Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Identification of Glutamate Residues Essential for Catalytic Activity and Zinc Coordination in Aminopeptidase A

Identification of Glutamate Residues Essential for Catalytic Activity and Zinc Coordination in... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 15, Issue of April 12, pp. 9069–9074, 1996 © 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Identification of Glutamate Residues Essential for Catalytic Activity and Zinc Coordination in Aminopeptidase A* (Received for publication, October 12, 1995, and in revised form, December 19, 1995) Gilles Vazeux‡, Jiyang Wang§, Pierre Corvol‡, and Catherine Llorens-Corte`s‡ From ‡INSERM Unit 36, Colle`ge de France, 3, rue d’Ulm, 75005 Paris, France and the §Howard Hughes Medical Institute, University of Alabama, Birmingham, Alabama 35294 Aminopeptidase A (EC 3.4.11.7, APA) is a homodimeric absorption spectrophotometry failed to detect any Zn in the membrane-bound glycoprotein that contains the con- purified enzyme, whereas one Ca ion was found to be asso- sensus sequence HEXXH (385–389) found in zinc metal- ciated with each monomer (7). Then, molecular cloning of the lopeptidases such as thermolysin. The x-ray structure of related murine B lymphocyte differentiation antigen BP1/6C3 the latter enzyme revealed that the two histidines of this (8), followed more recently by the cloning of APA in man (9, 10), motif are two of the three zinc-coordinating ligands and revealed the presence of the consensus sequence HEXXH found that the glutamate is a crucial amino acid involved in in the zinc metalloprotease family (11), recently classified as catalysis. Alignment of the sequence of mouse APA with zincins (12). In this motif, both histidines are two of the three those of the already characterized metallopeptidases zinc ligands, and the glutamate acts as a catalytic base. The showed the presence of several conserved amino acids overall amino acid homology of APA with other aminopepti- such as a glutamate residue in position 408 which may dases such as aminopeptidase N (APN), thyrotropin-releasing constitute the putative third zinc ligand. The functional hormone-degrading enzyme, and leukotriene A4 (LTA4) hydro- implication of this residue and the role of glutamate 386 lase reaches 25–35%, and the conservation is higher in the in the HELVH (385–389) motif of APA have been investi- region surrounding the zinc binding motif (Fig. 1). The x-ray gated by replacing these residues with an aspartate crystal structure of thermolysin showed the zinc ion to play a (Asp-386, Asp-408) or an alanine (Ala-386, Ala-408) by site-directed mutagenesis. Expressed mutated proteins catalytic role. It is coordinated to three amino acid side chains in position 386 showed no APA activity. Ala-408 was also and a water molecule that, upon ionization/polarization by the inactive, and Asp-408 had 5% of the wild type enzyme glutamate, initiates the nucleophilic attack of the substrate activity and a similar K . Zn incorporation measure- m scissile peptide bond (13). Site-directed mutagenesis studies ments indicated that Ala-386 binds the zinc ion as well have allowed the identification of corresponding residues in as the wild type enzyme, whereas the Ala-408 mutant did some members of the gluzincin family, including neutral en- not. These results provide evidence that Glu-408 is the dopeptidase (EC 3.4.24.11, NEP) (14–16), angiotensin-convert- third zinc-coordinating residue of APA, confirm the pre- ing enzyme (ACE) (17); (18), neutral metalloprotease from sumed involvement of Glu-386 in the catalytic process of Streptomyces cacaoi (19), and LTA4 hydrolase (20), which has the enzyme, and identify APA as a zinc metallopeptidase an aminopeptidase activity in addition to its epoxide hydrolase functionally similar to thermolysin. activity (21). In APA, replacement of His-389 by a phenylala- nine in the zinc binding motif of APA abolished the enzymatic activity, suggesting that this residue is probably one of the zinc Aminopeptidase A (glutamyl-aminopeptidase, EC 3.4.11.7, ligands (22). Nevertheless, the presence or absence of the zinc APA ) is a homodimeric type II membrane-bound protease, atom in the protein and the demonstration of its role in catal- which specifically cleaves in vitro the NH -terminal glutamyl ysis were not directly demonstrated and remain to be estab- or aspartyl residue (Glu or Asp) from peptide substrates such lished by a direct approach. as cholecystokinin-8 or angiotensin II (1, 2). Its activity is 21 Alignment of APA with other metallopeptidases (Fig. 1) in enhanced by various divalent cations such as Ca . APA is the region surrounding the zinc binding motif reveals that primarily located in the brush borders of the intestinal or renal several residues known to be involved in catalysis or zinc epithelial cells as well as in the vascular endothelium (3). Until binding are conserved. Interestingly, the sequence surrounding recently (4), the absence of specific APA inhibitors made it the glutamate zinc ligand in LTA4 hydrolase (20), WLXEG, is difficult to identify its physiological role. However, the enzyme conserved among the different aminopeptidases presented in is colocalized with some components of the renin angiotensin Fig. 1 (APA, APN, LTA4 hydrolase, and thyrotropin-releasing system (3, 5, 6), which suggests its potential role in vivo in the hormone-degrading enzyme). Furthermore, the amino acid se- conversion of angiotensin II to angiotensin III by removing the quence distance between glutamates of the HEXXH and NH -terminal aspartate residue. WLXEG motifs (21 residues) is also conserved. APA was first characterized as a Ca protease, since atomic We therefore hypothesized that Glu-408 located in the WL- NEG (405–409) motif of APA constitutes the third zinc ligand * The costs of publication of this article were defrayed in part by the and that Glu-386 located in the zinc binding motif HELVH payment of page charges. This article must therefore be hereby marked (385–389) plays a crucial role in catalysis as observed for other “advertisement” in accordance with 18 U.S.C. Section 1734 solely to gluzincins. Another conserved motif, EXIXD, where the gluta- indicate this fact. To whom correspondence should be addressed. Tel.: 331-44-27-16- mate is the third zinc ligand, has been identified in thermoly- 59; Fax: 331-44-27-16-91. sin, NEP, and ACE (23). Kinetic analysis and binding experi- The abbreviations used are: APA, aminopeptidase A; APN, amino- ments performed with NEP, ACE, and various mutants peptidase N; LTA4, leukotriene A4; NEP, neutral endopeptidase; ACE, indicate that the aspartate is involved in the precise position- angiotensin-converting enzyme; GluNA, a-L-glutamyl-b-naphthylam- ide; GluSH, glutamate-thiol. ing of the first histidine zinc ligand in the HEXXH motif, via a This is an Open Access article under the CC BY license. 9070 Glutamate Residues in the Active Site of APA FIG.1. Amino acid sequence align- ment of the zinc binding domain of different zinc metalloproteases. The putative zinc ligands and their homolo- gous residues in the other sequences are indicated in shadow letters. Numbers re- fer to the position of the mutated residues in the APA sequence. Conserved residues in APA, APN, LTA4 hydrolase, and thy- rotropin-releasing hormone-degrading enzyme are underlined. containing 10% glycerol, 5% 2-mercaptoethanol, 2% SDS and resolved salt link for an optimal interaction with the active site zinc ion by SDS-polyacrylamide gel electrophoresis (7.5% polyacrylamide) ac- (18, 24). However, in APA and APN, the corresponding residue cording to Laemmli (26). The dried gel was then exposed for is a serine (Ser-412 in APA). This led us to hypothesize that the autoradiography. hydroxyl group of the serine side chain may interact via a To account for small variations in APA synthesis due to differences in hydrogen bond with the first histidine of the HEXXH motif. the efficiency of electroporation or in the number of surviving cells, we To test these hypotheses, we investigated the functional determined the expression level of each mutant. For this purpose, we scanned the autoradiogram of immunoprecipitated wild type and mu- roles of glutamate residues 386 and 408 and serine residue 412 tant protein. We have verified that the quantity of immunoprecipitated by site-directed mutagenesis. In addition, a new method was protein was proportional to the concentration of antigen in the cell used for directly determining the presence of zinc in the active extract. An internal standard curve was constructed with different site of the recombinant APA. dilutions of immunoprecipitated wild type protein, and we used differ- ent exposure times of the autoradiogram to optimize conditions in EXPERIMENTAL PROCEDURES which a linear relationship was observed between amount of protein Site-directed Mutagenesis and Construction of Expression Plas- and the mean density. To determine the activities of the mutants with mids—Site-directed mutagenesis was performed on the mouse cDNA respect to the same quantity of enzyme, the substrate hydrolysis rates encoding APA (22), contained in the expression vector SRaBP1, using are reported for equivalent levels of expression of each mutant. Using the polymerase chain reaction as described previously (25). Two over- this methodology, the variation of the wild type specific activity from lapping regions of the cDNA were amplified separately using two flank- three different transfections is approximately 10% of the mean value. ing oligonucleotides A and B and one variable internal oligonucleotide Enzyme Assay—Transfected COS-7 cells were washed twice and C (Table I). Primer C, containing the mutation and a non-unique re- harvested by scraping in phosphate-buffered saline. After centrifuga- striction site (TaqI), was used with primer A to amplify the upstream tion at 2,000 3 g, 10 min, 4 °C, the cell pellet was resuspended in fragment. The downstream fragment was obtained after amplification ice-cold 50 mM Tris-HCl buffer, pH 7.4 (1 ml/35-mm Petri dish), soni- with oligonucleotides A and B followed by digestion with the restriction cated for 30 s, and dispensed in aliquots for the enzyme assay. enzyme TaqI and purification from a 2% agarose gel (GeneClean 2, The APA activity of these cell extracts was determined in a microtiter Bio101). The upstream fragment containing the mutation and the plate by following the rate of hydrolysis of a synthetic substrate, a-L- downstream fragment, digested with TaqI that cut in the overlapping glutamyl-b-naphthylamide (GluNA, Bachem) (4). sequence, were ligated. The resulting fragment was amplified with the The kinetic parameters (initial velocity, K ) were determined from 59- and 39-flanking primers A and B, which were chosen to cover a Lineweaver-Burk plots using final concentration ranging from 0.025 to sequence including unique restriction sites. DNA polymerase isolated 0.4 mM GluNA. from Pyrococcus furiosus (Pfu) (1 unit) was used (30 cycles: 94 °C, 30 s; The sensitivity of APA and some of the mutants to glutamate-thiol 55 °C, 30 s; 72 °C, 1 min). After gel purification of the fragment, the (GluSH), an inhibitor of APA (27), was determined by establishing 350-base pair polymerase chain reaction DNA insert containing the dose-dependent inhibition curves and calculating their IC values (an- mutation was substituted for the corresponding nonmutated region alyzed using a weighted nonlinear least squares regression program (S. (NarI-EcoRV) of the full-length APA cDNA. The presence of the muta- Urien; MICROPHARM, Faculte´de Me´decine, Department of Pharma- tions and the absence of nonspecific mutations were confirmed by cologie, Creteil, France)). sequencing the 350-base pair mutated region by the dideoxy chain 65 Incorporation of Zn—Half of each pool of cells, transfected as de- termination method (Sequenase 2, U. S. Biochemical Corp.). scribed previously, was incubated for 5 h (48 h after transfection) with The glutamate residue at position 386 was substituted for either an 65 20 mCi/ml Zn (Amersham Corp.). The other half of the pool was aspartate (Asp-386), or an alanine (Ala-386); glutamate 408 was mu- 35 subjected to metabolic labeling with [ S]methionine and immunopre- tated either to an aspartate (Asp-408) or to an alanine (Ala-408), and cipitation under the conditions described above. Immunoprecipitation serine 412 was replaced by an alanine (Ala-412). The primers used for 65 of the Zn-labeled cell extracts was performed using the same proce- the constructions of the mutant cDNAs are shown in Table I. dure except that the solubilization and washing buffer did not contain The ACE mutants were a generous gift from Dr. L. Wei (ACE Lys- EDTA. The immune complex was then counted with an automatic 361,365) and Dr. T. Williams (ACE Lys-361,365 Val-987). gamma counter. Transfection of COS-7 Cells—COS-7 cells were grown in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc.) complemented with RESULTS 10% fetal calf serum and were transfected with 30 mg of plasmid by Expression of Recombinant APA in COS-7 Cells and Meta- electroporation (250 V, 1,800 microfarads, Eurogentec electroporator). Each pool of transfected cells was divided into two 35-mm Petri dishes, bolic Labeling—To study the role of the amino acids proposed one for enzyme assay and one for metabolic labeling. to be essential in the APA active site, we constructed a series of Metabolic Labeling and Immunoprecipitation—Transfected COS-7 APA cDNAs encoding mutants of glutamates 386, 408, and cells were incubated 48 h after transfection in methionine- and serum- serine 412. Equivalent amounts of mutated APA cDNAs were free medium (Ham’s F-12) containing 50 mCi/ml [ S]methionine for 5 h. transiently transfected into COS-7 cells. After transfection, the Proteins were solubilized for2hin50mM Tris-HCl, pH 7.4, 150 mM cells were labeled by incubation with [ S]methionine, har- NaCl, 10 mM EDTA, and 1% Triton X-100 and then centrifuged at 15,000 3 g for 5 min at 4 °C. The supernatants were recovered, and vested, and the proteins from cell extracts were solubilized, immunoprecipitation was performed by incubating these cell extracts immunoprecipitated with an anti-APA polyclonal antiserum, overnight at 4 °C with protein A-Sepharose (Pharmacia LKB Biotech- resolved on SDS-polyacrylamide gel electrophoresis, and de- nology Inc.) (50 ml of 50% suspension in solubilization buffer) and 3 ml tected by autoradiography. Fig. 2 shows the presence of a major of a polyclonal anti-rat APA rabbit antiserum (final dilution: 1/200). band migrating with an apparent molecular mass of 130 kDa The immune complexes were collected by centrifugation and washed for the wild type APA and for the different mutants, indicating three times with solubilization buffer and once with 20 mM Tris-HCl, pH 6.8. Proteins were eluted (by boiling in 20 mM Tris-HCl, pH 6.8, that each mutant was expressed and similarly glycosylated. An Glutamate Residues in the Active Site of APA 9071 TABLE I Primers used for polymerase chain reaction mutagenesis of mouse APA cDNA Mutated bases are indicated in bold. Restriction sites are underlined. Numbers refer to the APA sequence deposited in the GenBank data base (accession no. M29961). Amino acid Name Nucleotide sequence (59–39) Numbering substitution A CTATGGAGTATGCGCTTCC 1075–1094 B TGCCTCTTGCAGTGAATCCC 1641–1621 C1 TGGTGTACAAGTGCGTGGG 1256–1239 Glu 3 Ala C2 TGGTGTACAAGATCGTGGG 1256–1239 Glu 3 Asp C3 AACTCGAAGAACGAAGCAAATCCTGGATTTAGC 1334–1301 Glu 3 Ala C4 AACTCGAAGAACGAAGCAAATCCATCATTTAGC 1334–1301 Glu 3 Asp C5 AACTCGAAGAACGCAGCAAATCC 1334–1311 Ser 3 Ala FIG.2. Metabolic labeling of recombinant APA. Transfected COS-7 cells were labeled for 5 h with [ S]methionine, and cell lysate proteins immunoprecipitated with an anti-APA polyclonal antiserum and resolved by 7.5% SDS-polyacrylamide gel electrophoresis, were identified by autoradiography. The first two lanes correspond to the cells transfected with pSVneo and the wild type APA, respectively. The FIG.3. Enzymatic activity of APA mutants. APA activity in cel- mutants have been named according to the position of the wild type lular extracts of transfected COS-7 cells is expressed as a percentage of residues and the amino acid to which they have been mutated. The wild type APA activity. Measurements are the mean 6 S.E. of three monomeric and dimeric forms of APA are indicated by arrows. independent transfections with duplicate determinations. The mean value for wild type APA corresponds to 1.3 nmol of substrate hydro- lyzed/min/mg of total protein. upper band of 260 kDa corresponding to the dimeric form of APA was also present in each lane. No specific protein band To characterize further the properties of the mutant Asp- was detected in the cells transfected with the control vector 408, we studied the K of this mutant and its response to the pSVneo. APA inhibitor GluSH. Asp-408 had a K of 98 6 2 mM, close to Enzymatic Activity of Recombinant APA—Fig. 3 shows the that of wild type APA (60 6 15 mM). IC values for GluSH were 27 27 enzymatic activity of the mutants expressed as a percentage of 4.2 6 0.18 3 10 M for Asp-408 and 1.0 6 0.3 3 10 M for the wild type recombinant APA activity, taking into account that wild type enzyme. The apparent affinities of the wild type the same amount of recombinant enzyme was used, as de- enzyme and Asp-408 for GluNA are comparable, suggesting scribed under “Experimental Procedures.” The activity of wild that the decrease of activity is probably due to a lower effi- type APA could be detected with short incubation times (15–30 ciency of hydrolysis. In contrast, the inhibitory potency of min), and this activity was abolished completely when 10 M of GluSH is about four times lower for Asp-408 compared with the the APA inhibitor GluSH or 10 mM EDTA was added. In the nonmutated enzyme. cells transfected with vector alone, 2 h was necessary to detect Zn Binding to Recombinant APA—To test for the presence less than 1% activity, which probably corresponds to the en- or absence of the zinc ion in the active site of the wild type APA dogenous APA activity of COS cells. This system therefore and its mutants, COS-7 cells were transfected with the differ- allows the expression of fully active recombinant wild type APA ent mutated cDNAs and incubated with the medium containing and permits the comparison of the enzymatic activities of the Zn. Cell extracts were then immunoprecipitated and the im- different mutants. In contrast to wild type APA, the activity of mune complexes counted. In parallel, an equivalent number of the mutant Ala-386 was not significantly different from the transfected cells was subjected to metabolic labeling with negative control. No residual activity was detected when the [ S]methionine. Autoradiography and densitometric scanning negative charge was restored with an Asp residue (mutant of immune complexes were performed after SDS-polyacryl- Asp-386). At position 408, changing the glutamate for an ala- amide gel electrophoresis, and allowed us, as for the enzymatic nine (mutant Ala-408) led to an inactive protein, preventing activity measurements, to calibrate the Zn measurements. measurement of kinetic parameters. In contrast, when the The sensitivity was improved by counting the radioactivity of negative charge was restored with an aspartate (mutant Asp- the immunoprecipitated fractions. To estimate the nonspecific 408), a low but significant activity could be detected, represent- labeling in these immunoprecipitated fractions, a control of ing 5% of the wild type APA specific activity. There was no nontransfected COS-7 cells was treated in parallel to estimate alteration of the activity of the mutant Ala-412 which was the background level, which was then subtracted from the similar to that of the wild type APA. previously obtained Zn labeling values of the mutants. The 9072 Glutamate Residues in the Active Site of APA FIG.4. Zn binding in ACE mu- tants. Comparison of two different meth- odologies for the determination of the presence of zinc in ACE and ACE mu- tants. Schematic representation of ACE and ACE mutants. The two homologous N and C domains are indicated, respec- tively, by the left and right shaded boxes, and the zinc binding motif is indicated under each domain. Mutations are indi- cated in bold. The replacement of Glu-987 (the third zinc binding ligand of the C domain of ACE) by a valine is represented by an asterisk. The values determined for [ H]trandolaprilat binding are from Ref. 32. resulting specific labeling values were then corrected with the corresponding enzyme expression levels ( S labeling values). To validate the method, this protocol was applied to deter- mination of the zinc content of the ACE (Fig. 4). ACE is a zinc metalloprotease that has two homologous domains, each bear- ing a catalytically functional active site (17) able to bind a zinc atom (28, 29). Previous data demonstrated that mutation of either both histidines of the zinc binding motif of one domain or of Glu-987, the amino acid identified as the third zinc binding residue of the C domain, abolished the ability of this domain to bind the zinc ion (18). In addition to the wild type ACE, we used a mutant ACE Lys-361,365 containing an intact C domain and an N domain inactivated by the replacement of both histidines by lysines in the zinc binding motif. The second mutant (ACE Lys-361,365 3 Val-987) had the same mutations in the N domain and was also mutated on the third zinc binding residue of the C domain. The experiments were performed as described FIG.5. Zn binding in APA and APA mutants. Transfected previously for APA, except that immunoprecipitation was per- COS-7 cells were incubated for 5 h with Zn, the cell lysate proteins formed with an ACE antiserum. immunoprecipitated, and the resultant immune complexes counted to Counting measurements presented in Fig. 4 indicated that 65 measure the amount of Zn incorporated. Results are expressed as a Zn incorporation of the ACE Lys-361,365 mutant represents percentage of wild type APA Zn incorporation. Specific binding for the wild type APA is 550 6 100 cpm and represents 75% of total binding. 40% of that of wild type ACE, showing that suppression of one zinc binding motif of ACE allowed the enzyme to bind about half the zinc content compared with wild type ACE. The ACE coordinating residue. In contrast to the aspartate of the con- sensus sequence of other thermolysin-related metallopepti- Lys-361,365 3 Val-987 mutant exhibited 13% of radiolabeling compared with the wild type ACE, indicating that mutating the dases (thermolysin, NEP, ACE), Ser-412 is not involved in the precise positioning of the active-site zinc ion. This is consistent third zinc ligand of the other domain, thus both ACE active sites are inactivated, resulted in an almost complete abolish- with the fact that this residue is not conserved as an Asp in thermolysin-related peptidases. ment of isotope incorporation. In Fig. 5, the radioactivity of the different mutant immune The constructions were expressed in a way similar to the nonmutated cDNA and indicate that the different mutations do complexes are compared with that of wild type APA. The im- mune complex radioactivity of Ala-386 was identical to wild not affect the biosynthesis, the folding, or the stability of the resulting proteins. The loss of activity of Ala-386 could be due type APA, indicating that this mutation did not impair Zn binding. In contrast, Ala-408 was not able to incorporate the to the replacement of a charged amino acid (Glu) by a hydro- phobic alanine, thus causing structural modifications of the zinc isotope. When the negative charge was restored (Asp-408), active site. As no residual activity was detected when the the mutant bound the zinc ion, but the affinity for the metal charge was restored with an Asp residue (Asp-386), we deduced appeared lower since only 60% was recovered in the immuno- that the loss of activity was not due to structural changes, precipitated Zn-labeled enzyme. considering the minimal structural difference between Glu and DISCUSSION Asp. APA was first described as a calcium-stimulated aminopep- The glutamate in position 408 was also shown to be essential tidase (30). In this study, we were able to show by metabolic since the mutant Ala-408 was inactive, but in contrast to the labeling with Zn that this protein could bind the zinc isotope, mutant Glu-386, the substitution for an aspartate at the same confirming directly that APA is a zinc-dependent enzyme in position partially restored 5% of activity. The similar apparent agreement with the presence of the signature HEXXHinthe affinity for the substrate of Asp-408 and wild type APA sug- sequence (11). Our biochemical characterization and zinc con- gests that the loss of activity is due to an alteration of the tent analysis of the expressed mutants demonstrate that both ability of this mutant to efficiently cleave the peptide bond of glutamates residues 386 and 408 are essential for APA enzy- the substrate, rather than an alteration in substrate binding. matic activity and function differently in the catalytic mecha- The lack of activity of the different mutants (with the excep- nism. Glutamate 386 is directly involved in the catalytic activ- tion of Ala-412) might consequently be due to a direct partici- ity, whereas glutamate 408 functions as the third zinc pation of the mutated residue in catalysis or an indirect in- Glutamate Residues in the Active Site of APA 9073 functional role of this glutamate residue in other proteases of the gluzincin family, e.g. NEP (14), ACE (17), LTA4 hydrolase (34), and neutral protease of S. cacaoi (19): the replacement of this glutamate by another residue resulted in a total loss of catalytic activity but did not affect the binding of a competitive inhibitor that interacted with the zinc atom, demonstrating that this residue is essential for catalytic activity but does not coordinate with the zinc ion. Furthermore, the replacement of glutamate 408 by an aspar- tate leads to a reduction of the hydrolysis efficiency and zinc affinity. This conclusion is further supported by a second ap- proach using the APA inhibitor GluSH. The thiol group of GluSH interacts strongly with the zinc ion (4, 27). Therefore, the affinity of the enzyme for this competitive inhibitor de- pends on the presence of the zinc ion in the active site, and a difference in the inhibitory potency for the mutated or nonmu- tated enzyme would be consistent with an alteration in zinc ion binding. The difference observed between the inhibitory po- tency of GluSH for the wild type APA and Asp-408 indicates that the zinc ion is still present in the active site of Asp-408 and allows the binding of the inhibitor, but its lower affinity sug- FIG.6. Putative reaction mechanism for the catalytic activity gests a decrease in the interaction with the inhibitor, probably of APA, according to the model presented for thermolysin. The zinc atom is coordinated to three zinc ligands (His-385, His-389, and due to a modification of the zinc ion position in the active site Glu-408) and a water molecule. The negative charge of Glu-386 plays a of the mutant, as proposed for the NEP-related mutant (16). role in catalysis by polarizing the zinc coordinated water molecule. Using thermolysin and NEP as an active-site model for APA (Fig. 6) (13, 16), replacement of the third zinc ligand Glu-408 volvement of the residue in the binding of the catalytically with an aspartate increases the distance between the zinc ion essential zinc ion. To distinguish between these possibilities, and the carbonyl group of the substrate and/or the zinc-bound we determined directly the presence or absence of the zinc ion water molecule. The consequence of such a modification would in the active site of APA mutants by metabolic labeling of be a reduction in the nucleophilicity of the water molecule, thus transfected cells with Zn. This approach has been recently producing a drastic effect on catalysis. used on the zinc-dependent insulin-degrading enzyme (31). The negative charge in position 408 is crucial for retention of Validation of the methodology was achieved by studying the the zinc ion in the active site of the enzyme, and the length of zinc content of previously characterized ACE mutants (17, 18). the Glu-408 side chain allows a precise positioning of the zinc The results are in agreement with previous work in which the ion essential for catalysis (33). presence of zinc in ACE mutants was indirectly estimated by Many zinc metalloproteases have been shown to share con- testing the sensitivity to [ H]trandolaprilat, a high affinity served zinc-coordinating residues in their active sites. Muta- specific ACE inhibitor whose binding depends on the presence tion of the histidines of the zinc binding motif or the conserved of the zinc ion in the active site of the enzyme (18, 32). In APA, glutamate identified as the third zinc-coordinating residue by a the elimination of the negative charge (Glu-3863 Ala) does not hydrophobic or positively charged residue led to the loss of affect zinc binding, indicating that glutamate 386 does not catalytic activity and zinc binding for APA (22), NEP (15, 16), coordinate the zinc ion. In contrast, Ala-408 cannot bind the ACE (17, 18), LTA4 hydrolase (20), and neutral metallopro- zinc ion, and the conservation of the negative charge (Asp-408) tease (19) gluzincins. partially restores zinc binding. These data support the hypoth- In summary, the present data show the importance of Glu- esis that glutamate 408 is the third coordinating ligand of the 386 and Glu-408 in the catalysis and zinc binding of APA, zinc ion in the active site of APA. respectively. These results are consistent with the catalytic Taken together, these results show that the replacement of mechanism of APA being similar to that proposed for thermo- Glu-386 by a hydrophobic or a negatively charged residue abol- lysin for which the three- dimensional structure is known. This ishes enzymatic activity but does not modify zinc binding, suggests that the APA exopeptidase is functionally more demonstrating that Glu-386 is not a zinc ligand but is essential closely related to metalloendopeptidases such as thermolysin for catalytic activity. The drastic effect on the enzymatic activ- or NEP than to other related metalloexopeptidases such as ity observed when the glutamate 386 is replaced by an aspar- carboxypeptidases. The binding motif of the catalytic zinc atom tate is surprising, considering that the structural modification is shared by many zinc metalloproteases (35), and the amino consists of a retraction of the carboxylic group by a distance of acids of this motif appear to have a conserved function since approximately 1.4 Å. This shows that in addition to the charge, their mutation leads to similar characteristics with regard to the length of the side chain of Glu-386 and consequently the enzymatic activity and zinc binding. This assumed similarity in geometry of this amino acid are crucial for enzymatic activity the catalytic site of the endopeptidase NEP and the exopepti- (14). By analogy with thermolysin and NEP (13, 33), a sche- dase APN was at the basis of the development of dual NEP/ matic model of the APA zinc binding site and a putative reac- APN inhibitors (33). Nevertheless, the loss of enzymatic activ- tion mechanism for the catalytic activity of APA can be pro- ity and zinc affinity in the APA mutant Asp-408 seems to be posed (Fig. 6). The functional consequences of changing glutamate 386 for an aspartate or an alanine would be a re- slightly lower than that of the corresponding aspartate NEP and ACE mutants (16, 18). This suggests the occurrence of duction (or a suppression) of the polarization of the zinc-coor- dinated water molecule, which would not be sufficiently acti- some differences in the spatial disposition of zinc ligand and vated to initiate the nucleophilic attack on the substrate the glutamate involved in catalysis in APA and thermolysin, carbonyl group. NEP or ACE. This hypothesis is supported by the absence of a Site-directed mutagenesis studies have already shown the functional role for Ser-412 in the catalytic process of APA, 9074 Glutamate Residues in the Active Site of APA 12. Hooper, N. M. (1994) FEBS Lett. 354, 1–6 contrary to what was shown for the corresponding aspartate of 13. Matthews, B. W. (1988) Acc. Chem. Res. 21, 333–340 the consensus sequence EXIXD in thermolysin, NEP and ACE. 14. Devault, A., Nault, C., Zollinger, M., Fournie´-Zaluski, M. C., Roques, B. P., In the absence of any structural information on APA or the Crine, P., and Boileau, G. (1988) J. Biol. Chem. 263, 4033–4040 15. Devault, A., Sales, V., Nault, C., Beaumont, A., Roques, B., Crine, P., and related zinc aminopeptidases, the generation of functional Boileau, G. (1988) FEBS Lett. 231, 54–58 knowledge of the APA catalytic site may aid in the design of 16. LeMoual, H., Devault, A., Roques, B., Crine, P., and Boileau, G. (1991) J. Biol. Chem. 266, 15670–15674 specific and potent APA inhibitors, tools that are essential for 17. Wei, L., Alhenc-Gelas, F., Corvol, P., and Clauser, E. (1991) J. Biol. Chem. 266, exploring the physiological role of APA. 9002–9008 18. Williams, T. A., Corvol, P., and Soubrier, F. (1994) J. Biol. Chem. 269, Acknowledgments—We are grateful to Drs. Bernard Roques and 29430–29434 Marie-The´re`se Chauvet for helpful discussions during the course of this 19. Chang, P. C., and Lee, Y. H. W. (1992) J. Biol. Chem. 267, 3952–3958 work and critical reading of this manuscript. We also thank Dr. 20. Medina, J. F., Wetterholm, A., Radmark, O., Shapiro, R., Haeggstro¨m,J.Z., Sherwin Wilk for providing the APA antiserum, Dr. Marie-Claude Vallee, B. L., and Samuelsson, B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7620–7624 Fournie´-Zaluski for the gift of the APA inhibitor, and Drs. Lei Wei and 21. Orning, L., Krivi, G., and Fitzpatrick, F. A. (1991) J. Biol. Mol. 266, 1375–1378 Tracy Williams for the gift of ACE mutants. 22. Wang, J. Y., and Cooper, M. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1222–1226 REFERENCES 23. Roques, B. P. (1993) Biochem. Soc. Trans. 21, 678–685 1. Wilk, S., and Healy, D. (1993) Adv. Neuroimmunol. 3, 195–207 24. LeMoual, H., Dion, N., Roques, B., Crine, P., and Boileau, G. (1994) Eur. J. 2. Nagatsu, I., Nagatsu, T., Yamamoto, T., Glenner, G. G., and Mehl, J. W. (1970) Biochem. 221, 475–480 Biochim. Biophys. Acta 198, 255–270 25. Herlitze, S., and Koenen, M. (1990) Gene (Amst.) 91, 143–147 3. Lodja, Z., and Gossrau, R. (1980) Histochemistry 67, 267–290 26. Laemmli, U. K. (1970) Nature 227, 680–685 4. Chauvel, E. N., Llorens-Corte`s, C., Coric, P., Wilk, S., Roques, B., and Fournie´- 27. Wilk, S., and Thurston, L. S. (1990) Neuropeptides 16, 163–168 Zaluski, M. C. (1994) J. Med. Chem. 37, 2950–2956 28. Ehlers, M. R. W., and Riordan, J. F. (1991) Biochemistry 30, 7118–7126 5. Chai, S. Y., Allen, A. M., Adam, W. R., and Mendelsohn, F. A. O. (1986) 29. Williams, T. A., Barnes, K., Kenny, A. J., Turner, A. J., and Hooper, N. M. J. Cardiovasc. Pharmacol. 10, S35–S39 (1992) Biochem. J. 288, 875–881 6. Bottari, S. P., deGasparo, M., Steckeling, U. M., and Levens, N. R. (1993) 30. Glenner, G. G., McMillan, P. J., and Folk, J. E. (1962) Nature 194, 867–868 Front. Neuroendocrinol. 14, 123–171 31. Perlman, R. K., and Rosner, M. R. (1994) J. Biol. Chem. 269, 33140–33145 7. Danielsen, E. M., Nore´n, O., Sjo¨stro¨m, H., Ingram, J., and Kenny, A. J. (1980) 32. Wei, L., Clauser, E., Alhenc-Gelas, F., and Corvol, P. (1992) J. Biol. Chem. 267, Biochem. J. 189, 591–603 13398–13405 8. Wu, Q., Lahti, J. M., Air, G. M., Burrows, P. D., and Cooper, M. D. (1990) Proc. 33. Roques, B. P., Noble, F., Dauge´, V., Fournie´-Zaluski, M. C., and Beaumont, A. Natl. Acad. Sci. U. S. A. 87, 993–997 (1993) Pharmacol. Rev. 45, 87–145 9. Nanus, D. M., Engelstein, D., Gastl, G. A., Gluck, L., Vidal, M. J., Morrison, M., Finstad, C. L., Bander, N. H., and Albino, A. P. (1993) Proc. Natl. Acad. 34. Wetterholm, A., Medina, J. F., Radmark, O., Shapiro, R., Haeggstro¨m,J.Z., Vallee, B. L., and Samuelsson, B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, Sci. U. S. A. 90, 7069–7073 10. Li, L., Wang, J., and Cooper, M. D. (1993) Genomics 17, 657–664 9141–9145 11. Jongeneel, C. V., Bouvier, J., and Bairoch, A. (1989) FEBS Lett. 242, 211–214 35. Vallee, B. L., and Auld, D. S. (1990) Biochemistry 29, 5647–5658 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Identification of Glutamate Residues Essential for Catalytic Activity and Zinc Coordination in Aminopeptidase A

Vazeux, Gilles; Wang, Jiyang; Corvol, Pierre; Llorens-Cortès, Catherine
Journal of Biological Chemistry – Apr 1, 1996
Download PDF
6 pages

Loading next page...
 
/lp/unpaywall/identification-of-glutamate-residues-essential-for-catalytic-activity-NxnB2ndRuF

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.271.15.9069
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 15, Issue of April 12, pp. 9069–9074, 1996 © 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Identification of Glutamate Residues Essential for Catalytic Activity and Zinc Coordination in Aminopeptidase A* (Received for publication, October 12, 1995, and in revised form, December 19, 1995) Gilles Vazeux‡, Jiyang Wang§, Pierre Corvol‡, and Catherine Llorens-Corte`s‡ From ‡INSERM Unit 36, Colle`ge de France, 3, rue d’Ulm, 75005 Paris, France and the §Howard Hughes Medical Institute, University of Alabama, Birmingham, Alabama 35294 Aminopeptidase A (EC 3.4.11.7, APA) is a homodimeric absorption spectrophotometry failed to detect any Zn in the membrane-bound glycoprotein that contains the con- purified enzyme, whereas one Ca ion was found to be asso- sensus sequence HEXXH (385–389) found in zinc metal- ciated with each monomer (7). Then, molecular cloning of the lopeptidases such as thermolysin. The x-ray structure of related murine B lymphocyte differentiation antigen BP1/6C3 the latter enzyme revealed that the two histidines of this (8), followed more recently by the cloning of APA in man (9, 10), motif are two of the three zinc-coordinating ligands and revealed the presence of the consensus sequence HEXXH found that the glutamate is a crucial amino acid involved in in the zinc metalloprotease family (11), recently classified as catalysis. Alignment of the sequence of mouse APA with zincins (12). In this motif, both histidines are two of the three those of the already characterized metallopeptidases zinc ligands, and the glutamate acts as a catalytic base. The showed the presence of several conserved amino acids overall amino acid homology of APA with other aminopepti- such as a glutamate residue in position 408 which may dases such as aminopeptidase N (APN), thyrotropin-releasing constitute the putative third zinc ligand. The functional hormone-degrading enzyme, and leukotriene A4 (LTA4) hydro- implication of this residue and the role of glutamate 386 lase reaches 25–35%, and the conservation is higher in the in the HELVH (385–389) motif of APA have been investi- region surrounding the zinc binding motif (Fig. 1). The x-ray gated by replacing these residues with an aspartate crystal structure of thermolysin showed the zinc ion to play a (Asp-386, Asp-408) or an alanine (Ala-386, Ala-408) by site-directed mutagenesis. Expressed mutated proteins catalytic role. It is coordinated to three amino acid side chains in position 386 showed no APA activity. Ala-408 was also and a water molecule that, upon ionization/polarization by the inactive, and Asp-408 had 5% of the wild type enzyme glutamate, initiates the nucleophilic attack of the substrate activity and a similar K . Zn incorporation measure- m scissile peptide bond (13). Site-directed mutagenesis studies ments indicated that Ala-386 binds the zinc ion as well have allowed the identification of corresponding residues in as the wild type enzyme, whereas the Ala-408 mutant did some members of the gluzincin family, including neutral en- not. These results provide evidence that Glu-408 is the dopeptidase (EC 3.4.24.11, NEP) (14–16), angiotensin-convert- third zinc-coordinating residue of APA, confirm the pre- ing enzyme (ACE) (17); (18), neutral metalloprotease from sumed involvement of Glu-386 in the catalytic process of Streptomyces cacaoi (19), and LTA4 hydrolase (20), which has the enzyme, and identify APA as a zinc metallopeptidase an aminopeptidase activity in addition to its epoxide hydrolase functionally similar to thermolysin. activity (21). In APA, replacement of His-389 by a phenylala- nine in the zinc binding motif of APA abolished the enzymatic activity, suggesting that this residue is probably one of the zinc Aminopeptidase A (glutamyl-aminopeptidase, EC 3.4.11.7, ligands (22). Nevertheless, the presence or absence of the zinc APA ) is a homodimeric type II membrane-bound protease, atom in the protein and the demonstration of its role in catal- which specifically cleaves in vitro the NH -terminal glutamyl ysis were not directly demonstrated and remain to be estab- or aspartyl residue (Glu or Asp) from peptide substrates such lished by a direct approach. as cholecystokinin-8 or angiotensin II (1, 2). Its activity is 21 Alignment of APA with other metallopeptidases (Fig. 1) in enhanced by various divalent cations such as Ca . APA is the region surrounding the zinc binding motif reveals that primarily located in the brush borders of the intestinal or renal several residues known to be involved in catalysis or zinc epithelial cells as well as in the vascular endothelium (3). Until binding are conserved. Interestingly, the sequence surrounding recently (4), the absence of specific APA inhibitors made it the glutamate zinc ligand in LTA4 hydrolase (20), WLXEG, is difficult to identify its physiological role. However, the enzyme conserved among the different aminopeptidases presented in is colocalized with some components of the renin angiotensin Fig. 1 (APA, APN, LTA4 hydrolase, and thyrotropin-releasing system (3, 5, 6), which suggests its potential role in vivo in the hormone-degrading enzyme). Furthermore, the amino acid se- conversion of angiotensin II to angiotensin III by removing the quence distance between glutamates of the HEXXH and NH -terminal aspartate residue. WLXEG motifs (21 residues) is also conserved. APA was first characterized as a Ca protease, since atomic We therefore hypothesized that Glu-408 located in the WL- NEG (405–409) motif of APA constitutes the third zinc ligand * The costs of publication of this article were defrayed in part by the and that Glu-386 located in the zinc binding motif HELVH payment of page charges. This article must therefore be hereby marked (385–389) plays a crucial role in catalysis as observed for other “advertisement” in accordance with 18 U.S.C. Section 1734 solely to gluzincins. Another conserved motif, EXIXD, where the gluta- indicate this fact. To whom correspondence should be addressed. Tel.: 331-44-27-16- mate is the third zinc ligand, has been identified in thermoly- 59; Fax: 331-44-27-16-91. sin, NEP, and ACE (23). Kinetic analysis and binding experi- The abbreviations used are: APA, aminopeptidase A; APN, amino- ments performed with NEP, ACE, and various mutants peptidase N; LTA4, leukotriene A4; NEP, neutral endopeptidase; ACE, indicate that the aspartate is involved in the precise position- angiotensin-converting enzyme; GluNA, a-L-glutamyl-b-naphthylam- ide; GluSH, glutamate-thiol. ing of the first histidine zinc ligand in the HEXXH motif, via a This is an Open Access article under the CC BY license. 9070 Glutamate Residues in the Active Site of APA FIG.1. Amino acid sequence align- ment of the zinc binding domain of different zinc metalloproteases. The putative zinc ligands and their homolo- gous residues in the other sequences are indicated in shadow letters. Numbers re- fer to the position of the mutated residues in the APA sequence. Conserved residues in APA, APN, LTA4 hydrolase, and thy- rotropin-releasing hormone-degrading enzyme are underlined. containing 10% glycerol, 5% 2-mercaptoethanol, 2% SDS and resolved salt link for an optimal interaction with the active site zinc ion by SDS-polyacrylamide gel electrophoresis (7.5% polyacrylamide) ac- (18, 24). However, in APA and APN, the corresponding residue cording to Laemmli (26). The dried gel was then exposed for is a serine (Ser-412 in APA). This led us to hypothesize that the autoradiography. hydroxyl group of the serine side chain may interact via a To account for small variations in APA synthesis due to differences in hydrogen bond with the first histidine of the HEXXH motif. the efficiency of electroporation or in the number of surviving cells, we To test these hypotheses, we investigated the functional determined the expression level of each mutant. For this purpose, we scanned the autoradiogram of immunoprecipitated wild type and mu- roles of glutamate residues 386 and 408 and serine residue 412 tant protein. We have verified that the quantity of immunoprecipitated by site-directed mutagenesis. In addition, a new method was protein was proportional to the concentration of antigen in the cell used for directly determining the presence of zinc in the active extract. An internal standard curve was constructed with different site of the recombinant APA. dilutions of immunoprecipitated wild type protein, and we used differ- ent exposure times of the autoradiogram to optimize conditions in EXPERIMENTAL PROCEDURES which a linear relationship was observed between amount of protein Site-directed Mutagenesis and Construction of Expression Plas- and the mean density. To determine the activities of the mutants with mids—Site-directed mutagenesis was performed on the mouse cDNA respect to the same quantity of enzyme, the substrate hydrolysis rates encoding APA (22), contained in the expression vector SRaBP1, using are reported for equivalent levels of expression of each mutant. Using the polymerase chain reaction as described previously (25). Two over- this methodology, the variation of the wild type specific activity from lapping regions of the cDNA were amplified separately using two flank- three different transfections is approximately 10% of the mean value. ing oligonucleotides A and B and one variable internal oligonucleotide Enzyme Assay—Transfected COS-7 cells were washed twice and C (Table I). Primer C, containing the mutation and a non-unique re- harvested by scraping in phosphate-buffered saline. After centrifuga- striction site (TaqI), was used with primer A to amplify the upstream tion at 2,000 3 g, 10 min, 4 °C, the cell pellet was resuspended in fragment. The downstream fragment was obtained after amplification ice-cold 50 mM Tris-HCl buffer, pH 7.4 (1 ml/35-mm Petri dish), soni- with oligonucleotides A and B followed by digestion with the restriction cated for 30 s, and dispensed in aliquots for the enzyme assay. enzyme TaqI and purification from a 2% agarose gel (GeneClean 2, The APA activity of these cell extracts was determined in a microtiter Bio101). The upstream fragment containing the mutation and the plate by following the rate of hydrolysis of a synthetic substrate, a-L- downstream fragment, digested with TaqI that cut in the overlapping glutamyl-b-naphthylamide (GluNA, Bachem) (4). sequence, were ligated. The resulting fragment was amplified with the The kinetic parameters (initial velocity, K ) were determined from 59- and 39-flanking primers A and B, which were chosen to cover a Lineweaver-Burk plots using final concentration ranging from 0.025 to sequence including unique restriction sites. DNA polymerase isolated 0.4 mM GluNA. from Pyrococcus furiosus (Pfu) (1 unit) was used (30 cycles: 94 °C, 30 s; The sensitivity of APA and some of the mutants to glutamate-thiol 55 °C, 30 s; 72 °C, 1 min). After gel purification of the fragment, the (GluSH), an inhibitor of APA (27), was determined by establishing 350-base pair polymerase chain reaction DNA insert containing the dose-dependent inhibition curves and calculating their IC values (an- mutation was substituted for the corresponding nonmutated region alyzed using a weighted nonlinear least squares regression program (S. (NarI-EcoRV) of the full-length APA cDNA. The presence of the muta- Urien; MICROPHARM, Faculte´de Me´decine, Department of Pharma- tions and the absence of nonspecific mutations were confirmed by cologie, Creteil, France)). sequencing the 350-base pair mutated region by the dideoxy chain 65 Incorporation of Zn—Half of each pool of cells, transfected as de- termination method (Sequenase 2, U. S. Biochemical Corp.). scribed previously, was incubated for 5 h (48 h after transfection) with The glutamate residue at position 386 was substituted for either an 65 20 mCi/ml Zn (Amersham Corp.). The other half of the pool was aspartate (Asp-386), or an alanine (Ala-386); glutamate 408 was mu- 35 subjected to metabolic labeling with [ S]methionine and immunopre- tated either to an aspartate (Asp-408) or to an alanine (Ala-408), and cipitation under the conditions described above. Immunoprecipitation serine 412 was replaced by an alanine (Ala-412). The primers used for 65 of the Zn-labeled cell extracts was performed using the same proce- the constructions of the mutant cDNAs are shown in Table I. dure except that the solubilization and washing buffer did not contain The ACE mutants were a generous gift from Dr. L. Wei (ACE Lys- EDTA. The immune complex was then counted with an automatic 361,365) and Dr. T. Williams (ACE Lys-361,365 Val-987). gamma counter. Transfection of COS-7 Cells—COS-7 cells were grown in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc.) complemented with RESULTS 10% fetal calf serum and were transfected with 30 mg of plasmid by Expression of Recombinant APA in COS-7 Cells and Meta- electroporation (250 V, 1,800 microfarads, Eurogentec electroporator). Each pool of transfected cells was divided into two 35-mm Petri dishes, bolic Labeling—To study the role of the amino acids proposed one for enzyme assay and one for metabolic labeling. to be essential in the APA active site, we constructed a series of Metabolic Labeling and Immunoprecipitation—Transfected COS-7 APA cDNAs encoding mutants of glutamates 386, 408, and cells were incubated 48 h after transfection in methionine- and serum- serine 412. Equivalent amounts of mutated APA cDNAs were free medium (Ham’s F-12) containing 50 mCi/ml [ S]methionine for 5 h. transiently transfected into COS-7 cells. After transfection, the Proteins were solubilized for2hin50mM Tris-HCl, pH 7.4, 150 mM cells were labeled by incubation with [ S]methionine, har- NaCl, 10 mM EDTA, and 1% Triton X-100 and then centrifuged at 15,000 3 g for 5 min at 4 °C. The supernatants were recovered, and vested, and the proteins from cell extracts were solubilized, immunoprecipitation was performed by incubating these cell extracts immunoprecipitated with an anti-APA polyclonal antiserum, overnight at 4 °C with protein A-Sepharose (Pharmacia LKB Biotech- resolved on SDS-polyacrylamide gel electrophoresis, and de- nology Inc.) (50 ml of 50% suspension in solubilization buffer) and 3 ml tected by autoradiography. Fig. 2 shows the presence of a major of a polyclonal anti-rat APA rabbit antiserum (final dilution: 1/200). band migrating with an apparent molecular mass of 130 kDa The immune complexes were collected by centrifugation and washed for the wild type APA and for the different mutants, indicating three times with solubilization buffer and once with 20 mM Tris-HCl, pH 6.8. Proteins were eluted (by boiling in 20 mM Tris-HCl, pH 6.8, that each mutant was expressed and similarly glycosylated. An Glutamate Residues in the Active Site of APA 9071 TABLE I Primers used for polymerase chain reaction mutagenesis of mouse APA cDNA Mutated bases are indicated in bold. Restriction sites are underlined. Numbers refer to the APA sequence deposited in the GenBank data base (accession no. M29961). Amino acid Name Nucleotide sequence (59–39) Numbering substitution A CTATGGAGTATGCGCTTCC 1075–1094 B TGCCTCTTGCAGTGAATCCC 1641–1621 C1 TGGTGTACAAGTGCGTGGG 1256–1239 Glu 3 Ala C2 TGGTGTACAAGATCGTGGG 1256–1239 Glu 3 Asp C3 AACTCGAAGAACGAAGCAAATCCTGGATTTAGC 1334–1301 Glu 3 Ala C4 AACTCGAAGAACGAAGCAAATCCATCATTTAGC 1334–1301 Glu 3 Asp C5 AACTCGAAGAACGCAGCAAATCC 1334–1311 Ser 3 Ala FIG.2. Metabolic labeling of recombinant APA. Transfected COS-7 cells were labeled for 5 h with [ S]methionine, and cell lysate proteins immunoprecipitated with an anti-APA polyclonal antiserum and resolved by 7.5% SDS-polyacrylamide gel electrophoresis, were identified by autoradiography. The first two lanes correspond to the cells transfected with pSVneo and the wild type APA, respectively. The FIG.3. Enzymatic activity of APA mutants. APA activity in cel- mutants have been named according to the position of the wild type lular extracts of transfected COS-7 cells is expressed as a percentage of residues and the amino acid to which they have been mutated. The wild type APA activity. Measurements are the mean 6 S.E. of three monomeric and dimeric forms of APA are indicated by arrows. independent transfections with duplicate determinations. The mean value for wild type APA corresponds to 1.3 nmol of substrate hydro- lyzed/min/mg of total protein. upper band of 260 kDa corresponding to the dimeric form of APA was also present in each lane. No specific protein band To characterize further the properties of the mutant Asp- was detected in the cells transfected with the control vector 408, we studied the K of this mutant and its response to the pSVneo. APA inhibitor GluSH. Asp-408 had a K of 98 6 2 mM, close to Enzymatic Activity of Recombinant APA—Fig. 3 shows the that of wild type APA (60 6 15 mM). IC values for GluSH were 27 27 enzymatic activity of the mutants expressed as a percentage of 4.2 6 0.18 3 10 M for Asp-408 and 1.0 6 0.3 3 10 M for the wild type recombinant APA activity, taking into account that wild type enzyme. The apparent affinities of the wild type the same amount of recombinant enzyme was used, as de- enzyme and Asp-408 for GluNA are comparable, suggesting scribed under “Experimental Procedures.” The activity of wild that the decrease of activity is probably due to a lower effi- type APA could be detected with short incubation times (15–30 ciency of hydrolysis. In contrast, the inhibitory potency of min), and this activity was abolished completely when 10 M of GluSH is about four times lower for Asp-408 compared with the the APA inhibitor GluSH or 10 mM EDTA was added. In the nonmutated enzyme. cells transfected with vector alone, 2 h was necessary to detect Zn Binding to Recombinant APA—To test for the presence less than 1% activity, which probably corresponds to the en- or absence of the zinc ion in the active site of the wild type APA dogenous APA activity of COS cells. This system therefore and its mutants, COS-7 cells were transfected with the differ- allows the expression of fully active recombinant wild type APA ent mutated cDNAs and incubated with the medium containing and permits the comparison of the enzymatic activities of the Zn. Cell extracts were then immunoprecipitated and the im- different mutants. In contrast to wild type APA, the activity of mune complexes counted. In parallel, an equivalent number of the mutant Ala-386 was not significantly different from the transfected cells was subjected to metabolic labeling with negative control. No residual activity was detected when the [ S]methionine. Autoradiography and densitometric scanning negative charge was restored with an Asp residue (mutant of immune complexes were performed after SDS-polyacryl- Asp-386). At position 408, changing the glutamate for an ala- amide gel electrophoresis, and allowed us, as for the enzymatic nine (mutant Ala-408) led to an inactive protein, preventing activity measurements, to calibrate the Zn measurements. measurement of kinetic parameters. In contrast, when the The sensitivity was improved by counting the radioactivity of negative charge was restored with an aspartate (mutant Asp- the immunoprecipitated fractions. To estimate the nonspecific 408), a low but significant activity could be detected, represent- labeling in these immunoprecipitated fractions, a control of ing 5% of the wild type APA specific activity. There was no nontransfected COS-7 cells was treated in parallel to estimate alteration of the activity of the mutant Ala-412 which was the background level, which was then subtracted from the similar to that of the wild type APA. previously obtained Zn labeling values of the mutants. The 9072 Glutamate Residues in the Active Site of APA FIG.4. Zn binding in ACE mu- tants. Comparison of two different meth- odologies for the determination of the presence of zinc in ACE and ACE mu- tants. Schematic representation of ACE and ACE mutants. The two homologous N and C domains are indicated, respec- tively, by the left and right shaded boxes, and the zinc binding motif is indicated under each domain. Mutations are indi- cated in bold. The replacement of Glu-987 (the third zinc binding ligand of the C domain of ACE) by a valine is represented by an asterisk. The values determined for [ H]trandolaprilat binding are from Ref. 32. resulting specific labeling values were then corrected with the corresponding enzyme expression levels ( S labeling values). To validate the method, this protocol was applied to deter- mination of the zinc content of the ACE (Fig. 4). ACE is a zinc metalloprotease that has two homologous domains, each bear- ing a catalytically functional active site (17) able to bind a zinc atom (28, 29). Previous data demonstrated that mutation of either both histidines of the zinc binding motif of one domain or of Glu-987, the amino acid identified as the third zinc binding residue of the C domain, abolished the ability of this domain to bind the zinc ion (18). In addition to the wild type ACE, we used a mutant ACE Lys-361,365 containing an intact C domain and an N domain inactivated by the replacement of both histidines by lysines in the zinc binding motif. The second mutant (ACE Lys-361,365 3 Val-987) had the same mutations in the N domain and was also mutated on the third zinc binding residue of the C domain. The experiments were performed as described FIG.5. Zn binding in APA and APA mutants. Transfected previously for APA, except that immunoprecipitation was per- COS-7 cells were incubated for 5 h with Zn, the cell lysate proteins formed with an ACE antiserum. immunoprecipitated, and the resultant immune complexes counted to Counting measurements presented in Fig. 4 indicated that 65 measure the amount of Zn incorporated. Results are expressed as a Zn incorporation of the ACE Lys-361,365 mutant represents percentage of wild type APA Zn incorporation. Specific binding for the wild type APA is 550 6 100 cpm and represents 75% of total binding. 40% of that of wild type ACE, showing that suppression of one zinc binding motif of ACE allowed the enzyme to bind about half the zinc content compared with wild type ACE. The ACE coordinating residue. In contrast to the aspartate of the con- sensus sequence of other thermolysin-related metallopepti- Lys-361,365 3 Val-987 mutant exhibited 13% of radiolabeling compared with the wild type ACE, indicating that mutating the dases (thermolysin, NEP, ACE), Ser-412 is not involved in the precise positioning of the active-site zinc ion. This is consistent third zinc ligand of the other domain, thus both ACE active sites are inactivated, resulted in an almost complete abolish- with the fact that this residue is not conserved as an Asp in thermolysin-related peptidases. ment of isotope incorporation. In Fig. 5, the radioactivity of the different mutant immune The constructions were expressed in a way similar to the nonmutated cDNA and indicate that the different mutations do complexes are compared with that of wild type APA. The im- mune complex radioactivity of Ala-386 was identical to wild not affect the biosynthesis, the folding, or the stability of the resulting proteins. The loss of activity of Ala-386 could be due type APA, indicating that this mutation did not impair Zn binding. In contrast, Ala-408 was not able to incorporate the to the replacement of a charged amino acid (Glu) by a hydro- phobic alanine, thus causing structural modifications of the zinc isotope. When the negative charge was restored (Asp-408), active site. As no residual activity was detected when the the mutant bound the zinc ion, but the affinity for the metal charge was restored with an Asp residue (Asp-386), we deduced appeared lower since only 60% was recovered in the immuno- that the loss of activity was not due to structural changes, precipitated Zn-labeled enzyme. considering the minimal structural difference between Glu and DISCUSSION Asp. APA was first described as a calcium-stimulated aminopep- The glutamate in position 408 was also shown to be essential tidase (30). In this study, we were able to show by metabolic since the mutant Ala-408 was inactive, but in contrast to the labeling with Zn that this protein could bind the zinc isotope, mutant Glu-386, the substitution for an aspartate at the same confirming directly that APA is a zinc-dependent enzyme in position partially restored 5% of activity. The similar apparent agreement with the presence of the signature HEXXHinthe affinity for the substrate of Asp-408 and wild type APA sug- sequence (11). Our biochemical characterization and zinc con- gests that the loss of activity is due to an alteration of the tent analysis of the expressed mutants demonstrate that both ability of this mutant to efficiently cleave the peptide bond of glutamates residues 386 and 408 are essential for APA enzy- the substrate, rather than an alteration in substrate binding. matic activity and function differently in the catalytic mecha- The lack of activity of the different mutants (with the excep- nism. Glutamate 386 is directly involved in the catalytic activ- tion of Ala-412) might consequently be due to a direct partici- ity, whereas glutamate 408 functions as the third zinc pation of the mutated residue in catalysis or an indirect in- Glutamate Residues in the Active Site of APA 9073 functional role of this glutamate residue in other proteases of the gluzincin family, e.g. NEP (14), ACE (17), LTA4 hydrolase (34), and neutral protease of S. cacaoi (19): the replacement of this glutamate by another residue resulted in a total loss of catalytic activity but did not affect the binding of a competitive inhibitor that interacted with the zinc atom, demonstrating that this residue is essential for catalytic activity but does not coordinate with the zinc ion. Furthermore, the replacement of glutamate 408 by an aspar- tate leads to a reduction of the hydrolysis efficiency and zinc affinity. This conclusion is further supported by a second ap- proach using the APA inhibitor GluSH. The thiol group of GluSH interacts strongly with the zinc ion (4, 27). Therefore, the affinity of the enzyme for this competitive inhibitor de- pends on the presence of the zinc ion in the active site, and a difference in the inhibitory potency for the mutated or nonmu- tated enzyme would be consistent with an alteration in zinc ion binding. The difference observed between the inhibitory po- tency of GluSH for the wild type APA and Asp-408 indicates that the zinc ion is still present in the active site of Asp-408 and allows the binding of the inhibitor, but its lower affinity sug- FIG.6. Putative reaction mechanism for the catalytic activity gests a decrease in the interaction with the inhibitor, probably of APA, according to the model presented for thermolysin. The zinc atom is coordinated to three zinc ligands (His-385, His-389, and due to a modification of the zinc ion position in the active site Glu-408) and a water molecule. The negative charge of Glu-386 plays a of the mutant, as proposed for the NEP-related mutant (16). role in catalysis by polarizing the zinc coordinated water molecule. Using thermolysin and NEP as an active-site model for APA (Fig. 6) (13, 16), replacement of the third zinc ligand Glu-408 volvement of the residue in the binding of the catalytically with an aspartate increases the distance between the zinc ion essential zinc ion. To distinguish between these possibilities, and the carbonyl group of the substrate and/or the zinc-bound we determined directly the presence or absence of the zinc ion water molecule. The consequence of such a modification would in the active site of APA mutants by metabolic labeling of be a reduction in the nucleophilicity of the water molecule, thus transfected cells with Zn. This approach has been recently producing a drastic effect on catalysis. used on the zinc-dependent insulin-degrading enzyme (31). The negative charge in position 408 is crucial for retention of Validation of the methodology was achieved by studying the the zinc ion in the active site of the enzyme, and the length of zinc content of previously characterized ACE mutants (17, 18). the Glu-408 side chain allows a precise positioning of the zinc The results are in agreement with previous work in which the ion essential for catalysis (33). presence of zinc in ACE mutants was indirectly estimated by Many zinc metalloproteases have been shown to share con- testing the sensitivity to [ H]trandolaprilat, a high affinity served zinc-coordinating residues in their active sites. Muta- specific ACE inhibitor whose binding depends on the presence tion of the histidines of the zinc binding motif or the conserved of the zinc ion in the active site of the enzyme (18, 32). In APA, glutamate identified as the third zinc-coordinating residue by a the elimination of the negative charge (Glu-3863 Ala) does not hydrophobic or positively charged residue led to the loss of affect zinc binding, indicating that glutamate 386 does not catalytic activity and zinc binding for APA (22), NEP (15, 16), coordinate the zinc ion. In contrast, Ala-408 cannot bind the ACE (17, 18), LTA4 hydrolase (20), and neutral metallopro- zinc ion, and the conservation of the negative charge (Asp-408) tease (19) gluzincins. partially restores zinc binding. These data support the hypoth- In summary, the present data show the importance of Glu- esis that glutamate 408 is the third coordinating ligand of the 386 and Glu-408 in the catalysis and zinc binding of APA, zinc ion in the active site of APA. respectively. These results are consistent with the catalytic Taken together, these results show that the replacement of mechanism of APA being similar to that proposed for thermo- Glu-386 by a hydrophobic or a negatively charged residue abol- lysin for which the three- dimensional structure is known. This ishes enzymatic activity but does not modify zinc binding, suggests that the APA exopeptidase is functionally more demonstrating that Glu-386 is not a zinc ligand but is essential closely related to metalloendopeptidases such as thermolysin for catalytic activity. The drastic effect on the enzymatic activ- or NEP than to other related metalloexopeptidases such as ity observed when the glutamate 386 is replaced by an aspar- carboxypeptidases. The binding motif of the catalytic zinc atom tate is surprising, considering that the structural modification is shared by many zinc metalloproteases (35), and the amino consists of a retraction of the carboxylic group by a distance of acids of this motif appear to have a conserved function since approximately 1.4 Å. This shows that in addition to the charge, their mutation leads to similar characteristics with regard to the length of the side chain of Glu-386 and consequently the enzymatic activity and zinc binding. This assumed similarity in geometry of this amino acid are crucial for enzymatic activity the catalytic site of the endopeptidase NEP and the exopepti- (14). By analogy with thermolysin and NEP (13, 33), a sche- dase APN was at the basis of the development of dual NEP/ matic model of the APA zinc binding site and a putative reac- APN inhibitors (33). Nevertheless, the loss of enzymatic activ- tion mechanism for the catalytic activity of APA can be pro- ity and zinc affinity in the APA mutant Asp-408 seems to be posed (Fig. 6). The functional consequences of changing glutamate 386 for an aspartate or an alanine would be a re- slightly lower than that of the corresponding aspartate NEP and ACE mutants (16, 18). This suggests the occurrence of duction (or a suppression) of the polarization of the zinc-coor- dinated water molecule, which would not be sufficiently acti- some differences in the spatial disposition of zinc ligand and vated to initiate the nucleophilic attack on the substrate the glutamate involved in catalysis in APA and thermolysin, carbonyl group. NEP or ACE. This hypothesis is supported by the absence of a Site-directed mutagenesis studies have already shown the functional role for Ser-412 in the catalytic process of APA, 9074 Glutamate Residues in the Active Site of APA 12. Hooper, N. M. (1994) FEBS Lett. 354, 1–6 contrary to what was shown for the corresponding aspartate of 13. Matthews, B. W. (1988) Acc. Chem. Res. 21, 333–340 the consensus sequence EXIXD in thermolysin, NEP and ACE. 14. Devault, A., Nault, C., Zollinger, M., Fournie´-Zaluski, M. C., Roques, B. P., In the absence of any structural information on APA or the Crine, P., and Boileau, G. (1988) J. Biol. Chem. 263, 4033–4040 15. Devault, A., Sales, V., Nault, C., Beaumont, A., Roques, B., Crine, P., and related zinc aminopeptidases, the generation of functional Boileau, G. (1988) FEBS Lett. 231, 54–58 knowledge of the APA catalytic site may aid in the design of 16. LeMoual, H., Devault, A., Roques, B., Crine, P., and Boileau, G. (1991) J. Biol. Chem. 266, 15670–15674 specific and potent APA inhibitors, tools that are essential for 17. Wei, L., Alhenc-Gelas, F., Corvol, P., and Clauser, E. (1991) J. Biol. Chem. 266, exploring the physiological role of APA. 9002–9008 18. Williams, T. A., Corvol, P., and Soubrier, F. (1994) J. Biol. Chem. 269, Acknowledgments—We are grateful to Drs. Bernard Roques and 29430–29434 Marie-The´re`se Chauvet for helpful discussions during the course of this 19. Chang, P. C., and Lee, Y. H. W. (1992) J. Biol. Chem. 267, 3952–3958 work and critical reading of this manuscript. We also thank Dr. 20. Medina, J. F., Wetterholm, A., Radmark, O., Shapiro, R., Haeggstro¨m,J.Z., Sherwin Wilk for providing the APA antiserum, Dr. Marie-Claude Vallee, B. L., and Samuelsson, B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7620–7624 Fournie´-Zaluski for the gift of the APA inhibitor, and Drs. Lei Wei and 21. Orning, L., Krivi, G., and Fitzpatrick, F. A. (1991) J. Biol. Mol. 266, 1375–1378 Tracy Williams for the gift of ACE mutants. 22. Wang, J. Y., and Cooper, M. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1222–1226 REFERENCES 23. Roques, B. P. (1993) Biochem. Soc. Trans. 21, 678–685 1. Wilk, S., and Healy, D. (1993) Adv. Neuroimmunol. 3, 195–207 24. LeMoual, H., Dion, N., Roques, B., Crine, P., and Boileau, G. (1994) Eur. J. 2. Nagatsu, I., Nagatsu, T., Yamamoto, T., Glenner, G. G., and Mehl, J. W. (1970) Biochem. 221, 475–480 Biochim. Biophys. Acta 198, 255–270 25. Herlitze, S., and Koenen, M. (1990) Gene (Amst.) 91, 143–147 3. Lodja, Z., and Gossrau, R. (1980) Histochemistry 67, 267–290 26. Laemmli, U. K. (1970) Nature 227, 680–685 4. Chauvel, E. N., Llorens-Corte`s, C., Coric, P., Wilk, S., Roques, B., and Fournie´- 27. Wilk, S., and Thurston, L. S. (1990) Neuropeptides 16, 163–168 Zaluski, M. C. (1994) J. Med. Chem. 37, 2950–2956 28. Ehlers, M. R. W., and Riordan, J. F. (1991) Biochemistry 30, 7118–7126 5. Chai, S. Y., Allen, A. M., Adam, W. R., and Mendelsohn, F. A. O. (1986) 29. Williams, T. A., Barnes, K., Kenny, A. J., Turner, A. J., and Hooper, N. M. J. Cardiovasc. Pharmacol. 10, S35–S39 (1992) Biochem. J. 288, 875–881 6. Bottari, S. P., deGasparo, M., Steckeling, U. M., and Levens, N. R. (1993) 30. Glenner, G. G., McMillan, P. J., and Folk, J. E. (1962) Nature 194, 867–868 Front. Neuroendocrinol. 14, 123–171 31. Perlman, R. K., and Rosner, M. R. (1994) J. Biol. Chem. 269, 33140–33145 7. Danielsen, E. M., Nore´n, O., Sjo¨stro¨m, H., Ingram, J., and Kenny, A. J. (1980) 32. Wei, L., Clauser, E., Alhenc-Gelas, F., and Corvol, P. (1992) J. Biol. Chem. 267, Biochem. J. 189, 591–603 13398–13405 8. Wu, Q., Lahti, J. M., Air, G. M., Burrows, P. D., and Cooper, M. D. (1990) Proc. 33. Roques, B. P., Noble, F., Dauge´, V., Fournie´-Zaluski, M. C., and Beaumont, A. Natl. Acad. Sci. U. S. A. 87, 993–997 (1993) Pharmacol. Rev. 45, 87–145 9. Nanus, D. M., Engelstein, D., Gastl, G. A., Gluck, L., Vidal, M. J., Morrison, M., Finstad, C. L., Bander, N. H., and Albino, A. P. (1993) Proc. Natl. Acad. 34. Wetterholm, A., Medina, J. F., Radmark, O., Shapiro, R., Haeggstro¨m,J.Z., Vallee, B. L., and Samuelsson, B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, Sci. U. S. A. 90, 7069–7073 10. Li, L., Wang, J., and Cooper, M. D. (1993) Genomics 17, 657–664 9141–9145 11. Jongeneel, C. V., Bouvier, J., and Bairoch, A. (1989) FEBS Lett. 242, 211–214 35. Vallee, B. L., and Auld, D. S. (1990) Biochemistry 29, 5647–5658

Journal

Journal of Biological Chemistry – Unpaywall

Published: Apr 1, 1996

There are no references for this article.