-71 -- B miR-1 miR-1 E miR-45 -- P miR-45 -- P miR-45 -- P miR-100 miR-100 E miR-43 --- P miR-790 miR-96 B miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-77 -- Figure 2 | Many secreted nematode miRNAs have identical seed sites to mouse miRNAs. (a) Temporal expression of highly abundant miRNAs (410,000 reads per million in at least one of the libraries) across the life stages. Nematode and mouse names are listed according to identical seed sites and miRNAs of high abundance in the secretion product are coloured according to their conservation level : Eumetazoa (red), Bilateria (blue), Protostomia (green), Nematoda (orange). (b) Sequence alignment of abundant secreted parasite miRNAs that contain identical seed sites between mouse and H. polygyrus; all families shown are of common ancestry apart from miR-425/63. Eumetazoa (lin-4/miR-125 and ﬁve miR-100 family members, material (Fig. 3a). Label-free quantiﬁcation of proteins in the Fig. 2a, red) and ﬁve among Bilatera (miR-79/miR-9, miR-83/ vesicles and supernatant by liquid chromatography-electrospray miR-29, miR-263/miR-183 and two let-7 family members, Fig. 2a, tandem mass spectrometry LC-MS/MS identiﬁed 362 proteins, blue). In addition, ﬁve bantam family members dominate the of which 139 were speciﬁcally enriched in the vesicle fraction secretory products along with miR-87 and miR-60, which also are (Po0.05, Fig. 3b, Supplementary Data set 2) including shared among Protostomia (Fig. 2a, green) and three miRNAs homologues of mammalian proteins present in exosomes: heat that evolved in the nematode lineage: miR-63, miR-239 and miR- shock proteins, Rab proteins, tetraspanins and Alix, which is 14,15 77 (Fig. 2a, orange). miR-63 shares an identical seed site to associated with exosome biogenesis (Table 1). The venom mammalian miR-425, although it is not of common ancestry , allergen-like proteins (members of the CAP superfamily, Fig. 2b. On the basis of their sequences, many of the secreted Pfam00188), which were previously identiﬁed as the dominant parasite miRNAs could therefore hijack existing mouse miRNA proteins in the H. polygyrus secretory products , are almost target networks if taken up by host cells. exclusively in the supernatant fraction (Fig. 3b, orange), further demonstrating speciﬁcity in the molecular composition of the vesicles and possibly indicating distinct routes of secretion. On Nematode vesicles are associated with secreted RNA.In this note, nematode intestinal proteins are enriched in the vesicle fraction (Fig. 3b, green and Supplementary Data set 2) and, mammalian systems, miRNAs have been found in body ﬂuids in association with speciﬁc proteins or in extracellular vesicles . consistent with an intestinal origin of the nematode exosomes, vesicles of similar size are observed in the intestinal tissue of To determine whether these RNAs could be present in vesicles, the H. polygyrus secretory products were ultracentrifuged and adult H. polygyrus analysed immediately ex vivo (Fig. 3c). One Argonaute protein was identiﬁed in both vesicle and supernatant quantitative reverse transcription–PCR (qRT)–PCR used to measure miRNA levels in the pellet and supernatant, revealing fractions (Fig. 3b, red) that belongs to the clade of Worm-speciﬁc the majority to be present in the pellet (Supplementary Fig. 3). Agos (WAGO). Phylogenetic analysis suggests that homologues to this WAGO are present in many parasitic nematodes but may Transmission electron microscopy (TEM) identiﬁed vesicle-like structures between 50 and 100 nm in diameter in the pelleted have been lost in Caenorhabditis (Fig. 3d). NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 3 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 Enriched Enriched in supernatant in vesicles −6 1 × 10 −5 1 × 10 −4 1 × 10 Argonaute VAL proteins −3 1 × 10 Exosome proteins Intestinal proteins Other −2 1 × 10 −1 1 × 10 1/256 1/64 1/16 1/4 1 4 16 64 256 Vesicle/supernatant ratio WAGO 1/2/4/5 clade IV WAGO 1/2/4/5 clade V (including caenorhabditis) WAGO 1/2/4/5 clade IV WAGO 1/2/4/5 clade IV Ascaris suum WAGO 2 Ascaris suum ADY40873 Brugia malayi XP_001895197 Wuchereria bancrofti EJW79934 Brugia malayi XP_001895198 Wuchereria bancrofti EJW75003 Loa loa EF014316 Loa loa XP_003149753 Ascaris suum F1KUF7 Ascaris suum ADY41511 Ascaris suum ADY40604 Ascaris suum WAGO 1 Dictyocaulus vivaparus DVC00216 Angiostrongylus cantonensis AAC00253 Heligmosomoides polygyrus secreted WAGO Ancylostoma ceylanicum AYC02701 Ancylostoma caninum ACC08275 Dictyocaulus vivaparus DVC01842 Heterorhabditis bacteriophora Hba_19411 Heterorhabditis bacteriophora HBC00350 Pristionchus pacificus PPA18974 Pristionchus pacificus H3F9V8 Pristionchus pacificus H3DSP7 Pristionchus pacificus PPA00428 Pristionchus pacificus PPC00082 Pristionchus pacificus H3EBA6 Pristionchus pacificus PPA07002 Figure 3 | H. polygyrus secretes exosomes of intestinal origin that contain a WAGO protein. (a) TEM of puriﬁed ultracentrifugation pellet (100mgml total protein) from H. polygyrus secretion product, scale indicates 0.5mm. (b) Scatter plot of proteins enriched in ultracentrifugation pellet or supernatant based on LC-MS/MS, n ¼ 3, using Po0.05 (one-way ANOVA) and FC 41.5 as cutoffs. Noted in the legend are homologues of intestinal nematode proteins (green), mammalian exosome proteins (purple), Venom Allergen-Like (VAL) proteins (orange) and an Argonaute protein (red). (c) TEM of adult worm intestine noting vesicles of comparable size to exosomes, scale indicates 1.0mm. (d) Phylogenetic relationship of the secreted Argonaute protein identiﬁed in H. polygyrus secretion product in relation to other nematode Argonautes. The analysis was performed on the same data set described in ref. 28 with the addition of the H. polygyrus-secreted argonaute sequence, using the same method (Bayesian analysis using MrBayes v3.2). three biological replicates demonstrate that the parasite miRNAs Table 1 | Table of nematode proteins enriched in vesicle are enriched in the vesicle fractions (75% of reads compared with fraction that are homologous to mouse proteins associated 10% in supernatant, which is dominated instead by rRNA and Y with exosomes. RNA fragments, Fig. 4a). This analysis also identiﬁed three mouse miRNA homologues: miR-193, miR-10 and miR-200, within the Name Pellet/sup P-value Organism Blast E value top ﬁve most abundant secreted miRNAs. These were ranked ratio much lower in the initial Illumina analysis (Supplementary Tetraspanin-11 40.0 o0.005 A. suum 2e 46 Table 1) likely because of the sequencing bias of the different kits Hsp-70 32.2 o0.005 D. medinensis 0.0 and platforms , underscoring the importance of comparing both Alix 30.2 0.006 C. elegans 1e 79 approaches. Overall the three replicates showed the same proﬁle Rab-11b 19.7 0.011 S. salar 1e 71 of miRNAs in each vesicle sample (Supplementary Table 2) and Rab-5 7.2 0.005 C. elegans 2e 205 neither vesicle nor supernatant contained intact large ribosomal Hsp-90 6.3 0.016 H. contortus 0.0 RNA (Supplementary Fig. 4). Northern blot analysis conﬁrmed Naming is based on best blast hit and P value based on n¼ 3. the speciﬁcity of small RNA biotypes in vesicles versus supernatant, showing miR-100 to be exclusively present in the vesicles and the Y RNA fragment to be exclusively present in Nematode RNAs are protected from degradation by exosomes. the supernatant (Fig. 4b). Notably, on the same blot To determine which RNAs identiﬁed in the total secretion pro- the full-length Y RNA was detected in the vesicles and both duct (Fig. 1) are speciﬁcally associated with vesicles, small RNA the miRNA and full-length Y RNA were largely resistant to sequencing of replicate vesicle and nonvesicle (supernatant) degradation by RNases in untreated samples but became fractions of the secretion product was carried out. Results from susceptible in the presence of Triton-X-100 (Fig. 4c). Together, 4 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. 1 μm 0.5 μm P value NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Vesicle Supernatant – + ––++ – + RNase A-T1 LS V –– ++ – – ++ Triton-X Supernatant Vesicle Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 40 30 MicroRNA miR-100 rRNA miR-100 Y RNA fragment tRNA LS V Y RNA 3p Rfam other 150 20 Uncharacterized ** 40 50 0 Y RNA 5p Y RNA 5p Figure 4 | Secreted miRNAs are protected from degradation through encapsulation within exosomes. (a) Classiﬁcation of H. polygyrus small RNAs in the secretion product following ultracentrifugation. (b) Northern blot analysis of RNA extracted from ultracentrifuge pellet or supernatant (from equivalent 10mg protein) using probes complementary to H. polygyrus miR-100 or the 5 arm of nematode Y RNA; * indicates the processed Y RNA and ** indicates the full length Y RNA. (c) Northern blot of RNA extracted from the pelleted secretion product following RNase treatment (0.5 Unit RNace- IT, 1 h at 37 C) in the presence or absence of 0.05% Triton-X-100. 15 80 25 **** ** **** ** ** **** 0 0 0 PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt N.S. 40 6,000 **** N.S. *** 4,000 2,000 0 0 PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt Figure 5 | H. polygyrus exosomes suppress a Type 2 innate immune response in vivo. H. polygyrus exosomes (10mg) were administered intranasally to BALB/c mice 24 h before administration of 50mg Alternaria extract and a further 5mg exosomes, or controls that received PBS. (a) Siglecf CD11c þ þ eosinophils in the bronchoalveolar lavage; (b) IL-5 and (c) IL-13 expression in PMA/ionomycin-stimulated lineage-negative, ICOS ST2 group 2 innate lymphoid cells in digested lung tissue were measured 24 h after Alternaria extract administration; (d) Gr1þ CD11bþ neutrophils in the same lavage samples; (e) the mean ﬂuorescence intensity (MFI) of ST2 (IL33R) staining in ILCs from each group of mice. Data are representative of two independent experiments, n¼ 4–6 per group; error bars are mean s.e.m. Data analysed by ANOVA and Tukey’s post test, ****Po0.0001, ***Po0.001, **Po0.01, *Po0.05. these results demonstrate that mature miRNAs and full-length Y administration led to a sharp reduction in bronchoalveolar RNAs are secreted by a parasitic nematode and are protected lavage eosinophilia (Fig. 5a), and suppressed expression of the through encapsulation within vesicles of intestinal origin that Type 2 cytokines interleukin (IL)-5 and IL-13 by innate lymphoid share similar size and protein composition to mammalian cells (ILCs; Fig. 5b,c). Neutrophilia, which does not depend on exosomes. Type 2 cytokines, was undiminished by exosome administration (Fig. 5d). Intriguingly, the overall expression of the IL-33 receptor (also known as ST2) was also suppressed in recipients of H. polygyrus exosomes suppress innate immunity in vivo. exosomes (Fig. 5e). Helminths are well known to suppress pathogenic immune responses in both the gastrointestinal tract and airways .To examine the functionality of the parasite-derived exosomes Internalization of nematode exosomes and RNAs by mouse in vivo, they were administered intranasally in combination cells. To determine whether the nematode-derived exosomes can with extracts of the allergenic fungus Alternaria, which induces enter mammalian cells, uptake was examined in mouse small rapid IL-33 release as part of the Type 2 Th2-like innate immune intestinal epithelial cells, a cell type that is naturally in direct response that leads to lung eosinophilia . Pre-treatment contact with H. polygrus in vivo. Exosomes were labelled with the with parasite-derived exosomes before Alternaria extract lipid dye PKH67 and incubated with MODE-K cells in vitro. NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 5 & 2014 Macmillan Publishers Limited. All rights reserved. Siglecf+CD11c- cell numbers (×104) + + – GR1 CD11b CD11c Siglecf cell numbers (×10 ) IL-5 % of + + – ICOS ST2 lineage ST2 MFI + + – in ICOS ST2 lineage IL-13 % of + + – ICOS ST2 lineage ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 1.5 Bantam – + Exo miR-71 miR-8/200 37 C Y RNA miR-16 1.0 miR-16 8.0 μM 0.5 4 C Figure 6 | H. polygyrus exosomes and RNAs are internalized by mouse cells. (a) Confocal analysis of murine epithelial cells incubated for 1 h with PKH67-labelled H. polygyrus exosomes at 37 and 4 C, scale indicates 8.0mM. (b) Relative expression of parasite-derived miRNAs in murine epithelial cells at 20 h post incubation with 5mg H. polygyrus exosomes following PBS washes. Signal observed in untreated host cells represents the background detection of the probe; for parasite-derived miRNA, the data are normalized to the input detection level of miRNAs in 5mg of exosomes, whereas miR-16 levels in exosome-treated cells are normalized to untreated cells. (c) Northern blot analysis of RNA extracted from murine epithelial cells following 20 h incubation with H. polygyrus exosomes (5mg total protein) compared with untreated cells following PBS washes, using a probe against the loop of the nematode Y RNA or mouse miR-16. Uptake was analysed by ﬂuorescence-activated cell sorting examined whether the parasite miRNAs could suppress transla- (FACS) and confocal microscopy. Over 60% of the cells were tion of a reporter vector containing the 3 -UTR of Dusp1 fused to PKH67-positive after 1 h of incubation with H. polygyrus vesicles luciferase. Synthetic parasite miRNAs were transfected into compared with 1.5% when incubated with background dye MODE-K cells, resulting in 1.2- to 2.0-fold reduction in luciferase (Supplementary Fig. 5). These results are unlikely to be due to levels for the Dusp1 reporter but not control (Fig. 7c). Notably, nonspeciﬁc association with the cell membrane as treatment with transfection of a cocktail of three of the miRNAs (at the same trypsin did not eliminate the signal (Supplementary Fig. 5). total RNA concentration) resulted in an increased reduction in Confocal analysis conﬁrmed uptake to the cytoplasm and luciferase activity (3.1-fold). This is consistent with enhanced demonstrates that this requires physiological temperature repressive effects of miRNA sites in close proximity and suggests (Fig. 6a). qRT–PCR analysis of the treated cells detects the that secreted parasite miRNAs could work in cooperation to exert parasite-speciﬁc miRNAs in cells after 20 h of incubation, with no maximal effects on host genes. In contrast, the 3 -UTR of the change in the endogenous miR-16 (Fig. 6b). The full-length IL33R-encoding gene Il1lr1 is not conserved and, although parasite-derived Y RNA could also be detected by northern blot binding sites for some of the secreted miRNAs were identiﬁed, analysis in cells which were treated directly with exosomes fol- we did not observe repression of a Il1rl1 3 -UTR reporter by lowed by washing (Fig. 6c). transfection of miR-71, which contained two 7mer sites (Fig. 7c and Supplementary Fig. 6). Regulation of mouse genes by nematode exosomes. To deter- Circulating nematode miRNAs in serum. To establish whether mine the function of these vesicles in mouse cells, gene expression the secreted nematode miRNAs naturally circulate in host tissues analyses were carried out on MODE-K cells following incubation in vivo, we examined serum from mice infected with H. polygyrus with H. polygyrus exosomes. A total of 128 genes were differen- (which resides in the gut lumen) or the ﬁlarial nematode tially expressed upon treatment (false discovery rate (FDR) L. sigmodontis (which resides in the pleural cavity). No Po0.05). Relatively subtle changes in gene expression were H. polygyrus miRNAs were detected in the serum; however, a observed (Fig. 7a); however, the most strongly downregulated total of 1,188 reads mapped perfectly and unambiguously to the gene was Dusp1 (also known as MKP-1 in human), a key reg- L. sigmodontis draft genome and 761 of these derived from ulator of MAPK signalling associated with dampening the type 1 16 nematode miRNAs (Table 2 and Supplementary Table 3). pro-inﬂammatory reaction to Toll like receptor (TLR) ligands. Although we cannot rule out the possibility that some of the Another gene signiﬁcantly downregulated by exosomes is Il1rl1 miRNAs in serum could derive from dying worms, the most (also known as IL33R in human and so referred to here as Il33r), abundant miRNAs detected are homologues of those found in H. the ligand-speciﬁc subunit of the receptor for IL-33, a key alarmin polygyrus exosomes, including miR-100, bantam, miR-71 and cytokine required for protection against multicellular parasites, miR-263 (Table 2, Fig. 8). These data conﬁrm the in vivo secre- which is produced by innate cells to drive early type 2 immune tion of parasite miRNAs and are consistent with the idea that responsiveness and is suppressed by the exosomes in ILCs exosomes and associated RNAs operate locally in the host’s body in vivo (Fig. 5e). The effects of the exosomes on Dusp1 and Il33r such that their detection in body ﬂuids will be dictated by the life were validated by RT–qPCR and are unlikely to reﬂect a stage and localization of the parasite in the host. nonspeciﬁc response to vesicle uptake as exosomes derived from mouse intestinal cells showed similar uptake but did not alter Dusp1 and Il33r levels (Fig. 7b and Supplementary Fig. 5). Discussion There are a number of potential mechanisms that could In summary, we have shown that nematode parasite-derived mediate the decrease in Dusp1 and Il33r levels. The 3 untranslated miRNAs and Y RNAs are transported into mammalian host cells region (UTR) of Dusp1 is highly conserved and contains 7mer via exosomes that regulate host genes associated with immunity binding sites for the parasite homologues of mouse miR-200 (aka and inﬂammation and suppress an innate Type 2 response miR-8) and let-7 as well as a 6mer site for miR-425 (aka miR-63) in vivo. Extracellular vesicles are emerging as a central in between these sites (Supplementary Fig. 6). We therefore mechanism for cell-to-cell signalling within mammalian systems, 6 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. Relative expression Input Cells Cells + exo Input Cells Cells + exo Input Cells Cells + exo Input Cells Cells + exo NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE and our report of their secretion by a nematode species is within Dusp1 FDR < 5% and FC > ± 30% the setting of vesicle secretion by an increasingly diverse range of −7 1 × 10 FDR < 5% 24–26 pathogens . We have demonstrated for the ﬁrst time that Other Akr1c18 nematode-derived RNAs are a key component within exosomes −6 1 × 10 that can be transferred to host cells. Nematodes are ubiquitous Nupr1 Mrps21 pathogens of both plants and animals and we anticipate that RNA −5 1 × 10 secretion is a conserved phenomenon, supported by the fact that Tomm7 Dgcr6 we detect miRNAs from the ﬁlarial nematode L. sigmodontis in Anln −4 1 × 10 LOC100048530 host tissue, consistent with a recent report . In fact, RNA Prpf19 Il33R secretion may be a ubiquitous feature across a range of parasites; −3 LOC666559 1 × 10 an initial report suggests that miRNAs are also associated with vesicles in the trematode Dicrocoelium dendriticum . −2 1 × 10 Given that many of the nematode miRNAs are homologues to mouse miRNAs, it is tempting to speculate that these could tap −1 1 × 10 into existing miRNA regulatory networks in host cells. In support of this, we show with a reporter assay that three of the secreted nematode miRNAs that have identical seed sites to mouse 0.7 1 1.3 miRNAs can together downregulate DUSP1 through conserved Exosome versus medium fold−change sites in its 3 UTR. Many questions remain, however, regarding the mechanism by which the nematode miRNAs can operate in Dusp1 Il33r host cells. The exosome is a functional ensemble and immune suppression is likely to require a combination of protein and *** *** miRNAs for fusion and gene regulation. It will be challenging, 1 therefore, to pin point the individual contributions of each. For example, a nematode Ago protein is secreted with the miRNAs that may be required for functionality. This Ago belongs to the 0.5 0.5 WAGO clade of Agos that evolved in the nematode lineage. The WAGOs mediate diverse RNA interference mechanisms in nematodes and can operate at epigenetic, transcriptional and post-transcriptional levels ; it is intriguing to now consider how these possibilities could extend to their hosts. Psicheck Dusp1 Il33r 2.0 An exciting ﬁnding in this study is the fact that the exosomes *** can suppress an innate Type 2 response in vivo, identifying *** vesicles as another class of immunomodulator used by the *** parasite and opening the door to further exploitation of exosomes *** 1.0 in a therapeutic context. Our previous work has shown that H. polygyrus-secreted material suppresses IL-33 release and it is likely that a combination of soluble proteins and exosomes together suppress this important pathway . From analyses 0.5 in vitro we identify Il33r and Dusp1 as host genes directly suppressed by the exosomes. Although DUSP1 has been broadly viewed as an attenuator of immune activation, it is known to preferentially downregulate IL-6 that has recently been shown to 0.25 promote susceptibility to H. polygyrus , while upregulating IL-10, which acts as a broadly immunosuppressive cytokine . Hence, parasite survival is likely to be favoured by reduced DUSP1 levels. Further, DUSP1/MKP-1 dampens the acute inﬂammatory response to lipopolysaccharide, promoting macrophage arginase expression over nitric oxide synthase . Hence, parasite repression of DUSP1 could block the induction of arginase, a known mediator of killing of H. polygyrus in the mouse . These possibilities are now being investigated in our Figure 7 | Mouse Il33r and Dusp1 are suppressed by H. polygyrus laboratories. Our reporter assays suggest that Dusp1 could be exosomes and the secreted miRNA repress target sites in Dusp1. directly targeted by the parasite miRNAs; however, we do not (a) Volcano plot of mouse genes up- or downregulated upon incubation observe repression of Il33r when transfecting the parasite with H. polygyrus-derived exosomes; red¼ FDR Po0.05 and FC430%. miRNA, miR-71, that is predicted to target its 3 UTR. It may (b) Levels of Dusp1 and Il1rl1 in mouse epithelial cells (5 10 ) following be that additional parasite-derived RNAs or proteins could 48 h treatment with 5mg H. polygyrus exosomes or MODE-K-derived regulate Il33r expression, or that the effect operates indirectly exosomes, n ¼ 8, error bars are mean s.e.m. Data analysed by ANOVA through a separate target gene. For example, reduced expression and Tukey’s post test, *Po0.05, **Po0.01, ***Po0.005, ****Po0.001. of Dusp1 or other regulators of MAPK signalling could result in (c) Repression of Psicheck reporter vector containing Dusp1 or Il1rl1 3 UTRs GATA-2 phosphorylation, which might inhibit its ability to fused to Renilla luciferase by co-transfection with individual or pooled 33,34 promote Il33r transcription . synthetic H. polygyrus miRNAs (50 nM), data represent renilla/luciferase Finally, our work has revealed not only secreted miRNAs that ratios, normalized to the values obtained for untreated samples; n¼ 3, are packaged in exosomes but also full-length Y RNAs that are ***Po0.005, *Po0.05. transferred to host cells at an abundance level detectable by northern blot analysis. Y RNAs are not known to function in gene NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 7 & 2014 Macmillan Publishers Limited. All rights reserved. Untreated + Mouse exo + Hp exo Untreated + Mouse exo + Hp exo P value Relative repression Relative expression Let-7 + miR-200 Let-7 + miR-200 + miR-425 Relative expression Let-7 + miR-200 + miR-425 miR-71 Untreated Neg control Let-7 miR-200 miR-425 Untreated Neg control Let-7 miR-200 miR-425 Let-7 + miR-200 Untreated Neg control ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 H. polygyrus miRNAs L. sigmodontis miRNAs Table 2 | Litomosoides sigmodontis-derived miRNAs found in (In vitro secretion) (in host serum) mouse serum. Name Mature sequence Number of miR-83/29 reads miR-60 miR-63/425 (infected) miR-86 miR-79/9 miR-100a UACCCGUAGCUCCGAAUAUGUGU 479 miR-100 miR-50 miR-239 miR-86 UAAGUGAAUGCUUUGCCACAGUCU 57 Bantam miR-34 miR-7 Bantam-a UGAGAUCAUUGUGAAAGCUAUU 45 miR-71 miR-153 miR-77 Bantam-b UGAGAUCACGUUACAUCCGCCU 45 mir-263 miR-2 miR-240/193 miR-87 miR-5866 miR-100b AACCCGUAGUUUCGAACAUGUGU 40 miR-57/10 miR-8/200 miR-71 UGAAAGACAUGGGUAGUGAGACG 32 lin-4/125 miR-100c AACCCGUAGAAUUGAAAUCGUGU 22 miR-5884 miR-50-5p UGAUAUGUCUGAUAUUCUUGGGUU 10 miR-44 miR-34-5p UGGCAGUGUGGUUAGCUGGUUGU 8 miR-263/183 AAUGGCACUAGAUGAAUUCACGG 7 Bantam-c UGAGAUCAUGCCACAUCCGUCU 4 Figure 8 | Venn Diagram of overlap in miRNAs identiﬁed in H. polygyrus miR-50-3p CCAGCAUCUCAGACGUAUCGGC 3 miR-153 UUGCAUAGUCACAAAAGUGAUG 3 secretion product or serum of mice infected with L. sigmodontis. miR-87-5p CGCCUGGGACUUCGACUCAACCU 2 The H. polygyrus miRNAs for comparison are taken from Supplementary miR-2 UAUCACAGCCAGCUUUGAUGU 2 Table 1 (top 20 most abundant in at least one platform). The miRNAs miR-5866 UUACCAUGUUGAUCGAUCUCC 2 that are perfectly conserved between nematodes and mice are excluded, since the origin in serum cannot be deduced. miRNA, micro RNA. miRNAs that map exclusively to the L. sigmodontis but not mouse genome, which were identiﬁed in the sera of mice infected with L. sigmodontis (40 infective larvae were injected subcutaneously structures consistent with miRNA precursors (according to prediction programmes and allowed to migrate to the pleural cavity where they developed naturally for 60 days). The detailed below). Reads matching the genome were aligned to a set of RNA lettering of miR-100 and bantam family members is arbitrary. sequences consisting of known H. polygyrus 18S, 28S and 5.8S rRNA sequences (Genbank AJ920355.1, AM039747.1 and DQ408618.1:527-678), 5S rRNA from a closely related species (Trichostrongylus colubriformis, Genbank U32119.1) and silencing but were recently shown to be packaged into exosomes Rfam sequences (version 10, obtained from ftp://ftp.sanger.ac.uk/pub/databases/ secreted from dendritic cells and play roles in RNA quality Rfam/10.0/Rfam.fasta.gz). The best hit with at most two edits was used to classify control and DNA replication in humans . Further work is the reads. Any reads that matched an rRNA or non-microRNA Rfam family were ﬁltered before miRNA analysis. The analysis of piRNAs was carried out with reads required to understand whether and how each of these classes of that did not match known Rfam classes or miRNAs; initial identiﬁcation was based secreted parasite RNA can contribute to the capacity of this on the presence of a ‘GUUUCA’ between 35 and 65 nt upstream of the 5 RNA parasite to manipulate its environment within the host. alignment start site . Inspection of the distribution plot identiﬁed the region 42–45 nt upstream of the 5 RNA alignment start site as being the key area for subsequent analyses (Supplementary Fig. 1). Methods Two miRNA prediction programmes were used to identify miRNAs in the data Puriﬁcation of vesicles from secretion product. For collection of H. polygyrus sets: miRDeep2 (ref. 40) and mireap (http://sourceforge.net/projects/mireap/). Both secretion product, CF1 mice are infected with infective-stage larvae by gavage and programmes use miRNA biogenesis to model the expected alignment of sRNA adult parasites collected from the small intestine 14 days post infection. The worms reads to a potential miRNA precursor. For miRDeep2, the following default are maintained in serum-free media in vitro as described elsewhere ; secretion settings were used: (a) requirement that reads match the genome perfectly, product is collected every 3 days for a maximum of 3 weeks (samples used here (b) removal of reads that match to more than ﬁve places in the genome and were from the ﬁrst week of collection) and puriﬁed as follows: eggs are removed by (c) cutoff -v 1, (d) the ‘-s option’ was employed, using all mature sequences spinning at 400 g before ﬁltering of the secretion through 0.2-mm ﬁlter (Millipore). from mirbase (version 19). The default settings of minimum free energy Filtered media is then processed following a modiﬁed protocol from that described 1 (o 20 kcal mol ) and read length (18–30) were employed. In both in ref. 38, by being spun at 100,000 g for 2 h in polyallomer tubes at 4 C in a SW40 programmes, precursor predictions with fewer than 10 reads were discarded. rotor (Beckman Coulter). Pelleted material is washed two times in ﬁltered PBS at Where multiple precursor loci predicted identical mature miRNAs, only the 100,000 g for 2 h. The supernatant is concentrated using Vivaspin 6 5000 MWCO precursor with the largest number of matching reads was reported. tubes (Fisher) at 5,000 g and washed two times with PBS. pCp end labelling and northern blot. For 3 end-labelling, total RNA was Small RNA library preparation and analysis. For the analysis of small RNAs in extracted from the life stages and secretion product using the miRNAeasy kit the life stages and total secretion products, total RNA was size-selected on 15% (Qiagen): 1mg total RNA was used from life stages and RNA extracted from a denaturing PAGE and libraries prepared from the 18 to 30 nt fraction using volume of secretion product equating to 15mg protein (the total RNA concentra- Illumina Small RNA preparation kit version 1.5 and sequenced on an Illumina tion was too low to detect by nanodrop or qubit). The 3 -end labelling was carried GAIIX instrument in Edinburgh Genomics (http://genomics.ed.ac.uk/). To identify out at 4 C overnight in 10ml using RNA ligase I (NEB) according to the manu- larger RNAs in the secretion product, separate libraries were also prepared for RNA facturer’s instructions with 3,000 Ci mmol P PcP (Perkin Elmer). Reactions size selected between 60 and 100 nt and sequenced in parallel. For analysis of were quenched by the addition of 2 loading buffer (8 M urea, 0.5% TBE) and 4ml vesicle and nonvesicle fractions, small RNA libraries were prepared using the run on an 18% PAGE at 350 V for 8 h, which was then visualized by phosphor- TruSeq kit and sequenced on MiSeq platforms, without prior size fractionation of imaging using a Typhoon Scanner (GE Healthcare). For northern blot analysis, the RNA. All libraries were analysed by ﬁrst clipping the 3 sRNA adapter using total RNA was extracted from volumes of vesicle and nonvesicle fractions that cutadapt, searching for at least a six-base match to the adapter sequence. For contained equivalent protein (10mg) and then separated by denaturing 15% PAGE, analysis of small RNAs only reads that contained the adapter were 16–40 nt in transferred to Hybond-N þ membrane (GE Healthcare) and chemically cross- length and were present at more than two copies were retained for further analysis. linked as described previously . Blots were prehybridized in PerfectHyb (Sigma) For analysis of RNAs 460 nt in the secretion product, sequences present at 4100 for 1 h at 42 C before overnight incubation with DNA probes (Invitrogen) that reads in the library (out of 490,614 reads sequenced) were aligned in Clustalw and were perfectly complementary to the miRNA or Y RNA: miR-100: 5 -ACACAA 0 0 manually inspected for sbRNA (Y RNA) content in terms of secondary structure GTTCGGATCTACGGGTT-3 , YRNA-5P: 5 -ACCCTACGACTCCGGACCA and location of a UUAUC motif in the terminal loop as described in (Fig. 1c and AGCGCG-3 , YRNA-3P: 5p-GCGCCGGTCGAGCTTTTGTCGAAGGGAAT-3p, Supplementary Fig. 2). The Y fragments in the small RNA libraries (o40 nt) were Y RNA-loop: 5p-AAGGGAATTCGAGACATTGTTGATAAC-3p. The probes then identiﬁed based on criteria that they aligned to these full-length Y RNAs. were labelled with T4 PNK (NEB) and 6,000 Ci mmol P ATP (Perkin Elmer) The draft genome assembly for H. polygyrus was created with the CLC de novo according to the manufacturers’ protocols. assembler using two lanes of Illumina GAII data with 50 bp paired-end and 100 bp paired-end reads from Edinburgh Genomics (http://genomics/ed.ac.uk/); the raw and assembled data are available at http://heligmosomoides.nematod.es/. This miRNA RT–qPCR. Analysis of miRNA levels in ultracentrifugation fractions was version was used to map the sequences around small RNA reads to identify carried out using the miScript system (Qiagen) with unmodiﬁed DNA probes 8 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE identical to the full-length parasite miRNA (Life Sciences): miR-100: 5 -AACCCG every 4 weeks. On the day of the experiment, cells were seeded in 24-well plates 0 0 0 5 TAGATCCGAACTTGTGT-3 ,miR-71: 5 -TGAAAGACATGGGTAGTGAGAC-3 , (1 10 cells per well) using advanced DMEM serum-free medium (Invitrogen) 0 0 0 let-7: 5 -TGAGGTAGTAGGTTGTATAGTT-3 and miR-60: 5 -TATTATGC supplemented with 1% L-glutamine and subsequently incubated (1 h at 37 C) ACATTTTCTGGTTCA-3 . For analysis of parasite-derived miRNA levels in host either in the presence of PKH67-labelled H. polygyrus-derived exosomes (5mgof cells, qRT–PCR was carried out using the miRCURY LNA microRNA PCR system total protein) or in the presence of the probe alone. After incubation, cells were (Exiqon) and LNA probes were custom-designed by Exiqon to minimize cross harvested, washed twice in FACS buffer (PBS 1 , 2.5% FBS, 0.1% BSA, 0.05% hybridization with mouse sequences, and efﬁciency of probes was measured NaN ) and ﬁnally resuspended in 500ml of the same buffer. A subset of the samples between 90 and 100% (data not shown). Analysis of mouse gene expression levels were then incubated with 50 ul of 0.25% Trypsin/EDTA (Gibco) for 5 min before was carried out using the Sybr green I master mix (Roche), with the following analysis (indicated in Supplementary Fig. 5). Samples were analysed using the BD 0 0 0 primers: gapdh_F: 5 -CATGGCCTTCCGTGTTCCTA-3 , gapdh_R: 5 -GCGGCA FACS Canto II ﬂow cytometer (BD Bioscience). Data ﬁles were acquired from the 0 0 0 CGTCAGATCCA-3 Dusp1_F: 5 -GTGCCTGACAGTGCAGAATC-3 , Dusp1_R: cytometer, with 5,000 events collected for each tube and the data analysis was 0 0 0 5 -CACTGCCCAGGTACAGGAAG-3 , Il33R_F: 5 -AGACCTGTTACCTGGGC performed using the FlowJo software (Tree Star Inc.). For confocal analyses, 0 0 0 AAG-3 , Il33R_R: 5 -CACCTGTCTTCTGCTATTCTGG-3 . Data were collected MODE-K cells were seeded on round microscope cover glasses in 24-well plates on a Light Cycler 480 System (Roche) following temperature proﬁles recom- (2.5 10 cells per well) in media described above. Cells were allowed to attach on mended by each manufacturer. The delta C method was used for quantiﬁcation as to the coverslips overnight and the following day shifted to advanced DMEM described in ref. 11 using GAPDH as the normalizer. Data were analysed using medium supplemented with 1% L-glutamine. Cells were incubated (1 h at 37 or one-way analysis of variance (ANOVA) followed by Tukey’s post test and variance 4 C) either in the presence of labelled exosomes or probe only. After incubation, within groups assessed by Brown Forsythe test. medium was aspirated, cells were washed twice in PBS and ﬁxed with 4% PFA, with residual PFA quenched with 50 mM glycine. Slide coverslips were washed extensively in PBS, and nuclei were stained with 4 ,6-diamidino-2-phenylindole- LC-MS/MS. Five micrograms of total protein from the secretion product ultra- supplemented ProLong Fade Gold (Invitrogen) mounting media. Samples were centrifuge pellet or supernatant were loaded on a 12% Tris-Bis NuPAGE gel examined on the Leica SP5 II (Leica Microsystems, lasers exciting at 405 and 488, (Invitrogen) and electrophoresis carried out for 5 min before in-gel digestion as 63 objective) using the LAS AP software (Leica). Images were analysed using the described in ref. 42. Capillary-HPLC-MS/MS analysis was performed using an Volocity software (Improvision). online system consisting of a micropump (1,200 binary HPLC system, Agilent, UK) coupled to a hybrid LTQ-Orbitrap XL instrument (ThermoFisher, UK). Data were searched using MASCOT Versions 2.4 (Matrix Science Ltd, UK) against an in- Microarray analysis. MODE-K cells were grown in DMEM media as described house H. polygyrus transcriptome assembly of 454 sequences using a maximum above and seeded into 24-well plates at 20,000 cells per well. The following day, missed-cut value of 2. Variable methionine oxidation and ﬁxed cysteine cells were incubated with H. polygyrus-derived exosomes (5mg total protein per carbamidomethylation were used in all searches; precursor mass tolerance was set well) for 20 h before washing twice with PBS and total RNA extracted. RNA was to 7 p.p.m. and MS/MS tolerance to 0.4 a.m.u. The signiﬁcance threshold (p)was prepared for microarray analysis using the Illumina TotalPrep RNA Ampliﬁcation set below 0.05 (MudPIT scoring). A peptide Mascot score threshold of 20 was used kit and run on MouseWG-6 v2.0 (Illumina) at the Wellcome Trust Clinical in the ﬁnal analysis, which corresponds to a global FDR of 4.6% using a decoy Research Facility (University of Edinburgh). The raw SampleProbeProﬁle ﬁle database search. LC-MS label-free quantitation was performed using Progenesis was processed within R, using ‘lumi’ and ‘lumiMouseAll.db’ Bioconductor 42 46–48 (Nonlinear Dynamics, UK) as described elsewhere where the total number of packages . Quality control was performed using Multi-Dimensional Scaling, Features (that is, intensity signal at a given retention time and m/z) was reduced to and one of the control samples that behaved as an outlier was removed. Raw MS/MS peaks with the charge of 2, 3 or 4þ and we only kept the ﬁve most intense expression values were processed with the Variance Stabilizing Transformation and MS/MS spectra per ‘Feature’. The subset of multicharged ions (2 þ,3þ and 4 þ ) the Robust Spline Normalization . An InterQuartile Range was calculated across was extracted from each LC-MS run. For a speciﬁc protein, the associated unique all samples for each probe, and used to select the most variable probe of those that peptide ions were summed to generate an abundance value that was transformed mapped to the same transcript. Probes without a gene or transcript annotation using an ArcSinH function required for the calculation of the P value. A total of were excluded, leaving a total of 30,708 nonredundant annotated probes. 362 proteins were identiﬁed in either the supernatant or pellet based on Differential expression was performed using the ‘limma’ package , ﬁtting a linear requirement of at least two peptides present; of these, 122 were enriched in the model for each probe and using an empirical Bayes method to obtain moderated supernatant and 139 in the pellet, while the remaining 101 did not show t-statistics. In order to reduce the multiple-test problem and focus on the most statistically signiﬁcant enrichment and were detectable in both samples. The interesting genes, ‘present’ probes with an Illumina detection P value o0.05 in at within-group means were calculated to determine the fold change and the least three samples were selected, leaving 12,276. The Benjamini and Hochberg transformed data were then used to calculate the P values using one-way ANOVA. method was used to calculate FDRs . Differentially expressed proteins were considered meaningful under the following conditions: detected by two or more peptides, with an absolute ratio of at least 1.5 In vivo analysis of exosome function in Alternaria model. BALB/c mice were and Po0.05 associated with the protein change. Classiﬁcation of intestinal proteins bred in-house at the University of Edinburgh and accommodated according to is based on homology to proteins identiﬁed in other nematodes, described in ref. 44. Home Ofﬁce regulations. Female mice were used when they were 6–10 weeks old. For all experiments presented in this study, the sample size was large enough to TEM. For visualization of the vesicles, the puriﬁed ultracentrifuged pellet from measure the effect size. No randomization and no blinding were performed in this H. polygyrus secretion product (100mgml protein concentration) was ﬁxed in study. H. polygyrus exosomes (10mg) were administered intranasally (under iso- 2% paraformaldehyde (PFA), deposited on Formvar-carbon-coated EM grids and ﬂurane sedation) in 50ml PBS, or 50ml PBS alone to controls, 24 h before intranasal treated with glutaraldehyde before treatment with uranyl oxalate and methyl cel- administration of 50mg Alternaria extract with a further 5mg of exosomes. Mice lulose as described in ref. 38. For analysis of adult H. polygyrus parasites, samples were killed 24 h after Alternaria administration, and bronchoalveolar lavage and were washed with PBS before ﬁxation in 2.5% glutaraldehyde solution in 0.1 M lung cell suspensions stained for ﬂow cytometry as described previously . Brieﬂy, sodium cacodylate buffer overnight. Parasites were rinsed three times with 0.1 M cells were counted, then surface stained for Siglecf þ CD11c (eosinophils) or Na cacodylate buffer, and post-ﬁxed in 1% osmium tetroxide for 1 h. After rinsing stimulated with phorbol myristate acetate (PMA) and ionomycin for 4 h in the in 0.1 M Na cacodylate buffer, they were sequentially dehydrated in a graded presence of BrefeldinA and surface stained as negative for lineage markers acetone series. Finally, samples were sequentially incubated for 30 min in an (CD3/CD4/CD5/CD19/CD11b/CD11c/CD19/GR1) and positive for CD45, ICOS araldite:acetone solution left to evaporate overnight at 60 C and then embedded in and ST2 (ILC2s), and assessed for staining of IL-5 and IL-13. Samples were fresh araldite resin and polymerized at 60 C for 48 h. Ultrathin sections, 60-nm acquired on a Becton-Dickinson LSRII ﬂow cytometer. thick, were cut from selected areas, stained in uranyl acetate and lead citrate, and Data were analysed using Prism 6 (Graphpad Prism, La Jolla, CA, USA). then viewed in a Philips CM120 TEM. Images were taken on a Gatan Orius CCD Variance within groups was assessed by Brown Forsythe test and data were camera. log-transformed and analysed by one-way ANOVA, with a Tukey’s multiple comparisons post test. Unless otherwise indicated, differences are not signiﬁcant. ****Po0.0001, ***Po0.001, **Po0.01, *Po0.05, N.S. not signiﬁcant P40.05. Flow cytometry and confocal analyses of uptake. Puriﬁed exosomes from H. polygyrus or MODE-K cells (measured as 5mg of total protein) were labelled with 2mg of PKH67 dye (Sigma) for 5 min at room temperature following the Luciferase assays. The 3 UTRs of Dusp1 and Il33r were cloned behind Renilla manufacturer’s protocol. The staining reaction was stopped by adding an equal luciferase in the Psicheck2 vector (Promega) at NotI and XhoI restriction sites as amount of 1% bovine serum albumin (BSA), and exosomes were washed in PBS described in ref. 41 using the following primers: Psi-Dusp_F: 5 -CTTTAC 0 0 and pelleted by ultracentrifugation (1 h at 100,000 g). A probe solution was pre- TCGAGAGGTGTGGAGTTTCACTTGC-3 , Psi-Dusp_R: 5 -CTTTAGCGGC 0 0 pared with the PKH67 following the same protocol but mixed with PBS solution in CGCAGCTACAAACCTACACTGGC-3 , Psi-Il33r_F: 5 -CTTTACTCGAGGA 45 0 0 the absence of exosomes. MODE-K cells were obtained from Dominique CTGTGTGTTGTAGCTTGG-3 , Psi-Il33r_R: 5 -CTTTAGCGGCCGCCAGA Kaiserlian (INSERM) and grown following the standard protocol in DMEM GGGAGGCTTTATAAGG-3 . (Invitrogen) medium supplemented with 10% fetal bovine serum (Invitrogen), 1% For reporter assays, 15,000 cells were reverse transfected into a 96-well plate penicillin–streptomycin (Lonza), 1% L-glutamine (Lonza), 1% non-essential amino with 0.3% lipofectamine (Invitrogen) and 50 ng of each Psicheck reporter in the acids/sodium pyruvate (Gibco). These were mycoplasma-free based on testing absence or presence of 50 nM synthetic miRNA mimic (Thermoﬁsher). Luciferase NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 9 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 measurements were carried out at 48 h post transfection, using the Dual Glo 21. Toedling, J. et al. Deep-sequencing protocols inﬂuence the results obtained in Luciferase assay system (Promega) and Luminensence measured on a Varioskan small-RNA sequencing. PLoS ONE 7, e32724 (2012). plate reader (Thermoﬁsher). Data shown in Fig. 7b represent n¼ 3 replicates 22. McSorley, H. J., Blair, N. F., Smith, K. A., McKenzie, A. N. & Maizels, R. M. (separate transfection experiments of the MODE-K cell line) measured in parallel Blockade of IL-33 release and suppression of type 2 innate lymphoid cell to control for consistent Renilla and Luciferase ratios using the same kit; data were responses by helminth secreted products in airway allergy. Mucosal Immunol. analysed by one-way ANOVA, with a Dunnett’s post test, ****Po0.0001, 7, 1068–1078 (2014). ***Po0.001, **Po0.01, *Po0.05. 23. Humphreys, N. E., Xu, D., Hepworth, M. R., Liew, F. Y. & Grencis, R. K. IL-33, a potent inducer of adaptive immunity to intestinal nematodes. J. Immunol. MicroRNA target prediction. A custom Perl script was used to identify seed- 180, 2443–2449 (2008). 24. Twu, O. et al. Trichomonas vaginalis exosomes deliver cargo to host cells and matching sites for the H. polygyrus miRNAs identiﬁed by sRNA-Seq. All the 3 UTR sequences corresponding to probes on the microarray were scanned, and the results mediate hostratioparasite interactions. PLoS Pathog. 9, e1003482 (2013). were passed to the TargetScan (v6.2) context scores Perl script. Targets for each 25. Silverman, J. M. et al. An exosome-based secretion pathway is responsible for miRNA were ranked by ‘Context þ Scores’. Conservation scores for relevant protein export from Leishmania and communication with macrophages. J. Cell 3 UTRs (Dusp1 and Il33r) were obtained from the UCSC Genome Browser, using Sci. 123, 842–852 (2010). 52,53 the ‘rtracklayer’ package to access the ‘phastCons60wayPlacental’ table . 26. Marcilla, A. et al. Extracellular vesicles from parasitic helminths contain speciﬁc excretory/secretory proteins and are internalized in intestinal host cells. PLoS ONE 7, e45974 (2012). Sequencing analysis of serum from infected mice. F1 mice were infected with 27. Bernal, D. et al. Surface analysis of Dicrocoelium dendriticum. The molecular H. polygyrus (400 L3 larvae introduced by oral gavage) and serum collected on day characterization of exosomes reveals the presence of miRNAs. J. Proteom. 105, 14 post infection. The presence of adult parasites was conﬁrmed by visual 232–241 (2014). inspection of the mouse gut lumen. Six-week-old BALB/c mice were infected with 28. Buck, A. H. & Blaxter, M. Functional diversiﬁcation of Argonautes in L. sigmodontis (subcutaneous inoculation of 40 L3), and gel-separated serum (BD nematodes: an expanding universe. Biochem. Soc. Trans. 41, 881–886 (2013). Microtainer) was collected by arterial exsanguination at 60 days post infection, 29. Smith, K. A. & Maizels, R. M. IL-6 controls susceptibility to helminth infection which was conﬁrmed by detection of adult worms in the mouse pleural cavity and by impeding Th2 responsiveness and altering the Treg phenotype in vivo. Eur. microﬁlarie in peripheral blood. For library preparation, 200ml of serum was J. Immunol. 44, 150–161 (2014). extracted with the miRNAeasy kit (Qiagen) and libraries generated following the 30. Hammer, M. et al. Dual speciﬁcity phosphatase 1 (DUSP1) regulates a subset of Trueseq protocol and sequenced on the Illumina Rapid HighSeq in Edinburgh LPS-induced genes and protects mice from lethal endotoxin shock. J. Exp. Med. Genomics. Data were processed as described above and analysed for perfect 203, 15–20 (2006). alignment to the mouse or L. sigmodontis genome (reads mapping to both genomes 31. Nelin, L. D. et al. MKP-1 switches arginine metabolism from nitric oxide were not analysed). Reads that aligned were then categorized by matches to Rfam synthase to arginase following endotoxin challenge. Am. J. Physiol. Cell Physiol. or prediction as miRNAs with miRdeep2, as described in ref. 11. 293, C632–C640 (2007). 32. Anthony, R. M. et al. Memory T(H)2 cells induce alternatively activated References macrophages to mediate protection against nematode parasites. Nat. Med. 12, 1. Blaxter, M. L. et al. A molecular evolutionary framework for the phylum 955–960 (2006). Nematoda. Nature 392, 71–75 (1998). 33. Baba, Y. et al. GATA2 is a critical transactivator for the human IL1RL1/ST2 2. Finney, C. A., Taylor, M. D., Wilson, M. S. & Maizels, R. M. Expansion and promoter in mast cells/basophils: opposing roles for GATA2 and GATA1 in activation of CD4( þ )CD25( þ ) regulatory T cells in Heligmosomoides human IL1RL1/ST2 gene expression. J. Biol. Chem. 287, 32689–32696 (2012). polygyrus infection. Eur. J. Immunol. 37, 1874–1886 (2007). 34. Towatari, M. et al. Regulation of GATA-2 phosphorylation by mitogen-activated 3. Mohrs, K., Harris, D. P., Lund, F. E. & Mohrs, M. Systemic dissemination and protein kinase and interleukin-3. J. Biol. Chem. 270, 4101–4107 (1995). persistence of Th2 and type 2 cells in response to infection with a strictly 35. Nolte-’t Hoen, E. N. et al. Deep sequencing of RNA from immune cell-derived enteric nematode parasite. J. Immunol. 175, 5306–5313 (2005). vesicles uncovers the selective incorporation of small non-coding RNA 4. Rausch, S. et al. Functional analysis of effector and regulatory T cells in a biotypes with potential regulatory functions. Nucleic Acids Res. 40, 9272–9285 parasitic nematode infection. Infect. Immun. 76, 1908–1919 (2008). (2012). 5. McSorley, H. J. & Maizels, R. M. Helminth infections and host immune 36. Nicolas, F. E., Hall, A. E., Csorba, T., Turnbull, C. & Dalmay, T. Biogenesis of regulation. Clin. Microbiol. Rev. 25, 585–608 (2012). Y RNA-derived small RNAs is independent of the microRNA pathway. FEBS 6. Grainger, J. R. et al. Helminth secretions induce de novo T cell Foxp3 Lett. 586, 1226–1230 (2012). expression and regulatory function through the TGF-beta pathway. J. Exp. Med. 37. Harcus, Y. et al. C-type lectins from the nematode parasites Heligmosomoides 207, 2331–2341 (2010). polygyrus and Nippostrongylus brasiliensis. Parasitol. Int. 58, 461–470 (2009). 7. Maizels, R. M. et al. Immune modulation and modulators in Heligmosomoides 38. Thery, C., Amigorena, S., Raposo, G. & Clayton, A. Current Protocols in Cell polygyrus infection. Exp. Parasitol. 132, 76–89 (2012). Biology Ch. 3 (eds Bonifacino J. S. et al.) 3.22.1–3.22.29 (John Wiley & Sons, 8. Turchinovich, A., Samatov, T. R., Tonevitsky, A. G. & Burwinkel, B. Circulating 2006). miRNAs: cell-cell communication function? Front. Genet. 4, 119 (2013). 39. Ruby, J. G. et al. Large-scale sequencing reveals 21U-RNAs and additional 9. Zhang, L. et al. Exogenous plant MIR168a speciﬁcally targets mammalian microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193–1207 (2006). LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Res. 22, 40. Friedlander, M. R., Mackowiak, S. D., Li, N., Chen, W. & Rajewsky, N. 107–126 (2012). miRDeep2 accurately identiﬁes known and hundreds of novel microRNA genes 10. Wang, K. et al. The complex exogenous RNA spectra in human plasma: an in seven animal clades. Nucleic Acids Res. 40, 37–52 (2012). interface with human gut biota? PLoS ONE 7, e51009 (2012). 41. Libri, V. et al. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as 11. Hoy, A. M. et al. Parasite-derived microRNAs in host serum as novel a target. Proc. Natl Acad. Sci. USA 109, 279–284 (2012). biomarkers of helminth infection. PLoS Negl. Trop. Dis. 8, e2701 (2014). 42. Le Bihan, T. et al. Shotgun proteomic analysis of the unicellular alga 12. Tritten, L. et al. Detection of circulating parasite-derived microRNAs in ﬁlarial Ostreococcus tauri. J. Proteom. 74, 2060–2070 (2011). infections. PLoS Negl. Trop. Dis. 8, e2971 (2014). 43. Hewitson, J. P. et al. Secretion of protective antigens by tissue-stage nematode 13. Hoy, A. M. & Buck, A. H. Extracellular small RNAs: what, where, why? larvae revealed by proteomic analysis and vaccination-induced sterile Biochem. Soc. Trans. 40, 886–890 (2012). immunity. PLoS Pathog. 9, e1003492 (2013). 14. Thery, C. et al. Proteomic analysis of dendritic cell-derived exosomes: a secreted 44. Yin, Y. et al. Intestinal transcriptomes of nematodes: comparison of the subcellular compartment distinct from apoptotic vesicles. J. Immunol. 166, parasites Ascaris suum and Haemonchus contortus with the free-living 7309–7318 (2001). Caenorhabditis elegans. PLoS Negl. Trop. Dis. 2, e269 (2008). 15. Baietti, M. F. et al. Syndecan-syntenin-ALIX regulates the biogenesis of 45. Vidal, K., Grosjean, I., evillard, J. P., Gespach, C. & Kaiserlian, D. exosomes. Nat. Cell Biol. 14, 677–685 (2012). Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. 16. Boria, I. et al. Nematode sbRNAs: homologs of vertebrate Y RNAs. J. Mol. Evol. Phenotypic and immune characterization of the MODE-K cell line. J. Immunol. 70, 346–358 (2010). Methods 166, 63–73 (1993). 17. Alvarez-Saavedra, E. & Horvitz, H. R. Many families of C. elegans microRNAs 46. Team, R.D.C. A language and environment for statistical computing http:// are not essential for development or viability. Curr. Biol. 20, 367–373 (2010). www.r-project.org (2010). 18. Tarver, J. E. et al. miRNAs: small genes with big potential in metazoan 47. Gentleman, R. C. et al. Bioconductor: open software development for phylogenetics. Mol. Biol. Evol. 30, 2369–2382 (2013). computational biology and bioinformatics. Genome Biol. 5, R80 (2004). 19. Mathivanan, S. & Simpson, R. J. ExoCarta: a compendium of exosomal proteins 48. Du, P., Kibbe, W. A. & Lin, S. M. lumi: a pipeline for processing Illumina and RNA. Proteomics 9, 4997–5000 (2009). microarray. Bioinformatics 24, 1547–1548 (2008). 49. Lin, S. M., Du, P., Huber, W. & Kibbe, W. A. Model-based variance-stabilizing 20. Hewitson, J. P. et al. Proteomic analysis of secretory products from the model transformation for Illumina microarray data. Nucleic Acids Res. 36, e11 gastrointestinal nematode Heligmosomoides polygyrus reveals dominance of venom allergen-like (VAL) proteins. J. Proteom. 74, 1573–1594 (2011). (2008). 10 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Y.H. generated worm and secretion samples; A.C. supported uptake and reporter 50. Smyth, G. K. Linear models and empirical bayes methods for assessing assays; M.B. oversaw genome assembly and phylogenetic analyses of AGO protein; differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. S.A.B. performed the L. sigmodontis infections and tissue sampling; A.I. analysed 3, Article3 (2004). small RNAseq data; R.M.M. supplied H. polygyrus life stage material, contributed to 51. Benjamini, Y. & Y., Hochberg Controlling the false discovery rate: a practical analysis of proteomic data, co-designed immunological experiments and edited and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 57, the manuscript. 289–300 (1995). 52. Karolchik, D. et al. The UCSC genome browser database: 2014 update. Nucleic Acids Res. 42, D764–D770 (2014). Additional information 53. Lawrence, M., Gentleman, R. & Carey, V. rtracklayer: an R package for Accession codes: The sequencing and microarray data from this study have been interfacing with genome browsers. Bioinformatics 25, 1841–1842 (2009). deposited in Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession codes GSE55978 and GSE55941. The novel miRNA sequences identiﬁed in this study have been deposited in miRBase and the ofﬁcial naming is provided in Supple- Acknowledgements mentary Data 1. The genomic information for H. polygyrus and L. sigmodontis is We thank J. Claycomb, K.A. Smith and J.P. Hewitson for many helpful discussions, available at http://www.nematodes.org/genomes/heligmosomoides_polygyrus/ and E. Robertson for maintaining the H. polygyrus life cycle, A. Fulton for maintaining the http://nematodes.org/genomes/litomosoides_sigmodontis/. L. sigmodontis life cycle, S. Mitchell for technical support for TEM and U. Trivedi, Supplementary Information accompanies this paper at http://www.nature.com/ S. Bridgett and Edinburgh Genomics for H. polygyrus genome assembly. The MODE-K naturecommunications cells were provided by D. Kaiserlian (INSERM). We thank the Wellcome Trust for funding through a Research Career Development Fellowship to AHB, a Programme Competing ﬁnancial interests: The authors declare no competing ﬁnancial interests. Grant to RMM, and funding to the Centre for Immunity, Infection and Evolution and Asthma UK for fellowship funding to H.J.McS. Reprints and permission information is available online at http://npg.nature.com/ reprintsandpermissions/ How to cite this article: Buck, A. H. et al. Exosomes secreted by nematode parasites Author contributions transfer small RNAs to mammalian cells and modulate innate immunity. Nat. Commun. A.H.B. designed and carried out RNAseq experiments and validation, identiﬁed vesicles 5:5488 doi: 10.1038/ncomms6488 (2014). in secretion, co-designed and contributed to analysis of serum and proteomic data, co-supervised functional and uptake assays and wrote the paper; G.C. co-designed and This work is licensed under a Creative Commons Attribution 4.0 carried out functional analyses, in vivo Alternaria extract experiments and vesicle International License. The images or other third party material in this detection in nematodes; F.S. designed and carried out uptake and functional assays; article are included in the article’s Creative Commons license, unless indicated otherwise S.K. carried out genome alignment/annotation; H.J.McS. co-designed and performed in vivo Alternaria extract experiments; J.Q. prepared and co-analysed serum libraries, in the credit line; if the material is not included under the Creative Commons license, T.L.B. carried out LC-MS/MS and analysis; C.A.-G. analysed microarray data and users will need to obtain permission from the license holder to reproduce the material. target prediction; M.L. puriﬁed secretion material and supported functional studies; To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 11 & 2014 Macmillan Publishers Limited. All rights reserved. DOI: 10.1038/ncomms9772 OPEN Erratum: Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity Amy H. Buck, Gillian Coakley, Fabio Simbari, Henry J. McSorley, Juan F. Quintana, Thierry Le Bihan, Sujai Kumar, Cei Abreu-Goodger, Marissa Lear, Yvonne Harcus, Alessandro Ceroni, Simon A. Babayan, Mark Blaxter, Alasdair Ivens & Rick M. Maizels Nature Communications 5:5488 doi: 10.1038/ncomms6488 (2014); Published 25 Nov 2014; Updated 22 Oct 2015 The afﬁliation details for Mark Blaxter are incorrect in this Article. The correct afﬁliation details for this author are given below: Centre for Immunity, Infection and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Institute of Evolutionary Biology, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Edinburgh Genomics, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ NATURE COMMUNICATIONS | 6:8772 | DOI: 10.1038/ncomms9772 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nature Communications Springer Journals http://www.deepdyve.com/lp/springer-journals/exosomes-secreted-by-nematode-parasites-transfer-small-rnas-to-Td91zX4XN0

Loading next page...

References (61)

J. Hewitson, A. Ivens, Y. Harcus, Kara Filbey, H. McSorley, J. Murray, S. Bridgett, D. Ashford, A. Dowle, R. Maizels (2013)
Secretion of Protective Antigens by Tissue-Stage Nematode Larvae Revealed by Proteomic Analysis and Vaccination-Induced Sterile Immunity
PLoS Pathogens, 9
Michael Hammer, J. Mages, Harald Dietrich, A. Servatius, N. Howells, A. Cato, R. Lang (2006)
Dual specificity phosphatase 1 (DUSP1) regulates a subset of LPS-induced genes and protects mice from lethal endotoxin shock
The Journal of Experimental Medicine, 203
M. Towatari, G. May, R. Marais, G. Perkins, C. Marshall, S. Cowley, T. Enver (1995)
Regulation of GATA-2 Phosphorylation by Mitogen-activated Protein Kinase and Interleukin-3 (*)
The Journal of Biological Chemistry, 270
T. Bihan, Sarah Martin, Eliane Chirnside, Gerben Ooijen, M. Barrios-Llerena, J. O’Neill, Pavel Shliaha, L. Kerr, A. Millar (2011)
Shotgun proteomic analysis of the unicellular alga Ostreococcus tauri.
Journal of proteomics, 74 10
J. Silverman, J. Clos, C. de'Oliveira, Omid Shirvani, Yuan Fang, Christine Wang, L. Foster, N. Reiner (2010)
An exosome-based secretion pathway is responsible for protein export from Leishmania and communication with macrophages
Journal of Cell Science, 123
M. Baietti, Zhe Zhang, E. Mortier, Aurélie Melchior, G. Degeest, A. Geeraerts, Y. Ivarsson, F. Depoortere, C. Coomans, E. Vermeiren, P. Zimmermann, G. David (2012)
Syndecan–syntenin–ALIX regulates the biogenesis of exosomes
Nature Cell Biology, 14
D. Bernal, M. Trelis, S. Montaner, Fernando Cantalapiedra, Alicia Galiano, M. Hackenberg, A. Marcilla (2014)
Surface analysis of Dicrocoelium dendriticum. The molecular characterization of exosomes reveals the presence of miRNAs.
Journal of proteomics, 105
C. Finney, Matthew Taylor, M. Wilson, R. Maizels (2007)
Expansion and activation of CD4+CD25+ regulatory T cells in Heligmosomoides polygyrus infection
European Journal of Immunology, 37
Y. Baba, K. Maeda, T. Yashiro, Eisuke Inage, K. Kasakura, Ryuyo Suzuki, F. Niyonsaba, M. Hara, Atsushi Tanabe, H. Ogawa, K. Okumura, Y. Ohtsuka, Toshiaki Shimizu, C. Nishiyama (2012)
GATA2 Is a Critical Transactivator for the Human IL1RL1/ST2 Promoter in Mast Cells/Basophils
The Journal of Biological Chemistry, 287
Ezequiel Alvarez-Saavedra, H. Horvitz (2010)
Many Families of C. elegans MicroRNAs Are Not Essential for Development or Viability
Current Biology, 20
S. Rausch, J. Huehn, Dennis Kirchhoff, J. Rzepecka, C. Schnoeller, S. Pillai, C. Loddenkemper, A. Scheffold, A. Hamann, R. Lucius, S. Hartmann (2008)
Functional Analysis of Effector and Regulatory T Cells in a Parasitic Nematode Infection
Infection and Immunity, 76
F. Nicolás, Adam Hall, Tibor Csorba, C. Turnbull, T. Dalmay (2012)
Biogenesis of Y RNA‐derived small RNAs is independent of the microRNA pathway
FEBS Letters, 586
Ilenia Boria, A. Gruber, Andrea Tanzer, S. Bernhart, Ronny Lorenz, Michael Mueller, I. Hofacker, P. Stadler (2010)
Nematode sbRNAs: Homologs of Vertebrate Y RNAs
Journal of Molecular Evolution, 70
M. Friedländer, Sebastian Mackowiak, Na Li, Wei Chen, N. Rajewsky (2011)
miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades
Nucleic Acids Research, 40
D. Karolchik, R. Baertsch, M. Diekhans, T. Furey, A. Hinrichs, Y. Lu, K. Roskin, M. Schwartz, C. Sugnet, D. Thomas, R. Weber, D. Haussler, W. Kent (2003)
The UCSC Genome Browser Database
Nucleic acids research, 31 1
Lin Zhang, Dongxia Hou, X. Chen, Donghai Li, Lingyun Zhu, Yujing Zhang, Jing Li, Zhen Bian, Xiangying Liang, Xing Cai, Yuan Yin, Cheng Wang, Tianfu Zhang, Dihan Zhu, Dianmu Zhang, Jie Xu, Qun Chen, Y. Ba, J. Liu, Qiang Wang, Jianqun Chen, Jin Wang, Meng Wang, Qipeng Zhang, Junfeng Zhang, Ke Zen, Chen-Yu Zhang (2011)
Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA
Cell Research, 22
Olivia Twu, N. Miguel, G. Lustig, Grant Stevens, A. Vashisht, J. Wohlschlegel, Patricia Johnson (2013)
Trichomonas vaginalis Exosomes Deliver Cargo to Host Cells and Mediate Host∶Parasite Interactions
PLoS Pathogens, 9
GK Smyth (2004)

Stat. Appl. Genet. Mol. Biol., 3
S. Lin, Pan Du, W. Huber, W. Kibbe (2008)
Model-based variance-stabilizing transformation for Illumina microarray data
Nucleic Acids Research, 36
XuD HumphreysNE (2008)
IL-33, a potent inducer of adaptive immunity to intestinal nematodes.
Journal of Immunology
Kai Wang, Hong Li, Yue Yuan, A. Etheridge, Yong Zhou, David Huang, P. Wilmes, D. Galas (2012)
The Complex Exogenous RNA Spectra in Human Plasma: An Interface with Human Gut Biota?
PLoS ONE, 7
Anna Hoy, Amy Buck (2012)
Extracellular small RNAs: what, where, why?
Biochemical Society Transactions, 40
A. Turchinovich, T. Samatov, A. Tonevitsky, B. Burwinkel (2013)
Circulating miRNAs: cell–cell communication function?
Frontiers in Genetics, 4
Pan Du, W. Kibbe, Simon Lin (2008)
lumi: a pipeline for processing Illumina microarray
Bioinformatics, 24 13
Y. Harcus, G. Nicoll, J. Murray, Kara Filbey, N. Gomez-Escobar, R. Maizels (2009)
C-type lectins from the nematode parasites Heligmosomoides polygyrus and Nippostrongylus brasiliensis
Parasitology International, 58
Lucienne Tritten, E. Burkman, A. Moorhead, M. Satti, J. Geary, C. Mackenzie, T. Geary (2014)
Detection of Circulating Parasite-Derived MicroRNAs in Filarial Infections
PLoS Neglected Tropical Diseases, 8
NE Humphreys (2008)
IL-33, a Potent Inducer of Adaptive Immunity to Intestinal Nematodes1
J. Immunol., 180
L. Nelin, Xianxi Wang, Qun Zhao, L. Chicoine, Tamara Young, Dionna Hatch, B. English, Yusen Liu, Nelin Ld, Wang X, Zhao Q, Chicoine Lg, Young Tl, Hatch Dm, English Bk, Y. Liu, Mkp (2007)
MKP-1 switches arginine metabolism from nitric oxide synthase to arginase following endotoxin challenge.
American journal of physiology. Cell physiology, 293 2
J. Ruby, Calvin Jan, Christopher Player, M. Axtell, William Lee, C. Nusbaum, Hui Ge, D. Bartel (2006)
Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans
Cell, 127
Y Benjamini (1995)

J. R. Stat. Soc. Ser. B Methodol., 57
Yong Yin, John Martin, Sahar Abubucker, A. Scott, J. McCarter, R. Wilson, D. Jasmer, M. Mitreva (2008)
Intestinal Transcriptomes of Nematodes: Comparison of the Parasites Ascaris suum and Haemonchus contortus with the Free-living Caenorhabditis elegans
PLoS Neglected Tropical Diseases, 2
Y Baba (2012)
GATA2 is a critical transactivator for the human IL1RL1/ST2 promoter in mast cells/basophils: opposing roles for GATA2 and GATA1 in human IL1RL1/ST2 gene expression
J. Biol. Chem., 287
R. Maizels, J. Hewitson, J. Murray, Y. Harcus, Blaise Dayer, Kara Filbey, J. Grainger, H. McSorley, L. Reynolds, Katherine Smith (2012)
Immune modulation and modulators in Heligmosomoides polygyrus infection.
Experimental parasitology, 132 1
R. Anthony, J. Urban, Farhang Alem, Hossein Hamed, C. Rozo, J. Boucher, N. Rooijen, W. Gause (2006)
Memory TH2 cells induce alternatively activated macrophages to mediate protection against nematode parasites
Nature Medicine, 12
J. Toedling, N. Servant, C. Ciaudo, L. Farinelli, O. Voinnet, E. Heard, E. Barillot (2012)
Deep-Sequencing Protocols Influence the Results Obtained in Small-RNA Sequencing
PLoS ONE, 7
D. Karolchik, G. Barber, J. Casper, H. Clawson, M. Cline, M. Diekhans, T. Dreszer, P. Fujita, L. Guruvadoo, M. Haeussler, R. Harte, S. Heitner, A. Hinrichs, K. Learned, Brian Lee, Chin Li, B. Raney, B. Rhead, K. Rosenbloom, C. Sloan, M. Speir, A. Zweig, D. Haussler, R. Kuhn, W. Kent (2013)
The UCSC Genome Browser database: 2014 update
Nucleic Acids Research, 42
A. Buck, M. Blaxter (2013)
Functional diversification of Argonautes in nematodes: an expanding universe
Biochemical Society Transactions, 41
H. McSorley, R. Maizels (2012)
Helminth Infections and Host Immune Regulation
Clinical Microbiology Reviews, 25
J. Grainger, K. Smith, J. Hewitson, H. McSorley, Y. Harcus, Kara Filbey, C. Finney, Edward Greenwood, D. Knox, M. Wilson, Y. Belkaid, A. Rudensky, R. Maizels (2010)
Helminth secretions induce de novo T cell Foxp3 expression and regulatory function through the TGF-β pathway
The Journal of Experimental Medicine, 207
M Lawrence, R Gentleman, V Carey (2009)
rtracklayer: an R package for interfacing with genome browsers
Bioinformatics, 25
J. Tarver, E. Sperling, Audrey Nailor, Alysha Heimberg, Jeffrey Robinson, B. King, D. Pisani, P. Donoghue, K. Peterson (2013)
miRNAs: small genes with big potential in metazoan phylogenetics.
Molecular biology and evolution, 30 11
J. Hewitson, Y. Harcus, J. Murray, M. Agtmaal, Kara Filbey, J. Grainger, S. Bridgett, M. Blaxter, P. Ashton, D. Ashford, R. Curwen, R. Wilson, A. Dowle, R. Maizels (2011)
Proteomic analysis of secretory products from the model gastrointestinal nematode Heligmosomoides polygyrus reveals dominance of venom allergen-like (VAL) proteins.
Journal of proteomics, 74 9
Katherine Smith, R. Maizels (2013)
IL-6 controls susceptibility to helminth infection by impeding Th2 responsiveness and altering the Treg phenotype in vivo
European Journal of Immunology, 44
K. Mohrs, D. Harris, F. Lund, M. Mohrs (2005)
Systemic Dissemination and Persistence of Th2 and Type 2 Cells in Response to Infection with a Strictly Enteric Nematode Parasite1
The Journal of Immunology, 175
R. Gentleman, V. Carey, D. Bates, B. Bolstad, M. Dettling, S. Dudoit, B. Ellis, L. Gautier, Yongchao Ge, Jeff Gentry, K. Hornik, T. Hothorn, W. Huber, S. Iacus, R. Irizarry, F. Leisch, Cheng Li, M. Maechler, A. Rossini, G. Sawitzki, Colin Smith, Gordon Smyth, L. Tierney, J. Yang, Jianhua Zhang (2004)
Bioconductor: open software development for computational biology and bioinformatics
Genome Biology, 5
C. Théry, S. Amigorena, G. Raposo, A. Clayton (2006)
Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids
Current Protocols in Cell Biology, 30
M Lawrence (2009)
rtracklayer: an R package for interfacing with genome browsers
Bioinformatics, 25
GK Smyth (2004)
Linear models and empirical bayes methods for assessing differential expression in microarray experiments
Stat. Appl. Genet. Mol. Biol., 3
R. Team (2014)
R: A language and environment for statistical computing.
MSOR connections, 1
A. Marcilla, M. Trelis, A. Cortés, J. Sotillo, Fernando Cantalapiedra, María Minguez, M. Valero, M. Pino, C. Muñoz-Antolí, R. Toledo, D. Bernal (2012)
Extracellular Vesicles from Parasitic Helminths Contain Specific Excretory/Secretory Proteins and Are Internalized in Intestinal Host Cells
PLoS ONE, 7
E. Hoen, H. Buermans, M. Waasdorp, W. Stoorvogel, M. Wauben, P. Hoen (2012)
Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions
Nucleic Acids Research, 40
G. Smyth (2011)
Statistical Applications in Genetics and Molecular Biology Linear Models and Empirical Bayes Methods for Assessing Differential Expression in Microarray Experiments
C. Théry, Muriel Boussac, P. Véron, P. Ricciardi-Castagnoli, G. Raposo, J. Garin, S. Amigorena (2001)
Proteomic Analysis of Dendritic Cell-Derived Exosomes: A Secreted Subcellular Compartment Distinct from Apoptotic Vesicles1
The Journal of Immunology, 166
H. McSorley, Natalie Blair, Katherine Smith, Andrew McKenzie, Rick Maizels (2014)
Blockade of IL-33 release and suppression of type 2 innate lymphoid cell responses by helminth secreted products in airway allergy
Mucosal Immunology, 7
V. Libri, A. Helwak, Pascal Miesen, D. Santhakumar, J. Borger, Grzegorz Kudla, Finn Grey, D. Tollervey, A. Buck (2011)
Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a target
Proceedings of the National Academy of Sciences, 109
Y. Benjamini, Y. Hochberg (1995)
Controlling the false discovery rate: a practical and powerful approach to multiple testing
Journal of the royal statistical society series b-methodological, 57
S. Mathivanan, Richard Simpson (2009)
ExoCarta: A compendium of exosomal proteins and RNA
PROTEOMICS, 9
Systems Biology
BIOINFORMATICS APPLICATIONS NOTE
A. Hoy, R. Lundie, A. Ivens, Juan Quintana, N. Nausch, T. Forster, F. Jones, N. Kabatereine, D. Dunne, F. Mutapi, A. MacDonald, A. Buck (2014)
Parasite-Derived MicroRNAs in Host Serum As Novel Biomarkers of Helminth Infection
PLoS Neglected Tropical Diseases, 8
K. Vidal, I. Grosjean, J. Revillard, C. Gespach, D. Kaiserlian (1993)
Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. Phenotypic and immune characterization of the MODE-K cell line.
Journal of immunological methods, 166 1
Mark Blaxter, P. Ley, J. Garey, Leo Liu, P. Scheldeman, A. Vierstraete, J. Vanfleteren, Laura Mackey, M. Dorris, L. Frisse, J. Vida, W. Thomas (1998)
A molecular evolutionary framework for the phylum Nematoda
Nature, 392

Publisher: Springer Journals
Copyright: Copyright © 2014 by The Author(s)
Subject: Science, Humanities and Social Sciences, multidisciplinary; Science, Humanities and Social Sciences, multidisciplinary; Science, multidisciplinary
eISSN: 2041-1723
DOI: 10.1038/ncomms6488
Publisher site: See Article on Publisher Site

Abstract

ARTICLE Received 8 Sep 2014 | Accepted 6 Oct 2014 | Published 25 Nov 2014 DOI: 10.1038/ncomms6488 OPEN Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity 1,2 1,2, 1,2, 1,2 1,2 Amy H. Buck , Gillian Coakley *, Fabio Simbari *, Henry J. McSorley , Juan F. Quintana , Thierry Le 2,3 4 5 1,2 1,2 1,w Bihan , Sujai Kumar , Cei Abreu-Goodger , Marissa Lear , Yvonne Harcus , Alessandro Ceroni , 2,w 2,3,6 2 1,2 Simon A. Babayan , Mark Blaxter , Alasdair Ivens & Rick M. Maizels In mammalian systems RNA can move between cells via vesicles. Here we demonstrate that the gastrointestinal nematode Heligmosomoides polygyrus, which infects mice, secretes vesi- cles containing microRNAs (miRNAs) and Y RNAs as well as a nematode Argonaute protein. These vesicles are of intestinal origin and are enriched for homologues of mammalian exo- some proteins. Administration of the nematode exosomes to mice suppresses Type 2 innate responses and eosinophilia induced by the allergen Alternaria. Microarray analysis of mouse cells incubated with nematode exosomes in vitro identiﬁes Il33r and Dusp1 as suppressed genes, and Dusp1 can be repressed by nematode miRNAs based on a reporter assay. We further identify miRNAs from the ﬁlarial nematode Litomosoides sigmodontis in the serum of infected mice, suggesting that miRNA secretion into host tissues is conserved among parasitic nematodes. These results reveal exosomes as another mechanism by which helminths manipulate their hosts and provide a mechanistic framework for RNA transfer between animal species. 1 2 Institute of Immunology and Infection Research, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Centre for Immunity, Infection and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. SynthSys, Centre for Synthetic and Systems Biology, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3BF, UK. Institute of Evolutionary Biology, School of Biological Sciences, University of ´ ´ Edinburgh, Edinburgh EH9 3FL, UK. Laboratorio Nacional de Genomica para la Biodiversidad, Langebio-CINVESTAV, Irapuato 36821, Guanajuato, Mexico. Edinburgh Genomics, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. * These authors contributed equally to this work. w Present addresses: Target Discovery Institute, University of Oxford, Nufﬁeld Department of Medicine Research Building, Oxford OX3 7FZ, UK. (A.C.); Institute of Biodiversity, Animal Health and Comparative Medicine, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ, UK (S.A.B.). Correspondence and requests for materials should be addressed to A.H.B. (email: [email protected]). NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 arasitic nematodes are ubiquitous pathogens of plants and DUSP1. This work identiﬁes exosomes as a new class of animals, including species that infect over 2 billion people immunomodulatory complex produced by helminths and Pand generally reside in extracellular niches in their hosts. provides the ﬁrst steps towards a mechanistic framework for H. polygyrus is a parasite related to human hookworm that RNA-mediated communication between animal species. naturally infects mice, and is in the same nematode clade as Caenorhabditis elegans . Within the mouse host, the parasite life cycle is exclusively intestinal: following ingestion, the larvae Results invade the small intestine, moult into adult worms and emerge Small RNAs in H. polygyrus secretory products. Total RNA was into the lumen of the duodenum to mate and to produce eggs extracted from the secretory products of H. polygyrus and com- expelled in the faeces. The infection induces Type 2 innate and pared with the proﬁle of small RNAs in adult nematodes, eggs adaptive (Th2) immune responses in parallel with a large and infective larvae. A heterogeneous population of small RNAs expansion of regulatory cells that mediate immunosuppressive o25 nucleotides (nt) was observed in all samples and several 2–4 effects , some of which have beneﬁcial properties in allergy and additional species between 25 and 30 nt were apparent in the auto-immunity . Immune suppression has been shown to be secretion product (Fig. 1a). Small RNA sequencing (o30 nt) mediated in part by a suite of immunomodulatory proteins identiﬁed miRNAs as the dominant class of secreted parasite 6,7 actively secreted by the nematodes . Given the burgeoning body small RNA (Fig. 1b) and also identiﬁed RNA fragments mapping of data detailing extracellular small RNAs in mammalian systems, to nematode stem-bulge RNAs, herein referred to as Y RNAs and emerging evidence that these can mediate cell-to-cell based on their recognized homology to this class of small RNA communication , it is intriguing to think this mechanism could (Fig. 1b). In contrast, piRNAs (or ‘21-U’ RNAs) were exclusively also be used by parasites. Small RNAs derived from bacteria, identiﬁed in the adult library (B14% of reads; Supplementary 9–12 plants and parasites have been detected in human body ﬂuids ; Fig. 1 and Supplementary Data set 1) with no evidence of however, the mechanism by which these are secreted or excreted secretion. RNAs between 70 and 100 nt were also present in the is unknown, and the meaning of their extracellular existence secreted product (Fig. 1a) and sequencing identiﬁed full-length unclear . We show here that H. polygyrus secretes a speciﬁc set Y RNAs as the major component of this fraction, with two of miRNAs and full-length Y RNAs that are stabilized against predominant classes of structure identiﬁed (Fig. 1c and degradation by encapsulation within vesicles. The vesicles are of Supplementary Fig. 2). intestinal origin and are enriched for homologues of mammalian A total of 263 ‘high conﬁdence’ miRNAs were classiﬁed from proteins found in exosomes, including heat shock proteins, the combined libraries based on representation of reads from tetraspanins and ALIX, a protein associated with exosome both 5p and 3p arms of the hairpin and/or homology with known 14,15 biogenesis as well as a nematode Argonaute (Ago) protein. miRNAs in other nematodes (Supplementary Data set 1). Each of Local administration of the nematode exosomes to mice by the these matches DNA sequences in the H. polygyrus whole genome intranasal route suppresses Type 2 innate responses and currently under assembly. Many also show stage-speciﬁc expres- eosinophilia induced by the allergen Alternaria in vivo. The sion patterns: for example, miR-35 family members are nematode vesicles are internalized by mouse intestinal epithelial exclusively expressed in the egg library, consistent with their cells in vitro and suppress genes involved in inﬂammation and functions in embryogenesis (Fig. 2a, boxed). The secretory immunity, including the receptor for the alarmin IL-33 and a key products are dominated by miRNAs with identical seed sites to regulator of mitogen-activated protein kinase (MAPK) signalling, mouse miRNAs, many of which are ancient: six are shared among Adult library H. polygyrus (<30 nt) full-length Y RNAs Uncharacterized 22% Y RNA 0.05% MicroRNA piRNA 55% 100 14% Full-length Y RNAs rRNA Other rfram 8% <1% tRNA <1% Secretion library (<30 nt) Uncharacterized 10% Y RNA 1% Other rfram <1% Small RNAs tRNA sequenced rRNA <1% 9% in (b) MicroRNA 78% Figure 1 | H. polygyrus secretory products contain miRNAs and Y RNAs. (a) Size distribution of 3 -end labelled (pCp) total RNA extracted from the life stages (1mg total RNA) or secretion product of H. polygyrus (total RNA from equivalent of 15mg protein secretion product). (b) Proportion of H. polygyrus small RNA biotypes (o30 nt) identiﬁed in sequencing libraries from adult worms and the secretion product. (c) Predicted secondary structures of the two families of Y RNA identiﬁed in H. polygyrus secretion products based on RNAfold, the conserved UUAUC motif is noted in blue. 2 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. Eggs L3 Adult Secretion AC UUUA UA A 5′ GC - UU C U GCGC GGUC GG GUCG AGGG UC UC 3′- CGCG CCAG UC CAGC UCCC AG G U UUA G C C G A A C AA G U U C 5′- C A AUC C GC UU UU UCAGGU CG GUUAGAGGG AU AU UCCC 3′-AGUUCA GC CGGUCUCCC UA AGGG UU A A A NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Eumetazoa Bilateria 0 miRNA name 10,000 r.p.m. Protostomia Nematoda Eggs L3 Adult Sec Nematode Mouse miR-87 -- P miR-63 miR-425 ** miR-79 miR-9 B miR-100 miR-100 E miR-190 miR-190 B miR-235 miR-25 B miR-87 -- P miR-87 -- P miR-63 miR-425 ** miR-63 miR-425 miR-250 -- N miR-239 -- N miR-83 miR-29 B lin-4 miR-125a E bantam -- P bantam -- P bantam -- P bantam -- P miR-60 -- P let-7 let-7 B let-7 let-7 B miR-100 miR-100 E miR-100 miR-100 E miR-263 miR-183 B miR-100 miR-100 E miR-100 miR-100 E bantam -- P miR-71 -- B miR-1 miR-1 E miR-45 -- P miR-45 -- P miR-45 -- P miR-100 miR-100 E miR-43 --- P miR-790 miR-96 B miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-35 -- P miR-77 -- Figure 2 | Many secreted nematode miRNAs have identical seed sites to mouse miRNAs. (a) Temporal expression of highly abundant miRNAs (410,000 reads per million in at least one of the libraries) across the life stages. Nematode and mouse names are listed according to identical seed sites and miRNAs of high abundance in the secretion product are coloured according to their conservation level : Eumetazoa (red), Bilateria (blue), Protostomia (green), Nematoda (orange). (b) Sequence alignment of abundant secreted parasite miRNAs that contain identical seed sites between mouse and H. polygyrus; all families shown are of common ancestry apart from miR-425/63. Eumetazoa (lin-4/miR-125 and ﬁve miR-100 family members, material (Fig. 3a). Label-free quantiﬁcation of proteins in the Fig. 2a, red) and ﬁve among Bilatera (miR-79/miR-9, miR-83/ vesicles and supernatant by liquid chromatography-electrospray miR-29, miR-263/miR-183 and two let-7 family members, Fig. 2a, tandem mass spectrometry LC-MS/MS identiﬁed 362 proteins, blue). In addition, ﬁve bantam family members dominate the of which 139 were speciﬁcally enriched in the vesicle fraction secretory products along with miR-87 and miR-60, which also are (Po0.05, Fig. 3b, Supplementary Data set 2) including shared among Protostomia (Fig. 2a, green) and three miRNAs homologues of mammalian proteins present in exosomes: heat that evolved in the nematode lineage: miR-63, miR-239 and miR- shock proteins, Rab proteins, tetraspanins and Alix, which is 14,15 77 (Fig. 2a, orange). miR-63 shares an identical seed site to associated with exosome biogenesis (Table 1). The venom mammalian miR-425, although it is not of common ancestry , allergen-like proteins (members of the CAP superfamily, Fig. 2b. On the basis of their sequences, many of the secreted Pfam00188), which were previously identiﬁed as the dominant parasite miRNAs could therefore hijack existing mouse miRNA proteins in the H. polygyrus secretory products , are almost target networks if taken up by host cells. exclusively in the supernatant fraction (Fig. 3b, orange), further demonstrating speciﬁcity in the molecular composition of the vesicles and possibly indicating distinct routes of secretion. On Nematode vesicles are associated with secreted RNA.In this note, nematode intestinal proteins are enriched in the vesicle fraction (Fig. 3b, green and Supplementary Data set 2) and, mammalian systems, miRNAs have been found in body ﬂuids in association with speciﬁc proteins or in extracellular vesicles . consistent with an intestinal origin of the nematode exosomes, vesicles of similar size are observed in the intestinal tissue of To determine whether these RNAs could be present in vesicles, the H. polygyrus secretory products were ultracentrifuged and adult H. polygyrus analysed immediately ex vivo (Fig. 3c). One Argonaute protein was identiﬁed in both vesicle and supernatant quantitative reverse transcription–PCR (qRT)–PCR used to measure miRNA levels in the pellet and supernatant, revealing fractions (Fig. 3b, red) that belongs to the clade of Worm-speciﬁc the majority to be present in the pellet (Supplementary Fig. 3). Agos (WAGO). Phylogenetic analysis suggests that homologues to this WAGO are present in many parasitic nematodes but may Transmission electron microscopy (TEM) identiﬁed vesicle-like structures between 50 and 100 nm in diameter in the pelleted have been lost in Caenorhabditis (Fig. 3d). NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 3 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 Enriched Enriched in supernatant in vesicles −6 1 × 10 −5 1 × 10 −4 1 × 10 Argonaute VAL proteins −3 1 × 10 Exosome proteins Intestinal proteins Other −2 1 × 10 −1 1 × 10 1/256 1/64 1/16 1/4 1 4 16 64 256 Vesicle/supernatant ratio WAGO 1/2/4/5 clade IV WAGO 1/2/4/5 clade V (including caenorhabditis) WAGO 1/2/4/5 clade IV WAGO 1/2/4/5 clade IV Ascaris suum WAGO 2 Ascaris suum ADY40873 Brugia malayi XP_001895197 Wuchereria bancrofti EJW79934 Brugia malayi XP_001895198 Wuchereria bancrofti EJW75003 Loa loa EF014316 Loa loa XP_003149753 Ascaris suum F1KUF7 Ascaris suum ADY41511 Ascaris suum ADY40604 Ascaris suum WAGO 1 Dictyocaulus vivaparus DVC00216 Angiostrongylus cantonensis AAC00253 Heligmosomoides polygyrus secreted WAGO Ancylostoma ceylanicum AYC02701 Ancylostoma caninum ACC08275 Dictyocaulus vivaparus DVC01842 Heterorhabditis bacteriophora Hba_19411 Heterorhabditis bacteriophora HBC00350 Pristionchus pacificus PPA18974 Pristionchus pacificus H3F9V8 Pristionchus pacificus H3DSP7 Pristionchus pacificus PPA00428 Pristionchus pacificus PPC00082 Pristionchus pacificus H3EBA6 Pristionchus pacificus PPA07002 Figure 3 | H. polygyrus secretes exosomes of intestinal origin that contain a WAGO protein. (a) TEM of puriﬁed ultracentrifugation pellet (100mgml total protein) from H. polygyrus secretion product, scale indicates 0.5mm. (b) Scatter plot of proteins enriched in ultracentrifugation pellet or supernatant based on LC-MS/MS, n ¼ 3, using Po0.05 (one-way ANOVA) and FC 41.5 as cutoffs. Noted in the legend are homologues of intestinal nematode proteins (green), mammalian exosome proteins (purple), Venom Allergen-Like (VAL) proteins (orange) and an Argonaute protein (red). (c) TEM of adult worm intestine noting vesicles of comparable size to exosomes, scale indicates 1.0mm. (d) Phylogenetic relationship of the secreted Argonaute protein identiﬁed in H. polygyrus secretion product in relation to other nematode Argonautes. The analysis was performed on the same data set described in ref. 28 with the addition of the H. polygyrus-secreted argonaute sequence, using the same method (Bayesian analysis using MrBayes v3.2). three biological replicates demonstrate that the parasite miRNAs Table 1 | Table of nematode proteins enriched in vesicle are enriched in the vesicle fractions (75% of reads compared with fraction that are homologous to mouse proteins associated 10% in supernatant, which is dominated instead by rRNA and Y with exosomes. RNA fragments, Fig. 4a). This analysis also identiﬁed three mouse miRNA homologues: miR-193, miR-10 and miR-200, within the Name Pellet/sup P-value Organism Blast E value top ﬁve most abundant secreted miRNAs. These were ranked ratio much lower in the initial Illumina analysis (Supplementary Tetraspanin-11 40.0 o0.005 A. suum 2e 46 Table 1) likely because of the sequencing bias of the different kits Hsp-70 32.2 o0.005 D. medinensis 0.0 and platforms , underscoring the importance of comparing both Alix 30.2 0.006 C. elegans 1e 79 approaches. Overall the three replicates showed the same proﬁle Rab-11b 19.7 0.011 S. salar 1e 71 of miRNAs in each vesicle sample (Supplementary Table 2) and Rab-5 7.2 0.005 C. elegans 2e 205 neither vesicle nor supernatant contained intact large ribosomal Hsp-90 6.3 0.016 H. contortus 0.0 RNA (Supplementary Fig. 4). Northern blot analysis conﬁrmed Naming is based on best blast hit and P value based on n¼ 3. the speciﬁcity of small RNA biotypes in vesicles versus supernatant, showing miR-100 to be exclusively present in the vesicles and the Y RNA fragment to be exclusively present in Nematode RNAs are protected from degradation by exosomes. the supernatant (Fig. 4b). Notably, on the same blot To determine which RNAs identiﬁed in the total secretion pro- the full-length Y RNA was detected in the vesicles and both duct (Fig. 1) are speciﬁcally associated with vesicles, small RNA the miRNA and full-length Y RNA were largely resistant to sequencing of replicate vesicle and nonvesicle (supernatant) degradation by RNases in untreated samples but became fractions of the secretion product was carried out. Results from susceptible in the presence of Triton-X-100 (Fig. 4c). Together, 4 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. 1 μm 0.5 μm P value NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Vesicle Supernatant – + ––++ – + RNase A-T1 LS V –– ++ – – ++ Triton-X Supernatant Vesicle Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 40 30 MicroRNA miR-100 rRNA miR-100 Y RNA fragment tRNA LS V Y RNA 3p Rfam other 150 20 Uncharacterized ** 40 50 0 Y RNA 5p Y RNA 5p Figure 4 | Secreted miRNAs are protected from degradation through encapsulation within exosomes. (a) Classiﬁcation of H. polygyrus small RNAs in the secretion product following ultracentrifugation. (b) Northern blot analysis of RNA extracted from ultracentrifuge pellet or supernatant (from equivalent 10mg protein) using probes complementary to H. polygyrus miR-100 or the 5 arm of nematode Y RNA; * indicates the processed Y RNA and ** indicates the full length Y RNA. (c) Northern blot of RNA extracted from the pelleted secretion product following RNase treatment (0.5 Unit RNace- IT, 1 h at 37 C) in the presence or absence of 0.05% Triton-X-100. 15 80 25 **** ** **** ** ** **** 0 0 0 PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt N.S. 40 6,000 **** N.S. *** 4,000 2,000 0 0 PBS PBS PBS Alt Exo Alt PBS PBS PBS Alt Exo Alt Figure 5 | H. polygyrus exosomes suppress a Type 2 innate immune response in vivo. H. polygyrus exosomes (10mg) were administered intranasally to BALB/c mice 24 h before administration of 50mg Alternaria extract and a further 5mg exosomes, or controls that received PBS. (a) Siglecf CD11c þ þ eosinophils in the bronchoalveolar lavage; (b) IL-5 and (c) IL-13 expression in PMA/ionomycin-stimulated lineage-negative, ICOS ST2 group 2 innate lymphoid cells in digested lung tissue were measured 24 h after Alternaria extract administration; (d) Gr1þ CD11bþ neutrophils in the same lavage samples; (e) the mean ﬂuorescence intensity (MFI) of ST2 (IL33R) staining in ILCs from each group of mice. Data are representative of two independent experiments, n¼ 4–6 per group; error bars are mean s.e.m. Data analysed by ANOVA and Tukey’s post test, ****Po0.0001, ***Po0.001, **Po0.01, *Po0.05. these results demonstrate that mature miRNAs and full-length Y administration led to a sharp reduction in bronchoalveolar RNAs are secreted by a parasitic nematode and are protected lavage eosinophilia (Fig. 5a), and suppressed expression of the through encapsulation within vesicles of intestinal origin that Type 2 cytokines interleukin (IL)-5 and IL-13 by innate lymphoid share similar size and protein composition to mammalian cells (ILCs; Fig. 5b,c). Neutrophilia, which does not depend on exosomes. Type 2 cytokines, was undiminished by exosome administration (Fig. 5d). Intriguingly, the overall expression of the IL-33 receptor (also known as ST2) was also suppressed in recipients of H. polygyrus exosomes suppress innate immunity in vivo. exosomes (Fig. 5e). Helminths are well known to suppress pathogenic immune responses in both the gastrointestinal tract and airways .To examine the functionality of the parasite-derived exosomes Internalization of nematode exosomes and RNAs by mouse in vivo, they were administered intranasally in combination cells. To determine whether the nematode-derived exosomes can with extracts of the allergenic fungus Alternaria, which induces enter mammalian cells, uptake was examined in mouse small rapid IL-33 release as part of the Type 2 Th2-like innate immune intestinal epithelial cells, a cell type that is naturally in direct response that leads to lung eosinophilia . Pre-treatment contact with H. polygrus in vivo. Exosomes were labelled with the with parasite-derived exosomes before Alternaria extract lipid dye PKH67 and incubated with MODE-K cells in vitro. NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 5 & 2014 Macmillan Publishers Limited. All rights reserved. Siglecf+CD11c- cell numbers (×104) + + – GR1 CD11b CD11c Siglecf cell numbers (×10 ) IL-5 % of + + – ICOS ST2 lineage ST2 MFI + + – in ICOS ST2 lineage IL-13 % of + + – ICOS ST2 lineage ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 1.5 Bantam – + Exo miR-71 miR-8/200 37 C Y RNA miR-16 1.0 miR-16 8.0 μM 0.5 4 C Figure 6 | H. polygyrus exosomes and RNAs are internalized by mouse cells. (a) Confocal analysis of murine epithelial cells incubated for 1 h with PKH67-labelled H. polygyrus exosomes at 37 and 4 C, scale indicates 8.0mM. (b) Relative expression of parasite-derived miRNAs in murine epithelial cells at 20 h post incubation with 5mg H. polygyrus exosomes following PBS washes. Signal observed in untreated host cells represents the background detection of the probe; for parasite-derived miRNA, the data are normalized to the input detection level of miRNAs in 5mg of exosomes, whereas miR-16 levels in exosome-treated cells are normalized to untreated cells. (c) Northern blot analysis of RNA extracted from murine epithelial cells following 20 h incubation with H. polygyrus exosomes (5mg total protein) compared with untreated cells following PBS washes, using a probe against the loop of the nematode Y RNA or mouse miR-16. Uptake was analysed by ﬂuorescence-activated cell sorting examined whether the parasite miRNAs could suppress transla- (FACS) and confocal microscopy. Over 60% of the cells were tion of a reporter vector containing the 3 -UTR of Dusp1 fused to PKH67-positive after 1 h of incubation with H. polygyrus vesicles luciferase. Synthetic parasite miRNAs were transfected into compared with 1.5% when incubated with background dye MODE-K cells, resulting in 1.2- to 2.0-fold reduction in luciferase (Supplementary Fig. 5). These results are unlikely to be due to levels for the Dusp1 reporter but not control (Fig. 7c). Notably, nonspeciﬁc association with the cell membrane as treatment with transfection of a cocktail of three of the miRNAs (at the same trypsin did not eliminate the signal (Supplementary Fig. 5). total RNA concentration) resulted in an increased reduction in Confocal analysis conﬁrmed uptake to the cytoplasm and luciferase activity (3.1-fold). This is consistent with enhanced demonstrates that this requires physiological temperature repressive effects of miRNA sites in close proximity and suggests (Fig. 6a). qRT–PCR analysis of the treated cells detects the that secreted parasite miRNAs could work in cooperation to exert parasite-speciﬁc miRNAs in cells after 20 h of incubation, with no maximal effects on host genes. In contrast, the 3 -UTR of the change in the endogenous miR-16 (Fig. 6b). The full-length IL33R-encoding gene Il1lr1 is not conserved and, although parasite-derived Y RNA could also be detected by northern blot binding sites for some of the secreted miRNAs were identiﬁed, analysis in cells which were treated directly with exosomes fol- we did not observe repression of a Il1rl1 3 -UTR reporter by lowed by washing (Fig. 6c). transfection of miR-71, which contained two 7mer sites (Fig. 7c and Supplementary Fig. 6). Regulation of mouse genes by nematode exosomes. To deter- Circulating nematode miRNAs in serum. To establish whether mine the function of these vesicles in mouse cells, gene expression the secreted nematode miRNAs naturally circulate in host tissues analyses were carried out on MODE-K cells following incubation in vivo, we examined serum from mice infected with H. polygyrus with H. polygyrus exosomes. A total of 128 genes were differen- (which resides in the gut lumen) or the ﬁlarial nematode tially expressed upon treatment (false discovery rate (FDR) L. sigmodontis (which resides in the pleural cavity). No Po0.05). Relatively subtle changes in gene expression were H. polygyrus miRNAs were detected in the serum; however, a observed (Fig. 7a); however, the most strongly downregulated total of 1,188 reads mapped perfectly and unambiguously to the gene was Dusp1 (also known as MKP-1 in human), a key reg- L. sigmodontis draft genome and 761 of these derived from ulator of MAPK signalling associated with dampening the type 1 16 nematode miRNAs (Table 2 and Supplementary Table 3). pro-inﬂammatory reaction to Toll like receptor (TLR) ligands. Although we cannot rule out the possibility that some of the Another gene signiﬁcantly downregulated by exosomes is Il1rl1 miRNAs in serum could derive from dying worms, the most (also known as IL33R in human and so referred to here as Il33r), abundant miRNAs detected are homologues of those found in H. the ligand-speciﬁc subunit of the receptor for IL-33, a key alarmin polygyrus exosomes, including miR-100, bantam, miR-71 and cytokine required for protection against multicellular parasites, miR-263 (Table 2, Fig. 8). These data conﬁrm the in vivo secre- which is produced by innate cells to drive early type 2 immune tion of parasite miRNAs and are consistent with the idea that responsiveness and is suppressed by the exosomes in ILCs exosomes and associated RNAs operate locally in the host’s body in vivo (Fig. 5e). The effects of the exosomes on Dusp1 and Il33r such that their detection in body ﬂuids will be dictated by the life were validated by RT–qPCR and are unlikely to reﬂect a stage and localization of the parasite in the host. nonspeciﬁc response to vesicle uptake as exosomes derived from mouse intestinal cells showed similar uptake but did not alter Dusp1 and Il33r levels (Fig. 7b and Supplementary Fig. 5). Discussion There are a number of potential mechanisms that could In summary, we have shown that nematode parasite-derived mediate the decrease in Dusp1 and Il33r levels. The 3 untranslated miRNAs and Y RNAs are transported into mammalian host cells region (UTR) of Dusp1 is highly conserved and contains 7mer via exosomes that regulate host genes associated with immunity binding sites for the parasite homologues of mouse miR-200 (aka and inﬂammation and suppress an innate Type 2 response miR-8) and let-7 as well as a 6mer site for miR-425 (aka miR-63) in vivo. Extracellular vesicles are emerging as a central in between these sites (Supplementary Fig. 6). We therefore mechanism for cell-to-cell signalling within mammalian systems, 6 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. Relative expression Input Cells Cells + exo Input Cells Cells + exo Input Cells Cells + exo Input Cells Cells + exo NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE and our report of their secretion by a nematode species is within Dusp1 FDR < 5% and FC > ± 30% the setting of vesicle secretion by an increasingly diverse range of −7 1 × 10 FDR < 5% 24–26 pathogens . We have demonstrated for the ﬁrst time that Other Akr1c18 nematode-derived RNAs are a key component within exosomes −6 1 × 10 that can be transferred to host cells. Nematodes are ubiquitous Nupr1 Mrps21 pathogens of both plants and animals and we anticipate that RNA −5 1 × 10 secretion is a conserved phenomenon, supported by the fact that Tomm7 Dgcr6 we detect miRNAs from the ﬁlarial nematode L. sigmodontis in Anln −4 1 × 10 LOC100048530 host tissue, consistent with a recent report . In fact, RNA Prpf19 Il33R secretion may be a ubiquitous feature across a range of parasites; −3 LOC666559 1 × 10 an initial report suggests that miRNAs are also associated with vesicles in the trematode Dicrocoelium dendriticum . −2 1 × 10 Given that many of the nematode miRNAs are homologues to mouse miRNAs, it is tempting to speculate that these could tap −1 1 × 10 into existing miRNA regulatory networks in host cells. In support of this, we show with a reporter assay that three of the secreted nematode miRNAs that have identical seed sites to mouse 0.7 1 1.3 miRNAs can together downregulate DUSP1 through conserved Exosome versus medium fold−change sites in its 3 UTR. Many questions remain, however, regarding the mechanism by which the nematode miRNAs can operate in Dusp1 Il33r host cells. The exosome is a functional ensemble and immune suppression is likely to require a combination of protein and *** *** miRNAs for fusion and gene regulation. It will be challenging, 1 therefore, to pin point the individual contributions of each. For example, a nematode Ago protein is secreted with the miRNAs that may be required for functionality. This Ago belongs to the 0.5 0.5 WAGO clade of Agos that evolved in the nematode lineage. The WAGOs mediate diverse RNA interference mechanisms in nematodes and can operate at epigenetic, transcriptional and post-transcriptional levels ; it is intriguing to now consider how these possibilities could extend to their hosts. Psicheck Dusp1 Il33r 2.0 An exciting ﬁnding in this study is the fact that the exosomes *** can suppress an innate Type 2 response in vivo, identifying *** vesicles as another class of immunomodulator used by the *** parasite and opening the door to further exploitation of exosomes *** 1.0 in a therapeutic context. Our previous work has shown that H. polygyrus-secreted material suppresses IL-33 release and it is likely that a combination of soluble proteins and exosomes together suppress this important pathway . From analyses 0.5 in vitro we identify Il33r and Dusp1 as host genes directly suppressed by the exosomes. Although DUSP1 has been broadly viewed as an attenuator of immune activation, it is known to preferentially downregulate IL-6 that has recently been shown to 0.25 promote susceptibility to H. polygyrus , while upregulating IL-10, which acts as a broadly immunosuppressive cytokine . Hence, parasite survival is likely to be favoured by reduced DUSP1 levels. Further, DUSP1/MKP-1 dampens the acute inﬂammatory response to lipopolysaccharide, promoting macrophage arginase expression over nitric oxide synthase . Hence, parasite repression of DUSP1 could block the induction of arginase, a known mediator of killing of H. polygyrus in the mouse . These possibilities are now being investigated in our Figure 7 | Mouse Il33r and Dusp1 are suppressed by H. polygyrus laboratories. Our reporter assays suggest that Dusp1 could be exosomes and the secreted miRNA repress target sites in Dusp1. directly targeted by the parasite miRNAs; however, we do not (a) Volcano plot of mouse genes up- or downregulated upon incubation observe repression of Il33r when transfecting the parasite with H. polygyrus-derived exosomes; red¼ FDR Po0.05 and FC430%. miRNA, miR-71, that is predicted to target its 3 UTR. It may (b) Levels of Dusp1 and Il1rl1 in mouse epithelial cells (5 10 ) following be that additional parasite-derived RNAs or proteins could 48 h treatment with 5mg H. polygyrus exosomes or MODE-K-derived regulate Il33r expression, or that the effect operates indirectly exosomes, n ¼ 8, error bars are mean s.e.m. Data analysed by ANOVA through a separate target gene. For example, reduced expression and Tukey’s post test, *Po0.05, **Po0.01, ***Po0.005, ****Po0.001. of Dusp1 or other regulators of MAPK signalling could result in (c) Repression of Psicheck reporter vector containing Dusp1 or Il1rl1 3 UTRs GATA-2 phosphorylation, which might inhibit its ability to fused to Renilla luciferase by co-transfection with individual or pooled 33,34 promote Il33r transcription . synthetic H. polygyrus miRNAs (50 nM), data represent renilla/luciferase Finally, our work has revealed not only secreted miRNAs that ratios, normalized to the values obtained for untreated samples; n¼ 3, are packaged in exosomes but also full-length Y RNAs that are ***Po0.005, *Po0.05. transferred to host cells at an abundance level detectable by northern blot analysis. Y RNAs are not known to function in gene NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 7 & 2014 Macmillan Publishers Limited. All rights reserved. Untreated + Mouse exo + Hp exo Untreated + Mouse exo + Hp exo P value Relative repression Relative expression Let-7 + miR-200 Let-7 + miR-200 + miR-425 Relative expression Let-7 + miR-200 + miR-425 miR-71 Untreated Neg control Let-7 miR-200 miR-425 Untreated Neg control Let-7 miR-200 miR-425 Let-7 + miR-200 Untreated Neg control ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 H. polygyrus miRNAs L. sigmodontis miRNAs Table 2 | Litomosoides sigmodontis-derived miRNAs found in (In vitro secretion) (in host serum) mouse serum. Name Mature sequence Number of miR-83/29 reads miR-60 miR-63/425 (infected) miR-86 miR-79/9 miR-100a UACCCGUAGCUCCGAAUAUGUGU 479 miR-100 miR-50 miR-239 miR-86 UAAGUGAAUGCUUUGCCACAGUCU 57 Bantam miR-34 miR-7 Bantam-a UGAGAUCAUUGUGAAAGCUAUU 45 miR-71 miR-153 miR-77 Bantam-b UGAGAUCACGUUACAUCCGCCU 45 mir-263 miR-2 miR-240/193 miR-87 miR-5866 miR-100b AACCCGUAGUUUCGAACAUGUGU 40 miR-57/10 miR-8/200 miR-71 UGAAAGACAUGGGUAGUGAGACG 32 lin-4/125 miR-100c AACCCGUAGAAUUGAAAUCGUGU 22 miR-5884 miR-50-5p UGAUAUGUCUGAUAUUCUUGGGUU 10 miR-44 miR-34-5p UGGCAGUGUGGUUAGCUGGUUGU 8 miR-263/183 AAUGGCACUAGAUGAAUUCACGG 7 Bantam-c UGAGAUCAUGCCACAUCCGUCU 4 Figure 8 | Venn Diagram of overlap in miRNAs identiﬁed in H. polygyrus miR-50-3p CCAGCAUCUCAGACGUAUCGGC 3 miR-153 UUGCAUAGUCACAAAAGUGAUG 3 secretion product or serum of mice infected with L. sigmodontis. miR-87-5p CGCCUGGGACUUCGACUCAACCU 2 The H. polygyrus miRNAs for comparison are taken from Supplementary miR-2 UAUCACAGCCAGCUUUGAUGU 2 Table 1 (top 20 most abundant in at least one platform). The miRNAs miR-5866 UUACCAUGUUGAUCGAUCUCC 2 that are perfectly conserved between nematodes and mice are excluded, since the origin in serum cannot be deduced. miRNA, micro RNA. miRNAs that map exclusively to the L. sigmodontis but not mouse genome, which were identiﬁed in the sera of mice infected with L. sigmodontis (40 infective larvae were injected subcutaneously structures consistent with miRNA precursors (according to prediction programmes and allowed to migrate to the pleural cavity where they developed naturally for 60 days). The detailed below). Reads matching the genome were aligned to a set of RNA lettering of miR-100 and bantam family members is arbitrary. sequences consisting of known H. polygyrus 18S, 28S and 5.8S rRNA sequences (Genbank AJ920355.1, AM039747.1 and DQ408618.1:527-678), 5S rRNA from a closely related species (Trichostrongylus colubriformis, Genbank U32119.1) and silencing but were recently shown to be packaged into exosomes Rfam sequences (version 10, obtained from ftp://ftp.sanger.ac.uk/pub/databases/ secreted from dendritic cells and play roles in RNA quality Rfam/10.0/Rfam.fasta.gz). The best hit with at most two edits was used to classify control and DNA replication in humans . Further work is the reads. Any reads that matched an rRNA or non-microRNA Rfam family were ﬁltered before miRNA analysis. The analysis of piRNAs was carried out with reads required to understand whether and how each of these classes of that did not match known Rfam classes or miRNAs; initial identiﬁcation was based secreted parasite RNA can contribute to the capacity of this on the presence of a ‘GUUUCA’ between 35 and 65 nt upstream of the 5 RNA parasite to manipulate its environment within the host. alignment start site . Inspection of the distribution plot identiﬁed the region 42–45 nt upstream of the 5 RNA alignment start site as being the key area for subsequent analyses (Supplementary Fig. 1). Methods Two miRNA prediction programmes were used to identify miRNAs in the data Puriﬁcation of vesicles from secretion product. For collection of H. polygyrus sets: miRDeep2 (ref. 40) and mireap (http://sourceforge.net/projects/mireap/). Both secretion product, CF1 mice are infected with infective-stage larvae by gavage and programmes use miRNA biogenesis to model the expected alignment of sRNA adult parasites collected from the small intestine 14 days post infection. The worms reads to a potential miRNA precursor. For miRDeep2, the following default are maintained in serum-free media in vitro as described elsewhere ; secretion settings were used: (a) requirement that reads match the genome perfectly, product is collected every 3 days for a maximum of 3 weeks (samples used here (b) removal of reads that match to more than ﬁve places in the genome and were from the ﬁrst week of collection) and puriﬁed as follows: eggs are removed by (c) cutoff -v 1, (d) the ‘-s option’ was employed, using all mature sequences spinning at 400 g before ﬁltering of the secretion through 0.2-mm ﬁlter (Millipore). from mirbase (version 19). The default settings of minimum free energy Filtered media is then processed following a modiﬁed protocol from that described 1 (o 20 kcal mol ) and read length (18–30) were employed. In both in ref. 38, by being spun at 100,000 g for 2 h in polyallomer tubes at 4 C in a SW40 programmes, precursor predictions with fewer than 10 reads were discarded. rotor (Beckman Coulter). Pelleted material is washed two times in ﬁltered PBS at Where multiple precursor loci predicted identical mature miRNAs, only the 100,000 g for 2 h. The supernatant is concentrated using Vivaspin 6 5000 MWCO precursor with the largest number of matching reads was reported. tubes (Fisher) at 5,000 g and washed two times with PBS. pCp end labelling and northern blot. For 3 end-labelling, total RNA was Small RNA library preparation and analysis. For the analysis of small RNAs in extracted from the life stages and secretion product using the miRNAeasy kit the life stages and total secretion products, total RNA was size-selected on 15% (Qiagen): 1mg total RNA was used from life stages and RNA extracted from a denaturing PAGE and libraries prepared from the 18 to 30 nt fraction using volume of secretion product equating to 15mg protein (the total RNA concentra- Illumina Small RNA preparation kit version 1.5 and sequenced on an Illumina tion was too low to detect by nanodrop or qubit). The 3 -end labelling was carried GAIIX instrument in Edinburgh Genomics (http://genomics.ed.ac.uk/). To identify out at 4 C overnight in 10ml using RNA ligase I (NEB) according to the manu- larger RNAs in the secretion product, separate libraries were also prepared for RNA facturer’s instructions with 3,000 Ci mmol P PcP (Perkin Elmer). Reactions size selected between 60 and 100 nt and sequenced in parallel. For analysis of were quenched by the addition of 2 loading buffer (8 M urea, 0.5% TBE) and 4ml vesicle and nonvesicle fractions, small RNA libraries were prepared using the run on an 18% PAGE at 350 V for 8 h, which was then visualized by phosphor- TruSeq kit and sequenced on MiSeq platforms, without prior size fractionation of imaging using a Typhoon Scanner (GE Healthcare). For northern blot analysis, the RNA. All libraries were analysed by ﬁrst clipping the 3 sRNA adapter using total RNA was extracted from volumes of vesicle and nonvesicle fractions that cutadapt, searching for at least a six-base match to the adapter sequence. For contained equivalent protein (10mg) and then separated by denaturing 15% PAGE, analysis of small RNAs only reads that contained the adapter were 16–40 nt in transferred to Hybond-N þ membrane (GE Healthcare) and chemically cross- length and were present at more than two copies were retained for further analysis. linked as described previously . Blots were prehybridized in PerfectHyb (Sigma) For analysis of RNAs 460 nt in the secretion product, sequences present at 4100 for 1 h at 42 C before overnight incubation with DNA probes (Invitrogen) that reads in the library (out of 490,614 reads sequenced) were aligned in Clustalw and were perfectly complementary to the miRNA or Y RNA: miR-100: 5 -ACACAA 0 0 manually inspected for sbRNA (Y RNA) content in terms of secondary structure GTTCGGATCTACGGGTT-3 , YRNA-5P: 5 -ACCCTACGACTCCGGACCA and location of a UUAUC motif in the terminal loop as described in (Fig. 1c and AGCGCG-3 , YRNA-3P: 5p-GCGCCGGTCGAGCTTTTGTCGAAGGGAAT-3p, Supplementary Fig. 2). The Y fragments in the small RNA libraries (o40 nt) were Y RNA-loop: 5p-AAGGGAATTCGAGACATTGTTGATAAC-3p. The probes then identiﬁed based on criteria that they aligned to these full-length Y RNAs. were labelled with T4 PNK (NEB) and 6,000 Ci mmol P ATP (Perkin Elmer) The draft genome assembly for H. polygyrus was created with the CLC de novo according to the manufacturers’ protocols. assembler using two lanes of Illumina GAII data with 50 bp paired-end and 100 bp paired-end reads from Edinburgh Genomics (http://genomics/ed.ac.uk/); the raw and assembled data are available at http://heligmosomoides.nematod.es/. This miRNA RT–qPCR. Analysis of miRNA levels in ultracentrifugation fractions was version was used to map the sequences around small RNA reads to identify carried out using the miScript system (Qiagen) with unmodiﬁed DNA probes 8 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE identical to the full-length parasite miRNA (Life Sciences): miR-100: 5 -AACCCG every 4 weeks. On the day of the experiment, cells were seeded in 24-well plates 0 0 0 5 TAGATCCGAACTTGTGT-3 ,miR-71: 5 -TGAAAGACATGGGTAGTGAGAC-3 , (1 10 cells per well) using advanced DMEM serum-free medium (Invitrogen) 0 0 0 let-7: 5 -TGAGGTAGTAGGTTGTATAGTT-3 and miR-60: 5 -TATTATGC supplemented with 1% L-glutamine and subsequently incubated (1 h at 37 C) ACATTTTCTGGTTCA-3 . For analysis of parasite-derived miRNA levels in host either in the presence of PKH67-labelled H. polygyrus-derived exosomes (5mgof cells, qRT–PCR was carried out using the miRCURY LNA microRNA PCR system total protein) or in the presence of the probe alone. After incubation, cells were (Exiqon) and LNA probes were custom-designed by Exiqon to minimize cross harvested, washed twice in FACS buffer (PBS 1 , 2.5% FBS, 0.1% BSA, 0.05% hybridization with mouse sequences, and efﬁciency of probes was measured NaN ) and ﬁnally resuspended in 500ml of the same buffer. A subset of the samples between 90 and 100% (data not shown). Analysis of mouse gene expression levels were then incubated with 50 ul of 0.25% Trypsin/EDTA (Gibco) for 5 min before was carried out using the Sybr green I master mix (Roche), with the following analysis (indicated in Supplementary Fig. 5). Samples were analysed using the BD 0 0 0 primers: gapdh_F: 5 -CATGGCCTTCCGTGTTCCTA-3 , gapdh_R: 5 -GCGGCA FACS Canto II ﬂow cytometer (BD Bioscience). Data ﬁles were acquired from the 0 0 0 CGTCAGATCCA-3 Dusp1_F: 5 -GTGCCTGACAGTGCAGAATC-3 , Dusp1_R: cytometer, with 5,000 events collected for each tube and the data analysis was 0 0 0 5 -CACTGCCCAGGTACAGGAAG-3 , Il33R_F: 5 -AGACCTGTTACCTGGGC performed using the FlowJo software (Tree Star Inc.). For confocal analyses, 0 0 0 AAG-3 , Il33R_R: 5 -CACCTGTCTTCTGCTATTCTGG-3 . Data were collected MODE-K cells were seeded on round microscope cover glasses in 24-well plates on a Light Cycler 480 System (Roche) following temperature proﬁles recom- (2.5 10 cells per well) in media described above. Cells were allowed to attach on mended by each manufacturer. The delta C method was used for quantiﬁcation as to the coverslips overnight and the following day shifted to advanced DMEM described in ref. 11 using GAPDH as the normalizer. Data were analysed using medium supplemented with 1% L-glutamine. Cells were incubated (1 h at 37 or one-way analysis of variance (ANOVA) followed by Tukey’s post test and variance 4 C) either in the presence of labelled exosomes or probe only. After incubation, within groups assessed by Brown Forsythe test. medium was aspirated, cells were washed twice in PBS and ﬁxed with 4% PFA, with residual PFA quenched with 50 mM glycine. Slide coverslips were washed extensively in PBS, and nuclei were stained with 4 ,6-diamidino-2-phenylindole- LC-MS/MS. Five micrograms of total protein from the secretion product ultra- supplemented ProLong Fade Gold (Invitrogen) mounting media. Samples were centrifuge pellet or supernatant were loaded on a 12% Tris-Bis NuPAGE gel examined on the Leica SP5 II (Leica Microsystems, lasers exciting at 405 and 488, (Invitrogen) and electrophoresis carried out for 5 min before in-gel digestion as 63 objective) using the LAS AP software (Leica). Images were analysed using the described in ref. 42. Capillary-HPLC-MS/MS analysis was performed using an Volocity software (Improvision). online system consisting of a micropump (1,200 binary HPLC system, Agilent, UK) coupled to a hybrid LTQ-Orbitrap XL instrument (ThermoFisher, UK). Data were searched using MASCOT Versions 2.4 (Matrix Science Ltd, UK) against an in- Microarray analysis. MODE-K cells were grown in DMEM media as described house H. polygyrus transcriptome assembly of 454 sequences using a maximum above and seeded into 24-well plates at 20,000 cells per well. The following day, missed-cut value of 2. Variable methionine oxidation and ﬁxed cysteine cells were incubated with H. polygyrus-derived exosomes (5mg total protein per carbamidomethylation were used in all searches; precursor mass tolerance was set well) for 20 h before washing twice with PBS and total RNA extracted. RNA was to 7 p.p.m. and MS/MS tolerance to 0.4 a.m.u. The signiﬁcance threshold (p)was prepared for microarray analysis using the Illumina TotalPrep RNA Ampliﬁcation set below 0.05 (MudPIT scoring). A peptide Mascot score threshold of 20 was used kit and run on MouseWG-6 v2.0 (Illumina) at the Wellcome Trust Clinical in the ﬁnal analysis, which corresponds to a global FDR of 4.6% using a decoy Research Facility (University of Edinburgh). The raw SampleProbeProﬁle ﬁle database search. LC-MS label-free quantitation was performed using Progenesis was processed within R, using ‘lumi’ and ‘lumiMouseAll.db’ Bioconductor 42 46–48 (Nonlinear Dynamics, UK) as described elsewhere where the total number of packages . Quality control was performed using Multi-Dimensional Scaling, Features (that is, intensity signal at a given retention time and m/z) was reduced to and one of the control samples that behaved as an outlier was removed. Raw MS/MS peaks with the charge of 2, 3 or 4þ and we only kept the ﬁve most intense expression values were processed with the Variance Stabilizing Transformation and MS/MS spectra per ‘Feature’. The subset of multicharged ions (2 þ,3þ and 4 þ ) the Robust Spline Normalization . An InterQuartile Range was calculated across was extracted from each LC-MS run. For a speciﬁc protein, the associated unique all samples for each probe, and used to select the most variable probe of those that peptide ions were summed to generate an abundance value that was transformed mapped to the same transcript. Probes without a gene or transcript annotation using an ArcSinH function required for the calculation of the P value. A total of were excluded, leaving a total of 30,708 nonredundant annotated probes. 362 proteins were identiﬁed in either the supernatant or pellet based on Differential expression was performed using the ‘limma’ package , ﬁtting a linear requirement of at least two peptides present; of these, 122 were enriched in the model for each probe and using an empirical Bayes method to obtain moderated supernatant and 139 in the pellet, while the remaining 101 did not show t-statistics. In order to reduce the multiple-test problem and focus on the most statistically signiﬁcant enrichment and were detectable in both samples. The interesting genes, ‘present’ probes with an Illumina detection P value o0.05 in at within-group means were calculated to determine the fold change and the least three samples were selected, leaving 12,276. The Benjamini and Hochberg transformed data were then used to calculate the P values using one-way ANOVA. method was used to calculate FDRs . Differentially expressed proteins were considered meaningful under the following conditions: detected by two or more peptides, with an absolute ratio of at least 1.5 In vivo analysis of exosome function in Alternaria model. BALB/c mice were and Po0.05 associated with the protein change. Classiﬁcation of intestinal proteins bred in-house at the University of Edinburgh and accommodated according to is based on homology to proteins identiﬁed in other nematodes, described in ref. 44. Home Ofﬁce regulations. Female mice were used when they were 6–10 weeks old. For all experiments presented in this study, the sample size was large enough to TEM. For visualization of the vesicles, the puriﬁed ultracentrifuged pellet from measure the effect size. No randomization and no blinding were performed in this H. polygyrus secretion product (100mgml protein concentration) was ﬁxed in study. H. polygyrus exosomes (10mg) were administered intranasally (under iso- 2% paraformaldehyde (PFA), deposited on Formvar-carbon-coated EM grids and ﬂurane sedation) in 50ml PBS, or 50ml PBS alone to controls, 24 h before intranasal treated with glutaraldehyde before treatment with uranyl oxalate and methyl cel- administration of 50mg Alternaria extract with a further 5mg of exosomes. Mice lulose as described in ref. 38. For analysis of adult H. polygyrus parasites, samples were killed 24 h after Alternaria administration, and bronchoalveolar lavage and were washed with PBS before ﬁxation in 2.5% glutaraldehyde solution in 0.1 M lung cell suspensions stained for ﬂow cytometry as described previously . Brieﬂy, sodium cacodylate buffer overnight. Parasites were rinsed three times with 0.1 M cells were counted, then surface stained for Siglecf þ CD11c (eosinophils) or Na cacodylate buffer, and post-ﬁxed in 1% osmium tetroxide for 1 h. After rinsing stimulated with phorbol myristate acetate (PMA) and ionomycin for 4 h in the in 0.1 M Na cacodylate buffer, they were sequentially dehydrated in a graded presence of BrefeldinA and surface stained as negative for lineage markers acetone series. Finally, samples were sequentially incubated for 30 min in an (CD3/CD4/CD5/CD19/CD11b/CD11c/CD19/GR1) and positive for CD45, ICOS araldite:acetone solution left to evaporate overnight at 60 C and then embedded in and ST2 (ILC2s), and assessed for staining of IL-5 and IL-13. Samples were fresh araldite resin and polymerized at 60 C for 48 h. Ultrathin sections, 60-nm acquired on a Becton-Dickinson LSRII ﬂow cytometer. thick, were cut from selected areas, stained in uranyl acetate and lead citrate, and Data were analysed using Prism 6 (Graphpad Prism, La Jolla, CA, USA). then viewed in a Philips CM120 TEM. Images were taken on a Gatan Orius CCD Variance within groups was assessed by Brown Forsythe test and data were camera. log-transformed and analysed by one-way ANOVA, with a Tukey’s multiple comparisons post test. Unless otherwise indicated, differences are not signiﬁcant. ****Po0.0001, ***Po0.001, **Po0.01, *Po0.05, N.S. not signiﬁcant P40.05. Flow cytometry and confocal analyses of uptake. Puriﬁed exosomes from H. polygyrus or MODE-K cells (measured as 5mg of total protein) were labelled with 2mg of PKH67 dye (Sigma) for 5 min at room temperature following the Luciferase assays. The 3 UTRs of Dusp1 and Il33r were cloned behind Renilla manufacturer’s protocol. The staining reaction was stopped by adding an equal luciferase in the Psicheck2 vector (Promega) at NotI and XhoI restriction sites as amount of 1% bovine serum albumin (BSA), and exosomes were washed in PBS described in ref. 41 using the following primers: Psi-Dusp_F: 5 -CTTTAC 0 0 and pelleted by ultracentrifugation (1 h at 100,000 g). A probe solution was pre- TCGAGAGGTGTGGAGTTTCACTTGC-3 , Psi-Dusp_R: 5 -CTTTAGCGGC 0 0 pared with the PKH67 following the same protocol but mixed with PBS solution in CGCAGCTACAAACCTACACTGGC-3 , Psi-Il33r_F: 5 -CTTTACTCGAGGA 45 0 0 the absence of exosomes. MODE-K cells were obtained from Dominique CTGTGTGTTGTAGCTTGG-3 , Psi-Il33r_R: 5 -CTTTAGCGGCCGCCAGA Kaiserlian (INSERM) and grown following the standard protocol in DMEM GGGAGGCTTTATAAGG-3 . (Invitrogen) medium supplemented with 10% fetal bovine serum (Invitrogen), 1% For reporter assays, 15,000 cells were reverse transfected into a 96-well plate penicillin–streptomycin (Lonza), 1% L-glutamine (Lonza), 1% non-essential amino with 0.3% lipofectamine (Invitrogen) and 50 ng of each Psicheck reporter in the acids/sodium pyruvate (Gibco). These were mycoplasma-free based on testing absence or presence of 50 nM synthetic miRNA mimic (Thermoﬁsher). Luciferase NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 9 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 measurements were carried out at 48 h post transfection, using the Dual Glo 21. Toedling, J. et al. Deep-sequencing protocols inﬂuence the results obtained in Luciferase assay system (Promega) and Luminensence measured on a Varioskan small-RNA sequencing. PLoS ONE 7, e32724 (2012). plate reader (Thermoﬁsher). Data shown in Fig. 7b represent n¼ 3 replicates 22. McSorley, H. J., Blair, N. F., Smith, K. A., McKenzie, A. N. & Maizels, R. M. (separate transfection experiments of the MODE-K cell line) measured in parallel Blockade of IL-33 release and suppression of type 2 innate lymphoid cell to control for consistent Renilla and Luciferase ratios using the same kit; data were responses by helminth secreted products in airway allergy. Mucosal Immunol. analysed by one-way ANOVA, with a Dunnett’s post test, ****Po0.0001, 7, 1068–1078 (2014). ***Po0.001, **Po0.01, *Po0.05. 23. Humphreys, N. E., Xu, D., Hepworth, M. R., Liew, F. Y. & Grencis, R. K. IL-33, a potent inducer of adaptive immunity to intestinal nematodes. J. Immunol. MicroRNA target prediction. A custom Perl script was used to identify seed- 180, 2443–2449 (2008). 24. Twu, O. et al. Trichomonas vaginalis exosomes deliver cargo to host cells and matching sites for the H. polygyrus miRNAs identiﬁed by sRNA-Seq. All the 3 UTR sequences corresponding to probes on the microarray were scanned, and the results mediate hostratioparasite interactions. PLoS Pathog. 9, e1003482 (2013). were passed to the TargetScan (v6.2) context scores Perl script. Targets for each 25. Silverman, J. M. et al. An exosome-based secretion pathway is responsible for miRNA were ranked by ‘Context þ Scores’. Conservation scores for relevant protein export from Leishmania and communication with macrophages. J. Cell 3 UTRs (Dusp1 and Il33r) were obtained from the UCSC Genome Browser, using Sci. 123, 842–852 (2010). 52,53 the ‘rtracklayer’ package to access the ‘phastCons60wayPlacental’ table . 26. Marcilla, A. et al. Extracellular vesicles from parasitic helminths contain speciﬁc excretory/secretory proteins and are internalized in intestinal host cells. PLoS ONE 7, e45974 (2012). Sequencing analysis of serum from infected mice. F1 mice were infected with 27. Bernal, D. et al. Surface analysis of Dicrocoelium dendriticum. The molecular H. polygyrus (400 L3 larvae introduced by oral gavage) and serum collected on day characterization of exosomes reveals the presence of miRNAs. J. Proteom. 105, 14 post infection. The presence of adult parasites was conﬁrmed by visual 232–241 (2014). inspection of the mouse gut lumen. Six-week-old BALB/c mice were infected with 28. Buck, A. H. & Blaxter, M. Functional diversiﬁcation of Argonautes in L. sigmodontis (subcutaneous inoculation of 40 L3), and gel-separated serum (BD nematodes: an expanding universe. Biochem. Soc. Trans. 41, 881–886 (2013). Microtainer) was collected by arterial exsanguination at 60 days post infection, 29. Smith, K. A. & Maizels, R. M. IL-6 controls susceptibility to helminth infection which was conﬁrmed by detection of adult worms in the mouse pleural cavity and by impeding Th2 responsiveness and altering the Treg phenotype in vivo. Eur. microﬁlarie in peripheral blood. For library preparation, 200ml of serum was J. Immunol. 44, 150–161 (2014). extracted with the miRNAeasy kit (Qiagen) and libraries generated following the 30. Hammer, M. et al. Dual speciﬁcity phosphatase 1 (DUSP1) regulates a subset of Trueseq protocol and sequenced on the Illumina Rapid HighSeq in Edinburgh LPS-induced genes and protects mice from lethal endotoxin shock. J. Exp. Med. Genomics. Data were processed as described above and analysed for perfect 203, 15–20 (2006). alignment to the mouse or L. sigmodontis genome (reads mapping to both genomes 31. Nelin, L. D. et al. MKP-1 switches arginine metabolism from nitric oxide were not analysed). Reads that aligned were then categorized by matches to Rfam synthase to arginase following endotoxin challenge. Am. J. Physiol. Cell Physiol. or prediction as miRNAs with miRdeep2, as described in ref. 11. 293, C632–C640 (2007). 32. Anthony, R. M. et al. Memory T(H)2 cells induce alternatively activated References macrophages to mediate protection against nematode parasites. Nat. Med. 12, 1. Blaxter, M. L. et al. A molecular evolutionary framework for the phylum 955–960 (2006). Nematoda. Nature 392, 71–75 (1998). 33. Baba, Y. et al. GATA2 is a critical transactivator for the human IL1RL1/ST2 2. Finney, C. A., Taylor, M. D., Wilson, M. S. & Maizels, R. M. Expansion and promoter in mast cells/basophils: opposing roles for GATA2 and GATA1 in activation of CD4( þ )CD25( þ ) regulatory T cells in Heligmosomoides human IL1RL1/ST2 gene expression. J. Biol. Chem. 287, 32689–32696 (2012). polygyrus infection. Eur. J. Immunol. 37, 1874–1886 (2007). 34. Towatari, M. et al. Regulation of GATA-2 phosphorylation by mitogen-activated 3. Mohrs, K., Harris, D. P., Lund, F. E. & Mohrs, M. Systemic dissemination and protein kinase and interleukin-3. J. Biol. Chem. 270, 4101–4107 (1995). persistence of Th2 and type 2 cells in response to infection with a strictly 35. Nolte-’t Hoen, E. N. et al. Deep sequencing of RNA from immune cell-derived enteric nematode parasite. J. Immunol. 175, 5306–5313 (2005). vesicles uncovers the selective incorporation of small non-coding RNA 4. Rausch, S. et al. Functional analysis of effector and regulatory T cells in a biotypes with potential regulatory functions. Nucleic Acids Res. 40, 9272–9285 parasitic nematode infection. Infect. Immun. 76, 1908–1919 (2008). (2012). 5. McSorley, H. J. & Maizels, R. M. Helminth infections and host immune 36. Nicolas, F. E., Hall, A. E., Csorba, T., Turnbull, C. & Dalmay, T. Biogenesis of regulation. Clin. Microbiol. Rev. 25, 585–608 (2012). Y RNA-derived small RNAs is independent of the microRNA pathway. FEBS 6. Grainger, J. R. et al. Helminth secretions induce de novo T cell Foxp3 Lett. 586, 1226–1230 (2012). expression and regulatory function through the TGF-beta pathway. J. Exp. Med. 37. Harcus, Y. et al. C-type lectins from the nematode parasites Heligmosomoides 207, 2331–2341 (2010). polygyrus and Nippostrongylus brasiliensis. Parasitol. Int. 58, 461–470 (2009). 7. Maizels, R. M. et al. Immune modulation and modulators in Heligmosomoides 38. Thery, C., Amigorena, S., Raposo, G. & Clayton, A. Current Protocols in Cell polygyrus infection. Exp. Parasitol. 132, 76–89 (2012). Biology Ch. 3 (eds Bonifacino J. S. et al.) 3.22.1–3.22.29 (John Wiley & Sons, 8. Turchinovich, A., Samatov, T. R., Tonevitsky, A. G. & Burwinkel, B. Circulating 2006). miRNAs: cell-cell communication function? Front. Genet. 4, 119 (2013). 39. Ruby, J. G. et al. Large-scale sequencing reveals 21U-RNAs and additional 9. Zhang, L. et al. Exogenous plant MIR168a speciﬁcally targets mammalian microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193–1207 (2006). LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Res. 22, 40. Friedlander, M. R., Mackowiak, S. D., Li, N., Chen, W. & Rajewsky, N. 107–126 (2012). miRDeep2 accurately identiﬁes known and hundreds of novel microRNA genes 10. Wang, K. et al. The complex exogenous RNA spectra in human plasma: an in seven animal clades. Nucleic Acids Res. 40, 37–52 (2012). interface with human gut biota? PLoS ONE 7, e51009 (2012). 41. Libri, V. et al. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as 11. Hoy, A. M. et al. Parasite-derived microRNAs in host serum as novel a target. Proc. Natl Acad. Sci. USA 109, 279–284 (2012). biomarkers of helminth infection. PLoS Negl. Trop. Dis. 8, e2701 (2014). 42. Le Bihan, T. et al. Shotgun proteomic analysis of the unicellular alga 12. Tritten, L. et al. Detection of circulating parasite-derived microRNAs in ﬁlarial Ostreococcus tauri. J. Proteom. 74, 2060–2070 (2011). infections. PLoS Negl. Trop. Dis. 8, e2971 (2014). 43. Hewitson, J. P. et al. Secretion of protective antigens by tissue-stage nematode 13. Hoy, A. M. & Buck, A. H. Extracellular small RNAs: what, where, why? larvae revealed by proteomic analysis and vaccination-induced sterile Biochem. Soc. Trans. 40, 886–890 (2012). immunity. PLoS Pathog. 9, e1003492 (2013). 14. Thery, C. et al. Proteomic analysis of dendritic cell-derived exosomes: a secreted 44. Yin, Y. et al. Intestinal transcriptomes of nematodes: comparison of the subcellular compartment distinct from apoptotic vesicles. J. Immunol. 166, parasites Ascaris suum and Haemonchus contortus with the free-living 7309–7318 (2001). Caenorhabditis elegans. PLoS Negl. Trop. Dis. 2, e269 (2008). 15. Baietti, M. F. et al. Syndecan-syntenin-ALIX regulates the biogenesis of 45. Vidal, K., Grosjean, I., evillard, J. P., Gespach, C. & Kaiserlian, D. exosomes. Nat. Cell Biol. 14, 677–685 (2012). Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. 16. Boria, I. et al. Nematode sbRNAs: homologs of vertebrate Y RNAs. J. Mol. Evol. Phenotypic and immune characterization of the MODE-K cell line. J. Immunol. 70, 346–358 (2010). Methods 166, 63–73 (1993). 17. Alvarez-Saavedra, E. & Horvitz, H. R. Many families of C. elegans microRNAs 46. Team, R.D.C. A language and environment for statistical computing http:// are not essential for development or viability. Curr. Biol. 20, 367–373 (2010). www.r-project.org (2010). 18. Tarver, J. E. et al. miRNAs: small genes with big potential in metazoan 47. Gentleman, R. C. et al. Bioconductor: open software development for phylogenetics. Mol. Biol. Evol. 30, 2369–2382 (2013). computational biology and bioinformatics. Genome Biol. 5, R80 (2004). 19. Mathivanan, S. & Simpson, R. J. ExoCarta: a compendium of exosomal proteins 48. Du, P., Kibbe, W. A. & Lin, S. M. lumi: a pipeline for processing Illumina and RNA. Proteomics 9, 4997–5000 (2009). microarray. Bioinformatics 24, 1547–1548 (2008). 49. Lin, S. M., Du, P., Huber, W. & Kibbe, W. A. Model-based variance-stabilizing 20. Hewitson, J. P. et al. Proteomic analysis of secretory products from the model transformation for Illumina microarray data. Nucleic Acids Res. 36, e11 gastrointestinal nematode Heligmosomoides polygyrus reveals dominance of venom allergen-like (VAL) proteins. J. Proteom. 74, 1573–1594 (2011). (2008). 10 NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6488 ARTICLE Y.H. generated worm and secretion samples; A.C. supported uptake and reporter 50. Smyth, G. K. Linear models and empirical bayes methods for assessing assays; M.B. oversaw genome assembly and phylogenetic analyses of AGO protein; differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. S.A.B. performed the L. sigmodontis infections and tissue sampling; A.I. analysed 3, Article3 (2004). small RNAseq data; R.M.M. supplied H. polygyrus life stage material, contributed to 51. Benjamini, Y. & Y., Hochberg Controlling the false discovery rate: a practical analysis of proteomic data, co-designed immunological experiments and edited and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 57, the manuscript. 289–300 (1995). 52. Karolchik, D. et al. The UCSC genome browser database: 2014 update. Nucleic Acids Res. 42, D764–D770 (2014). Additional information 53. Lawrence, M., Gentleman, R. & Carey, V. rtracklayer: an R package for Accession codes: The sequencing and microarray data from this study have been interfacing with genome browsers. Bioinformatics 25, 1841–1842 (2009). deposited in Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession codes GSE55978 and GSE55941. The novel miRNA sequences identiﬁed in this study have been deposited in miRBase and the ofﬁcial naming is provided in Supple- Acknowledgements mentary Data 1. The genomic information for H. polygyrus and L. sigmodontis is We thank J. Claycomb, K.A. Smith and J.P. Hewitson for many helpful discussions, available at http://www.nematodes.org/genomes/heligmosomoides_polygyrus/ and E. Robertson for maintaining the H. polygyrus life cycle, A. Fulton for maintaining the http://nematodes.org/genomes/litomosoides_sigmodontis/. L. sigmodontis life cycle, S. Mitchell for technical support for TEM and U. Trivedi, Supplementary Information accompanies this paper at http://www.nature.com/ S. Bridgett and Edinburgh Genomics for H. polygyrus genome assembly. The MODE-K naturecommunications cells were provided by D. Kaiserlian (INSERM). We thank the Wellcome Trust for funding through a Research Career Development Fellowship to AHB, a Programme Competing ﬁnancial interests: The authors declare no competing ﬁnancial interests. Grant to RMM, and funding to the Centre for Immunity, Infection and Evolution and Asthma UK for fellowship funding to H.J.McS. Reprints and permission information is available online at http://npg.nature.com/ reprintsandpermissions/ How to cite this article: Buck, A. H. et al. Exosomes secreted by nematode parasites Author contributions transfer small RNAs to mammalian cells and modulate innate immunity. Nat. Commun. A.H.B. designed and carried out RNAseq experiments and validation, identiﬁed vesicles 5:5488 doi: 10.1038/ncomms6488 (2014). in secretion, co-designed and contributed to analysis of serum and proteomic data, co-supervised functional and uptake assays and wrote the paper; G.C. co-designed and This work is licensed under a Creative Commons Attribution 4.0 carried out functional analyses, in vivo Alternaria extract experiments and vesicle International License. The images or other third party material in this detection in nematodes; F.S. designed and carried out uptake and functional assays; article are included in the article’s Creative Commons license, unless indicated otherwise S.K. carried out genome alignment/annotation; H.J.McS. co-designed and performed in vivo Alternaria extract experiments; J.Q. prepared and co-analysed serum libraries, in the credit line; if the material is not included under the Creative Commons license, T.L.B. carried out LC-MS/MS and analysis; C.A.-G. analysed microarray data and users will need to obtain permission from the license holder to reproduce the material. target prediction; M.L. puriﬁed secretion material and supported functional studies; To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ NATURE COMMUNICATIONS | 5:5488 | DOI: 10.1038/ncomms6488 | www.nature.com/naturecommunications 11 & 2014 Macmillan Publishers Limited. All rights reserved. DOI: 10.1038/ncomms9772 OPEN Erratum: Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity Amy H. Buck, Gillian Coakley, Fabio Simbari, Henry J. McSorley, Juan F. Quintana, Thierry Le Bihan, Sujai Kumar, Cei Abreu-Goodger, Marissa Lear, Yvonne Harcus, Alessandro Ceroni, Simon A. Babayan, Mark Blaxter, Alasdair Ivens & Rick M. Maizels Nature Communications 5:5488 doi: 10.1038/ncomms6488 (2014); Published 25 Nov 2014; Updated 22 Oct 2015 The afﬁliation details for Mark Blaxter are incorrect in this Article. The correct afﬁliation details for this author are given below: Centre for Immunity, Infection and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Institute of Evolutionary Biology, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. Edinburgh Genomics, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3FL, UK. This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ NATURE COMMUNICATIONS | 6:8772 | DOI: 10.1038/ncomms9772 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved.

Journal

Nature Communications – Springer Journals

Published: Nov 25, 2014

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity

References (61)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies