Cellular and molecular responses to increased skeletal muscle loading after irradiation

Gregory R. Adams; Vincent J. Caiozzo; Fadia Haddad; Kenneth M. Baldwin

doi:10.1152/ajpcell.00173.2002

Cellular and molecular responses to increased skeletal muscle loading after irradiation

Adams, Gregory R.;Caiozzo, Vincent J.;Haddad, Fadia;Baldwin, Kenneth M.; 2002-10-01 00:00:00 UC Irvine ICTS Publications Title Permalink https://escholarship.org/uc/item/9sg699q3 Journal American Journal of Physiology-Cell Physiology, 283(4) ISSN 0363-6143 1522-1563 Authors Adams, Gregory R Caiozzo, Vincent J Haddad, Fadia et al. Publication Date 2002-10-01 DOI 10.1152/ajpcell.00173.2002 Copyright Information This work is made available under the terms of a Creative Commons Attribution License, availalbe at https://creativecommons.org/licenses/by/4.0/ Peer reviewed eScholarship.org Powered by the California Digital Library University of California Am J Physiol Cell Physiol 283: C1182–C1195, 2002. First published June 26, 2002; 10.1152/ajpcell.00173.2002. Cellular and molecular responses to increased skeletal muscle loading after irradiation 1 1,2 GREGORY R. ADAMS, VINCENT J. CAIOZZO, 1 1 FADIA HADDAD, AND KENNETH M. BALDWIN 1 2 Departments of Physiology and Biophysics and Orthopaedics, College of Medicine, University of California, Irvine, California 92697 Received 16 April 2002; accepted in ﬁnal form 15 June 2002 Adams, Gregory R., Vincent J. Caiozzo, Fadia cellular injury in vivo, interfered with the regeneration Haddad, and Kenneth M. Baldwin. Cellular and molecu- of skeletal muscle (see, e.g., Refs. 15, 25, 32). Because lar responses to increased skeletal muscle loading after irra- there is an absence of overt cellular damage, it was diation. Am J Physiol Cell Physiol 283: C1182–C1195, 2002. postulated that the failure of myoﬁbers to regenerate First published June 26, 2002; 10.1152/ajpcell.00173.2002.— resulted from damage to DNA that prevents satellite Irradiation of rat skeletal muscles before increased loading cell proliferation. It would follow then that mature, has been shown to prevent compensatory hypertrophy for permanently differentiated mammalian myoﬁbers periods of up to 4 wk, possibly by preventing satellite cells would not appear to be the locus of the radiation- from proliferating and providing new myonuclei. Recent induced mitotic failure (8, 54). Thus the inhibitory work suggested that stem cell populations exist that might effects of radiation on muscle regeneration were pro- allow irradiated muscles to eventually hypertrophy over posed to be a result of the incapacitation of satellite cell time. We report that irradiation essentially prevented hyper- trophy in rat muscles subjected to 3 mo of functional overload mitotic activity. (OL-Ir). The time course and magnitude of changes in cellu- The theory that radiation-induced inhibition of cel- lar and molecular markers of anabolic and myogenic re- lular proliferation can inhibit mammalian muscle ad- sponses were similar in the OL-Ir and the contralateral aptation and repair has recently been extended to nonirradiated, overloaded (OL) muscles for the ﬁrst 3–7 include the prevention of compensatory muscle hyper- days. These markers then returned to control levels in OL-Ir trophy after increased loading. In support of this the- muscles while remaining elevated in OL muscles. The num- ory, a number of studies have demonstrated that the ber of myonuclei and amount of DNA were increased mark- muscle hypertrophy process appears to involve the edly in OL but not OL-Ir muscles. Thus it appears that stem addition of nuclei to existing myoﬁbers (see, e.g., Refs. cells were not added to the irradiated muscles in this time 44–46, 51) and that prior irradiation can prevent this period. These data are consistent with the theory that the adaptation (35, 38–41). For example, a series of papers addition of new myonuclei may be required for compensatory published by Rosenblatt et al. (39–41) showed that, in hypertrophy in the rat. response to functional overload, irradiated myoﬁbers myonuclei; satellite cell do not hypertrophy or increase their myonuclear num- ber but do alter their myosin heavy chain (MHC) iso- form proﬁle from a faster to a slower phenotype. These MATURE MAMMALIAN SKELETAL muscle cells are multinu- results suggest that the irradiated myoﬁbers adapt in a cleated myoﬁbers that are formed via the fusion of manner similar to that of nonirradiated myoﬁbers with individual myoblast cells during development. Evi- regard to the qualitative expression of contractile pro- dence suggests that these multinucleated myoﬁbers tein isoforms but are unable to increase the quantity of are permanently differentiated and therefore incapa- protein accumulated in the myoﬁbers. Similarly, ble of mitotic activity (8, 21, 54). During muscle regen- Phelan and Gonyea (35) found that after 4 wk of eration after injury, myoﬁbers can be repaired and/or overload, muscle hypertrophy was absent and cell pro- replaced via the fusion of muscle stem cells (satellite liferation was signiﬁcantly less in irradiated vs. control cells) either with existing damaged myoﬁbers or with muscles. In addition to the inhibition of either regen- each other to form new myoﬁbers (43, 48, 49). eration or hypertrophy, it has also been reported that The impetus for much of the current interest in the irradiation prevents the recovery of muscle mass from role of satellite cells in muscle adaptation has its roots unloading-induced atrophy in mice (27). In avian mus- in the muscle regeneration literature. The results from cles, irradiation appears to prevent stretch-induced a number of studies using muscle injury models indi- cellular proliferation, but only a relatively small pro- cated that relatively modest doses of radiation, well portion of the hypertrophy response is affected (26). below the threshold of those required to induce overt The costs of publication of this article were defrayed in part by the Address for reprint requests and other correspondence: G. R. payment of page charges. The article must therefore be hereby Adams, Dept. of Physiology and Biophysics, Medical Sciences I C308, marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734 Univ. of California, Irvine, CA 92697 (E-mail: [email protected]). solely to indicate this fact. C1182 0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society http://www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1183 Recent reports indicated that there are stem cell the gastrocnemius and soleus muscles as described previ- ously (6). populations within skeletal muscle that appear to be Tissue collection. Groups of rats were killed by injection of resistant to radiation-induced damage (20). In addi- Pentosol (Med-Pharmex) at 6 and 24 h and at 3, 7, 15, and 90 tion, there are data to indicate that stem cells from days after the irradiation procedure. Two groups of untreated extramuscular tissues can be incorporated into skele- rats were used as controls and were killed at the beginning of tal muscles, and once there they function as muscle the study (t 0) and the end of the 90-day period. On the stem cells (12). These results suggest that a pool of basis of the results seen in the primary study, additional mitotically competent stem cells could be available for groups of six rats each were used in a follow-up study to the eventual restoration of the compensatory hypertro- determine whether measurable hypertrophy developed after 4 mo of functional overload. phy response in muscles that have been previously At the appropriate time point the plantaris muscles of the irradiated. irradiated and contralateral legs were dissected free of con- The ﬁnding that hypertrophy of mammalian skeletal nective tissue, weighed, and snap frozen. Muscles were muscle may require the incorporation of stem cells stored at 80°C for subsequent analysis. gives rise to some important hypotheses: 1) the number Biochemical and molecular analyses. Tissue samples were of myonuclei present in a muscle ﬁber is a limiting analyzed for total DNA and protein content as described factor for protein production, indicating that there is previously (1). Myoﬁbrillar protein content was deter- not a signiﬁcant reserve capacity for growth processes mined via modiﬁcation of the method described by Solaro dependent on nuclear functions; and 2) over the time et al. (52; see Ref. 57). Total RNA isolation. Measurements of total RNA content periods studied to date (i.e., up to 4 wk), muscles do provide insights on the translational capacity of tissue. Total not have a source of stem cells other than that which RNA was extracted from preweighed frozen muscle samples is present in the muscle domain at the time of irra- with the TRI reagent (Molecular Research Center, Cincin- diation. nati, OH) according to the company’s protocol, which is based Therefore, the current study was designed to address on the method described by Chomczynski and Sacchi (9). portions of these two hypotheses. First we hypothe- Extracted RNA was precipitated from the aqueous phase sized that it should be possible to detect and evaluate with isopropanol and, after washing with ethanol, dried and adaptive responses that involve nuclear function, such suspended in a known volume of nuclease-free water. The RNA concentration was determined by optical density at 260 as increased RNA levels, generated within myoﬁbers in nm (using an OD unit equivalent to 40 g/ml). The muscle overloaded-irradiated muscles. Second, we postulated total RNA concentration was calculated based on total RNA that previous studies may not have allowed sufﬁcient yield and the weight of the analyzed sample. The RNA time for either an intrinsic radiation-resistant popula- samples were stored frozen at 80°C to be used subsequently tion of satellite cells or an extramuscular stem cell in determining both total mRNA (poly A) and speciﬁc mRNA source to contribute to the development of compensa- expression with slot blotting and relative reverse transcrip- tory hypertrophy. Accordingly, a study was performed tion (RT)-polymerase chain reaction (PCR) procedures. with the functional overload model, in which the plan- RNA slot blotting. RNA slot blotting techniques were used taris muscles were bilaterally overloaded and one leg to elucidate the contribution of various fractions of RNA to the changes seen in response to treatments. In the current was then exposed to irradiation while the rest of the study this analysis was aimed at measuring the total amount animal was protected from the radiation dose. The of mRNA as well as two markers of contractile protein mes- muscles from subgroups of these rats were studied at sage. One microgram of total RNA was denatured in twenty speciﬁc time points spanning a period of 90 days after microliters of denaturing buffer (18% formaldehyde, 10 treatment. SSC) at 60°C for 15 min. Samples were brought up to 100-l volume with 6 SSC and were applied onto a positively METHODS charged nylon membrane (GeneScreen plus; NEN) with a slot blot apparatus (Schleicher and Schuell). Two blot series Forty-eight female Sprague-Dawley rats (212 3 g body were performed for each sample. After UV ﬁxation, each wt) were randomly assigned to one of eight groups (n 6 per membrane was hybridized consecutively with 1) either an group) for the primary experiments in this study. All proce- antisense -skeletal actin mRNA probe to determine -skel- dures were approved by the University of California, Irvine, etal actin mRNA expression or an antisense MHC mRNA Institutional Animal Care and Use Committee. In six of these probe common to all MHC; 2) an oligo dT probe (12- to groups one leg was exposed to -radiation as follows. 18-mer; Life Technology) that was used to detect poly A RNA Treatment. In the six groups chosen for treatment, the left (total mRNA population); and 3) an antisense 18S ribosomal hindlimb of the animals was exposed to 25-Gy (2.5 Gy/min) RNA probe. The signal of this probe is directly proportional to ionizing irradiation with a Mark I irradiator (model 68, J. L. the amount of total RNA and thus was used to normalize for Shepard and Associates, Glendale, CA). The exact dose of possible variability in the amount of loaded RNA per slot. irradiation was determined with Fricke dosimetry solution. Probes were 5 end-labeled with P with -ATP and T4 Irradiation was focused onto the hindlimb of each animal polynucleotide kinase. Hybridization and washing proce- with a collimator, thus allowing the irradiation to be focused dures were carried out as described previously (17). Hybrid- onto the hindlimb musculature without exposing the rest of ization signals were detected and analyzed with a phosphor- the body. After induction of anesthesia (40 mg/kg ketamine-2 imager and Image Quant analysis software (Molecular Dy- mg/kg acepromazine), the animal was positioned such that namics). The slot blot hybridization signal for these probes the left hindlimb was aligned with the slit of the collimator. was strongly correlated with the amount of loaded total RNA, Immediately after the irradiation procedure, rats had the ranging from 0.25 to 2 g per slot. For each sample, the MHC plantaris muscles of both legs overloaded via the removal of mRNA, actin mRNA, and dT (poly A) signals were normal- AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1184 IRRADIATION AND MUSCLE HYPERTROPHY ized to the corresponding 18S signal. The mRNA per muscle For the 18S ampliﬁcation we used the alternate 18S inter- as reported for MHC and -skeletal actin mRNA was based nal standards (Ambion), which yield a 324-bp product. The on the total RNA content per muscle and the mRNA ratio 18S primers were mixed with competimers at an optimized to 18S. ratio that could range from 1:4 to 1:10, depending on the The sequences of the oligonucleotide probes used for hy- abundance of the target mRNA. Inclusion of 18S competim- bridization were as follows: -skeletal actin antisense probe: ers was necessary to bring down the 18S signal, which allows GGCTGGCTTTAATGCTTCAAGT (based on reported actin its linear ampliﬁcation to the same range as the coampliﬁed mRNA sequence; GenBank accession no. V01224); MHC an- target mRNA (relative RT-PCR kit protocol; Ambion). tisense probe (common to all rat MHC): TGGTGTCCTGCTC- For each speciﬁc target mRNA, RT and PCR were carried CTTCTT (based on type I MHC mRNA sequence position under identical conditions with the same reagent premix for 5306–5324; GenBank accession no. NM017239; complemen- all the samples to be compared in the study. To validate the tary to coding region 500 nt upstream from stop codon and consistency of the analysis procedures, at least one represen- 100% identical in all MHC isoforms including adult and tative from each group was included in each RT-PCR run. developmental; signal obtained with this common MHC One microliter of each RT reaction (0- to 10-fold dilution probe is indicative of total population of MHC mRNA ex- depending on target mRNA abundance) was used for the pressed in muscle); 18S rRNA antisense probe: GTGCAGC- PCR ampliﬁcation. PCR was carried out in the presence of CCCGGACATCTAAG (based on rat ribosomal RNA se- 2mMMgCl 2 with standard PCR buffer (GIBCO), 0.2 mM quence; GenBank accession no. M11188). dNTP, 1 M speciﬁc primer set, 0.5 M 18S primer- Reverse transcription. One microgram of total RNA was competimer mix, and 0.75 U of DNA Taq polymerase reverse transcribed for each muscle sample with SuperScript (GIBCO) in a total volume of 25 l. Ampliﬁcations were II RT from GIBCO-BRL and a mix of oligo dT (100 ng/ carried out in a Stratagene Robocycler with an initial reaction) and random primers (200 ng/reaction) in a 20-l denaturing step of 3 min at 96°C, followed by 25 cycles of total reaction volume at 45°C for 50 min, according to the 1 min at 96°C, 1 min at 55°C (55 – 60°C depending on provided protocol. At the end of the RT reaction, the tubes primers), 1 min at 72°C, and a ﬁnal step of 3 min at 72°C. were heated at 90°C for 5 min to stop the reaction and then PCR products were separated on a 2 – 2.5% agarose gel by were stored at 80°C until used in the PCR for speciﬁc electrophoresis and stained with ethidium bromide, and mRNA analyses. signal quantiﬁcation was conducted by laser scanning den- Polymerase chain reaction. A relative RT-PCR method sitometry, as reported previously (59). In this approach, using 18S as an internal standard (Ambion, Austin, TX) was each speciﬁc mRNA signal is normalized to its correspond- applied to study the expression of speciﬁc mRNAs for IGF-I, ing 18S. For each primer set, PCR conditions (cDNA dilu- IGF-I receptor, IGF binding proteins (BP-4 and BP-5), myo- tions, 18S competimer-primer mix, MgCl 2 concentration, genin, cyclin D1, and p21. The sequences for the various and annealing temperature) were set to optimal condi- primers used for the speciﬁc target mRNAs are shown in tions, so that both the target mRNA and 18S product yields Table 1. These primers were designed with the Primer Select were in the linear range of the semilog plot when the yield computer program (DNA Star), purchased from Life Technol- is expressed as a function of the number of cycles. ogy GIBCO, and were tested for their compatibility with the Phosphorylation state of intracellular signaling proteins. alternate 18S primers. It should be noted that for IGF BP-4, The phosphorylation states of the p70-S6 kinase (S6K1) and the primers’ sequence is based on the mouse X76066 se- extracellular signal-regulated kinases 1 and 2 (ERK1/2) were quence. These mouse primers were selected on the basis of examined by immunoblotting with phosphospeciﬁc antibod- regions that are highly similar to the human IGF BP-4 ies (Cell Signaling Technology, Beverly, MA). The antibodies cDNA, and they proved to be effective with rat mRNA. In used detected changes in phosphorylation at sites critical for each PCR reaction, 18S ribosomal RNA was coampliﬁed with increased activity in vivo (22, 60). Muscle samples were the target cDNA (mRNA) to serve as an internal standard extracted by homogenization in 7 vols of ice-cold buffer A [50 and to allow correction for differences in starting amounts of mM Tris HCl, pH 7.8, 2 mM potassium phosphate, 2 mM total RNA. EDTA, 2 mM EGTA, 50 mM -glycerophosphate, 10% glyc- Table 1. Sequence of speciﬁc sets of primers used in RT-PCR mRNA analyses Target mRNA PCR Primer Sequence 533 Product Size, bp GenBank Accession No. IGF-I (all) 5 sense: GCATTGTGGATGAGTGTTGC 202 all X06043 3 antisense: GGCTCCTCCTACATTCTGTA 254 MGF MGF 5 sense: GCATTGTGGATGAGTGTTGC 163 X06108 3 antisense: CTTTTCTTGTGTGTCGATAGG IGF-I receptor 5 sense: CGGCTTCTCTGCAGTAAACACA 245 L29232 3 antisense: ACTGGGAAGCGGAGAAAAGAGA IGF-BP5 5 sense: CACGCCTTCGACAGCAGTAAC 214 NM_012817 3 antisense: GTCGGGAATGGGGAGTGTCT IGF-BP4 5 sense: CCTGGGCTTGGGGATGC 212 X76066 3 antisense: AGGGGTTGAAGCTGTTGTTGG Myogenin 5 sense: ACTACCCACCGTCCATTCAC 233 M24393 3 antisense: TCGGGGCACTCACTGTCTCT Cyclin D 5 sense: AAGTGCGTGCAGAGGGAGAT 267 D14014 3 antisense: GGGGCGGATAGAGTTGTCAG p21 5 sense: CCCGTGGACAGTGAGCAGTT 233 U24174 3 antisense: AGCAGGGCCGAGGAGGTA RT, reverse transcription; PCR, polymerase chain reaction; MGF, mechanosensitive IGF-I isoform. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1185 erol, 1% Triton X-100, 1 mM DTT, 3 mM benzamidine, 1 mM myonuclei distribution relative to length (nuclei/mm) and sodium orthovanadate, 10 M leupeptin, 5 g/ml aprotinin, volume (m /nuclei). All measurements of muscle ﬁber seg- 200 g/ml soybean trypsin inhibitor, and 1 mM 4-(2-ami- ment length and volume were normalized to a sarcomere noethyl)benzenesulfonyl ﬂuoride (AEBSF)] with a motor- length of 2.5 m. This sarcomere length was chosen because driven glass pestle. The homogenate was immediately cen- this was the value observed by us in other studies in our trifuged at 12,000 g for 30 min at 4°C. The supernatant was laboratories examining the architecture of the plantaris mus- immediately saved in aliquots at 80°C for subsequent use cle (unpublished observations; n 24,000 measurements of in immunoblotting. The supernatant protein concentration sarcomere length). was determined by using the Bio-Rad protein assay with BSA MHC isoform analysis. A portion of each muscle sample as the standard. Approximately 50 g of supernatant pro- was homogenized in a solution that contained (in mM) 250 teins were subjected to sodium dodecyl sulfate-polyacrylam- sucrose, 100 KCl, 5 EDTA, and 10 Tris-base. The homogenate ide gel electrophoresis (SDS-PAGE; 12.5% T), according to a protein was diluted to 1 mg/ml in a storage buffer containing standard protocol (24), and then electrophoretically trans- 50% glycerol, 100 mM Na P 0 , 5 mM EDTA, and 2 mM 4 2 7 ferred to a polyvinylidene diﬂuoride (PVDF) membrane (Im- 2-mercaptoethanol (pH 8.8) and stored at 20°C until sub- mobilon-P) with 10% methanol, 1 mM orthovanadate, 25 mM sequent analyses for MHC protein content. Tris, and 193 mM glycine, pH 8.3. Phospho-ERK1/2 and Skeletal MHCs were separated with a SDS-PAGE tech- phospho-S6K1 were detected with phosphorylation state-spe- nique. The method used is a modiﬁcation of that published by ciﬁc antibodies (Cell Signaling Technology) and an enhanced Talmadge and Roy (55), which allows for the detection of all chemiluminescence (ECL) method of detection (Amersham). six rat MHC isoforms (3). The separating gel contained 30% Signal intensity was determined by laser scanning densitom- glycerol, 8% acrylamide, 1.5 M Tris-base, 1 M glycine, and etry (Image Quant; Molecular Dynamics). For each speciﬁc 10% SDS. The stacking gel contained 4% acrylamide, 30% antibody, all the samples were run under identical (previous- glycerol, 0.5 M Tris HCl, 100 mM EDTA, and 0.4% SDS. ly optimized) conditions, including the transfer on the mem- Protein samples were denatured by placing 5 g of sample in brane, the reaction with the ﬁrst and secondary antibodies, 35 l of sample buffer and heating the solution for 2 min at washing conditions, ECL detection, and the ﬁlm exposure. To 100°C. The sample buffer consisted of 5% -mercaptoethanol, ensure the consistency of this analysis, at least one represen- 100 mM Tris-base, 5% glycerol, 4% SDS, and bromophenol tative sample from each group was included in each gel run blue. The gels were run at 275 V for 22 h under refrigera- and Western blot analysis. In addition, a positive control, tion. The gels were stained with Brilliant Blue G 250 (Sigma) provided by the antibody supplier, was run on each gel to and destained, and then they were scanned and quantiﬁed allow for normalization. For each set of Western blotting and with a Molecular Dynamics densitometer (Sunnyvale, CA). detection conditions, the detected signal was directly propor- The peaks of interest representing the distinct MHC isoforms tional to the amount of protein loaded on the gel over a 20- to were identiﬁed in the digitized densitometric data sets. The 150-g range (data not shown). area of each peak was determined by integration and was Confocal microscopy for determination of cell volumes and indicative of the relative expression of the corresponding myonuclei number. At the time of death, an 5-mm segment MHC isoform. was taken from the midbelly of each muscle and frozen in Statistical analysis. All values are reported as means isopentane that was cooled by liquid nitrogen. Subsequently, SE. For each time point, treatment effects were determined the muscle sample was thawed as described by Allen et al. by ANOVA with post hoc testing [Student-Newman-Keuls (4), and single ﬁbers segments (n 10 ﬁber segments/mus- (SNK)] with the Prism software package (Graphpad). Pear- cle) were isolated by placing the muscle sample in a small son correlation analysis was used to assess the relationship dissection chamber containing a glycerol-relaxing solution between myoﬁbrillar protein and DNA and between p21 and (50% glycerol, 2 mM EGTA, 1 mM MgCl , 4 mM ATP, 10 mM 2 myogenin with the Prism package. For all statistical tests the imidazole, 100 mM KCl, pH 7.0). Dissection was performed 0.05 level of conﬁdence was accepted for statistical signiﬁ- with a microscope (Technival 2, Jena, Germany) with back cance. lighting and microsurgical forceps (super ﬁne Dumont twee- zers; Biomedical Research Instruments, Rockville, MD). Iso- RESULTS lated ﬁber segments were placed into a PBS solution contain- ing Hoechst 33258, a DNA binding agent that acquires At the end of 3 mo after irradiation, the body weight speciﬁc excitation/emission spectrum properties on DNA of the -radiation-treated rats was not different from binding and thus can be used to image the nuclei with that of the untreated control group [305 5 and 318 ﬂuorescence microscopy (Molecular Probes, Eugene, OR). 6 g, respectively (synergist ablation removes 4gof The ﬁber segment was then washed several times in PBS and muscle)]. This result indicates that the localized irra- then placed into a PBS solution containing BODIPY-labeled diation did not have any adverse effects on the gener- phallicidin (Biomolecular Probes). Phallicidin binds selec- alized growth of the treated animals (initial body wt tively to actin and serves as a tool for identifying the dimen- sions of the ﬁber. After these labeling procedures, the ﬁber 212 3 g). In addition, pilot data indicated that the segment was washed in PBS and mounted on a glass slide myoﬁbrillar yield, cross-sectional area (CSA), and force with glycerol. The coverslip had struts to prevent compres- production of irradiated muscles were not altered rel- sion of the muscle ﬁber segment when it was mounted. The ative to controls 4 wk after this irradiation protocol volume of a muscle ﬁber segment, its length, and the corre- was imposed (data not shown). sponding number of myonuclei were determined with a MRC Muscle hypertrophy. Fifteen days of overload re- 600 Bio-Rad laser scanning confocal microscope and a mag- sulted in signiﬁcant muscle hypertrophy in non-irradi- niﬁcation of 400. The images were then reconstructed and ated overloaded (OL) muscles as evidenced by in- rendered with Advanced Visualization Software version 6.0 creased muscle mass (Fig. 1A). Ninety days of overload (AVS; Waltham, MA). By using the volume integration mod- resulted in further hypertrophy (Fig. 1). In the over- ule of AVS, it was possible to determine the volume of the single-ﬁber segment. This approach allows the expression of loaded muscles that were irradiated (OL-Ir), there was AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1186 IRRADIATION AND MUSCLE HYPERTROPHY --- OL 15 Day t=O 90 Day ··••A .... OL- lr ·.; 80 )* ··-O··· C o ntrol cii 0-;- ,.. _ ., ,._. Clo. ... "' .... .c .:3 E . --·-O* 0.0 * - -..... . . .i. = -- -~ ii 0J) i:.: E Q '-' ... 20 "' ·;:: ::;: ... C 0 >--r- = 0 6 9 12 15 90 s: Days Fig. 2. Myoﬁbrillar protein content of the OL muscles was progres- sively increased by 7, 15, and 90 days of overload treatment. A small increase in myoﬁbrillar protein in the OL-Ir muscles was evident "' ,-... ·- ~ after 1 day of increased loading. The myoﬁbrillar protein content of E -g * the 90-day control rats was higher than that of the t 0 controls. = .Q !: 0J) *P 0.05 vs. t 0. Q., -- 0J) '0 "" e -~ ._,. OL muscle myoﬁbrillar protein was 1.8-fold as opposed -;; .:E to a 2.6-fold increase compared with the t 0 controls E -~ .. ., (Fig. 2). ~~ 0 The myoﬁbrillar protein content of the OL-Ir mus- ~ ~ ~O" o" ~ cles at 90 days was not different from that of untreated o" cl; o" o" c..,<>"" muscles of animals in the 90-day control group. How- Fig. 1. A: removal of synergists results in a substantial increase in ever, the myoﬁbrillar protein content of the 90-day plantaris muscle wet weight in nonirradiated (OL) muscles. A small control muscles had increased 40% compared with but signiﬁcant hypertrophy response was detected in the overloaded- the t 0 controls (Fig. 2). This suggests that the irradiated (OL-Ir) muscles at 15 days, with no further increase in myoﬁbrillar protein content of the OL-Ir muscles re- mass over 90 days of overload treatment. The mass of the plantaris mained proportional to the amount of body growth seen muscles from control rats increased as a result of growth such that the absolute weight of the muscles of the 90-day control group was over the 90 days. signiﬁcantly larger than that from the rats killed at the beginning of Cell proliferation. The DNA content of both OL and the study (time t 0). B: when normalized for body weight increases, OL-Ir muscles was increased at 15 and 90 days after the plantaris wet weight of the 90-day OL-Ir muscles and the 90-day treatment compared with the t 0 control group (Fig. control muscles was not different than that of the t 0 control rats. *P 0.05 vs. t 0; P 0.05 vs. OL (contralateral muscle). 3). However, the increase in DNA content seen in the OL-Ir muscles was smaller than that in the OL group. The DNA content of the OL-Ir group was not different a small increase in mass at both 15 and 90 days after from that seen in the 90-day controls. In both OL and treatment relative to the t 0 normal control muscles. OL-Ir muscles, the concentration of DNA (e.g., in When normalized to body mass, the observed changes mg/g) was unchanged over time (data not shown). in mass in the OL-Ir group at 90 days were no longer This ﬁnding demonstrates the apparent coordination signiﬁcant (Fig. 1B). In addition, the 90-day values for the OL-Ir muscles were not different from those of the 90-day untreated controls (Fig. 1). Similar results were t=O 15 Day 90 Day I * seen for the total muscle protein content (data not shown). = ,-... Myoﬁbrillar protein was used as a conservative ., ~ - ... marker of hypertrophic adaptation to avoid the poten- = "' Q = u !: tial complications of acute inﬂammatory response that -< -- may occur with this treatment during the ﬁrst 3–5 z ~ ~ --- days (5). The myoﬁbrillar protein content of the OL 200 plantaris muscles was signiﬁcantly increased at 7 (27%), 15 (57%) and 90 (2.6-fold) days after surgery compared with the zero time point control muscles o" _,, & & o" ;-. < ~~ o" o" (Fig. 2). In contrast, the OL-Ir muscles demonstrated c.P c.P only a transient increase at the 24 h time point (Fig. 2). Fig. 3. Overload stimulus resulted in a signiﬁcant increase in DNA The young adult female rats used in this study contin- content in the OL muscles. A small but signiﬁcant increase in DNA content was also seen in OL-Ir muscles at 15 days, with no further ued to increase body mass ( 50%) over the 3-mo period increase in DNA detected over the remainder of the 90-day overload of this study. As a result, some portion of the observed treatment. DNA content of the plantaris muscles from control rats myoﬁbrillar protein increase was most likely related to was increased at 90 days. There were no changes in DNA concentra- this generalized growth process. For example, com- # tion in any muscles (data not shown). *P 0.05 vs. t 0; P 0.05 pared with the 90-day control, the increase in 90-day vs. OL. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1187 of DNA and cell size in both growing and hypertro- phying muscles. ,-, * # Over the course of this study, the relationship be- tween DNA and myoﬁbrillar protein content followed a ~ ~ o- similar pattern in the OL and OL-Ir groups (Fig. 4A). ... nJ u Cl> Consistent with the possibility of an early inﬂamma- ... ~~ tory response (5), there was a small increase in DNA at .c - · - nJ the early time points after the ablation surgery in both 'og >,,_ groups. Despite this early complication, the overall ::!:~ relationship between DNA and myoﬁbrillar protein (/) resulted in a strong correlation in the OL muscles (Fig. 4B). In contrast, the early increases in DNA in the OL-Ir muscles were not paralleled by increased myoﬁ- c=i control brillar protein and hence did not show a signiﬁcant * # - OL correlation (data not shown). Figure 4A is essentially a combination of the data presented in Figs. 2 and 3. Thus it is particularly striking to note that the large ·a; increase in DNA content (Fig. 3) seen in the OL mus- 200 ::::, cles is associated with an increase in myoﬁbrillar pro- g, tein (Fig. 2) such that the ratio of these two variables is ::!: the same as that seen for the control groups at 90 days (Fig. 4A). Myonuclear analysis. CSA and myonuclear number were determined in single ﬁbers from t 0 and 90-day C plantaris muscles. CSA of myoﬁbers from the OL mus- cles was signiﬁcantly increased (46%) at 90 days after Cl> overload (Fig. 5A). There was no change in the CSA of E Ill ::::, ::::, 20000 myoﬁbers from OL-Ir muscles. The number of myonu- 0 .!! clei per millimeter of myoﬁber length was signiﬁcantly :: g 15000 .8 g ·- >, 10000 o::!: >, A ::!: Control OL OL-lr Fig. 5. A: overload resulted in a signiﬁcant increase in the cross- ____ .. sectional area of OL but not OL-Ir plantaris muscle ﬁbers. B: there was an increase in no. of myonuclei per millimeter of myoﬁber in the OL but not OL-Ir myoﬁbers. C: ratio of the myoﬁber volume per -- oL myonucleus was unchanged in both the treatment and control --.-- OL- lr groups. *P 0.05 vs. t 0; P 0.05 vs. contralateral OL-Ir. - -0··· 90 Control 1--r- 0 3 6 9 12 15 90 increased in myoﬁbers from the OL (44%) but not Days the OL-Ir plantaris muscles (Fig. 5B). As a result of 100 the increase in myonuclei in the OL muscles, the myo- ﬁber volume-to-myonucleus ratio remained unchanged r=0.88 (Fig. 5C). o--. ... ... p=0.009 / Cellular signaling response to increased loading. The Q.-;:; phosphorylation state of both S6K1 and 4E binding ... "' so "' " = 8 protein 1 (4E-BP1) was markedly increased at very ... 01) ·- -- early time points after the imposition of increased ::: 8 / ~ OLGro,p ... --- 0 loading in both OL and OL-Ir muscles (Fig. 6). In the .... OL muscles, phosphorylation of 4E-BP1 and S6K1 re- ::; 0 mained elevated through the 15-day time point and 0 100 200 300 400 500 600 700 returned to control levels by 90 days. In the OL-Ir DNA (µg/muscl e) muscles, the increase in phosphorylation of these pro- Fig. 4. A: ratio of DNA to myoﬁbrillar content changed with a teins appeared to be resolved by the 7 day time point similar pattern in both OL and OL-Ir plantaris muscles. There (Fig. 6). was no change in this ratio in the muscles from control rats. B: The phosphorylation of both ERK1 and -2 was in- there was a signiﬁcant correlation between myoﬁbrillar protein creased at very early time points after the initiation of and DNA content in the OL but not the OL-Ir plantaris muscles. *P 0.05 vs. t 0. overloading in both OL and OL-Ir muscles (Fig. 7). By AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1188 IRRADIATION AND MUSCLE HYPERTROPHY upregulated at 1 and 3 days after treatment and then declined toward baseline values in both OL and OL-Ir Days: 0 0.25 1 3 7 15 90 -- muscles (Fig. 9). Other components of IGF-I-related NC a b a b a b a b b b systems also changed in a similar pattern in both OL and OL-IR muscles. Similar to our previous reports (2, 16), overloading signiﬁcantly increased the expression 0.75 of IGF-I mRNA by 24 h of treatment, returning to .... baseline values between the 15 and 90 day time points i:i::i (data not shown). The increase in IGF-I mRNA was ', * r;r;i 0.50 ...,. similar for OL and OL-Ir muscles. The mRNA for the * ', type 1 IGF-I receptor was signiﬁcantly increased only ',,, ------1- -= Q. --- -_ 'i::-:::-.:.. --- - at the 1 day time point in both OL and OL-Ir muscles _g 0.25 (data not shown). The mRNA for IGF BP-5 was un- changed, whereas that for IGF BP-4 was increased similarly in OL and OL-Ir muscles at 3 and 7 days of 0 .00 increased loading (data not shown). The expression of the mRNA for the myogenic regu- Days: 0 0.25 1 3 7 15 90 latory factor myogenin was signiﬁcantly elevated to a a b a b a b a b a b NC very similar degree at 24 and 72 h after the overloading --~ =--~.-.---- ---p85 ~ , - - - - - - Pp70S6k surgery in OL and OL-Ir muscles (Fig. 10). The expres- sion of this mRNA declined to baseline in both muscles -- oL at 15 days but was again signiﬁcantly increased at 90 --.. ··OL- Ir --o -- Control days in the OL-Ir muscles but not the OL muscles. The !2 5000 pattern of changes seen in the expression of MGF and ~ 4000 myogenin appeared to be quite similar. ,g_ 3000 "' ll 2000 p.. Days: 0 0.25 3 7 15 -------- ---· -- -- - -o 0 ~ Pp44 NC a _ b~- a ~ b~ a-_ b_ a ~..:..'.'......:..:_NC ERKl 9 12 15 0 3 6 90 Pp42 !:=!::!!~!E!!=:=-=:=:=:.....;..;:==.:=- •:.ll!! ... r6!' ERK2 Days Fig. 6. Phosphorylation state of the inhibitory eukaryotic initiation factor 4E binding protein (4E-BP1; A and B) and of p70 S6 kinase (S6K1; C and D) was increased in both OL and OL-Ir plantaris muscles at early time points. Phosphorylation state of 4E-BP1 and of ij 5000 S6K1 in the OL and OL-Ir muscles diverged after 3 days. There was no change in 4E-BP1 or S6K1 phosphorylation state in the muscles -= from control rats (E). A and C are representative Western blot images for 4E-BP1 and phospho-S6K1, respectively. Phosphorylation state for 4E-BP1 represents the ratio between slow-migrating isoforms ( and ) and faster-migrating forms ( and ) (13). NC, normal control; a, OL; b, OL-Ir. *P 0.05 vs. t 0. 7 days after treatment, the phosphorylation levels of the ERKs had returned to or below the baseline values. -- oL Molecular marker responses to increased loading. ·• .. ·· OL-lr The amount of total RNA per muscle increased in both ·-O·· Control f": OL and OL-Ir muscles through 7 days of increased _____ .. loading (Fig. 8A). This value remained elevated in the -= Q. OL muscles through 90 days, whereas in the OL-Ir "' .c muscles it returned to baseline between the 7 and 15 day time points. A similar pattern was seen for total mRNA, which 0 ~ 0 3 6 9 12 15 90 remained elevated through 90 days in the OL muscles Days but declined to control levels by 15 days in the OL-Ir muscles (Fig. 8B). The proportion of mRNA to total Fig. 7. A: representative Western blot image for phospho-extracel- lular signal-regulated kinase (ERK)1/2 detection. Both ERK1 (p44) RNA as determined by dT-to-18S ratio was essentially and ERK2 (p42) are detected with the same phosphospeciﬁc anti- unchanged during the course of the study (data not body. Phosphorylation state of ERK1 (B) and -2 (C) was increased in shown). both OL and OL-Ir plantaris muscles at very early time points, then The expression of the mRNA for the mechanosensi- declined in parallel. There was no change in ERK1 and -2 phosphor- tive isoform of IGF-I (MGF; Ref. 18) was signiﬁcantly ylation state in the muscles from control rats. *P 0.05 vs. t 0. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1189 2.0 -- OL "' .... ··•···OL-IR 1.5 -- ···O ··· Cont ro l ... < ---I! __________ _ 1i IX "' 1.0 --i- J• ~ ·- ---I ' -- • --0 ·= <: Q,l 2- · ·-· · - !>II :z: ,_ 0 0.5 --- -·- .. ~-~~~=::::.-,~~- >, -, i:t: ..... 0 L· Ir ···<>-·· Contro I -- OL 0.0 -',--,----,- --,-~----.-, 0 t--- 0 3 6 9 12 15 90 Days Fig. 10. mRNA for the myogenic regulatory factor myogenin was signiﬁcantly increased in both OL and OL-Ir plantaris muscles until ... ,l! 1i the 3 day time point, then declined toward baseline. Myogenin ,.,, * ,' * ...... ______ ..: •:,,.•-- mRNA was signiﬁcantly increased at 90 days in the OL-Ir muscles. * ........... ~ There was no change in myogenin mRNA in the muscles from control --------+.- ,::.-.:~! rats. *P 0.05 vs. t 0. -· - ·-- - IX cles throughout the 90 days of the study. In the OL muscles, cyclin D1 mRNA tended to be increased, but 01-'-;--.--"'T""--.----- >--,- 0 6 9 12 15 90 this change (vs. t 0) was signiﬁcant only at 1 and 3 Days days after treatment (Fig. 11). The expression of p21 mRNA was increased at very Fig. 8. Total RNA (A) and total mRNA (B) per muscle were signiﬁ- cantly increased in both OL and OL-Ir plantaris muscles until the 7 early time points in both OL and OL-Ir muscles (Fig. day time point. Both RNA and mRNA remained signiﬁcantly ele- 12). However, there was a much greater increase in vated through 90 days in OL but not OL-Ir muscles. There was a p21 mRNA expression in OL-Ir than in OL muscles. As signiﬁcant increase in total mRNA but not total RNA at 90 days in we previously reported (2, 16) there was a signiﬁcant the muscles from control rats. *P 0.05 vs. t 0. x-Axes in arbitrary correlation (r 0.77, P 0.04) between the increased scan units. expression of p21 mRNA and myogenin mRNA in OL but not OL-Ir muscles. Increased expression of cyclin D1 and the cyclin- The expression of actin and MHC mRNA were used dependent kinase inhibitor (CKI) p21 are indicative of to assess contractile protein-speciﬁc molecular re- cells either entering into the cell cycle (cyclin D1) or sponses to increased loading. The amount of MHC exiting from the cell cycle (p21). The expression of mRNA in the OL-Ir muscles did not increase relative to cyclin D1 mRNA increased signiﬁcantly in both OL and t 0 values and was signiﬁcantly lower at 90 days OL-Ir muscles, indicating that a population of cells compared with the 90-day control muscles. The within the muscles was preparing to become mitoti- amount of MHC mRNA per OL muscle was signiﬁ- cally active (Fig. 11). The increase in cyclin D1 was cantly increased after the 15 day time point (Fig. 13A). much greater in the OL-Ir muscles than in the OL In contrast, the amount of actin mRNA present in muscles at all time points. For example, at 3 days the muscles increased at earlier time points and remained cyclin D1 mRNA was increased approximately three- elevated over the 90-day course of this study in OL but fold and ﬁvefold in OL and OL-Ir muscles, respectively. not OL-Ir muscles (Fig. 13B). Cyclin D1 mRNA remained elevated in the OL-Ir mus- 2.0 ,-._ -- oL QC -+- OL "' 0.5 .... . .... OL- [R '-' ··•·· OL-Ir -- 1.5 ·:J ··-O··· Control 0.4 "' ·--0 ... Control 00 , .... , IX -- 1.0 * ,,!1----'-!.L ____ < E 0.3 IX ;:; ,, _,, 0.5 0 . 2 = --t 1i c., >, - - · · () u ~ :; 0.1 0.0 >--,- ·· -··-· · - ··-··-·· - ··--· - · ~- ~ 12 15 90 0 3 6 9 Days 0.0 0 3 6 9 12 15 90 Fig. 11. mRNA for the cell cycle regulator cyclin D1 was signiﬁcantly Days and similarly increased in both OL and OL-Ir plantaris muscles until Fig. 9. mRNA for mechanosensitive growth factor (MGF) was signif- the 3 day time point. Cyclin D1 mRNA remained elevated through- icantly increased in both OL and OL-Ir plantaris muscles until the 3 out the 90-day overload period in the OL-Ir but not the OL muscles. day time point, then declined toward baseline. There was no change There was no change in cyclin D1 mRNA in the muscles from control in MGF mRNA in the muscles from control rats. *P 0.05 vs. t 0. rats. *P 0.05 vs. t 0; P 0.05 vs. OL. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1190 IRRADIATION AND MUSCLE HYPERTROPHY --- OL overload stimulus. The results of the current study 3.0 ...... OL-IR extend the period for postirradiation overloading to 3 ,....._ 2.5 ---0--· mo. In that extended period, the hypertrophy response Cont ro l "' .... was negligible in the OL-Ir muscles. 2.0 '-" -- F-- I! Prevention of hypertrophy is not absolute. At the 15 : -----..r* 1.5 I - day time point there was a small but signiﬁcant in- IX crease in the mass and myoﬁbrillar protein content of 1.0 the OL-Ir plantaris muscles (Figs. 1 and 2). During this ;::; * ........ .----I C. -~- 0.5 time period, the DNA content of the OL-Ir muscles also o- -. - .. - -- - --- --- --- --- -- - -.. increased by a small but signiﬁcant amount (Fig. 3). 0.0 This suggests the possibility that a small number of 0 6 9 12 15 90 Days satellite cells or myogenic precursor cells (MPC) within the irradiated muscles may have been able to complete Fig. 12. mRNA for the cyclin-dependent kinase inhibitor p21 was mitosis. These cells may have been undamaged by the signiﬁcantly increased through 3 and 7 days in OL and OL-Ir plantaris muscles, respectively. Increase in p21 D1 mRNA in the irradiation treatment or have been able to affect re- OL-Ir muscles was greater than that seen in OL muscles at most pairs to their DNA (29). Alternatively, there may have time points. There was no change in cyclin D1 mRNA in the muscles been a small population of unfused satellite cells or from control rats. *P 0.05 vs. t 0. MPCs that responded to the overload stimulus via differentiation and fusion with myoﬁbers. In support of MHC isoforms. Increased mechanical loading of the this second alternative, in a study with ﬁner temporal plantaris resulted in the classic fast-to-slow shift in resolution, we found (2) that the increase in expression MHC protein expression in both OL and OL-Ir muscles of p21 and myogenin mRNA precedes that of cyclin D1 (Fig. 14). This pattern of adaptation appeared to be in response to increased loading and thus may signal accentuated in the OL-Ir muscles. For example, the the presence of such a cell population. Over the re- type I MHC isoform, representing the slowest pheno- mainder of the 3-mo course of this study, the myoﬁbril- type, represented 5% of the total MHC pool in control lar protein content of the OL-Ir muscles remained rat plantaris muscles. In the OL-Ir muscles, this iso- essentially constant, e.g., they did not experience the form was increased more than eightfold to 20% of the large increase in myoﬁbrillar protein accumulation total MHC present. Similarly, the IIb MHC expression seen in the OL muscles (Fig. 2). Assuming that normal declined by 62% in OL muscles and 80% in OL-Ir muscles. As a result of the exaggerated adaptation of the OL-Ir muscles, 50% of the MHC present was either type I or IIa, whereas these isoforms repre- ., --- oL -;;:; .. ,... OL· lr sented only 25% of the MHC in the OL muscles. "' ::i ··-O··· Control DISCUSSION ::; I 00 Irradiation has been used for some time in studies -- -· -2 of skeletal muscle regeneration and compensatory growth. Originally, this modality was used to block ---...... skeletal muscle regeneration after injury. The inter- pretation of the results of these various studies has 0 1---- been predicated on the notion that the lasting effects of the radiation treatment were those associated with ., chromosomal damage (e.g., double strand breaks, -;;:; cross-linking, base pair loss, etc). It is commonly as- "' ::i ::; sumed that the primary outcome of this treatment -----j. involves the prevention of mitotic activity within the affected muscles. ------i-------- ---· , :::<J IX ,~ '- . - · . - • - _ _ __ __ _ • • - ... -__ .f. ... More recently, a number of studies have demon- E 50 strated that irradiation also appears to prevent skele- 'f tal muscle hypertrophy in rats (21, 35, 39–41). How- --· O --- OL ··•···OL·lr · Control ever, these studies were conducted before reports that 0 -,- 1) identiﬁed a population of stem cells that are appar- 0 6 9 12 15 90 ently resistant to radiation-induced damage (20) and 2) Days found that stem cells from extramuscular tissues can Fig. 13. A: mRNA for myosin heavy chain (MHC) (probe common to be incorporated into skeletal muscles (12). Because the all rat isoforms) was signiﬁcantly increased in OL plantaris muscles at both 15 and 90 days. There were no signiﬁcant changes in MHC cited irradiation studies were carried out over a rela- mRNA in the muscles from OL-Ir or control rats. B: mRNA for tively short time span (4 wk), they did not rule out the -skeletal actin was signiﬁcantly increased in OL plantaris muscles possibility that extramuscular and/or radiation-resis- at 7, 15, and 90 days. There were no signiﬁcant changes in -actin tant stem cells might eventually contribute to the de- mRNA in the muscles from OL-Ir or control rats. *P 0.05 vs. t 0. velopment of compensatory hypertrophy given a longer x-Axes in arbitrary scan units. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1191 Days: 0 15d 90 d Con OL OL+lr OL OL+lr Con --------- ,._.... 11c:1 - nx llb Fig. 14. A: representative gel image for MHC isoform separation. Propor- 40 tion (% of total) of MHC protein iso- --- oL forms present in OL and OL-Ir planta- ris muscles changed signiﬁcantly over ··* ·OL· lr _______ .I* 0-. - the 90-day treatment period. B: type · · O·· Control ------- T IIa MHC increased signiﬁcantly in --- - --o both OL and OL-Ir muscles. C: type I MHC increased signiﬁcantly in OL-Ir f.:-__ but not OL muscles. D: decrease in ~- .L* ·--------~* expression of MHC IIb in both OL and Q-·- - - -- -- - ---- -2 ---------------"! * OL-Ir muscles was signiﬁcant at both the 15 and 90 day time points. E: type o~-----------. IIx MHC increased in both muscle treatment groups and was signiﬁcant at both 15 and 90 days. In the muscles from control rats, the only signiﬁcant change was an increase in type IIx MHC at 90 days. *P 0.05 vs. t 0; .. r P 0.05 vs. OL. u ~ . * I*# ;------ - - - - - - ~* ~ 20 ! 40 <5--------- 1---------------------- ----i ~ 30 = 20 0- ---- ---- --- - --2 o...__------.-----..----. 0-'-----.-----.-------, 0 25 50 75 100 0 25 50 75 100 Time (Days) Time (Days) cycles of protein turnover continued, these results sug- sensitive measurements, the increased phosphoryla- gest that the housekeeping mode of transcription and tion of S6K1 and 4E-BP1. Increases in the phosphory- translation was unimpaired by the irradiation treat- lation of S6K1 and 4E-BP1 have been reported to be ment. The small increase in myoﬁbrillar protein seen associated with an increase in translation and are in the early stages of the OL-Ir treatment also suggests known to occur in response to 1) increased muscle that the myoﬁbers had the capacity not only to renew loading and/or 2) IGF-I receptor ligation (10, 11, 13, 23, components of the contractile machinery but also to 34, 62). The activation of S6K1 has a relatively modest implement a growth and/or limited hypertrophy pro- positive impact on translation in general, but, more gram. In addition, the current data would suggest that importantly, it increases the translation of speciﬁc the inhibition of the hypertrophy response was not mRNAs that encode components of the translational related to the production of muscle-speciﬁc mRNAs, apparatus itself (19, 56). Phosphorylation of 4E-BP1 such as that for MHC, because the conversion from fast results in its dissociation from the eukaryotic initiation to slow MHC expression was robust in the irradiated factor (eIF)4G binding site on eIF4E, allowing for the muscles. In contrast to the OL-Ir muscles, the con- formation of the translation initiation complex and tralateral OL muscles demonstrated a continuous com- thereby increasing translation (53). At 3 days after pensatory hypertrophy response detectable from 7 treatment the phosphorylation of S6K1 was increased days onward (Fig. 2). more than sixfold in both OL and OL-Ir muscles. How- Differential responses to overload. Examination of ever, at 7 days, when phospho-S6K1 was increased the data from the ﬁrst 3–7 days of overload in this ﬁvefold in the OL muscles, it was not different from study suggests that the responses of the OL and OL-Ir control in OL-Ir muscles. Subsequent to this response, muscles were not different. The ﬁrst signiﬁcant diver- other parameters demonstrated similarly dramatic di- gence in response between these two treatments can be vergence. For example, at 7 days after treatment total seen in what arguably might be the most temporally RNA was increased approximately twofold in both OL AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1192 IRRADIATION AND MUSCLE HYPERTROPHY and OL-Ir muscles. At 15 days, the RNA of the OL tempts at cellular proliferation. For example, in- muscles was still increased more than twofold, creased protein production within myoﬁbers is proba- whereas the RNA content of the OL-Ir muscles had bly reﬂected by the increase in total RNA as more essentially returned to baseline. The total RNA pool ribosomes are produced to meet the demand for trans- primarily reﬂects the amount of ribosomal RNA lation. However, ribosomal synthesis would also be present and thus is indicative of the translational ca- expected to increase markedly in cells that are becom- pacity of the tissue. Similar to the total RNA pool, the ing mitotically active (see, e.g., Ref. 61). Similarly, total mRNA present in both sets of muscles was in- activation of the pathways including S6K1 activation creased at early time points and then diverged between would also be critical for both anabolic processes and 7 and 15 days. Interestingly, the changes in speciﬁc cellular proliferation (19, 23). As a result, it is difﬁcult mRNA expression did not demonstrate this pattern of to speculate on the mechanisms underlying the ob- abrupt divergence. In each case there was no difference served divergence responses in the OL vs. OL-Ir mus- (e.g., MGF and myogenin), a greater excursion (e.g., cles. However, it seems clear that some regulatory cyclin D1 and p21), or a lack of response (e.g., actin and processes acted to downregulate cellular responses in MHC) in the OL-Ir muscles. the OL-Ir muscles in the 3- to 15-day time frame. It is The observation of correlations between increased possible that this is simply a result of the aborted myogenin and p21 expression suggests that the process mitotic processes in the incapacitated stem cell popu- of satellite cell differentiation is underway in over- lations. However, the magnitude of the changes (e.g., loaded skeletal muscles (2). In the current study the doubling of the RNA content; a 6- to 7-fold increase in increase in expression of myogenin was similar in OL phospho-S6K1) suggests that a signiﬁcant portion of and OL-Ir muscles. However, the increase in p21 this activity was occurring in the myoﬁbers because mRNA levels was much greater in the OL-Ir muscles these cells represent the majority of the tissue mass. and did not correlate with the changes in myogenin. In This conclusion is supported by the cyclin D1 and p21 general, the CKI p21 is thought to participate in the mRNA data (Figs. 11 and 12), which indicate that stem initiation of the differentiation process. Because it did cells within the OL-Ir muscles were continually at- not appear that the OL-Ir muscles were increasing tempting to enter the cell cycle throughout the study their complement of DNA (and therefore cell number), period. These cells would be expected to have elevated the increase in differentiation signaling appears to be a levels of growth-promoting signals and components; paradox. However, in this instance the greatly in- however, the OL-Ir data do not reﬂect a substantial creased p21 expression may be unrelated to the over- contribution from this cell population (e.g., mostly loading stimulus. For example, there is evidence that baseline values). This lack of contribution from muscle cellular responses to radiation-induced DNA damage stem cells agrees with results of previous studies such include withdrawal from the cell cycle to institute as that published by Phelan and Gonyea (35) in which repair processes (see, e.g., Ref. 31). This process is the incorporation of bromodeoxyuridine, a marker of mediated by p53, which is upstream from p21. There- mitotic activity, was greatly increased in OL but not fore, the increase in p21 expression seen in the OL-Ir OL-Ir muscles. muscles may reﬂect periods during which mechanisms Role of muscle stem cells. The premise that the fail- involved in attempts at chromosomal repair are active ure of stem cells to provide nuclei to myoﬁbers is the rather than processes involved in muscle hypertrophy. primary lesion imposed by the irradiation treatment An additional point of divergence in the response to implies that some processes related to myonuclear increased loading is evident in the expression of MHC function are limiting for the development of hypertro- proteins (Fig. 14). The exaggerated shift to slower phy. In the case of injury-regeneration studies, the MHC expression in the OL-Ir muscles represents a necessity for mitotic activity is relatively clear; muscle compensatory adaptation most likely stimulated by the cells are destroyed by toxins or mechanical damage inability of these muscles to increase their mass or and therefore must be replaced by the de novo devel- CSA. This shift would provide for greater energetic opment of myotubes via the proliferation, differentia- economy as the overloaded muscles cope with the de- tion, and fusion of muscle stem cells (satellite cells mands of increased loading. and/or MPCs). However, in the context of skeletal mus- The data from this study suggest several mechanis- cle compensatory hypertrophy, the requirement for mi- tically important conclusions. First, the initial ability totic activity is less obvious. If, in fact, the fusion of of the OL-Ir muscles to respond appropriately to the newly made myoblasts with existing myoﬁbers is re- increase in loading state indicates that the cellular quired for the hypertrophy response, then this would systems associated with anabolic processes (e.g., in- suggest that a number of nuclear processes were al- creased translation and transcription) were probably ready functioning at or near maximal capacity in the not damaged by the irradiation treatment. Second, the existing myoﬁbers before the increase in loading. This myonuclei of the OL-Ir muscles continued to partici- raises a number of intriguing questions. The most pate in the adaptation process via the shift in MHC obvious of these questions is what speciﬁc processes, protein expression. mediated by myonuclei, actually limit the development Unfortunately, the methods used in this study do not of myoﬁber hypertrophy. Second, why does a lack of allow for the differentiation of responses that would be newly formed myonuclei more or less permanently purely anabolic from those that were promoting at- prevent hypertrophy rather than just slowing the pro- AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1193 cess? For example, in the rat synergist ablation model, myoﬁbers (21, 47). In particular, the difference in cy- the absolute stimulus for the hypertrophic response is toplasm volume-to-myonucleus ratio between fast and essentially continuous, whereas the relative stimulus slow ﬁbers in mixed fast muscles, such as the rat declines as the muscle enlarges. Logic would suggest plantaris, is fairly pronounced (42, 58). It would there- that in response to this stimulus, the existing mecha- fore follow that the OL-Ir muscles from the current nisms for ﬁber hypertrophy would remain activated study might have been expected to have a decreased until the stimulus for adaptation declines. However, in cytoplasm volume-to-myonucleus ratio compared with irradiated muscles, this does not appear to be the case. the controls. However, despite a substantial shift to- The various markers of anabolism, such as enhanced ward slower MHC expression, the whole muscle DNA translation initiation (e.g., S6K1 and 4E-BP1) or concentration and single-ﬁber cytoplasmic volume-to- increased translational capacity (e.g., total RNA) ini- myonucleus ratio of the OL-Ir muscles were unchanged tially respond appropriately but then return to base- from controls. This suggests that the lower cytoplasmic line levels even though the overload stimulus appar- volume-to-myonucleus ratio seen in slow ﬁbers may ently continues. not be a necessary condition for the expression of the Nuclear function and hypertrophy. The results of this type I MHC isoform. study appear to support the hypothesis that the irra- Potential for adaptation after 3 mo. The data from diation protocol inhibits compensatory hypertrophy via the OL-Ir muscles indicated a tendency toward an the prevention of cell proliferation, ultimately depriv- upswing at 90 days for a number of measurements ing the myoﬁbers of their needed reserve for expansion (Figs. 4A,6B, 7, and 11–13). In the case of myogenin of the myonuclear pool. If this is the case, then an and cyclin D1 mRNA, these increases were signiﬁcant examination of potential mechanisms for this result is compared with the t 0 control values. This suggested warranted. that these muscles might be entering a new phase of One of the primary limitations imposed by the bulk potentially anabolic activity that could lead to a much amount of DNA present in a given myoﬁber is the delayed hypertrophy response. Accordingly, an addi- ability to produce the apparatus for mRNA translation tional cohort of rats was subjected to OL-Ir protocol to (28). Although protein production via mRNA is subject allow for an additional month (i.e., total of 4 mo) for the to potential ampliﬁcation via multiple translations by development of muscle hypertrophy. At 4 mo we ob- ribosomes, rRNA and tRNA are the ﬁnal gene prod- served no indication of a hypertrophic response (e.g., ucts; thus mass production requires many DNA tem- no increase in muscle mass) in the OL-Ir muscles of plates (14, 28). As reviewed by Booth et al. (7), there is these rats. Although these 4-mo observations demon- evidence that a general increase in translational efﬁ- strate that the increases in some cellular and molecu- ciency occurs at the onset of muscle hypertrophy. How- lar markers at 3 mo did not herald the delayed onset of ever, sustained increases in protein production appear a compensatory hypertrophy response, they did not to require substantial increases in the translational shed any light on the reason for these increases. machinery. For example, in the hypertrophying heart, In summary, the results of this study demonstrate early adaptations include an increase in translational that irradiation essentially prevents the development efﬁciency and an acceleration of the synthesis of new of compensatory hypertrophy in rodent skeletal mus- ribosomes (30, 50). In multinucleated myoﬁbers, cur- cles for up to 4 mo. This would suggest that neither rent dogma suggests that the number of copies of rRNA endogenous or extramuscular stem cells contribute sig- and tRNA genes can only be manipulated via changes niﬁcantly to the stem cell population of overloaded in the number of nuclei present. muscles, at least in this time frame. Localized irradi- There is evidence that higher volumes of transcrip- ation protocols do not appear to induce signiﬁcant tional activity will require an increase in space within damage to myoﬁbers or the intrinsic mechanisms nec- the nucleus (14). Thus it is possible that the physical essary for them to adapt to increased loading. The spacing within the myonuclei may become a limiting results of this study tend to support the hypothesis factor during times of high transcriptional activity. If that the mechanisms by which myoﬁbers adapt to the dense packing of macromolecules within myoﬁbers increased loading appear to include an obligatory restricts the expansion of nuclear volume, then it is “myogenic” component involving the proliferation, dif- possible that the addition of satellite cells and their ferentiation, and fusion of muscle stem cells with the nuclei to myoﬁbers might allow for the distribution of existing myoﬁbers. transcriptional loads, thus surmounting this obstacle. The authors thank Anqi Qin, Ming Zeng, Sam McCue, and Mike However, a number of reports indicate that the RNA Baker for invaluable technical assistance. produced by a myonucleus may have a fairly limited This work was supported by National Space Biomedical Research range of distribution within a myoﬁber (33, 37, 36). Institute Grant NCC9-58 (K. M. Baldwin) and National Institute of This would suggest that differential transcription re- Arthritis and Musculoskeletal and Skin Diseases Grants AR-45594 (G. R. Adams) and AR-46856 (V. J. Caiozzo). quiring mRNA translocation to other myonuclear do- mains might not be an option for dealing with nuclear space restrictions. REFERENCES As a general rule, slow myoﬁbers are thought to have 1. Adams GR and Haddad F. The relationships between IGF-1, a greater number of myonuclei per millimeter and a DNA content, and protein accumulation during skeletal muscle lower cytoplasm volume-to-myonucleus ratio than fast hypertrophy. J Appl Physiol 81: 2509–2516, 1996. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1194 IRRADIATION AND MUSCLE HYPERTROPHY 2. Adams GR, Haddad F, and Baldwin KM. Time course of muscle are not dependent upon satellite cell proliferation. Cell changes in markers of myogenesis in overloaded rat skeletal Tissue Res 296: 531–539, 1999. muscles. J Appl Physiol 87: 1705–1712, 1999. 27. Mitchell PO and Pavlath GK. A muscle precursor cell-depen- 3. Adams GR, Haddad F, McCue SA, Bodell PW, Zeng M, Qin dent pathway contributes to muscle growth after atrophy. Am J A, Qin X, and Baldwin KM. Effects of spaceﬂight and thyroid Physiol Cell Physiol 281: C1706–C1715, 2001. deﬁciency on rat hindlimb development. II. Expression of MHC 28. Montagne J. Genetic and molecular mechanisms of cell size isoforms. J Appl Physiol 88: 904–916, 2000. control. Mol Cell Biol Res Commun 4: 195–202, 2000. 4. Allen DL, Monke SR, Talmadge RJ, Roy RR, and Edgerton 29. Mozdziak PE, Schultz E, and Cassens RG. The effect of VR. Plasticity of myonuclear number in hypertrophied and at- in vivo and in vitro irradiation (25 Gy) on the subsequent in rophied mammalian skeletal muscle ﬁbers. J Appl Physiol 78: vitro growth of satellite cells. Cell Tissue Res 283: 203 – 208, 1969–1976, 1995. 5. Armstrong RB, Marum P, Tullson P, and Saubert CW. 30. Nagatomo Y, Carabello BA, Hamawaki M, Nemoto S, Mat- Acute hypertrophic response of skeletal muscle to removal of suo T, and McDermott PJ. Translational mechanisms accel- synergists. J Appl Physiol 46: 835–842, 1979. erate the rate of protein synthesis during canine pressure-over- 6. Baldwin KM, Valdez V, Herrick RE, MacIntosh AM, and load hypertrophy. Am J Physiol Heart Circ Physiol 277: H2176– Roy RR. Biochemical properties of overloaded fast twitch skel- H2184, 1999. etal muscle. J Appl Physiol 52: 467–472, 1982. 31. Niibe Y, Nakano T, Ohno T, Tsujii H, and Oka K. Relation- 7. Booth FW, Tseng BS, Fluck M, and Carson JA. Molecular ship between p21/WAF-1/CIP-1 and apoptosis in cervical cancer and cellular adaptation of muscle in response to physical train- during radiation therapy. Int J Radiat Oncol Biol Phys 44: ing. Acta Physiol Scand 162: 343–350, 1998. 297–303, 1999. 8. Chambers RL and McDermott JC. Molecular basis of skeletal 32. Pagel CN and Partridge TA. Covert persistence of mdx mouse muscle regeneration. Can J Appl Physiol 21: 155–184, 1996. myopathy is revealed by acute and chronic effects of irradiation. 9. Chomczynski P and Sacchi N. Single-step method of RNA J Neurol Sci 164: 103–116, 1999. isolation by acid guanidinium thiocyanate-phenol-chloroform ex- 33. Pavlath GK, Rich K, Webster SG, and Blau HM. Localiza- traction. Anal Biochem 162: 156–159, 1987. tion of muscle gene products in nuclear domains. Nature 337: 10. Dufner A and Thomas G. Ribosomal S6 kinase signaling and 570–573, 1989. the control of translation. Exp Cell Res 253: 100–109, 1999. 34. Petley T, Graff K, Jiang W, and Florini J. Variation among 11. Farrell PA, Hernandez JM, Fedele MJ, Vary TC, Kimball cell types in the signaling pathways by which IGF-I stimulates SR, and Jefferson LS. Eukaryotic initiation factors and pro- speciﬁc cellular responses. Horm Metab Res 31: 70–76, 1999. tein synthesis after resistance exercise in rats. J Appl Physiol 88: 35. Phelan JN and Gonyea WJ. Effect of radiation on satellite cell 1036–1042, 2000. activity and protein expression in overloaded mammalian skel- 12. Ferrari G, Cusells-De Angelis G, Coletta M, Paolucci E, etal muscle. Anat Rec 247: 179–188, 1997. Stornaiuolo A, Cossu G, and Mavilio F. Muscle regeneration 36. Ralston E and Hall ZW. Restricted distribution of mRNA by bone marrow-derived myogenic progenitors. Science 279: produced from a single nucleus in hybrid myotubes. J Cell Biol 1528–1530, 1998. 119: 1063–1068, 1992. 13. Gingras AC, Kennedy SG, O’Leary MA, Sonenberg N, and 37. Ralston E, McLaren RS, and Horowitz JA. Nuclear domains Hay N. 4E-BP1, a repressor of mRNA translation, is phosphor- in skeletal myotubes: the localization of transferrin receptor ylated and inactivated by the Akt(PKB) signaling pathway. mRNA is independent of its half-life and restricted by binding to Genes Dev 12: 502–513, 1998. ribosomes. Exp Cell Res 236: 453–462, 1997. 14. Gregory TR. Coincidence, coevolution, or causation? DNA con- 38. Robertson TA, Grounds MD, and Papadimitriou JM. Elu- tent, cell size, and the C-value enigma. Biol Rev Camb Philos Soc cidation of aspects of murine skeletal muscle regeneration using 76: 65–101, 2001. local and whole body irradiation. J Anat 181: 265–276, 1992. 15. Gulati AK. The effect of X-irradiation on skeletal muscle regen- 39. Rosenblatt DJ and Parry DJ. Gamma irradiation prevents eration in the adult rat. J Neurol Sci 78: 111–120, 1987. compensatory hypertrophy of overloaded mouse extensor digito- 16. Haddad F and Adams GR. Acute cellular and molecular re- rum longus muscle. J Appl Physiol 73: 2538–2543, 1992. sponses to resistance exercise. J Appl Physiol 93: 394–403, 2002. 40. Rosenblatt JD and Parry DJ. Adaptation of rat extensor 17. Haddad F, Herrick RE, Adams GR, and Baldwin KM. digitorum longus muscle to gamma irradiation and overload. Myosin heavy chain expression in rodent skeletal muscle: effects Pﬂu ¨ gers Arch 423: 255–264, 1993. of zero gravity. J Appl Physiol 75: 2471–2477, 1993. 41. Rosenblatt JD, Yong D, and Parry DJ. Satellite cell activity 18. Hameed M, Harridge SDR, and Goldspink G. Sarcopenia is required for hypertrophy of overloaded adult rat skeletal and hypertrophy: a role for insulin-like growth factor-1 in aged muscle. Muscle Nerve 17: 608–613, 1994. muscle? Exerc Sport Sci Rev 30: 15–19, 2002. 42. Roy RR, Monke SR, Allen DL, and Edgerton VR. Modula- 19. Hashemolhosseini S, Nagamine Y, Morley SJ, Desrivie ` res tion of myonuclear number in functionally overloaded and exer- S, Mercep L, and Ferrari S. Rapamycin inhibition of the G to cised rat plantaris ﬁbers. J Appl Physiol 87: 634–642, 1999. S transition is mediated by effects on cyclin D1 mRNA and 43. Sabourin LA and Rudnicki MA. The molecular regulation of protein stability. J Biol Chem 273: 14424–14429, 1998. myogenesis. Clin Genet 57: 16–25, 2000. 20. Heslop L, Morgan JE, and Partridge TA. Evidence for a 44. Salleo A, LaSpada G, Falzea G, Denaro MG, and Cic- myogenic stem cell that is exhausted in dystrophic muscle. J Cell ciarello R. Response of satellite cells and muscle ﬁbers to Sci 113: 2299–2308, 2000. long-term compensatory hypertrophy. J Submicrosc Cytol 21. Hughes SM and Schiafﬁno S. Control of muscle ﬁber size: a Pathol 15: 929–940, 1983. crucial factor in ageing. Acta Physiol Scand 167: 307–312, 1999. 45. Schiafﬁno S, Bormioli SP, and Aloisi M. Cell proliferation in 22. Karin M. The regulation of AP-1 activity by mitogen-activated rat skeletal muscle during early stages of compensatory hyper- protein kinases. Philos Trans R Soc Lond B Biol Sci 351: 127– trophy. Virchows Arch B Cell Pathol 11: 268–273, 1972. 134, 1996. 46. Schiafﬁno S, Bormioli SP, and Aloisi M. The fate of newly 23. Kawasome H, Papst P, Webb S, Keller GM, Johnson GL, formed satellite cells during compensatory muscle hypertrophy. and Gelfand EW. Targeted disruption of p70s6k deﬁnes its role Virchows Arch B Cell Pathol 21: 113–118, 1976. in protein synthesis and rapamycin sensitivity. Proc Natl Acad 47. Schmalbruch H and Lewis DM. Dynamics of nuclei of muscle Sci USA 95: 5033–5038, 1998. 24. Laemmli UK. Cleavage of structural proteins during the assem- ﬁbers and connective tissue cells in normal and denervated rat bly of the head of bacteriophage T4. Nature 227: 680–685, 1970. muscles. Muscle Nerve 23: 617–626, 2000. 25. Lewis RB. Changes in striated muscle following single intense 48. Schultz E. Satellite cell behavior during skeletal muscle growth doses of X-rays. Lab Invest 3: 48–55, 1954. and regeneration. Med Sci Sports Exerc 21: S181–S186, 1989. 26. Lowe DA and Alway SE. Stretch-induced myogenin, MyoD, 49. Schultz E and McCormick KM. Skeletal muscle satellite cells. and MRF4 expression and acute hypertrophy in quail slow-tonic Rev Physiol Biochem Pharmacol 123: 213–257, 1994. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1195 50. Siehl D, Chua BH, Lautensack-Belser N, and Morgan HE. 57. Thomason DB, Herrick RE, and Baldwin KM. Activity in- Faster protein and ribosome synthesis in thyroxine-induced hy- ﬂuences on soleus muscle myosin during rodent hindlimb sus- pertrophy of rat heart. Am J Physiol Cell Physiol 248: C309– pension. J Appl Physiol 63: 138–144, 1987. C319, 1985. 58. Tseng BS, Kasper CE, and Edgerton VR. Cytoplasm to myo- 51. Snow MH. Satellite cell response in rat soleus muscle undergo- nucleus ratios and succinate dehydrogenase activities in adult ing hypertrophy due to surgical ablation of synergists. Anat Rec rat slow and fast muscle ﬁbers. Cell Tissue Res 275: 39–49, 1994. 227: 437–446, 1990. 59. Wright C, Haddad F, Qin A, and Baldwin KM. Analysis of 52. Solaro RJ, Pang DC, and Briggs FN. The puriﬁcation of myosin heavy chain mRNA expression by RT-PCR. J Appl cardiac myoﬁbrils with Triton X-100. Biochim Biophys Acta 245: Physiol 83: 1389–1396, 1997. 259–262, 1971. 60. Yau L, Lukes H, McDiarmid H, Werner J, and Zahradka P. 53. Sonnenberg N and Ginggras AC. The mRNA 5 cap-binding Insulin-like growth factor-I (IGF-I)-dependent activation of protein eIF4E and control of cell growth. Curr Opin Cell Biol 10: pp42/44 mitogen-activated protein kinase occurs independently 268–275, 1998. of IGF-I receptor kinase activation and IRS-1 tyrosine phosphor- 54. Stockdale FE and Holtzer H. DNA synthesis and myogenesis. ylation. Eur J Biochem 266: 1147–1157, 1999. Exp Cell Res 24: 508–520, 1961. 61. Zahradka P, Larson DE, and Sells BH. Regulation of ribo- 55. Talmadge RJ and Roy RR. Electrophoretic separation of rat some biogenesis in differentiated rat myotubes. Mol Cell Bio- skeletal muscle myosin heavy-chain isoforms. J Appl Physiol 75: chem 104: 189–194, 1991. 2337–2340, 1993. 62. Zheng Z, Messi ML, and Delbono O. Age-dependent IGF-1 56. Thomas G and Hall MN. TOR signaling and control of cell regulation of gene transcription of Ca channels in skeletal growth. Curr Opin Cell Biol 9: 782–787, 1997. muscle. Mech Ageing Dev 122: 373–384, 2001. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png AJP Cell Physiology Unpaywall http://www.deepdyve.com/lp/unpaywall/cellular-and-molecular-responses-to-increased-skeletal-muscle-loading-Syxla9Hse9

Loading next page...

References (68)

Stefano Schiaffino, S. Bormioli, M. Aloisi (1972)
Cell proliferation in rat skeletal muscle during early stages of compensatory hypertrophy
Virchows Archiv B, 11
D. Lowe, S. Alway (1999)
Stretch-induced myogenin, MyoD, and MRF4 expression and acute hypertrophy in quail slow-tonic muscle are not dependent upon satellite cell proliferation
Cell and Tissue Research, 296
J. Rosenblatt, David Parry (1993)
Adaptation of rat extensor digitorum longus muscle to gamma irradiation and overload
Pflügers Archiv, 423
K. Baldwin, V. Valdez, R. Herrick, A. Macintosh, R. Roy (1982)
Biochemical properties of overloaded fast-twitch skeletal muscle.
Journal of applied physiology: respiratory, environmental and exercise physiology, 52 2
F Haddad, GR. Adams (2002)
Acute cellular and molecular responses to resistance exercise.
, 93
J. Montagne (2000)
Genetic and molecular mechanisms of cell size control.
Molecular cell biology research communications : MCBRC, 4 4
George Thomas, Michael Hall (1997)
TOR signalling and control of cell growth.
Current opinion in cell biology, 9 6
Frank Stockdale, Howard Holtzer (1961)
DNA synthesis and myogenesis.
Experimental cell research, 24
J. Rosenblatt, D. Parry (1992)
Gamma irradiation prevents compensatory hypertrophy of overloaded mouse extensor digitorum longus muscle.
Journal of applied physiology, 73 6
Almut Dufner, George Thomas (1999)
Ribosomal S6 kinase signaling and the control of translation.
Experimental cell research, 253 1
F. Booth, B. Tseng, M. Flück, J. Carson (1998)
Molecular and cellular adaptation of muscle in response to physical training.
Acta physiologica Scandinavica, 162 3
E. Schultz, K. McCormick (1994)
Skeletal muscle satellite cells.
Reviews of physiology, biochemistry and pharmacology, 123
F Haddad, RE Herrick, GR Adams, KM. Baldwin (1993)
Myosin heavy chain expression in rodent skeletal muscle: effects of zero gravity.
, 75
F. Haddad, G. Adams (2002)
Selected contribution: acute cellular and molecular responses to resistance exercise.
Journal of applied physiology, 93 1
Paul Mozdziak, Edward Schultz, R. Cassens (1996)
The effect of in vivo and in vitro irradiation (25 Gy) on the subsequent in vitro growth of satellite cells
Cell and Tissue Research, 283
Y. Niibe, Y. Niibe, Takashi Nakano, Tatsuya Ohno, H. Tsujii, Kuniyuki Oka (1999)
Relationship between p21/WAF-1/CIP-1 and apoptosis in cervical cancer during radiation therapy.
International journal of radiation oncology, biology, physics, 44 2
M. Snow (1990)
Satellite cell response in rat soleus muscle undergoing hypertrophy due to surgical ablation of synergists
The Anatomical Record, 227
Y. Nagatomo, B. Carabello, M. Hamawaki, S. Nemoto, T. Matsuo, P. McDermott (1999)
Translational mechanisms accelerate the rate of protein synthesis during canine pressure-overload hypertrophy.
American journal of physiology. Heart and circulatory physiology, 277 6
Patrick Mitchell, G. Pavlath (2001)
A muscle precursor cell-dependent pathway contributes to muscle growth after atrophy.
American journal of physiology. Cell physiology, 281 5
L. Yau, L. Yau, Helena Lukes, Helena Lukes, Heather McDiarmid, Julieta Werner, Peter Zahradka, Peter Zahradka (1999)
Insulin-like growth factor-I (IGF-I)-dependent activation of pp42/44 mitogen-activated protein kinase occurs independently of IGF-I receptor kinase activation and IRS-1 tyrosine phosphorylation.
European journal of biochemistry, 266 3
G. Adams, F. Haddad, S. McCue, P. Bodell, M. Zeng, L. Qin, A. Qin, K. Baldwin (2000)
Effects of spaceflight and thyroid deficiency on rat hindlimb development. II. Expression of MHC isoforms.
Journal of applied physiology, 88 3
Peter Zahradkal, D. Larson, B. Sells (2004)
Regulation of ribosome biogenesis in differentiated rat myotubes
Molecular and Cellular Biochemistry, 104
J. Rosenblatt, David Yong, D. Parry (1994)
Satellite cell activity is required for hypertrophy of overloaded adult rat muscle
Muscle & Nerve, 17
L. Heslop, Jennifer Morgan, Terence Partridge (2000)
Evidence for a myogenic stem cell that is exhausted in dystrophic muscle.
Journal of cell science, 113 ( Pt 12)
H. Kawasome, P. Papst, Saiphone Webb, G. Keller, G. Johnson, E. Gelfand, N. Terada (1998)
Targeted disruption of p70(s6k) defines its role in protein synthesis and rapamycin sensitivity.
Proceedings of the National Academy of Sciences of the United States of America, 95 9
M. Karin (1995)
The Regulation of AP-1 Activity by Mitogen-activated Protein Kinases (*)
The Journal of Biological Chemistry, 270
JD Rosenblatt, D Yong, DJ. Parry (1994)
Satellite cell activity is required for hypertrophy of overloaded adult rat skeletal muscle.
, 17
R. Talmadge, R. Roy (1993)
Electrophoretic separation of rat skeletal muscle myosin heavy-chain isoforms.
Journal of applied physiology, 75 5
R. Solaro, R. Solaro, D. Pang, D. Pang, F. Briggs, F. Briggs (1971)
The purification of cardiac myofibrils with Triton X-100.
Biochimica et biophysica acta, 245 1
J. Phelan, W. Gonyea (1997)
Effect of radiation on satellite cell activity and protein expression in overloaded mammalian skeletal muscle
The Anatomical Record, 247
L. Sabourin, M. Rudnicki (2000)
The molecular regulation of myogenesis
Clinical Genetics, 57
T. Robertson, Miranda Grounds, John Papadimitriou (1992)
Elucidation of aspects of murine skeletal muscle regeneration using local and whole body irradiation.
Journal of anatomy, 181 ( Pt 2)
Evelyn Ralston, Z. Hall (1992)
Restricted distribution of mRNA produced from a single nucleus in hybrid myotubes
The Journal of Cell Biology, 119
A. Salleo, G. Spada, G. Falzea, M. Denaro, R. Cicciarello (1983)
Response of satellite cells and muscle fibers to long-term compensatory hypertrophy.
Journal of submicroscopic cytology, 15 4
Stefano Schiaffino, S. Bormioli, M. Aloisi (1976)
The fate of newly formed satellite cells during compensatory muscle hypertrophy
Virchows Archiv B, 21
A. Gingras, S. Kennedy, Maura O'Leary, N. Sonenberg, N. Hay (1998)
4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway.
Genes & development, 12 4
C1195 IRRADIATION AND MUSCLE HYPERTROPHY
N. Sonenberg, A. Gingras (1998)
The mRNA 5' cap-binding protein eIF4E and control of cell growth.
Current opinion in cell biology, 10 2
T. Petley, K. Graff, W. Jiang, Haifeng Yang, J. Florini (1999)
Variation Among Cell Types in the Signaling Pathways by which IGF-I Stimulates Specific Cellular Responses*
Hormone and Metabolic Research, 31
M. Hameed, S. Harridge, G. Goldspink (2002)
Sarcopenia and Hypertrophy: A Role for Insulin-Like Growth Factor-1 in Aged Muscle?
Exercise and Sport Sciences Reviews, 30
H. Schmalbruch, D. Lewis (2000)
Dynamics of nuclei of muscle fibers and connective tissue cells in normal and denervated rat muscles
Muscle & Nerve, 23
G. Pavlath, K. Rich, S. Webster, H. Blau (1989)
Localization of muscle gene products in nuclear domains
Nature, 337
P. Chomczyński, N. Sacchi (1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Analytical biochemistry, 162 1
D. Allen, S. Monke, R. Talmadge, R. Roy, V. Edgerton (1995)
Plasticity of myonuclear number in hypertrophied and atrophied mammalian skeletal muscle fibers.
Journal of applied physiology, 78 5
G. Ferrari, G. Cusella, D. Angelis, M. Coletta, E. Paolucci, A. Stornaiuolo, G. Cossu, F. Mavilio (1998)
Muscle regeneration by bone marrow-derived myogenic progenitors.
Science, 279 5356
G. Adams, F. Haddad (1996)
The relationships among IGF-1, DNA content, and protein accumulation during skeletal muscle hypertrophy.
Journal of applied physiology, 81 6
Lewis Rb (1954)
Changes in striated muscle following single intense doses of x-rays.
Laboratory Investigation, 3
Charles Pagel, Terence Partridge (1999)
Covert persistence of mdx mouse myopathy is revealed by acute and chronic effects of irradiation
Journal of the Neurological Sciences, 164
Roland Roy, S. Monke, David Allen, V. Edgerton (1999)
Modulation of myonuclear number in functionally overloaded and exercised rat plantaris fibers.
Journal of applied physiology, 87 2
G. Adams, F. Haddad, S. McCue, P. Bodell, M. Zeng, L. Qin, A. Qin, K. Baldwin
Effects of spaceﬂight and thyroid deﬁciency on rat hindlimb development. II. Expression of MHC isoforms on
F. Haddad, R. Herrick, And ADAMS, K. Baldwin, Robert Adia, Gregory Herrick, M. Adamskenneth, Baldwin, Myosin (1993)
Myosin heavy chain expression in rodent skeletal muscle: effects of exposure to zero gravity.
Journal of applied physiology, 75 6
P. Farrell, J. Hernandez, M. Fedele, T. Vary, S. Kimball, L. Jefferson (2000)
Eukaryotic initiation factors and protein synthesis after resistance exercise in rats.
Journal of applied physiology, 88 3
Simon Hughes, Stefano Schiaffino (1999)
Control of muscle fibre size: a crucial factor in ageing.
Acta physiologica Scandinavica, 167 4
Edward Schultz (1989)
Satellite cell behavior during skeletal muscle growth and regeneration.
Medicine and science in sports and exercise, 21 5 Suppl
C. Wright, F. Haddad, A. Qin, K. Baldwin (1997)
Analysis of myosin heavy chain mRNA expression by RT-PCR.
Journal of applied physiology, 83 4
Zhenlin Zheng, M. Messi, O. Delbono (2001)
Age-dependent IGF-1 regulation of gene transcription of Ca2+ channels in skeletal muscle
Mechanisms of Ageing and Development, 122
S. Hashemolhosseini, Y. Nagamine, S. Morley, S. Desrivières, L. Mercep, S. Ferrari (1998)
Rapamycin Inhibition of the G1 to S Transition Is Mediated by Effects on Cyclin D1 mRNA and Protein Stability*
The Journal of Biological Chemistry, 273
Rebecca Chambers, J. McDermott (1996)
Molecular basis of skeletal muscle regeneration.
Canadian journal of applied physiology = Revue canadienne de physiologie appliquee, 21 3
T. Gregory (2001)
Coincidence, coevolution, or causation? DNA content, cellsize, and the C‐value enigma
Biological Reviews, 76
A. Gulati (1987)
The effect of X-irradiation on skeletal muscle regeneration in the adult rat
Journal of the Neurological Sciences, 78
Evelyn Ralston, Robert McLaren, Jill Horowitz (1997)
Nuclear domains in skeletal myotubes: the localization of transferrin receptor mRNA is independent of its half-life and restricted by binding to ribosomes.
Experimental cell research, 236 2
D. Thomason, R. Herrick, K. Baldwin (1987)
Activity influences on soleus muscle myosin during rodent hindlimb suspension.
Journal of applied physiology, 63 1
D. Siehl, B. Chua, N. Lautensack-Belser, H. Morgan (1985)
Faster protein and ribosome synthesis in thyroxine-induced hypertrophy of rat heart.
The American journal of physiology, 248 3 Pt 1
G. Adams, F. Haddad, K. Baldwin (1999)
Time course of changes in markers of myogenesis in overloaded rat skeletal muscles.
Journal of applied physiology, 87 5
U. Laemmli (1970)
Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4
Nature, 227
Brian Tseng, Christine Kasper, V. Edgerton (2004)
Cytoplasm-to-myonucleus ratios and succinate dehydrogenase activities in adult rat slow and fast muscle fibers
Cell and Tissue Research, 275
R. Armstrong, P. Marum, P. Tullson, C. Saubert (1979)
Acute hypertrophic response of skeletal muscle to removal of synergists.
Journal of applied physiology: respiratory, environmental and exercise physiology, 46 4
R. Lewis (1954)
Changes in striated muscle following single intense doses of x-rays.
Laboratory investigation; a journal of technical methods and pathology, 3 1

Publisher: Unpaywall
ISSN: 0363-6143
DOI: 10.1152/ajpcell.00173.2002
Publisher site: See Article on Publisher Site

Abstract

UC Irvine ICTS Publications Title Permalink https://escholarship.org/uc/item/9sg699q3 Journal American Journal of Physiology-Cell Physiology, 283(4) ISSN 0363-6143 1522-1563 Authors Adams, Gregory R Caiozzo, Vincent J Haddad, Fadia et al. Publication Date 2002-10-01 DOI 10.1152/ajpcell.00173.2002 Copyright Information This work is made available under the terms of a Creative Commons Attribution License, availalbe at https://creativecommons.org/licenses/by/4.0/ Peer reviewed eScholarship.org Powered by the California Digital Library University of California Am J Physiol Cell Physiol 283: C1182–C1195, 2002. First published June 26, 2002; 10.1152/ajpcell.00173.2002. Cellular and molecular responses to increased skeletal muscle loading after irradiation 1 1,2 GREGORY R. ADAMS, VINCENT J. CAIOZZO, 1 1 FADIA HADDAD, AND KENNETH M. BALDWIN 1 2 Departments of Physiology and Biophysics and Orthopaedics, College of Medicine, University of California, Irvine, California 92697 Received 16 April 2002; accepted in ﬁnal form 15 June 2002 Adams, Gregory R., Vincent J. Caiozzo, Fadia cellular injury in vivo, interfered with the regeneration Haddad, and Kenneth M. Baldwin. Cellular and molecu- of skeletal muscle (see, e.g., Refs. 15, 25, 32). Because lar responses to increased skeletal muscle loading after irra- there is an absence of overt cellular damage, it was diation. Am J Physiol Cell Physiol 283: C1182–C1195, 2002. postulated that the failure of myoﬁbers to regenerate First published June 26, 2002; 10.1152/ajpcell.00173.2002.— resulted from damage to DNA that prevents satellite Irradiation of rat skeletal muscles before increased loading cell proliferation. It would follow then that mature, has been shown to prevent compensatory hypertrophy for permanently differentiated mammalian myoﬁbers periods of up to 4 wk, possibly by preventing satellite cells would not appear to be the locus of the radiation- from proliferating and providing new myonuclei. Recent induced mitotic failure (8, 54). Thus the inhibitory work suggested that stem cell populations exist that might effects of radiation on muscle regeneration were pro- allow irradiated muscles to eventually hypertrophy over posed to be a result of the incapacitation of satellite cell time. We report that irradiation essentially prevented hyper- trophy in rat muscles subjected to 3 mo of functional overload mitotic activity. (OL-Ir). The time course and magnitude of changes in cellu- The theory that radiation-induced inhibition of cel- lar and molecular markers of anabolic and myogenic re- lular proliferation can inhibit mammalian muscle ad- sponses were similar in the OL-Ir and the contralateral aptation and repair has recently been extended to nonirradiated, overloaded (OL) muscles for the ﬁrst 3–7 include the prevention of compensatory muscle hyper- days. These markers then returned to control levels in OL-Ir trophy after increased loading. In support of this the- muscles while remaining elevated in OL muscles. The num- ory, a number of studies have demonstrated that the ber of myonuclei and amount of DNA were increased mark- muscle hypertrophy process appears to involve the edly in OL but not OL-Ir muscles. Thus it appears that stem addition of nuclei to existing myoﬁbers (see, e.g., Refs. cells were not added to the irradiated muscles in this time 44–46, 51) and that prior irradiation can prevent this period. These data are consistent with the theory that the adaptation (35, 38–41). For example, a series of papers addition of new myonuclei may be required for compensatory published by Rosenblatt et al. (39–41) showed that, in hypertrophy in the rat. response to functional overload, irradiated myoﬁbers myonuclei; satellite cell do not hypertrophy or increase their myonuclear num- ber but do alter their myosin heavy chain (MHC) iso- form proﬁle from a faster to a slower phenotype. These MATURE MAMMALIAN SKELETAL muscle cells are multinu- results suggest that the irradiated myoﬁbers adapt in a cleated myoﬁbers that are formed via the fusion of manner similar to that of nonirradiated myoﬁbers with individual myoblast cells during development. Evi- regard to the qualitative expression of contractile pro- dence suggests that these multinucleated myoﬁbers tein isoforms but are unable to increase the quantity of are permanently differentiated and therefore incapa- protein accumulated in the myoﬁbers. Similarly, ble of mitotic activity (8, 21, 54). During muscle regen- Phelan and Gonyea (35) found that after 4 wk of eration after injury, myoﬁbers can be repaired and/or overload, muscle hypertrophy was absent and cell pro- replaced via the fusion of muscle stem cells (satellite liferation was signiﬁcantly less in irradiated vs. control cells) either with existing damaged myoﬁbers or with muscles. In addition to the inhibition of either regen- each other to form new myoﬁbers (43, 48, 49). eration or hypertrophy, it has also been reported that The impetus for much of the current interest in the irradiation prevents the recovery of muscle mass from role of satellite cells in muscle adaptation has its roots unloading-induced atrophy in mice (27). In avian mus- in the muscle regeneration literature. The results from cles, irradiation appears to prevent stretch-induced a number of studies using muscle injury models indi- cellular proliferation, but only a relatively small pro- cated that relatively modest doses of radiation, well portion of the hypertrophy response is affected (26). below the threshold of those required to induce overt The costs of publication of this article were defrayed in part by the Address for reprint requests and other correspondence: G. R. payment of page charges. The article must therefore be hereby Adams, Dept. of Physiology and Biophysics, Medical Sciences I C308, marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734 Univ. of California, Irvine, CA 92697 (E-mail: [email protected]). solely to indicate this fact. C1182 0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society http://www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1183 Recent reports indicated that there are stem cell the gastrocnemius and soleus muscles as described previ- ously (6). populations within skeletal muscle that appear to be Tissue collection. Groups of rats were killed by injection of resistant to radiation-induced damage (20). In addi- Pentosol (Med-Pharmex) at 6 and 24 h and at 3, 7, 15, and 90 tion, there are data to indicate that stem cells from days after the irradiation procedure. Two groups of untreated extramuscular tissues can be incorporated into skele- rats were used as controls and were killed at the beginning of tal muscles, and once there they function as muscle the study (t 0) and the end of the 90-day period. On the stem cells (12). These results suggest that a pool of basis of the results seen in the primary study, additional mitotically competent stem cells could be available for groups of six rats each were used in a follow-up study to the eventual restoration of the compensatory hypertro- determine whether measurable hypertrophy developed after 4 mo of functional overload. phy response in muscles that have been previously At the appropriate time point the plantaris muscles of the irradiated. irradiated and contralateral legs were dissected free of con- The ﬁnding that hypertrophy of mammalian skeletal nective tissue, weighed, and snap frozen. Muscles were muscle may require the incorporation of stem cells stored at 80°C for subsequent analysis. gives rise to some important hypotheses: 1) the number Biochemical and molecular analyses. Tissue samples were of myonuclei present in a muscle ﬁber is a limiting analyzed for total DNA and protein content as described factor for protein production, indicating that there is previously (1). Myoﬁbrillar protein content was deter- not a signiﬁcant reserve capacity for growth processes mined via modiﬁcation of the method described by Solaro dependent on nuclear functions; and 2) over the time et al. (52; see Ref. 57). Total RNA isolation. Measurements of total RNA content periods studied to date (i.e., up to 4 wk), muscles do provide insights on the translational capacity of tissue. Total not have a source of stem cells other than that which RNA was extracted from preweighed frozen muscle samples is present in the muscle domain at the time of irra- with the TRI reagent (Molecular Research Center, Cincin- diation. nati, OH) according to the company’s protocol, which is based Therefore, the current study was designed to address on the method described by Chomczynski and Sacchi (9). portions of these two hypotheses. First we hypothe- Extracted RNA was precipitated from the aqueous phase sized that it should be possible to detect and evaluate with isopropanol and, after washing with ethanol, dried and adaptive responses that involve nuclear function, such suspended in a known volume of nuclease-free water. The RNA concentration was determined by optical density at 260 as increased RNA levels, generated within myoﬁbers in nm (using an OD unit equivalent to 40 g/ml). The muscle overloaded-irradiated muscles. Second, we postulated total RNA concentration was calculated based on total RNA that previous studies may not have allowed sufﬁcient yield and the weight of the analyzed sample. The RNA time for either an intrinsic radiation-resistant popula- samples were stored frozen at 80°C to be used subsequently tion of satellite cells or an extramuscular stem cell in determining both total mRNA (poly A) and speciﬁc mRNA source to contribute to the development of compensa- expression with slot blotting and relative reverse transcrip- tory hypertrophy. Accordingly, a study was performed tion (RT)-polymerase chain reaction (PCR) procedures. with the functional overload model, in which the plan- RNA slot blotting. RNA slot blotting techniques were used taris muscles were bilaterally overloaded and one leg to elucidate the contribution of various fractions of RNA to the changes seen in response to treatments. In the current was then exposed to irradiation while the rest of the study this analysis was aimed at measuring the total amount animal was protected from the radiation dose. The of mRNA as well as two markers of contractile protein mes- muscles from subgroups of these rats were studied at sage. One microgram of total RNA was denatured in twenty speciﬁc time points spanning a period of 90 days after microliters of denaturing buffer (18% formaldehyde, 10 treatment. SSC) at 60°C for 15 min. Samples were brought up to 100-l volume with 6 SSC and were applied onto a positively METHODS charged nylon membrane (GeneScreen plus; NEN) with a slot blot apparatus (Schleicher and Schuell). Two blot series Forty-eight female Sprague-Dawley rats (212 3 g body were performed for each sample. After UV ﬁxation, each wt) were randomly assigned to one of eight groups (n 6 per membrane was hybridized consecutively with 1) either an group) for the primary experiments in this study. All proce- antisense -skeletal actin mRNA probe to determine -skel- dures were approved by the University of California, Irvine, etal actin mRNA expression or an antisense MHC mRNA Institutional Animal Care and Use Committee. In six of these probe common to all MHC; 2) an oligo dT probe (12- to groups one leg was exposed to -radiation as follows. 18-mer; Life Technology) that was used to detect poly A RNA Treatment. In the six groups chosen for treatment, the left (total mRNA population); and 3) an antisense 18S ribosomal hindlimb of the animals was exposed to 25-Gy (2.5 Gy/min) RNA probe. The signal of this probe is directly proportional to ionizing irradiation with a Mark I irradiator (model 68, J. L. the amount of total RNA and thus was used to normalize for Shepard and Associates, Glendale, CA). The exact dose of possible variability in the amount of loaded RNA per slot. irradiation was determined with Fricke dosimetry solution. Probes were 5 end-labeled with P with -ATP and T4 Irradiation was focused onto the hindlimb of each animal polynucleotide kinase. Hybridization and washing proce- with a collimator, thus allowing the irradiation to be focused dures were carried out as described previously (17). Hybrid- onto the hindlimb musculature without exposing the rest of ization signals were detected and analyzed with a phosphor- the body. After induction of anesthesia (40 mg/kg ketamine-2 imager and Image Quant analysis software (Molecular Dy- mg/kg acepromazine), the animal was positioned such that namics). The slot blot hybridization signal for these probes the left hindlimb was aligned with the slit of the collimator. was strongly correlated with the amount of loaded total RNA, Immediately after the irradiation procedure, rats had the ranging from 0.25 to 2 g per slot. For each sample, the MHC plantaris muscles of both legs overloaded via the removal of mRNA, actin mRNA, and dT (poly A) signals were normal- AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1184 IRRADIATION AND MUSCLE HYPERTROPHY ized to the corresponding 18S signal. The mRNA per muscle For the 18S ampliﬁcation we used the alternate 18S inter- as reported for MHC and -skeletal actin mRNA was based nal standards (Ambion), which yield a 324-bp product. The on the total RNA content per muscle and the mRNA ratio 18S primers were mixed with competimers at an optimized to 18S. ratio that could range from 1:4 to 1:10, depending on the The sequences of the oligonucleotide probes used for hy- abundance of the target mRNA. Inclusion of 18S competim- bridization were as follows: -skeletal actin antisense probe: ers was necessary to bring down the 18S signal, which allows GGCTGGCTTTAATGCTTCAAGT (based on reported actin its linear ampliﬁcation to the same range as the coampliﬁed mRNA sequence; GenBank accession no. V01224); MHC an- target mRNA (relative RT-PCR kit protocol; Ambion). tisense probe (common to all rat MHC): TGGTGTCCTGCTC- For each speciﬁc target mRNA, RT and PCR were carried CTTCTT (based on type I MHC mRNA sequence position under identical conditions with the same reagent premix for 5306–5324; GenBank accession no. NM017239; complemen- all the samples to be compared in the study. To validate the tary to coding region 500 nt upstream from stop codon and consistency of the analysis procedures, at least one represen- 100% identical in all MHC isoforms including adult and tative from each group was included in each RT-PCR run. developmental; signal obtained with this common MHC One microliter of each RT reaction (0- to 10-fold dilution probe is indicative of total population of MHC mRNA ex- depending on target mRNA abundance) was used for the pressed in muscle); 18S rRNA antisense probe: GTGCAGC- PCR ampliﬁcation. PCR was carried out in the presence of CCCGGACATCTAAG (based on rat ribosomal RNA se- 2mMMgCl 2 with standard PCR buffer (GIBCO), 0.2 mM quence; GenBank accession no. M11188). dNTP, 1 M speciﬁc primer set, 0.5 M 18S primer- Reverse transcription. One microgram of total RNA was competimer mix, and 0.75 U of DNA Taq polymerase reverse transcribed for each muscle sample with SuperScript (GIBCO) in a total volume of 25 l. Ampliﬁcations were II RT from GIBCO-BRL and a mix of oligo dT (100 ng/ carried out in a Stratagene Robocycler with an initial reaction) and random primers (200 ng/reaction) in a 20-l denaturing step of 3 min at 96°C, followed by 25 cycles of total reaction volume at 45°C for 50 min, according to the 1 min at 96°C, 1 min at 55°C (55 – 60°C depending on provided protocol. At the end of the RT reaction, the tubes primers), 1 min at 72°C, and a ﬁnal step of 3 min at 72°C. were heated at 90°C for 5 min to stop the reaction and then PCR products were separated on a 2 – 2.5% agarose gel by were stored at 80°C until used in the PCR for speciﬁc electrophoresis and stained with ethidium bromide, and mRNA analyses. signal quantiﬁcation was conducted by laser scanning den- Polymerase chain reaction. A relative RT-PCR method sitometry, as reported previously (59). In this approach, using 18S as an internal standard (Ambion, Austin, TX) was each speciﬁc mRNA signal is normalized to its correspond- applied to study the expression of speciﬁc mRNAs for IGF-I, ing 18S. For each primer set, PCR conditions (cDNA dilu- IGF-I receptor, IGF binding proteins (BP-4 and BP-5), myo- tions, 18S competimer-primer mix, MgCl 2 concentration, genin, cyclin D1, and p21. The sequences for the various and annealing temperature) were set to optimal condi- primers used for the speciﬁc target mRNAs are shown in tions, so that both the target mRNA and 18S product yields Table 1. These primers were designed with the Primer Select were in the linear range of the semilog plot when the yield computer program (DNA Star), purchased from Life Technol- is expressed as a function of the number of cycles. ogy GIBCO, and were tested for their compatibility with the Phosphorylation state of intracellular signaling proteins. alternate 18S primers. It should be noted that for IGF BP-4, The phosphorylation states of the p70-S6 kinase (S6K1) and the primers’ sequence is based on the mouse X76066 se- extracellular signal-regulated kinases 1 and 2 (ERK1/2) were quence. These mouse primers were selected on the basis of examined by immunoblotting with phosphospeciﬁc antibod- regions that are highly similar to the human IGF BP-4 ies (Cell Signaling Technology, Beverly, MA). The antibodies cDNA, and they proved to be effective with rat mRNA. In used detected changes in phosphorylation at sites critical for each PCR reaction, 18S ribosomal RNA was coampliﬁed with increased activity in vivo (22, 60). Muscle samples were the target cDNA (mRNA) to serve as an internal standard extracted by homogenization in 7 vols of ice-cold buffer A [50 and to allow correction for differences in starting amounts of mM Tris HCl, pH 7.8, 2 mM potassium phosphate, 2 mM total RNA. EDTA, 2 mM EGTA, 50 mM -glycerophosphate, 10% glyc- Table 1. Sequence of speciﬁc sets of primers used in RT-PCR mRNA analyses Target mRNA PCR Primer Sequence 533 Product Size, bp GenBank Accession No. IGF-I (all) 5 sense: GCATTGTGGATGAGTGTTGC 202 all X06043 3 antisense: GGCTCCTCCTACATTCTGTA 254 MGF MGF 5 sense: GCATTGTGGATGAGTGTTGC 163 X06108 3 antisense: CTTTTCTTGTGTGTCGATAGG IGF-I receptor 5 sense: CGGCTTCTCTGCAGTAAACACA 245 L29232 3 antisense: ACTGGGAAGCGGAGAAAAGAGA IGF-BP5 5 sense: CACGCCTTCGACAGCAGTAAC 214 NM_012817 3 antisense: GTCGGGAATGGGGAGTGTCT IGF-BP4 5 sense: CCTGGGCTTGGGGATGC 212 X76066 3 antisense: AGGGGTTGAAGCTGTTGTTGG Myogenin 5 sense: ACTACCCACCGTCCATTCAC 233 M24393 3 antisense: TCGGGGCACTCACTGTCTCT Cyclin D 5 sense: AAGTGCGTGCAGAGGGAGAT 267 D14014 3 antisense: GGGGCGGATAGAGTTGTCAG p21 5 sense: CCCGTGGACAGTGAGCAGTT 233 U24174 3 antisense: AGCAGGGCCGAGGAGGTA RT, reverse transcription; PCR, polymerase chain reaction; MGF, mechanosensitive IGF-I isoform. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1185 erol, 1% Triton X-100, 1 mM DTT, 3 mM benzamidine, 1 mM myonuclei distribution relative to length (nuclei/mm) and sodium orthovanadate, 10 M leupeptin, 5 g/ml aprotinin, volume (m /nuclei). All measurements of muscle ﬁber seg- 200 g/ml soybean trypsin inhibitor, and 1 mM 4-(2-ami- ment length and volume were normalized to a sarcomere noethyl)benzenesulfonyl ﬂuoride (AEBSF)] with a motor- length of 2.5 m. This sarcomere length was chosen because driven glass pestle. The homogenate was immediately cen- this was the value observed by us in other studies in our trifuged at 12,000 g for 30 min at 4°C. The supernatant was laboratories examining the architecture of the plantaris mus- immediately saved in aliquots at 80°C for subsequent use cle (unpublished observations; n 24,000 measurements of in immunoblotting. The supernatant protein concentration sarcomere length). was determined by using the Bio-Rad protein assay with BSA MHC isoform analysis. A portion of each muscle sample as the standard. Approximately 50 g of supernatant pro- was homogenized in a solution that contained (in mM) 250 teins were subjected to sodium dodecyl sulfate-polyacrylam- sucrose, 100 KCl, 5 EDTA, and 10 Tris-base. The homogenate ide gel electrophoresis (SDS-PAGE; 12.5% T), according to a protein was diluted to 1 mg/ml in a storage buffer containing standard protocol (24), and then electrophoretically trans- 50% glycerol, 100 mM Na P 0 , 5 mM EDTA, and 2 mM 4 2 7 ferred to a polyvinylidene diﬂuoride (PVDF) membrane (Im- 2-mercaptoethanol (pH 8.8) and stored at 20°C until sub- mobilon-P) with 10% methanol, 1 mM orthovanadate, 25 mM sequent analyses for MHC protein content. Tris, and 193 mM glycine, pH 8.3. Phospho-ERK1/2 and Skeletal MHCs were separated with a SDS-PAGE tech- phospho-S6K1 were detected with phosphorylation state-spe- nique. The method used is a modiﬁcation of that published by ciﬁc antibodies (Cell Signaling Technology) and an enhanced Talmadge and Roy (55), which allows for the detection of all chemiluminescence (ECL) method of detection (Amersham). six rat MHC isoforms (3). The separating gel contained 30% Signal intensity was determined by laser scanning densitom- glycerol, 8% acrylamide, 1.5 M Tris-base, 1 M glycine, and etry (Image Quant; Molecular Dynamics). For each speciﬁc 10% SDS. The stacking gel contained 4% acrylamide, 30% antibody, all the samples were run under identical (previous- glycerol, 0.5 M Tris HCl, 100 mM EDTA, and 0.4% SDS. ly optimized) conditions, including the transfer on the mem- Protein samples were denatured by placing 5 g of sample in brane, the reaction with the ﬁrst and secondary antibodies, 35 l of sample buffer and heating the solution for 2 min at washing conditions, ECL detection, and the ﬁlm exposure. To 100°C. The sample buffer consisted of 5% -mercaptoethanol, ensure the consistency of this analysis, at least one represen- 100 mM Tris-base, 5% glycerol, 4% SDS, and bromophenol tative sample from each group was included in each gel run blue. The gels were run at 275 V for 22 h under refrigera- and Western blot analysis. In addition, a positive control, tion. The gels were stained with Brilliant Blue G 250 (Sigma) provided by the antibody supplier, was run on each gel to and destained, and then they were scanned and quantiﬁed allow for normalization. For each set of Western blotting and with a Molecular Dynamics densitometer (Sunnyvale, CA). detection conditions, the detected signal was directly propor- The peaks of interest representing the distinct MHC isoforms tional to the amount of protein loaded on the gel over a 20- to were identiﬁed in the digitized densitometric data sets. The 150-g range (data not shown). area of each peak was determined by integration and was Confocal microscopy for determination of cell volumes and indicative of the relative expression of the corresponding myonuclei number. At the time of death, an 5-mm segment MHC isoform. was taken from the midbelly of each muscle and frozen in Statistical analysis. All values are reported as means isopentane that was cooled by liquid nitrogen. Subsequently, SE. For each time point, treatment effects were determined the muscle sample was thawed as described by Allen et al. by ANOVA with post hoc testing [Student-Newman-Keuls (4), and single ﬁbers segments (n 10 ﬁber segments/mus- (SNK)] with the Prism software package (Graphpad). Pear- cle) were isolated by placing the muscle sample in a small son correlation analysis was used to assess the relationship dissection chamber containing a glycerol-relaxing solution between myoﬁbrillar protein and DNA and between p21 and (50% glycerol, 2 mM EGTA, 1 mM MgCl , 4 mM ATP, 10 mM 2 myogenin with the Prism package. For all statistical tests the imidazole, 100 mM KCl, pH 7.0). Dissection was performed 0.05 level of conﬁdence was accepted for statistical signiﬁ- with a microscope (Technival 2, Jena, Germany) with back cance. lighting and microsurgical forceps (super ﬁne Dumont twee- zers; Biomedical Research Instruments, Rockville, MD). Iso- RESULTS lated ﬁber segments were placed into a PBS solution contain- ing Hoechst 33258, a DNA binding agent that acquires At the end of 3 mo after irradiation, the body weight speciﬁc excitation/emission spectrum properties on DNA of the -radiation-treated rats was not different from binding and thus can be used to image the nuclei with that of the untreated control group [305 5 and 318 ﬂuorescence microscopy (Molecular Probes, Eugene, OR). 6 g, respectively (synergist ablation removes 4gof The ﬁber segment was then washed several times in PBS and muscle)]. This result indicates that the localized irra- then placed into a PBS solution containing BODIPY-labeled diation did not have any adverse effects on the gener- phallicidin (Biomolecular Probes). Phallicidin binds selec- alized growth of the treated animals (initial body wt tively to actin and serves as a tool for identifying the dimen- sions of the ﬁber. After these labeling procedures, the ﬁber 212 3 g). In addition, pilot data indicated that the segment was washed in PBS and mounted on a glass slide myoﬁbrillar yield, cross-sectional area (CSA), and force with glycerol. The coverslip had struts to prevent compres- production of irradiated muscles were not altered rel- sion of the muscle ﬁber segment when it was mounted. The ative to controls 4 wk after this irradiation protocol volume of a muscle ﬁber segment, its length, and the corre- was imposed (data not shown). sponding number of myonuclei were determined with a MRC Muscle hypertrophy. Fifteen days of overload re- 600 Bio-Rad laser scanning confocal microscope and a mag- sulted in signiﬁcant muscle hypertrophy in non-irradi- niﬁcation of 400. The images were then reconstructed and ated overloaded (OL) muscles as evidenced by in- rendered with Advanced Visualization Software version 6.0 creased muscle mass (Fig. 1A). Ninety days of overload (AVS; Waltham, MA). By using the volume integration mod- resulted in further hypertrophy (Fig. 1). In the over- ule of AVS, it was possible to determine the volume of the single-ﬁber segment. This approach allows the expression of loaded muscles that were irradiated (OL-Ir), there was AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1186 IRRADIATION AND MUSCLE HYPERTROPHY --- OL 15 Day t=O 90 Day ··••A .... OL- lr ·.; 80 )* ··-O··· C o ntrol cii 0-;- ,.. _ ., ,._. Clo. ... "' .... .c .:3 E . --·-O* 0.0 * - -..... . . .i. = -- -~ ii 0J) i:.: E Q '-' ... 20 "' ·;:: ::;: ... C 0 >--r- = 0 6 9 12 15 90 s: Days Fig. 2. Myoﬁbrillar protein content of the OL muscles was progres- sively increased by 7, 15, and 90 days of overload treatment. A small increase in myoﬁbrillar protein in the OL-Ir muscles was evident "' ,-... ·- ~ after 1 day of increased loading. The myoﬁbrillar protein content of E -g * the 90-day control rats was higher than that of the t 0 controls. = .Q !: 0J) *P 0.05 vs. t 0. Q., -- 0J) '0 "" e -~ ._,. OL muscle myoﬁbrillar protein was 1.8-fold as opposed -;; .:E to a 2.6-fold increase compared with the t 0 controls E -~ .. ., (Fig. 2). ~~ 0 The myoﬁbrillar protein content of the OL-Ir mus- ~ ~ ~O" o" ~ cles at 90 days was not different from that of untreated o" cl; o" o" c..,<>"" muscles of animals in the 90-day control group. How- Fig. 1. A: removal of synergists results in a substantial increase in ever, the myoﬁbrillar protein content of the 90-day plantaris muscle wet weight in nonirradiated (OL) muscles. A small control muscles had increased 40% compared with but signiﬁcant hypertrophy response was detected in the overloaded- the t 0 controls (Fig. 2). This suggests that the irradiated (OL-Ir) muscles at 15 days, with no further increase in myoﬁbrillar protein content of the OL-Ir muscles re- mass over 90 days of overload treatment. The mass of the plantaris mained proportional to the amount of body growth seen muscles from control rats increased as a result of growth such that the absolute weight of the muscles of the 90-day control group was over the 90 days. signiﬁcantly larger than that from the rats killed at the beginning of Cell proliferation. The DNA content of both OL and the study (time t 0). B: when normalized for body weight increases, OL-Ir muscles was increased at 15 and 90 days after the plantaris wet weight of the 90-day OL-Ir muscles and the 90-day treatment compared with the t 0 control group (Fig. control muscles was not different than that of the t 0 control rats. *P 0.05 vs. t 0; P 0.05 vs. OL (contralateral muscle). 3). However, the increase in DNA content seen in the OL-Ir muscles was smaller than that in the OL group. The DNA content of the OL-Ir group was not different a small increase in mass at both 15 and 90 days after from that seen in the 90-day controls. In both OL and treatment relative to the t 0 normal control muscles. OL-Ir muscles, the concentration of DNA (e.g., in When normalized to body mass, the observed changes mg/g) was unchanged over time (data not shown). in mass in the OL-Ir group at 90 days were no longer This ﬁnding demonstrates the apparent coordination signiﬁcant (Fig. 1B). In addition, the 90-day values for the OL-Ir muscles were not different from those of the 90-day untreated controls (Fig. 1). Similar results were t=O 15 Day 90 Day I * seen for the total muscle protein content (data not shown). = ,-... Myoﬁbrillar protein was used as a conservative ., ~ - ... marker of hypertrophic adaptation to avoid the poten- = "' Q = u !: tial complications of acute inﬂammatory response that -< -- may occur with this treatment during the ﬁrst 3–5 z ~ ~ --- days (5). The myoﬁbrillar protein content of the OL 200 plantaris muscles was signiﬁcantly increased at 7 (27%), 15 (57%) and 90 (2.6-fold) days after surgery compared with the zero time point control muscles o" _,, & & o" ;-. < ~~ o" o" (Fig. 2). In contrast, the OL-Ir muscles demonstrated c.P c.P only a transient increase at the 24 h time point (Fig. 2). Fig. 3. Overload stimulus resulted in a signiﬁcant increase in DNA The young adult female rats used in this study contin- content in the OL muscles. A small but signiﬁcant increase in DNA content was also seen in OL-Ir muscles at 15 days, with no further ued to increase body mass ( 50%) over the 3-mo period increase in DNA detected over the remainder of the 90-day overload of this study. As a result, some portion of the observed treatment. DNA content of the plantaris muscles from control rats myoﬁbrillar protein increase was most likely related to was increased at 90 days. There were no changes in DNA concentra- this generalized growth process. For example, com- # tion in any muscles (data not shown). *P 0.05 vs. t 0; P 0.05 pared with the 90-day control, the increase in 90-day vs. OL. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1187 of DNA and cell size in both growing and hypertro- phying muscles. ,-, * # Over the course of this study, the relationship be- tween DNA and myoﬁbrillar protein content followed a ~ ~ o- similar pattern in the OL and OL-Ir groups (Fig. 4A). ... nJ u Cl> Consistent with the possibility of an early inﬂamma- ... ~~ tory response (5), there was a small increase in DNA at .c - · - nJ the early time points after the ablation surgery in both 'og >,,_ groups. Despite this early complication, the overall ::!:~ relationship between DNA and myoﬁbrillar protein (/) resulted in a strong correlation in the OL muscles (Fig. 4B). In contrast, the early increases in DNA in the OL-Ir muscles were not paralleled by increased myoﬁ- c=i control brillar protein and hence did not show a signiﬁcant * # - OL correlation (data not shown). Figure 4A is essentially a combination of the data presented in Figs. 2 and 3. Thus it is particularly striking to note that the large ·a; increase in DNA content (Fig. 3) seen in the OL mus- 200 ::::, cles is associated with an increase in myoﬁbrillar pro- g, tein (Fig. 2) such that the ratio of these two variables is ::!: the same as that seen for the control groups at 90 days (Fig. 4A). Myonuclear analysis. CSA and myonuclear number were determined in single ﬁbers from t 0 and 90-day C plantaris muscles. CSA of myoﬁbers from the OL mus- cles was signiﬁcantly increased (46%) at 90 days after Cl> overload (Fig. 5A). There was no change in the CSA of E Ill ::::, ::::, 20000 myoﬁbers from OL-Ir muscles. The number of myonu- 0 .!! clei per millimeter of myoﬁber length was signiﬁcantly :: g 15000 .8 g ·- >, 10000 o::!: >, A ::!: Control OL OL-lr Fig. 5. A: overload resulted in a signiﬁcant increase in the cross- ____ .. sectional area of OL but not OL-Ir plantaris muscle ﬁbers. B: there was an increase in no. of myonuclei per millimeter of myoﬁber in the OL but not OL-Ir myoﬁbers. C: ratio of the myoﬁber volume per -- oL myonucleus was unchanged in both the treatment and control --.-- OL- lr groups. *P 0.05 vs. t 0; P 0.05 vs. contralateral OL-Ir. - -0··· 90 Control 1--r- 0 3 6 9 12 15 90 increased in myoﬁbers from the OL (44%) but not Days the OL-Ir plantaris muscles (Fig. 5B). As a result of 100 the increase in myonuclei in the OL muscles, the myo- ﬁber volume-to-myonucleus ratio remained unchanged r=0.88 (Fig. 5C). o--. ... ... p=0.009 / Cellular signaling response to increased loading. The Q.-;:; phosphorylation state of both S6K1 and 4E binding ... "' so "' " = 8 protein 1 (4E-BP1) was markedly increased at very ... 01) ·- -- early time points after the imposition of increased ::: 8 / ~ OLGro,p ... --- 0 loading in both OL and OL-Ir muscles (Fig. 6). In the .... OL muscles, phosphorylation of 4E-BP1 and S6K1 re- ::; 0 mained elevated through the 15-day time point and 0 100 200 300 400 500 600 700 returned to control levels by 90 days. In the OL-Ir DNA (µg/muscl e) muscles, the increase in phosphorylation of these pro- Fig. 4. A: ratio of DNA to myoﬁbrillar content changed with a teins appeared to be resolved by the 7 day time point similar pattern in both OL and OL-Ir plantaris muscles. There (Fig. 6). was no change in this ratio in the muscles from control rats. B: The phosphorylation of both ERK1 and -2 was in- there was a signiﬁcant correlation between myoﬁbrillar protein creased at very early time points after the initiation of and DNA content in the OL but not the OL-Ir plantaris muscles. *P 0.05 vs. t 0. overloading in both OL and OL-Ir muscles (Fig. 7). By AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1188 IRRADIATION AND MUSCLE HYPERTROPHY upregulated at 1 and 3 days after treatment and then declined toward baseline values in both OL and OL-Ir Days: 0 0.25 1 3 7 15 90 -- muscles (Fig. 9). Other components of IGF-I-related NC a b a b a b a b b b systems also changed in a similar pattern in both OL and OL-IR muscles. Similar to our previous reports (2, 16), overloading signiﬁcantly increased the expression 0.75 of IGF-I mRNA by 24 h of treatment, returning to .... baseline values between the 15 and 90 day time points i:i::i (data not shown). The increase in IGF-I mRNA was ', * r;r;i 0.50 ...,. similar for OL and OL-Ir muscles. The mRNA for the * ', type 1 IGF-I receptor was signiﬁcantly increased only ',,, ------1- -= Q. --- -_ 'i::-:::-.:.. --- - at the 1 day time point in both OL and OL-Ir muscles _g 0.25 (data not shown). The mRNA for IGF BP-5 was un- changed, whereas that for IGF BP-4 was increased similarly in OL and OL-Ir muscles at 3 and 7 days of 0 .00 increased loading (data not shown). The expression of the mRNA for the myogenic regu- Days: 0 0.25 1 3 7 15 90 latory factor myogenin was signiﬁcantly elevated to a a b a b a b a b a b NC very similar degree at 24 and 72 h after the overloading --~ =--~.-.---- ---p85 ~ , - - - - - - Pp70S6k surgery in OL and OL-Ir muscles (Fig. 10). The expres- sion of this mRNA declined to baseline in both muscles -- oL at 15 days but was again signiﬁcantly increased at 90 --.. ··OL- Ir --o -- Control days in the OL-Ir muscles but not the OL muscles. The !2 5000 pattern of changes seen in the expression of MGF and ~ 4000 myogenin appeared to be quite similar. ,g_ 3000 "' ll 2000 p.. Days: 0 0.25 3 7 15 -------- ---· -- -- - -o 0 ~ Pp44 NC a _ b~- a ~ b~ a-_ b_ a ~..:..'.'......:..:_NC ERKl 9 12 15 0 3 6 90 Pp42 !:=!::!!~!E!!=:=-=:=:=:.....;..;:==.:=- •:.ll!! ... r6!' ERK2 Days Fig. 6. Phosphorylation state of the inhibitory eukaryotic initiation factor 4E binding protein (4E-BP1; A and B) and of p70 S6 kinase (S6K1; C and D) was increased in both OL and OL-Ir plantaris muscles at early time points. Phosphorylation state of 4E-BP1 and of ij 5000 S6K1 in the OL and OL-Ir muscles diverged after 3 days. There was no change in 4E-BP1 or S6K1 phosphorylation state in the muscles -= from control rats (E). A and C are representative Western blot images for 4E-BP1 and phospho-S6K1, respectively. Phosphorylation state for 4E-BP1 represents the ratio between slow-migrating isoforms ( and ) and faster-migrating forms ( and ) (13). NC, normal control; a, OL; b, OL-Ir. *P 0.05 vs. t 0. 7 days after treatment, the phosphorylation levels of the ERKs had returned to or below the baseline values. -- oL Molecular marker responses to increased loading. ·• .. ·· OL-lr The amount of total RNA per muscle increased in both ·-O·· Control f": OL and OL-Ir muscles through 7 days of increased _____ .. loading (Fig. 8A). This value remained elevated in the -= Q. OL muscles through 90 days, whereas in the OL-Ir "' .c muscles it returned to baseline between the 7 and 15 day time points. A similar pattern was seen for total mRNA, which 0 ~ 0 3 6 9 12 15 90 remained elevated through 90 days in the OL muscles Days but declined to control levels by 15 days in the OL-Ir muscles (Fig. 8B). The proportion of mRNA to total Fig. 7. A: representative Western blot image for phospho-extracel- lular signal-regulated kinase (ERK)1/2 detection. Both ERK1 (p44) RNA as determined by dT-to-18S ratio was essentially and ERK2 (p42) are detected with the same phosphospeciﬁc anti- unchanged during the course of the study (data not body. Phosphorylation state of ERK1 (B) and -2 (C) was increased in shown). both OL and OL-Ir plantaris muscles at very early time points, then The expression of the mRNA for the mechanosensi- declined in parallel. There was no change in ERK1 and -2 phosphor- tive isoform of IGF-I (MGF; Ref. 18) was signiﬁcantly ylation state in the muscles from control rats. *P 0.05 vs. t 0. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1189 2.0 -- OL "' .... ··•···OL-IR 1.5 -- ···O ··· Cont ro l ... < ---I! __________ _ 1i IX "' 1.0 --i- J• ~ ·- ---I ' -- • --0 ·= <: Q,l 2- · ·-· · - !>II :z: ,_ 0 0.5 --- -·- .. ~-~~~=::::.-,~~- >, -, i:t: ..... 0 L· Ir ···<>-·· Contro I -- OL 0.0 -',--,----,- --,-~----.-, 0 t--- 0 3 6 9 12 15 90 Days Fig. 10. mRNA for the myogenic regulatory factor myogenin was signiﬁcantly increased in both OL and OL-Ir plantaris muscles until ... ,l! 1i the 3 day time point, then declined toward baseline. Myogenin ,.,, * ,' * ...... ______ ..: •:,,.•-- mRNA was signiﬁcantly increased at 90 days in the OL-Ir muscles. * ........... ~ There was no change in myogenin mRNA in the muscles from control --------+.- ,::.-.:~! rats. *P 0.05 vs. t 0. -· - ·-- - IX cles throughout the 90 days of the study. In the OL muscles, cyclin D1 mRNA tended to be increased, but 01-'-;--.--"'T""--.----- >--,- 0 6 9 12 15 90 this change (vs. t 0) was signiﬁcant only at 1 and 3 Days days after treatment (Fig. 11). The expression of p21 mRNA was increased at very Fig. 8. Total RNA (A) and total mRNA (B) per muscle were signiﬁ- cantly increased in both OL and OL-Ir plantaris muscles until the 7 early time points in both OL and OL-Ir muscles (Fig. day time point. Both RNA and mRNA remained signiﬁcantly ele- 12). However, there was a much greater increase in vated through 90 days in OL but not OL-Ir muscles. There was a p21 mRNA expression in OL-Ir than in OL muscles. As signiﬁcant increase in total mRNA but not total RNA at 90 days in we previously reported (2, 16) there was a signiﬁcant the muscles from control rats. *P 0.05 vs. t 0. x-Axes in arbitrary correlation (r 0.77, P 0.04) between the increased scan units. expression of p21 mRNA and myogenin mRNA in OL but not OL-Ir muscles. Increased expression of cyclin D1 and the cyclin- The expression of actin and MHC mRNA were used dependent kinase inhibitor (CKI) p21 are indicative of to assess contractile protein-speciﬁc molecular re- cells either entering into the cell cycle (cyclin D1) or sponses to increased loading. The amount of MHC exiting from the cell cycle (p21). The expression of mRNA in the OL-Ir muscles did not increase relative to cyclin D1 mRNA increased signiﬁcantly in both OL and t 0 values and was signiﬁcantly lower at 90 days OL-Ir muscles, indicating that a population of cells compared with the 90-day control muscles. The within the muscles was preparing to become mitoti- amount of MHC mRNA per OL muscle was signiﬁ- cally active (Fig. 11). The increase in cyclin D1 was cantly increased after the 15 day time point (Fig. 13A). much greater in the OL-Ir muscles than in the OL In contrast, the amount of actin mRNA present in muscles at all time points. For example, at 3 days the muscles increased at earlier time points and remained cyclin D1 mRNA was increased approximately three- elevated over the 90-day course of this study in OL but fold and ﬁvefold in OL and OL-Ir muscles, respectively. not OL-Ir muscles (Fig. 13B). Cyclin D1 mRNA remained elevated in the OL-Ir mus- 2.0 ,-._ -- oL QC -+- OL "' 0.5 .... . .... OL- [R '-' ··•·· OL-Ir -- 1.5 ·:J ··-O··· Control 0.4 "' ·--0 ... Control 00 , .... , IX -- 1.0 * ,,!1----'-!.L ____ < E 0.3 IX ;:; ,, _,, 0.5 0 . 2 = --t 1i c., >, - - · · () u ~ :; 0.1 0.0 >--,- ·· -··-· · - ··-··-·· - ··--· - · ~- ~ 12 15 90 0 3 6 9 Days 0.0 0 3 6 9 12 15 90 Fig. 11. mRNA for the cell cycle regulator cyclin D1 was signiﬁcantly Days and similarly increased in both OL and OL-Ir plantaris muscles until Fig. 9. mRNA for mechanosensitive growth factor (MGF) was signif- the 3 day time point. Cyclin D1 mRNA remained elevated through- icantly increased in both OL and OL-Ir plantaris muscles until the 3 out the 90-day overload period in the OL-Ir but not the OL muscles. day time point, then declined toward baseline. There was no change There was no change in cyclin D1 mRNA in the muscles from control in MGF mRNA in the muscles from control rats. *P 0.05 vs. t 0. rats. *P 0.05 vs. t 0; P 0.05 vs. OL. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1190 IRRADIATION AND MUSCLE HYPERTROPHY --- OL overload stimulus. The results of the current study 3.0 ...... OL-IR extend the period for postirradiation overloading to 3 ,....._ 2.5 ---0--· mo. In that extended period, the hypertrophy response Cont ro l "' .... was negligible in the OL-Ir muscles. 2.0 '-" -- F-- I! Prevention of hypertrophy is not absolute. At the 15 : -----..r* 1.5 I - day time point there was a small but signiﬁcant in- IX crease in the mass and myoﬁbrillar protein content of 1.0 the OL-Ir plantaris muscles (Figs. 1 and 2). During this ;::; * ........ .----I C. -~- 0.5 time period, the DNA content of the OL-Ir muscles also o- -. - .. - -- - --- --- --- --- -- - -.. increased by a small but signiﬁcant amount (Fig. 3). 0.0 This suggests the possibility that a small number of 0 6 9 12 15 90 Days satellite cells or myogenic precursor cells (MPC) within the irradiated muscles may have been able to complete Fig. 12. mRNA for the cyclin-dependent kinase inhibitor p21 was mitosis. These cells may have been undamaged by the signiﬁcantly increased through 3 and 7 days in OL and OL-Ir plantaris muscles, respectively. Increase in p21 D1 mRNA in the irradiation treatment or have been able to affect re- OL-Ir muscles was greater than that seen in OL muscles at most pairs to their DNA (29). Alternatively, there may have time points. There was no change in cyclin D1 mRNA in the muscles been a small population of unfused satellite cells or from control rats. *P 0.05 vs. t 0. MPCs that responded to the overload stimulus via differentiation and fusion with myoﬁbers. In support of MHC isoforms. Increased mechanical loading of the this second alternative, in a study with ﬁner temporal plantaris resulted in the classic fast-to-slow shift in resolution, we found (2) that the increase in expression MHC protein expression in both OL and OL-Ir muscles of p21 and myogenin mRNA precedes that of cyclin D1 (Fig. 14). This pattern of adaptation appeared to be in response to increased loading and thus may signal accentuated in the OL-Ir muscles. For example, the the presence of such a cell population. Over the re- type I MHC isoform, representing the slowest pheno- mainder of the 3-mo course of this study, the myoﬁbril- type, represented 5% of the total MHC pool in control lar protein content of the OL-Ir muscles remained rat plantaris muscles. In the OL-Ir muscles, this iso- essentially constant, e.g., they did not experience the form was increased more than eightfold to 20% of the large increase in myoﬁbrillar protein accumulation total MHC present. Similarly, the IIb MHC expression seen in the OL muscles (Fig. 2). Assuming that normal declined by 62% in OL muscles and 80% in OL-Ir muscles. As a result of the exaggerated adaptation of the OL-Ir muscles, 50% of the MHC present was either type I or IIa, whereas these isoforms repre- ., --- oL -;;:; .. ,... OL· lr sented only 25% of the MHC in the OL muscles. "' ::i ··-O··· Control DISCUSSION ::; I 00 Irradiation has been used for some time in studies -- -· -2 of skeletal muscle regeneration and compensatory growth. Originally, this modality was used to block ---...... skeletal muscle regeneration after injury. The inter- pretation of the results of these various studies has 0 1---- been predicated on the notion that the lasting effects of the radiation treatment were those associated with ., chromosomal damage (e.g., double strand breaks, -;;:; cross-linking, base pair loss, etc). It is commonly as- "' ::i ::; sumed that the primary outcome of this treatment -----j. involves the prevention of mitotic activity within the affected muscles. ------i-------- ---· , :::<J IX ,~ '- . - · . - • - _ _ __ __ _ • • - ... -__ .f. ... More recently, a number of studies have demon- E 50 strated that irradiation also appears to prevent skele- 'f tal muscle hypertrophy in rats (21, 35, 39–41). How- --· O --- OL ··•···OL·lr · Control ever, these studies were conducted before reports that 0 -,- 1) identiﬁed a population of stem cells that are appar- 0 6 9 12 15 90 ently resistant to radiation-induced damage (20) and 2) Days found that stem cells from extramuscular tissues can Fig. 13. A: mRNA for myosin heavy chain (MHC) (probe common to be incorporated into skeletal muscles (12). Because the all rat isoforms) was signiﬁcantly increased in OL plantaris muscles at both 15 and 90 days. There were no signiﬁcant changes in MHC cited irradiation studies were carried out over a rela- mRNA in the muscles from OL-Ir or control rats. B: mRNA for tively short time span (4 wk), they did not rule out the -skeletal actin was signiﬁcantly increased in OL plantaris muscles possibility that extramuscular and/or radiation-resis- at 7, 15, and 90 days. There were no signiﬁcant changes in -actin tant stem cells might eventually contribute to the de- mRNA in the muscles from OL-Ir or control rats. *P 0.05 vs. t 0. velopment of compensatory hypertrophy given a longer x-Axes in arbitrary scan units. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1191 Days: 0 15d 90 d Con OL OL+lr OL OL+lr Con --------- ,._.... 11c:1 - nx llb Fig. 14. A: representative gel image for MHC isoform separation. Propor- 40 tion (% of total) of MHC protein iso- --- oL forms present in OL and OL-Ir planta- ris muscles changed signiﬁcantly over ··* ·OL· lr _______ .I* 0-. - the 90-day treatment period. B: type · · O·· Control ------- T IIa MHC increased signiﬁcantly in --- - --o both OL and OL-Ir muscles. C: type I MHC increased signiﬁcantly in OL-Ir f.:-__ but not OL muscles. D: decrease in ~- .L* ·--------~* expression of MHC IIb in both OL and Q-·- - - -- -- - ---- -2 ---------------"! * OL-Ir muscles was signiﬁcant at both the 15 and 90 day time points. E: type o~-----------. IIx MHC increased in both muscle treatment groups and was signiﬁcant at both 15 and 90 days. In the muscles from control rats, the only signiﬁcant change was an increase in type IIx MHC at 90 days. *P 0.05 vs. t 0; .. r P 0.05 vs. OL. u ~ . * I*# ;------ - - - - - - ~* ~ 20 ! 40 <5--------- 1---------------------- ----i ~ 30 = 20 0- ---- ---- --- - --2 o...__------.-----..----. 0-'-----.-----.-------, 0 25 50 75 100 0 25 50 75 100 Time (Days) Time (Days) cycles of protein turnover continued, these results sug- sensitive measurements, the increased phosphoryla- gest that the housekeeping mode of transcription and tion of S6K1 and 4E-BP1. Increases in the phosphory- translation was unimpaired by the irradiation treat- lation of S6K1 and 4E-BP1 have been reported to be ment. The small increase in myoﬁbrillar protein seen associated with an increase in translation and are in the early stages of the OL-Ir treatment also suggests known to occur in response to 1) increased muscle that the myoﬁbers had the capacity not only to renew loading and/or 2) IGF-I receptor ligation (10, 11, 13, 23, components of the contractile machinery but also to 34, 62). The activation of S6K1 has a relatively modest implement a growth and/or limited hypertrophy pro- positive impact on translation in general, but, more gram. In addition, the current data would suggest that importantly, it increases the translation of speciﬁc the inhibition of the hypertrophy response was not mRNAs that encode components of the translational related to the production of muscle-speciﬁc mRNAs, apparatus itself (19, 56). Phosphorylation of 4E-BP1 such as that for MHC, because the conversion from fast results in its dissociation from the eukaryotic initiation to slow MHC expression was robust in the irradiated factor (eIF)4G binding site on eIF4E, allowing for the muscles. In contrast to the OL-Ir muscles, the con- formation of the translation initiation complex and tralateral OL muscles demonstrated a continuous com- thereby increasing translation (53). At 3 days after pensatory hypertrophy response detectable from 7 treatment the phosphorylation of S6K1 was increased days onward (Fig. 2). more than sixfold in both OL and OL-Ir muscles. How- Differential responses to overload. Examination of ever, at 7 days, when phospho-S6K1 was increased the data from the ﬁrst 3–7 days of overload in this ﬁvefold in the OL muscles, it was not different from study suggests that the responses of the OL and OL-Ir control in OL-Ir muscles. Subsequent to this response, muscles were not different. The ﬁrst signiﬁcant diver- other parameters demonstrated similarly dramatic di- gence in response between these two treatments can be vergence. For example, at 7 days after treatment total seen in what arguably might be the most temporally RNA was increased approximately twofold in both OL AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1192 IRRADIATION AND MUSCLE HYPERTROPHY and OL-Ir muscles. At 15 days, the RNA of the OL tempts at cellular proliferation. For example, in- muscles was still increased more than twofold, creased protein production within myoﬁbers is proba- whereas the RNA content of the OL-Ir muscles had bly reﬂected by the increase in total RNA as more essentially returned to baseline. The total RNA pool ribosomes are produced to meet the demand for trans- primarily reﬂects the amount of ribosomal RNA lation. However, ribosomal synthesis would also be present and thus is indicative of the translational ca- expected to increase markedly in cells that are becom- pacity of the tissue. Similar to the total RNA pool, the ing mitotically active (see, e.g., Ref. 61). Similarly, total mRNA present in both sets of muscles was in- activation of the pathways including S6K1 activation creased at early time points and then diverged between would also be critical for both anabolic processes and 7 and 15 days. Interestingly, the changes in speciﬁc cellular proliferation (19, 23). As a result, it is difﬁcult mRNA expression did not demonstrate this pattern of to speculate on the mechanisms underlying the ob- abrupt divergence. In each case there was no difference served divergence responses in the OL vs. OL-Ir mus- (e.g., MGF and myogenin), a greater excursion (e.g., cles. However, it seems clear that some regulatory cyclin D1 and p21), or a lack of response (e.g., actin and processes acted to downregulate cellular responses in MHC) in the OL-Ir muscles. the OL-Ir muscles in the 3- to 15-day time frame. It is The observation of correlations between increased possible that this is simply a result of the aborted myogenin and p21 expression suggests that the process mitotic processes in the incapacitated stem cell popu- of satellite cell differentiation is underway in over- lations. However, the magnitude of the changes (e.g., loaded skeletal muscles (2). In the current study the doubling of the RNA content; a 6- to 7-fold increase in increase in expression of myogenin was similar in OL phospho-S6K1) suggests that a signiﬁcant portion of and OL-Ir muscles. However, the increase in p21 this activity was occurring in the myoﬁbers because mRNA levels was much greater in the OL-Ir muscles these cells represent the majority of the tissue mass. and did not correlate with the changes in myogenin. In This conclusion is supported by the cyclin D1 and p21 general, the CKI p21 is thought to participate in the mRNA data (Figs. 11 and 12), which indicate that stem initiation of the differentiation process. Because it did cells within the OL-Ir muscles were continually at- not appear that the OL-Ir muscles were increasing tempting to enter the cell cycle throughout the study their complement of DNA (and therefore cell number), period. These cells would be expected to have elevated the increase in differentiation signaling appears to be a levels of growth-promoting signals and components; paradox. However, in this instance the greatly in- however, the OL-Ir data do not reﬂect a substantial creased p21 expression may be unrelated to the over- contribution from this cell population (e.g., mostly loading stimulus. For example, there is evidence that baseline values). This lack of contribution from muscle cellular responses to radiation-induced DNA damage stem cells agrees with results of previous studies such include withdrawal from the cell cycle to institute as that published by Phelan and Gonyea (35) in which repair processes (see, e.g., Ref. 31). This process is the incorporation of bromodeoxyuridine, a marker of mediated by p53, which is upstream from p21. There- mitotic activity, was greatly increased in OL but not fore, the increase in p21 expression seen in the OL-Ir OL-Ir muscles. muscles may reﬂect periods during which mechanisms Role of muscle stem cells. The premise that the fail- involved in attempts at chromosomal repair are active ure of stem cells to provide nuclei to myoﬁbers is the rather than processes involved in muscle hypertrophy. primary lesion imposed by the irradiation treatment An additional point of divergence in the response to implies that some processes related to myonuclear increased loading is evident in the expression of MHC function are limiting for the development of hypertro- proteins (Fig. 14). The exaggerated shift to slower phy. In the case of injury-regeneration studies, the MHC expression in the OL-Ir muscles represents a necessity for mitotic activity is relatively clear; muscle compensatory adaptation most likely stimulated by the cells are destroyed by toxins or mechanical damage inability of these muscles to increase their mass or and therefore must be replaced by the de novo devel- CSA. This shift would provide for greater energetic opment of myotubes via the proliferation, differentia- economy as the overloaded muscles cope with the de- tion, and fusion of muscle stem cells (satellite cells mands of increased loading. and/or MPCs). However, in the context of skeletal mus- The data from this study suggest several mechanis- cle compensatory hypertrophy, the requirement for mi- tically important conclusions. First, the initial ability totic activity is less obvious. If, in fact, the fusion of of the OL-Ir muscles to respond appropriately to the newly made myoblasts with existing myoﬁbers is re- increase in loading state indicates that the cellular quired for the hypertrophy response, then this would systems associated with anabolic processes (e.g., in- suggest that a number of nuclear processes were al- creased translation and transcription) were probably ready functioning at or near maximal capacity in the not damaged by the irradiation treatment. Second, the existing myoﬁbers before the increase in loading. This myonuclei of the OL-Ir muscles continued to partici- raises a number of intriguing questions. The most pate in the adaptation process via the shift in MHC obvious of these questions is what speciﬁc processes, protein expression. mediated by myonuclei, actually limit the development Unfortunately, the methods used in this study do not of myoﬁber hypertrophy. Second, why does a lack of allow for the differentiation of responses that would be newly formed myonuclei more or less permanently purely anabolic from those that were promoting at- prevent hypertrophy rather than just slowing the pro- AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1193 cess? For example, in the rat synergist ablation model, myoﬁbers (21, 47). In particular, the difference in cy- the absolute stimulus for the hypertrophic response is toplasm volume-to-myonucleus ratio between fast and essentially continuous, whereas the relative stimulus slow ﬁbers in mixed fast muscles, such as the rat declines as the muscle enlarges. Logic would suggest plantaris, is fairly pronounced (42, 58). It would there- that in response to this stimulus, the existing mecha- fore follow that the OL-Ir muscles from the current nisms for ﬁber hypertrophy would remain activated study might have been expected to have a decreased until the stimulus for adaptation declines. However, in cytoplasm volume-to-myonucleus ratio compared with irradiated muscles, this does not appear to be the case. the controls. However, despite a substantial shift to- The various markers of anabolism, such as enhanced ward slower MHC expression, the whole muscle DNA translation initiation (e.g., S6K1 and 4E-BP1) or concentration and single-ﬁber cytoplasmic volume-to- increased translational capacity (e.g., total RNA) ini- myonucleus ratio of the OL-Ir muscles were unchanged tially respond appropriately but then return to base- from controls. This suggests that the lower cytoplasmic line levels even though the overload stimulus appar- volume-to-myonucleus ratio seen in slow ﬁbers may ently continues. not be a necessary condition for the expression of the Nuclear function and hypertrophy. The results of this type I MHC isoform. study appear to support the hypothesis that the irra- Potential for adaptation after 3 mo. The data from diation protocol inhibits compensatory hypertrophy via the OL-Ir muscles indicated a tendency toward an the prevention of cell proliferation, ultimately depriv- upswing at 90 days for a number of measurements ing the myoﬁbers of their needed reserve for expansion (Figs. 4A,6B, 7, and 11–13). In the case of myogenin of the myonuclear pool. If this is the case, then an and cyclin D1 mRNA, these increases were signiﬁcant examination of potential mechanisms for this result is compared with the t 0 control values. This suggested warranted. that these muscles might be entering a new phase of One of the primary limitations imposed by the bulk potentially anabolic activity that could lead to a much amount of DNA present in a given myoﬁber is the delayed hypertrophy response. Accordingly, an addi- ability to produce the apparatus for mRNA translation tional cohort of rats was subjected to OL-Ir protocol to (28). Although protein production via mRNA is subject allow for an additional month (i.e., total of 4 mo) for the to potential ampliﬁcation via multiple translations by development of muscle hypertrophy. At 4 mo we ob- ribosomes, rRNA and tRNA are the ﬁnal gene prod- served no indication of a hypertrophic response (e.g., ucts; thus mass production requires many DNA tem- no increase in muscle mass) in the OL-Ir muscles of plates (14, 28). As reviewed by Booth et al. (7), there is these rats. Although these 4-mo observations demon- evidence that a general increase in translational efﬁ- strate that the increases in some cellular and molecu- ciency occurs at the onset of muscle hypertrophy. How- lar markers at 3 mo did not herald the delayed onset of ever, sustained increases in protein production appear a compensatory hypertrophy response, they did not to require substantial increases in the translational shed any light on the reason for these increases. machinery. For example, in the hypertrophying heart, In summary, the results of this study demonstrate early adaptations include an increase in translational that irradiation essentially prevents the development efﬁciency and an acceleration of the synthesis of new of compensatory hypertrophy in rodent skeletal mus- ribosomes (30, 50). In multinucleated myoﬁbers, cur- cles for up to 4 mo. This would suggest that neither rent dogma suggests that the number of copies of rRNA endogenous or extramuscular stem cells contribute sig- and tRNA genes can only be manipulated via changes niﬁcantly to the stem cell population of overloaded in the number of nuclei present. muscles, at least in this time frame. Localized irradi- There is evidence that higher volumes of transcrip- ation protocols do not appear to induce signiﬁcant tional activity will require an increase in space within damage to myoﬁbers or the intrinsic mechanisms nec- the nucleus (14). Thus it is possible that the physical essary for them to adapt to increased loading. The spacing within the myonuclei may become a limiting results of this study tend to support the hypothesis factor during times of high transcriptional activity. If that the mechanisms by which myoﬁbers adapt to the dense packing of macromolecules within myoﬁbers increased loading appear to include an obligatory restricts the expansion of nuclear volume, then it is “myogenic” component involving the proliferation, dif- possible that the addition of satellite cells and their ferentiation, and fusion of muscle stem cells with the nuclei to myoﬁbers might allow for the distribution of existing myoﬁbers. transcriptional loads, thus surmounting this obstacle. The authors thank Anqi Qin, Ming Zeng, Sam McCue, and Mike However, a number of reports indicate that the RNA Baker for invaluable technical assistance. produced by a myonucleus may have a fairly limited This work was supported by National Space Biomedical Research range of distribution within a myoﬁber (33, 37, 36). Institute Grant NCC9-58 (K. M. Baldwin) and National Institute of This would suggest that differential transcription re- Arthritis and Musculoskeletal and Skin Diseases Grants AR-45594 (G. R. Adams) and AR-46856 (V. J. Caiozzo). quiring mRNA translocation to other myonuclear do- mains might not be an option for dealing with nuclear space restrictions. REFERENCES As a general rule, slow myoﬁbers are thought to have 1. Adams GR and Haddad F. The relationships between IGF-1, a greater number of myonuclei per millimeter and a DNA content, and protein accumulation during skeletal muscle lower cytoplasm volume-to-myonucleus ratio than fast hypertrophy. J Appl Physiol 81: 2509–2516, 1996. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. C1194 IRRADIATION AND MUSCLE HYPERTROPHY 2. Adams GR, Haddad F, and Baldwin KM. Time course of muscle are not dependent upon satellite cell proliferation. Cell changes in markers of myogenesis in overloaded rat skeletal Tissue Res 296: 531–539, 1999. muscles. J Appl Physiol 87: 1705–1712, 1999. 27. Mitchell PO and Pavlath GK. A muscle precursor cell-depen- 3. Adams GR, Haddad F, McCue SA, Bodell PW, Zeng M, Qin dent pathway contributes to muscle growth after atrophy. Am J A, Qin X, and Baldwin KM. Effects of spaceﬂight and thyroid Physiol Cell Physiol 281: C1706–C1715, 2001. deﬁciency on rat hindlimb development. II. Expression of MHC 28. Montagne J. Genetic and molecular mechanisms of cell size isoforms. J Appl Physiol 88: 904–916, 2000. control. Mol Cell Biol Res Commun 4: 195–202, 2000. 4. Allen DL, Monke SR, Talmadge RJ, Roy RR, and Edgerton 29. Mozdziak PE, Schultz E, and Cassens RG. The effect of VR. Plasticity of myonuclear number in hypertrophied and at- in vivo and in vitro irradiation (25 Gy) on the subsequent in rophied mammalian skeletal muscle ﬁbers. J Appl Physiol 78: vitro growth of satellite cells. Cell Tissue Res 283: 203 – 208, 1969–1976, 1995. 5. Armstrong RB, Marum P, Tullson P, and Saubert CW. 30. Nagatomo Y, Carabello BA, Hamawaki M, Nemoto S, Mat- Acute hypertrophic response of skeletal muscle to removal of suo T, and McDermott PJ. Translational mechanisms accel- synergists. J Appl Physiol 46: 835–842, 1979. erate the rate of protein synthesis during canine pressure-over- 6. Baldwin KM, Valdez V, Herrick RE, MacIntosh AM, and load hypertrophy. Am J Physiol Heart Circ Physiol 277: H2176– Roy RR. Biochemical properties of overloaded fast twitch skel- H2184, 1999. etal muscle. J Appl Physiol 52: 467–472, 1982. 31. Niibe Y, Nakano T, Ohno T, Tsujii H, and Oka K. Relation- 7. Booth FW, Tseng BS, Fluck M, and Carson JA. Molecular ship between p21/WAF-1/CIP-1 and apoptosis in cervical cancer and cellular adaptation of muscle in response to physical train- during radiation therapy. Int J Radiat Oncol Biol Phys 44: ing. Acta Physiol Scand 162: 343–350, 1998. 297–303, 1999. 8. Chambers RL and McDermott JC. Molecular basis of skeletal 32. Pagel CN and Partridge TA. Covert persistence of mdx mouse muscle regeneration. Can J Appl Physiol 21: 155–184, 1996. myopathy is revealed by acute and chronic effects of irradiation. 9. Chomczynski P and Sacchi N. Single-step method of RNA J Neurol Sci 164: 103–116, 1999. isolation by acid guanidinium thiocyanate-phenol-chloroform ex- 33. Pavlath GK, Rich K, Webster SG, and Blau HM. Localiza- traction. Anal Biochem 162: 156–159, 1987. tion of muscle gene products in nuclear domains. Nature 337: 10. Dufner A and Thomas G. Ribosomal S6 kinase signaling and 570–573, 1989. the control of translation. Exp Cell Res 253: 100–109, 1999. 34. Petley T, Graff K, Jiang W, and Florini J. Variation among 11. Farrell PA, Hernandez JM, Fedele MJ, Vary TC, Kimball cell types in the signaling pathways by which IGF-I stimulates SR, and Jefferson LS. Eukaryotic initiation factors and pro- speciﬁc cellular responses. Horm Metab Res 31: 70–76, 1999. tein synthesis after resistance exercise in rats. J Appl Physiol 88: 35. Phelan JN and Gonyea WJ. Effect of radiation on satellite cell 1036–1042, 2000. activity and protein expression in overloaded mammalian skel- 12. Ferrari G, Cusells-De Angelis G, Coletta M, Paolucci E, etal muscle. Anat Rec 247: 179–188, 1997. Stornaiuolo A, Cossu G, and Mavilio F. Muscle regeneration 36. Ralston E and Hall ZW. Restricted distribution of mRNA by bone marrow-derived myogenic progenitors. Science 279: produced from a single nucleus in hybrid myotubes. J Cell Biol 1528–1530, 1998. 119: 1063–1068, 1992. 13. Gingras AC, Kennedy SG, O’Leary MA, Sonenberg N, and 37. Ralston E, McLaren RS, and Horowitz JA. Nuclear domains Hay N. 4E-BP1, a repressor of mRNA translation, is phosphor- in skeletal myotubes: the localization of transferrin receptor ylated and inactivated by the Akt(PKB) signaling pathway. mRNA is independent of its half-life and restricted by binding to Genes Dev 12: 502–513, 1998. ribosomes. Exp Cell Res 236: 453–462, 1997. 14. Gregory TR. Coincidence, coevolution, or causation? DNA con- 38. Robertson TA, Grounds MD, and Papadimitriou JM. Elu- tent, cell size, and the C-value enigma. Biol Rev Camb Philos Soc cidation of aspects of murine skeletal muscle regeneration using 76: 65–101, 2001. local and whole body irradiation. J Anat 181: 265–276, 1992. 15. Gulati AK. The effect of X-irradiation on skeletal muscle regen- 39. Rosenblatt DJ and Parry DJ. Gamma irradiation prevents eration in the adult rat. J Neurol Sci 78: 111–120, 1987. compensatory hypertrophy of overloaded mouse extensor digito- 16. Haddad F and Adams GR. Acute cellular and molecular re- rum longus muscle. J Appl Physiol 73: 2538–2543, 1992. sponses to resistance exercise. J Appl Physiol 93: 394–403, 2002. 40. Rosenblatt JD and Parry DJ. Adaptation of rat extensor 17. Haddad F, Herrick RE, Adams GR, and Baldwin KM. digitorum longus muscle to gamma irradiation and overload. Myosin heavy chain expression in rodent skeletal muscle: effects Pﬂu ¨ gers Arch 423: 255–264, 1993. of zero gravity. J Appl Physiol 75: 2471–2477, 1993. 41. Rosenblatt JD, Yong D, and Parry DJ. Satellite cell activity 18. Hameed M, Harridge SDR, and Goldspink G. Sarcopenia is required for hypertrophy of overloaded adult rat skeletal and hypertrophy: a role for insulin-like growth factor-1 in aged muscle. Muscle Nerve 17: 608–613, 1994. muscle? Exerc Sport Sci Rev 30: 15–19, 2002. 42. Roy RR, Monke SR, Allen DL, and Edgerton VR. Modula- 19. Hashemolhosseini S, Nagamine Y, Morley SJ, Desrivie ` res tion of myonuclear number in functionally overloaded and exer- S, Mercep L, and Ferrari S. Rapamycin inhibition of the G to cised rat plantaris ﬁbers. J Appl Physiol 87: 634–642, 1999. S transition is mediated by effects on cyclin D1 mRNA and 43. Sabourin LA and Rudnicki MA. The molecular regulation of protein stability. J Biol Chem 273: 14424–14429, 1998. myogenesis. Clin Genet 57: 16–25, 2000. 20. Heslop L, Morgan JE, and Partridge TA. Evidence for a 44. Salleo A, LaSpada G, Falzea G, Denaro MG, and Cic- myogenic stem cell that is exhausted in dystrophic muscle. J Cell ciarello R. Response of satellite cells and muscle ﬁbers to Sci 113: 2299–2308, 2000. long-term compensatory hypertrophy. J Submicrosc Cytol 21. Hughes SM and Schiafﬁno S. Control of muscle ﬁber size: a Pathol 15: 929–940, 1983. crucial factor in ageing. Acta Physiol Scand 167: 307–312, 1999. 45. Schiafﬁno S, Bormioli SP, and Aloisi M. Cell proliferation in 22. Karin M. The regulation of AP-1 activity by mitogen-activated rat skeletal muscle during early stages of compensatory hyper- protein kinases. Philos Trans R Soc Lond B Biol Sci 351: 127– trophy. Virchows Arch B Cell Pathol 11: 268–273, 1972. 134, 1996. 46. Schiafﬁno S, Bormioli SP, and Aloisi M. The fate of newly 23. Kawasome H, Papst P, Webb S, Keller GM, Johnson GL, formed satellite cells during compensatory muscle hypertrophy. and Gelfand EW. Targeted disruption of p70s6k deﬁnes its role Virchows Arch B Cell Pathol 21: 113–118, 1976. in protein synthesis and rapamycin sensitivity. Proc Natl Acad 47. Schmalbruch H and Lewis DM. Dynamics of nuclei of muscle Sci USA 95: 5033–5038, 1998. 24. Laemmli UK. Cleavage of structural proteins during the assem- ﬁbers and connective tissue cells in normal and denervated rat bly of the head of bacteriophage T4. Nature 227: 680–685, 1970. muscles. Muscle Nerve 23: 617–626, 2000. 25. Lewis RB. Changes in striated muscle following single intense 48. Schultz E. Satellite cell behavior during skeletal muscle growth doses of X-rays. Lab Invest 3: 48–55, 1954. and regeneration. Med Sci Sports Exerc 21: S181–S186, 1989. 26. Lowe DA and Alway SE. Stretch-induced myogenin, MyoD, 49. Schultz E and McCormick KM. Skeletal muscle satellite cells. and MRF4 expression and acute hypertrophy in quail slow-tonic Rev Physiol Biochem Pharmacol 123: 213–257, 1994. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved. IRRADIATION AND MUSCLE HYPERTROPHY C1195 50. Siehl D, Chua BH, Lautensack-Belser N, and Morgan HE. 57. Thomason DB, Herrick RE, and Baldwin KM. Activity in- Faster protein and ribosome synthesis in thyroxine-induced hy- ﬂuences on soleus muscle myosin during rodent hindlimb sus- pertrophy of rat heart. Am J Physiol Cell Physiol 248: C309– pension. J Appl Physiol 63: 138–144, 1987. C319, 1985. 58. Tseng BS, Kasper CE, and Edgerton VR. Cytoplasm to myo- 51. Snow MH. Satellite cell response in rat soleus muscle undergo- nucleus ratios and succinate dehydrogenase activities in adult ing hypertrophy due to surgical ablation of synergists. Anat Rec rat slow and fast muscle ﬁbers. Cell Tissue Res 275: 39–49, 1994. 227: 437–446, 1990. 59. Wright C, Haddad F, Qin A, and Baldwin KM. Analysis of 52. Solaro RJ, Pang DC, and Briggs FN. The puriﬁcation of myosin heavy chain mRNA expression by RT-PCR. J Appl cardiac myoﬁbrils with Triton X-100. Biochim Biophys Acta 245: Physiol 83: 1389–1396, 1997. 259–262, 1971. 60. Yau L, Lukes H, McDiarmid H, Werner J, and Zahradka P. 53. Sonnenberg N and Ginggras AC. The mRNA 5 cap-binding Insulin-like growth factor-I (IGF-I)-dependent activation of protein eIF4E and control of cell growth. Curr Opin Cell Biol 10: pp42/44 mitogen-activated protein kinase occurs independently 268–275, 1998. of IGF-I receptor kinase activation and IRS-1 tyrosine phosphor- 54. Stockdale FE and Holtzer H. DNA synthesis and myogenesis. ylation. Eur J Biochem 266: 1147–1157, 1999. Exp Cell Res 24: 508–520, 1961. 61. Zahradka P, Larson DE, and Sells BH. Regulation of ribo- 55. Talmadge RJ and Roy RR. Electrophoretic separation of rat some biogenesis in differentiated rat myotubes. Mol Cell Bio- skeletal muscle myosin heavy-chain isoforms. J Appl Physiol 75: chem 104: 189–194, 1991. 2337–2340, 1993. 62. Zheng Z, Messi ML, and Delbono O. Age-dependent IGF-1 56. Thomas G and Hall MN. TOR signaling and control of cell regulation of gene transcription of Ca channels in skeletal growth. Curr Opin Cell Biol 9: 782–787, 1997. muscle. Mech Ageing Dev 122: 373–384, 2001. AJP-Cell Physiol • VOL 283 • OCTOBER 2002 • www.ajpcell.org Downloaded from www.physiology.org/journal/ajpcell by ${individualUser.givenNames} ${individualUser.surname} (128.200.102.124) on March 15, 2018. Copyright © 2002 American Physiological Society. All rights reserved.

Journal

AJP Cell Physiology – Unpaywall

Published: Oct 1, 2002

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Cellular and molecular responses to increased skeletal muscle loading after irradiation

Cellular and molecular responses to increased skeletal muscle loading after irradiation

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Cellular and molecular responses to increased skeletal muscle loading after irradiation

Cellular and molecular responses to increased skeletal muscle loading after irradiation

References (68)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies