Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Two Cytoplasmic Domains of Mammalian Adenylyl Cyclase Form a GSα- and Forskolin-activated Enzyme in Vitro

Two Cytoplasmic Domains of Mammalian Adenylyl Cyclase Form a GSα- and Forskolin-activated Enzyme... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 18, Issue of May 3, pp. 10941–10945, 1996 © 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Two Cytoplasmic Domains of Mammalian Adenylyl Cyclase Form a G - and Forskolin-activated Enzyme in Vitro* sa (Received for publication, February 2, 1996, and in revised form, March 14, 1996) Shui-Zhong Yan, David Hahn, Zhi-Hui Huang, and Wei-Jen Tang‡ From the Department of Pharmacological and Physiological Sciences, University of Chicago, Chicago, Illinois 60637 Mammalian adenylyl cyclases have two homologous by P-site inhibitors, indicating the essential roles of C and 1a cytoplasmic domains (C and C ). The first cytoplasmic C domains for catalysis and regulation. In this paper, we 1 2 2a domain of type I enzyme (IC ) and the second cytoplas- describe the expression and purification of the C and C 1a 2a mic domain of type II enzyme (IIC -D3, a construct in domains of type I and type II adenylyl cyclase, respectively. which 36 N-terminal amino acids of the C region are 2 Alone, each has no adenylyl cyclase activity; however, mixing of deleted) were expressed and purified to homogeneity. the two domains in vitro results in G - and forskolin-activated sa Alone, each had no adenylyl cyclase activity; however, enzyme activity. mixing of the two domains in vitro resulted in G - and sa EXPERIMENTAL PROCEDURES forskolin-activated enzyme activity. The turnover num- ber for G - and forskolin-stimulated enzyme activity of Plasmids—For construction of the expression plasmid vector sa pProEx-HAH6, the NcoI and EcoRI 4.9-kb fragment of pProEx-1 (Life the complex between IC and IIC -D3 was 8.2 s . The 1 2 Technologies, Inc.) was ligated with the phosphorylated linkers (59- concentration of IIC -D3 to achieve half-maximal activa- CATGCATCACCATCACCATCACGCGGCCGCCTACCCGTATGATGT- tion of IC was 0.8 and 1.3 mM when stimulated by for- CCCGGATTACGCCGGAATTCCCATGGC and 59-AATTGCCATGGGA- skolin and G , respectively. The concentration of IIC -D3 sa 2 ATTCCGGCGTAATCCGGGACATCATACGGGTAGGCGGCCGCGTG- needed to complex with IC was reduced 10-fold (0.08 TGGTGATGGTGATG). Proper insertion of cDNA at the NcoI site of mM) when the enzyme was activated by both forskolin pProEx-HAH6 vector would result in the expression of a fusion protein and G , suggesting that G and forskolin increased the sa sa that contained both HA1 and hexo-histidine tags at the N terminus affinity of the two cytoplasmic domains for each other. (Fig. 1A). The BspHI and HindIII fragments were excised from pTrc-IC and pTrc-IC IIC -L (15). The resulting fragments were ligated with 1 2 3 NcoI- and HindIII-digested pProEx-HAH6 to construct vectors, pProEx- HAH6-IC and pPro-HAH6-IC IIC . To construct pProEx-HAH6-IIC , 1 1 2 2 The enzymatic activity of adenylyl cyclase is the key step in the BspHI-blunted EcoRI fragment was excised from pUC-IIC and regulating the intracellular cAMP concentration upon stimu- ligated into pProEx-HAH6 that was digested with NcoI and SmaI (15). lation of a variety of hormones, neurotransmitters, and other To construct pProEx-HAH6-IIC -D3, an 0.8-kb DNA fragment encoding regulatory molecules. There are at least nine distinct mamma- IIC was amplified by 15 cycles of polymerase chain reaction using pProEx-HAH6-IIC as the template, Vent DNA polymerase, and lian adenylyl cyclases which have a similar structure (Fig. 1A) two oligonucleotides (59-CGAGGAATTCTGGAGAACGTGCTTCCTG- (1–11). This includes two intensely hydrophobic domains (M CACAC and 59-TGCGTTCTGATTTAATCTGTATCAGGCTGA) as the and M ) and two ;40-kDa cytoplasmic domains (C and C ). 2 1 2 primers. The resulting DNA was digested with EcoRI and HindIII and The C and C domains contain sequences (C and C ) that 1 2 1a 2a ligated into pProEx-HAH6 that was digested with the same enzymes. are similar to each other and to other adenylyl and guanylyl Plasmids pProEx-HAH6-IC , -IIC , -IIC -D3, -IC IIC were used to 1 2 2 1 2 cyclases (12, 13). Each isoform of adenylyl cyclase has its own express IC , IIC , IIC -D3, and IC IIC , respectively. 1 2 2 1 2 Expression of Soluble Adenylyl Cyclase—Escherichia coli cells with a distinct tissue distribution and unique regulatory properties, plasmid were grown in Luria’s broth containing ampicillin (50 mg/ml) at providing modes for different cells to respond diversely to sim- 30 °C and IPTG to 0.1 mM was added when the culture reached an A ilar stimuli (12, 14). of 0.4. Cells were harvested at suitable times, centrifuged at 6,000 3 g Membrane-bound adenylyl cyclases are expressed in small at 4 °C, and frozen. Frozen cells was thawed in 1/10 culture volume of quantities, and the enzyme is labile and difficult to manipulate T b P (20 mM Tris HCl, pH 8.0, 5 mM b-mercaptoethanol, 0.1 mM 20 5 0.1 in detergent-containing solutions. To facilitate biochemical and phenylmethylsulfonyl fluoride), lysozyme to 0.1 mg/ml was added, the cells were sonicated briefly, and the supernatant after centrifugation structural analysis, a soluble adenylyl cyclase has been con- (150,000 3 g for 30 min, 4 °C) was saved. The concentration of proteins structed by linking the C and C domains of type I and type 1a 2a was determined using Bradford reagent (Bio-Rad) and bovine serum II adenylyl cyclases, respectively (15). The resulting protein is albumin as standard (16). The proteins were separated by electrophore- sensitive to activation by G and forskolin and to inhibition sa sis on 11% SDS-PAGE and immunoblot was performed using the ECL system (Amersham). Ascites fluid of hybridoma 12CA5 was raised and collected as described (17). * This work was supported by the Cancer Research Foundation and Purification of Soluble Adenylyl Cyclase—All steps of the purification Brain Research Foundation. The costs of publication of this article were were performed at 4 °C in a cold room. Supernatant of E. coli lysate defrayed in part by the payment of page charges. This article must (from 4 liters, harvested 4 h after IPTG induction) was applied directly therefore be hereby marked “advertisement” in accordance with 18 to a 20-ml Ni-NTA column (Qiagen) that was equilibrated with U.S.C. Section 1734 solely to indicate this fact. ‡ To whom correspondence should be addressed: Dept. of Pharmaco- T b P containing 100 mM NaCl. The Ni-NTA column was washed 20 5 0.1 logical and Physiological Sciences, University of Chicago, 947 E. 58th with 100 ml of T b P containing 500 mM NaCl and 100 ml of 20 5 0.1 St., Chicago, IL 60637. Tel.: 312-702-4331; Fax: 312-702-3774. T b P N containing 20 mM imidazole (pH 7.0). The column was 20 5 0.1 100 The abbreviations used are: G , the a subunit of the G protein that then eluted with 100 ml of T b P N containing 150 mM imidazole sa 20 5 0.1 100 stimulates adenylyl cyclase; Fsk, forskolin; GTPgS, guanosine 59-3-O- (pH 7.0). The eluate was concentrated by ultrafiltration (Amicon, pos- (thio)triphosphate; 29-d-39-AMP, 29-deoxyadenosine 39-monophosphate; itive pressure ultrafiltration device, PM 10 membrane) and then diluted DTT, dithiothreitol; PAGE, polyacrylamide gel electrophoresis; kb, 2-fold with T E D (20 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 1 mM 20 1 1 kilobase pair(s); FPLC, fast protein liquid chromatography; IPTG, isopropyl-1-thio-b-D-galactopyranoside; HA1, hemagglutinin of influ- enza virus. Buffer compositions: T 5 20 mM Tris-HCl, pH 8.0 at 4 °C; N 5 100–500 mM NaCl; P 5 0.1 mM phenylmethylsulfonyl 20 100–500 0.1 b 5 5mM b-mercaptoethanol; D 5 1mM DTT; E 5 1mM EDTA; fluoride; I 5 20–150 mM imidazole, pH 7.0. 5 1 1 20–150 This is an Open Access article under the CC BY license. 10942 Soluble Adenylyl Cyclase DTT), these steps being repeated three times to reduce NaCl concen- tration to below 15 mM. The resulting concentrate was applied to a Pharmacia Mono Q HR 10/10 fast protein liquid chromatography (FPLC) column that had been equilibrated with T E D . The column 20 1 1 was washed with 1 volume of T E D , and absorbed proteins were 20 1 1 eluted at 1 ml/min with the 240-ml linear gradient of NaCl (200–500 mM and 100–300 mM NaCl for purification of IC and IIC -D3, respec- 1 2 tively) in T E D ; 4-ml fractions were collected. The protein peak of IC 20 1 1 1 was determined by its adenylyl cyclase activity when the fractions were mixed with E. coli lysates that contained IIC ; the peak of IIC -D3 was 2 2 determined using the lysates containing IC . Recombinant protein, IC 1 1 was eluted at about 350 mM NaCl and IIC -D3 at about 200 mM NaCl. The peak fractions of IC and IIC -D3 were then separated by electro- 1 2 phoresis on 11% SDS-PAGE and analyzed for purity by Coomassie Blue staining. The purest fractions of IC were then applied to a Pharmacia Superdex 200 HR10/30 gel filtration column that had been equilibrated with T E D and peak activity was collected. Purified IC and IIC -D3 20 1 1 1 2 were concentrated in a Centricon 10 microconcentrator (Amicon) and stored at 280 °C (protein concentration . 1 mg/ml). Gel Filtration—Purified IC , IIC -D3, or mixed IC and IIC -D3 (200 1 2 1 2 ml) were applied to a Pharmacia Superdex 200 HR 10/30 gel filtration column; the flow rate was 0.3 ml/min and 0.3-ml fractions were col- lected. For Fig. 5A,T E D N was used in sample dilution and in 20 1 1 500 equilibrating and running the column. For Fig. 5B (to mimic assay condition), samples were incubated in 200 mlofT D with 10 mM 20 1 MgCl ,1mM ATP, and 100 mM forskolin at 30 °C for 2 min; forskolin (100 mM, 200 ml) was applied to a Pharmacia Superdex 200 HR 10/30 gel filtration column that had been equilibrated with T D N containing 20 1 100 10 mM MgCl and1mM ATP, and samples were applied immediately after application of forskolin. Adenylyl cyclase activity was measured in the presence of 100 mM forskolin. As a control, a lysate of E. coli containing IC IIC (300 mginT b P N ) was applied under the 1 2 20 5 0.1 100 same conditions. Adenylyl Cyclase Assay—Activity was assayed in a 100-ml final vol- ume for 10–20 min at 30 °C in the presence of 10 mM MgCl (18). Recombinant IC , IIC , and IIC -D3 were premixed on ice for 10 min 1 2 2 before assay. Recombinant G was purified and activated as described sa (19, 20). Membranes of Sf9 cells that expressed IM C -(1–570), IM C - 1 1 1 1 (1–484), IM C , and IIM C were prepared as described (21). 2 2 2 2 RESULTS AND DISCUSSION Expression of IC IIC ,IC , and IIC —A soluble adenylyl 1 2 1 2 cyclase was constructed by linking the conserved cytoplasmic domains from type I (C ) and type II (C ) adenylyl cyclases (15). 1 2 The resulting protein, IC IIC , could be activated by G and 1 2 sa forskolin, and the activated enzyme could be inhibited by P-site inhibitors. IC IIC was tagged with hexa-histidine and the 1 2 HA1 epitope at the N terminus to facilitate the detection and purification (Fig. 1A). Hexo-histidine allowed affinity purifica- tion using immobilized metal affinity chromatography (e.g. us- FIG.1. Properties of soluble type I-type II adenylyl cyclase ing Ni-NTA resin), and the HA1 epitope permitted the detec- constructs expressed in E. coli. A, the top shows a model of mam- malian adenylyl cyclase with each of its regions labeled. ACI 5 type I tion of recombinant protein using monoclonal antibody made enzyme; ACII 5 type II enzyme. Below are shown the constructs used by hybridoma, 12CA5 (20, 22). High speed supernatant of ly- in this work. The first four include, at their amino termini, a hexa- sates from both E. coli BL21DE3 and SG22094 cells that ex- histidine and a HA1 epitope tag with a short linker to create the EcoRI pressed IC IIC had increased forskolin-stimulated adenylyl and NcoI restriction sites. B, adenylyl cyclase activities and protein 1 2 expression of the IC IIC construct in protease-deficient E. coli strains, cyclase activities, and the enzyme activities were higher (4– 1 2 BL21DE3 and SG22094. Samples (10 ml) were taken for enzyme assay 120-fold) in lysates of cells that were harvested after 8–19 h of and immunoblot assay with either 12CA5 or C2-1077 antibodies at the IPTG induction than after only 2–4 h of IPTG induction (Fig. indicated times after IPTG induction. C, adenylyl cyclase activities for 1B) (23). Using monoclonal antibody 12CA5 and anti-peptide a mixture of 10 ml of a bacterial lysate (from BL21DE3 cells) containing the components at the top that were obtained after the indicated hours antiserum C2-1077 (detecting the N and C terminus of IC IIC , 1 2 of induction with IPTG and 10 ml of an lysate (from BL21-DE3 cells) respectively), the expected 60-kDa protein was detected (Fig. containing either IIC or IC . The immunoblot shows the amount of the 2 1 1B). While the lysates from the later times after IPTG induc- component at the top after the indicated hours of induction by IPTG. p.i. tion had higher forskolin-stimulated enzyme activity, they did 5 post-IPTG induction. Adenylyl cyclase activity is shown as 21 21 nmolzmin zmg . Data are representative of two experiments. not have increased amounts of 60-kDa full-length protein. This suggested that the majority of adenylyl cyclase activity from IC IIC was proteolyzed after 4–19 h of IPTG induction and antiserum C2-1077, suggesting that there is a prominent cleav- 1 2 that the proteolyzed product was catalytically active. Expres- age at the junction between IC and IIC . To investigate 1 2 sion of IC IIC in protease-deficient strains, BL21DE3 (Lon ), whether the complex of IC and IIC was part of a catalytically 1 2 1 2 2 2 2 SG22094 (Lon , Clp ), or SG21163 (Lon , htpR) did not en- active species of the proteolyzed IC IIC , HA1 and hexo-histi- 1 2 hance the accumulation of full-length 60-kDa protein (Fig. 1B, dine-tagged IC and IIC were expressed separately. Using the 1 2 data not shown for SG21163) (23, 24). monoclonal antibody from 12CA5, the 30- and 31-kDa proteins A 30-kDa proteolytic fragment of IC IIC was detected using were detected in high speed supernatants of lysates from E. coli 1 2 Soluble Adenylyl Cyclase 10943 FIG.2. Purification of IC and IIC -D3. A, purification on a Ni- 1 2 NTA column. Lysates of E. coli that expressed IC , IIC , and IIC -D3 1 2 2 (1.5 ml) were passed through a 0.3-ml Ni-NTA column, and proteins that flowed through the column were collected. The column was subse- quently washed with 1.5 ml of wash 1 buffer, T b N P , and that of 20 5 500 0.1 wash 2 buffer, T b N I P . The column was then eluted with 1.5 ml 20 5 100 20 0.1 of T b N I P . Lane 1, load; lane 2, flow-through; lane 3, wash 1; 20 5 100 150 0.1 lane 4, wash 2; and lane 5, eluate. Total adenylyl cyclase activities (nmolzmin )ofIC , IIC , and IIC -D3 lysates were 72, 38, and 75, 1 2 2 respectively. Activities of flow-throughs, washes, and eluates are given as a percentage of adenylyl cyclase activity applied. Immunoblot was performed with antibody, 12CA5. Data are representative of two exper- FIG.3. Enzyme activity of a mixture of IC and IIC -D3 (0.2 mg 1 2 iments. B, Coomassie Blue stain of purified IC (0.2 mg) and IIC -D3(5 each). A, activation by forskolin; B, activation by G -GTPgS; C, syn- 1 2 sa mg). C, immunoblot of purified IC and IIC -D3 (100 ng each). ergistic activation by G -GTPgS and forskolin; D, inhibition by 29- 1 2 sa deoxy-39-AMP. The concentration of GTPgS-G is 200 nM in C. Sum sa (Fsk1G ) is the sum of adenylyl cyclase activities observed in the sa TABLE I presence of forskolin or GTPgS-G alone; Fsk 1 G is adenylyl cyclase sa sa Adenylyl cyclase activity of purified IC and IIC -D3 1 2 activity observed in the presence of both GTPgS-G and forskolin. The sa Purified IC (10 mg), IIC -D3 (20 mg), and IC 1 IIC -D3 (0.2 mg each) means 6 S.E. are representative of two experiments. 1 2 1 2 21 21 were assayed for adenylyl cyclase activity (nmol z min z mg ). G - sa GTPgS(8 mM), forskolin (100 mM), and G -GTPgS 1 forskolin (200 nM sa and 100 mM, respectively) were added as indicated. Enzyme the hexo-histidine tag. When lysates containing IC were Addition mixed with lysates containing IIC and applied to Ni-NTA IC IIC -D3IC1 IIC -D3 1 2 1 2 column, most of adenylyl cyclase did not bind to the column 21 21 nmol z min z mg (data not shown). This indicated that the binding between IC 0.02 0.01 3 and IIC was not strong enough for copurification of IC and 2 1 G -GTPgS 0.02 0.01 3900 sa IIC . Forskolin 0.02 0.01 3340 G -GTPgS 1 forskolin 0.02 0.01 8200 sa To purify IIC , we used IIC -D3, a construct that deleted 36 2 2 N-terminal amino acids of IIC , residues that are not conserved among mammalian adenylyl cyclases. HA1 and hexo-histidine- tagged IIC -D3 protein was expressed as a soluble protein, that expressed IC or IIC (expected molecular mass as 27 and based on immunoblot, and formed G - and forskolin-regulated 1 2 sa 31 kDa, respectively), indicating that the IC and IIC protein adenylyl cyclase when mixed with lysate containing IC in vitro 1 2 1 were stable, soluble proteins. Adenylyl cyclase activities of E. (Fig. 1C). IIC -D3 could be purified by Ni-NTA and, after sub- coli lysates that expressed either IC or IIC were not different sequent chromatography on FPLC-Mono Q, 95% pure protein 1 2 from those of lysates of E. coli that carried the control vector (29 kDa) was obtained (Fig. 2B). Its identity was confirmed by 21 21 (;0.01 nmolzmin zmg ). However, mixing of the lysates, each immunoblot (Fig. 2C). The recovery of adenylyl cyclase activity expressing one of these constructs, resulted in high enzyme was about 35%, and the yields for IIC -D3 proteins were 2 mg 21 21 activity (2–9 nmolzmin zmg , Fig. 1C). The enzyme activity from each liter of E. coli culture. correlated generally with expression (monitored by immuno- Characterization of Purified IC and IIC -D3—Purified IC 1 2 1 blot) of IC and IIC from cells (Fig. 1C). and IIC -D3 proteins by themselves had little enzyme activity 1 2 2 Purification of IC and IIC —IC could be purified by Ni- (Table I). Mixing of IC and IIC -D3 proteins resulted in G - 1 2 1 1 2 sa NTA (Fig. 2A). The enriched IC could be further purified using and forskolin-stimulated activity (Table I, Fig. 3, A and B). As a FPLC Mono Q column and Superdex 200 gel filtration. The it did for IC IIC , GTPgS-G acted synergistically with fors- 1 2 sa 30-kDa protein was the adenylyl cyclase (indicated by arrow kolin in activating mixed IC and IIC -D3, while 29-d-39-AMP 1 2 and verified based on enzyme activity and immunoblot, Fig. 2, inhibited the activity (Fig. 3, C and D). NaCl inhibited the B and C). A 29-kDa protein was a major contaminant. The activity of mixed IC and IIC -D3 (IC 5 300 mM, not shown). 1 2 50 recovery of forskolin-stimulated adenylyl cyclase activity was The highest turnover number for adenylyl cyclase activity of only 5%, and the yield was 50 mg from each liter of E. coli mixed IC and IIC -D3 (when activated by G and forskolin 1 2 sa culture. simultaneously) was 8.2 s , similar to rates of the purified The same procedure did not succeed in the purification of native and recombinant type I adenylyl cyclase (19, 25, 26). IIC . The majority of the adenylyl cyclase activity from IIC did Thus, the purified soluble adenylyl cyclase has the proper 2 2 not bind to Ni-NTA, probably due to proteolysis or masking of catalytic and regulatory properties and could be used as a 10944 Soluble Adenylyl Cyclase FIG.5. Superdex 200 gel filtration chromatography of purified IC , IIC -D3, mixed IC and IIC -D3, and an extract containing 1 2 1 2 IC IIC using T E D N (A) and T D N with 10 mM MgCl ,1 1 2 20 1 1 500 20 1 100 2 FIG.4. Complementation of adenylyl cyclase activity. A, mM ATP, and forskolin (B). Molecular size markers (Bio-Rad) are complementation of IC by IIC -D3. B, complementation of IM C -(1– 1 2 1 1 thyroglobin (670 kDa), g-globulin (158 kDa), chicken ovalbumin (44 570) or IM C -(1–484) by IIC -D3. C, complementation of IM C or 1 1 2 1 1 kDa), and horse myoglobin (17 kDa). A, total activity values of the IIM C by IC . Purified IC (20 ng), or Sf9 cell membranes (20 mg) 2 2 1 1 purified IC (5 mg), IIC -D3(5 mg), mixed IC (0.5 mg) and IIC -D3(5 mg), 1 2 1 2 containing IM C -(1–570) or IM C -(1–484) were mixed with the indi- 1 1 1 1 and an extract containing IC IIC (300 mg) were 80, 183, 47, and 9.9 1 2 cated quantities of IIC -D3 on ice for 10 min before the assay. Sf9 cell 2 21 nmolzmin , respectively. B, total activity values of the purified IC (5 membranes containing IM C or IIM C (20 mg) were mixed with the 1 1 2 2 mg), IIC -D3(5 mg), mixed IC (1 mg) and IIC -D3 (50 mg), and an extract 2 1 2 indicated quantities of IC . Adenylyl cyclase assays were performed at containing IC IIC (300 mg) were 82.5, 66.2, 115.8, and 6.37 1 2 30 °C in the presence of 100 mM forskolin (A, Fsk, B, and C)or100 mM nmolzmin , respectively. Data are representative of two experiments. forskolin and 200 nM GTPgS-G (A, Fsk1G ). The means 6 S.E. are sa sa representative of two experiments. enzyme activity of lysates containing IC IIC . When IC alone 1 2 1 model system for the biochemical and structural analysis of was applied, a major peak of adenylyl cyclase activity consist- mammalian adenylyl cyclase. ent with a globular 55 kDa was observed; the shift from 30- to Increased concentrations of IIC -D3 markedly increased ad- 55-kDa protein was due to the lower concentration of NaCl. enylyl cyclase activity when added to a fixed amount of IC (6 This suggested that IC might exist as a dimer or as a non- 1 1 nM) (Fig. 4A). The half-saturable concentration (EC )of globular protein at lower salt concentrations (100 mM). When IIC -D3 for forskolin- and G -GTPgS-activated activity was the mixture of IC (1 mg) and IIC -D3 (50 mg) was tested, a peak 2 sa 1 2 0.8 and 1.3 mM, respectively. When G and forskolin were used of adenylyl cyclase activity consistent with 45-kDa proteins sa together, EC of IIC -D3 fell about 10-fold to 0.08 mM. This was observed. The shift in elution profile suggested that IC 50 2 1 suggested that the synergistic effects of G -GTPgS and for- and IIC -D3 did interact. The low apparent molecular mass (45 sa 2 skolin on enzyme activity reflected an increase in the affinity of kDa instead of the expected 60 kDa) could be accounted for by IC and IIC -D3 for each other. dissociation of the complex of IC and IIC -D3 and/or an un- 1 2 1 2 Purified IC or IIC -D3 were subjected to gel filtration on usual shape of the complex. 1 2 Pharmacia Superdex 200 using T E D N as the buffer. A Complementation of IC and IIC -D3 by the Halves of Adeny- 20 1 1 500 1 2 major peak of adenylyl cyclase activity consistent with a glob- lyl Cyclases—Although IC and IIC did form a complex with 1 2 ular 30-kDa protein was observed, half of the size for the adenylyl cyclase activity, we failed to detect enzyme activity enzyme activity of lysates containing IC IIC (Fig. 5A). The when two cytoplasmic domains from type I enzyme (IC and 1 2 1 molecular size did not shift for the mixture of IC and IIC -D3, IC ) were used (linked or a mixture of IC and IC ) (not shown). 1 2 2 1 2 presumably due to the low affinity between two molecules To investigate the relative affinity of IC for either IC or IIC , 1 2 2 (Fig. 5A). we tested the ability of IC to complement the carboxyl-termi- To investigate whether a complex of IC and IIC -D3 could be nal half of type I or type II enzyme (IM C and IIM C ) (Fig. 1 2 2 2 2 2 detected, gel filtration was performed in the presence of for- 4C). As reported previously, the truncation mutants of type I skolin under the conditions for the enzyme assay (forskolin, 1 and type II adenylyl cyclases that consisted of either the amino- mM ATP, and 10 mM MgCl and the minimal concentration (100 terminal half (INM C -(1–570) and INM C -(1–484)) or the 2 1 1 1 1 mM) of NaCl; Fig. 5B). A major peak of adenylyl cyclase activity carboxyl-terminal half (IM C and IIM C ) of the protein had 2 2 2 2 consistent with a globular 30-kDa protein was observed when no detectable adenylyl cyclase activity when expressed alone; the purified IIC -D3 was applied alone, half of the size for the however, coexpression of the amino- and the carboxyl-terminal 2 Soluble Adenylyl Cyclase 10945 Acknowledgments—We thank Susan Gottesman for providing halves resulted in G - and forskolin-regulated adenylyl cy- sa SG22094 and SG21163, Richard Lerner for hybridoma, 12CA5, and clase activity (Fig. 1A) (21). IC and IIC -D3 each had no 1 2 Chester Drum, Wolfgang Epstein, and Mitchel Villereal for their help- adenylyl cyclase activity alone, and Sf9 cell membranes con- ful suggestions. taining the amino- or carboxyl-terminal halves of adenylyl cy- clase had enzymatic activities that were similar to the control REFERENCES cell membranes (that containing b-galactosidase) (Fig. 4, B and 1. Feinstein, P. G., Schrader, K. A., Bakalyar, H. A., Tang, W. J., Krupinski, J., Gilman, A. G., and Reed, R. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, C). When IIC -D3 was added to Sf9 cell membranes containing 10173–10177 either INM C -(1–570) or INM C -(1–484), there was up to a 1 1 1 1 2. Bakalyar, H. A., and Reed, R. R. (1990) Science 250, 1403–1406 40-fold increase in forskolin-stimulated adenylyl cyclase activ- 3. Krupinski, J., Coussen, F., Bakalyar, H. A., Tang, W. J., Feinstein, P. G., Orth, K., Reed, R. R., and Gilman, A. G. (1989) Science 244, 1558–1564 ity (Fig. 4B). In contrast, there was no increase in enzyme 4. Gao, B., and Gilman, A. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, activity when IIC -D3 was mixed with Sf9 cell membranes 10178–10182 containing IM C . When IC was reconstituted with Sf9 cell 5. Katsushika, S., Chen, L., Kawabe, J., Nilakantan, R., Halnon, N. J., and 2 2 1 Homcy, C. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8774–8778 membranes containing IIM C , there was up to a 20-fold in- 2 2 6. Cali, J. J., Zwaagstra, J. C., Mons, N., Cooper, D. M., and Krupinski, J. (1994) crease in forskolin-stimulated adenylyl cyclase activity (Fig. J. Biol. Chem. 269, 12190–12195 4C). However, only a 3–4-fold increase in enzyme activity was 7. Yoshimura, M., and Cooper, D. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6716–6720 observed when IC was reconstituted with Sf9 cell membranes 8. Premont, R. T., Chen, J., Ma, H. W., Ponnapalli, M., and Iyengar, R. (1992) containing IM C . The EC of IC to reconstitute adenylyl 2 2 50 1 Proc. Natl. Acad. Sci. U. S. A. 89, 9809–9813 cyclase activity of IIM C was at least 10-fold lower than that 9. Ishikawa, Y., Katsushika, S., Chen, L., Halnon, N. J., Kawabe, J., and Homcy, 2 2 C. J. (1992) J. Biol. Chem. 267, 13553–13557 of IM C . 2 2 10. Watson, P. A., Krupinski, J., Kempinski, A. M., and Frankenfield, C. D. (1994) There has been considerable speculation about the roles of J. Biol. Chem. 269, 28893–28898 11. Paterson, J. M., Smith, S. M., Harmar, A. J., and Antoni, F. A. (1995) Biochem. the transmembrane domains of adenylyl cyclases (12). The Biophys. Res. Commun. 214, 1000–1008 transmembrane domains target adenylyl cyclase to the plasma 12. Tang, W. J., and Gilman, A. G. (1992) Cell 70, 869–872 membrane for interaction with, and thereby regulation by, G 13. Garbers, D. L., and Lowe, D. G. (1994) J. Biol. Chem. 269, 30741–30744 14. Taussig, R., and Gilman, A. G. (1995) J. Biol. Chem. 270, 1–4 proteins. Our studies indicate that the two cytoplasmic do- 15. Tang, W. J., and Gilman, A. G. (1995) Science 268, 1769–1772 mains of mammalian adenylyl cyclases do not appear to have 16. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254 high affinity for each other. EC for IIC to complex with IC 17. Harlow, E., and Lane, D. (1988) Antibodies: a Laboratory Manual, Cold Spring 50 2 1 Harbor Laboratory, Cold Spring Harbor, NY is 0.8 and 1.3 mM in forskolin- and G -stimulated activity, sa 18. Salomon, Y., Londos, C., and Rodbell, M. (1976) Anal. Biochem. 58, 541–548 respectively. 19. Tang, W. J., Krupinski, J., and Gilman, A. G. (1991) J. Biol. Chem. 266, 8595–8603 Affinity between two natural linked cytoplasmic domains 20. Lee, E., Linder, M. E., and Gilman, A. G. (1994) Methods Enzymol. 237, (IC and IC ) is at least 10-fold less than that between IC 1 2 1 146–160 and IIC . Thus, the transmembrane domain (M ) could link 21. Tang, W. J., Stanzel, M., and Gilman, A. G. (1995) Biochemistry 34, 2 2 14563–14572 and facilitate the interaction of the two cytoplasmic domains 22. Field, J., Nikawa, J.-I., Broek, D., MacDonald, B., Rodgers, L., Wilson, I. A., by creating a high local concentration. It remains to be de- Lerner, R. A., and Wigler, M. (1988) Mol. Cell Biol. 8, 2159–2165 termined whether the transmembrane domains have addi- 23. Gottesman, S. (1990) Methods Enzymol. 185, 119–129 24. Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 189, 113–130 tional functions, such as altering the interaction between two 25. Taussig, R., Quarmby, L. M., and Gilman, A. G. (1993) J. Biol. Chem. 268, cytoplasmic domains for regulations or serving as pore 9–12 structures. 26. Smigel, M. D. (1986) J. Biol. Chem. 261, 1976–1982 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Two Cytoplasmic Domains of Mammalian Adenylyl Cyclase Form a GSα- and Forskolin-activated Enzyme in Vitro

Yan, Shui-Zhong; Hahn, David; Huang, Zhi-Hui; Tang, Wei-Jen
Journal of Biological Chemistry – May 1, 1996
Download PDF
5 pages

Loading next page...
 
/lp/unpaywall/two-cytoplasmic-domains-of-mammalian-adenylyl-cyclase-form-a-gs-and-MZguree3H4

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.271.18.10941
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 18, Issue of May 3, pp. 10941–10945, 1996 © 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Two Cytoplasmic Domains of Mammalian Adenylyl Cyclase Form a G - and Forskolin-activated Enzyme in Vitro* sa (Received for publication, February 2, 1996, and in revised form, March 14, 1996) Shui-Zhong Yan, David Hahn, Zhi-Hui Huang, and Wei-Jen Tang‡ From the Department of Pharmacological and Physiological Sciences, University of Chicago, Chicago, Illinois 60637 Mammalian adenylyl cyclases have two homologous by P-site inhibitors, indicating the essential roles of C and 1a cytoplasmic domains (C and C ). The first cytoplasmic C domains for catalysis and regulation. In this paper, we 1 2 2a domain of type I enzyme (IC ) and the second cytoplas- describe the expression and purification of the C and C 1a 2a mic domain of type II enzyme (IIC -D3, a construct in domains of type I and type II adenylyl cyclase, respectively. which 36 N-terminal amino acids of the C region are 2 Alone, each has no adenylyl cyclase activity; however, mixing of deleted) were expressed and purified to homogeneity. the two domains in vitro results in G - and forskolin-activated sa Alone, each had no adenylyl cyclase activity; however, enzyme activity. mixing of the two domains in vitro resulted in G - and sa EXPERIMENTAL PROCEDURES forskolin-activated enzyme activity. The turnover num- ber for G - and forskolin-stimulated enzyme activity of Plasmids—For construction of the expression plasmid vector sa pProEx-HAH6, the NcoI and EcoRI 4.9-kb fragment of pProEx-1 (Life the complex between IC and IIC -D3 was 8.2 s . The 1 2 Technologies, Inc.) was ligated with the phosphorylated linkers (59- concentration of IIC -D3 to achieve half-maximal activa- CATGCATCACCATCACCATCACGCGGCCGCCTACCCGTATGATGT- tion of IC was 0.8 and 1.3 mM when stimulated by for- CCCGGATTACGCCGGAATTCCCATGGC and 59-AATTGCCATGGGA- skolin and G , respectively. The concentration of IIC -D3 sa 2 ATTCCGGCGTAATCCGGGACATCATACGGGTAGGCGGCCGCGTG- needed to complex with IC was reduced 10-fold (0.08 TGGTGATGGTGATG). Proper insertion of cDNA at the NcoI site of mM) when the enzyme was activated by both forskolin pProEx-HAH6 vector would result in the expression of a fusion protein and G , suggesting that G and forskolin increased the sa sa that contained both HA1 and hexo-histidine tags at the N terminus affinity of the two cytoplasmic domains for each other. (Fig. 1A). The BspHI and HindIII fragments were excised from pTrc-IC and pTrc-IC IIC -L (15). The resulting fragments were ligated with 1 2 3 NcoI- and HindIII-digested pProEx-HAH6 to construct vectors, pProEx- HAH6-IC and pPro-HAH6-IC IIC . To construct pProEx-HAH6-IIC , 1 1 2 2 The enzymatic activity of adenylyl cyclase is the key step in the BspHI-blunted EcoRI fragment was excised from pUC-IIC and regulating the intracellular cAMP concentration upon stimu- ligated into pProEx-HAH6 that was digested with NcoI and SmaI (15). lation of a variety of hormones, neurotransmitters, and other To construct pProEx-HAH6-IIC -D3, an 0.8-kb DNA fragment encoding regulatory molecules. There are at least nine distinct mamma- IIC was amplified by 15 cycles of polymerase chain reaction using pProEx-HAH6-IIC as the template, Vent DNA polymerase, and lian adenylyl cyclases which have a similar structure (Fig. 1A) two oligonucleotides (59-CGAGGAATTCTGGAGAACGTGCTTCCTG- (1–11). This includes two intensely hydrophobic domains (M CACAC and 59-TGCGTTCTGATTTAATCTGTATCAGGCTGA) as the and M ) and two ;40-kDa cytoplasmic domains (C and C ). 2 1 2 primers. The resulting DNA was digested with EcoRI and HindIII and The C and C domains contain sequences (C and C ) that 1 2 1a 2a ligated into pProEx-HAH6 that was digested with the same enzymes. are similar to each other and to other adenylyl and guanylyl Plasmids pProEx-HAH6-IC , -IIC , -IIC -D3, -IC IIC were used to 1 2 2 1 2 cyclases (12, 13). Each isoform of adenylyl cyclase has its own express IC , IIC , IIC -D3, and IC IIC , respectively. 1 2 2 1 2 Expression of Soluble Adenylyl Cyclase—Escherichia coli cells with a distinct tissue distribution and unique regulatory properties, plasmid were grown in Luria’s broth containing ampicillin (50 mg/ml) at providing modes for different cells to respond diversely to sim- 30 °C and IPTG to 0.1 mM was added when the culture reached an A ilar stimuli (12, 14). of 0.4. Cells were harvested at suitable times, centrifuged at 6,000 3 g Membrane-bound adenylyl cyclases are expressed in small at 4 °C, and frozen. Frozen cells was thawed in 1/10 culture volume of quantities, and the enzyme is labile and difficult to manipulate T b P (20 mM Tris HCl, pH 8.0, 5 mM b-mercaptoethanol, 0.1 mM 20 5 0.1 in detergent-containing solutions. To facilitate biochemical and phenylmethylsulfonyl fluoride), lysozyme to 0.1 mg/ml was added, the cells were sonicated briefly, and the supernatant after centrifugation structural analysis, a soluble adenylyl cyclase has been con- (150,000 3 g for 30 min, 4 °C) was saved. The concentration of proteins structed by linking the C and C domains of type I and type 1a 2a was determined using Bradford reagent (Bio-Rad) and bovine serum II adenylyl cyclases, respectively (15). The resulting protein is albumin as standard (16). The proteins were separated by electrophore- sensitive to activation by G and forskolin and to inhibition sa sis on 11% SDS-PAGE and immunoblot was performed using the ECL system (Amersham). Ascites fluid of hybridoma 12CA5 was raised and collected as described (17). * This work was supported by the Cancer Research Foundation and Purification of Soluble Adenylyl Cyclase—All steps of the purification Brain Research Foundation. The costs of publication of this article were were performed at 4 °C in a cold room. Supernatant of E. coli lysate defrayed in part by the payment of page charges. This article must (from 4 liters, harvested 4 h after IPTG induction) was applied directly therefore be hereby marked “advertisement” in accordance with 18 to a 20-ml Ni-NTA column (Qiagen) that was equilibrated with U.S.C. Section 1734 solely to indicate this fact. ‡ To whom correspondence should be addressed: Dept. of Pharmaco- T b P containing 100 mM NaCl. The Ni-NTA column was washed 20 5 0.1 logical and Physiological Sciences, University of Chicago, 947 E. 58th with 100 ml of T b P containing 500 mM NaCl and 100 ml of 20 5 0.1 St., Chicago, IL 60637. Tel.: 312-702-4331; Fax: 312-702-3774. T b P N containing 20 mM imidazole (pH 7.0). The column was 20 5 0.1 100 The abbreviations used are: G , the a subunit of the G protein that then eluted with 100 ml of T b P N containing 150 mM imidazole sa 20 5 0.1 100 stimulates adenylyl cyclase; Fsk, forskolin; GTPgS, guanosine 59-3-O- (pH 7.0). The eluate was concentrated by ultrafiltration (Amicon, pos- (thio)triphosphate; 29-d-39-AMP, 29-deoxyadenosine 39-monophosphate; itive pressure ultrafiltration device, PM 10 membrane) and then diluted DTT, dithiothreitol; PAGE, polyacrylamide gel electrophoresis; kb, 2-fold with T E D (20 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 1 mM 20 1 1 kilobase pair(s); FPLC, fast protein liquid chromatography; IPTG, isopropyl-1-thio-b-D-galactopyranoside; HA1, hemagglutinin of influ- enza virus. Buffer compositions: T 5 20 mM Tris-HCl, pH 8.0 at 4 °C; N 5 100–500 mM NaCl; P 5 0.1 mM phenylmethylsulfonyl 20 100–500 0.1 b 5 5mM b-mercaptoethanol; D 5 1mM DTT; E 5 1mM EDTA; fluoride; I 5 20–150 mM imidazole, pH 7.0. 5 1 1 20–150 This is an Open Access article under the CC BY license. 10942 Soluble Adenylyl Cyclase DTT), these steps being repeated three times to reduce NaCl concen- tration to below 15 mM. The resulting concentrate was applied to a Pharmacia Mono Q HR 10/10 fast protein liquid chromatography (FPLC) column that had been equilibrated with T E D . The column 20 1 1 was washed with 1 volume of T E D , and absorbed proteins were 20 1 1 eluted at 1 ml/min with the 240-ml linear gradient of NaCl (200–500 mM and 100–300 mM NaCl for purification of IC and IIC -D3, respec- 1 2 tively) in T E D ; 4-ml fractions were collected. The protein peak of IC 20 1 1 1 was determined by its adenylyl cyclase activity when the fractions were mixed with E. coli lysates that contained IIC ; the peak of IIC -D3 was 2 2 determined using the lysates containing IC . Recombinant protein, IC 1 1 was eluted at about 350 mM NaCl and IIC -D3 at about 200 mM NaCl. The peak fractions of IC and IIC -D3 were then separated by electro- 1 2 phoresis on 11% SDS-PAGE and analyzed for purity by Coomassie Blue staining. The purest fractions of IC were then applied to a Pharmacia Superdex 200 HR10/30 gel filtration column that had been equilibrated with T E D and peak activity was collected. Purified IC and IIC -D3 20 1 1 1 2 were concentrated in a Centricon 10 microconcentrator (Amicon) and stored at 280 °C (protein concentration . 1 mg/ml). Gel Filtration—Purified IC , IIC -D3, or mixed IC and IIC -D3 (200 1 2 1 2 ml) were applied to a Pharmacia Superdex 200 HR 10/30 gel filtration column; the flow rate was 0.3 ml/min and 0.3-ml fractions were col- lected. For Fig. 5A,T E D N was used in sample dilution and in 20 1 1 500 equilibrating and running the column. For Fig. 5B (to mimic assay condition), samples were incubated in 200 mlofT D with 10 mM 20 1 MgCl ,1mM ATP, and 100 mM forskolin at 30 °C for 2 min; forskolin (100 mM, 200 ml) was applied to a Pharmacia Superdex 200 HR 10/30 gel filtration column that had been equilibrated with T D N containing 20 1 100 10 mM MgCl and1mM ATP, and samples were applied immediately after application of forskolin. Adenylyl cyclase activity was measured in the presence of 100 mM forskolin. As a control, a lysate of E. coli containing IC IIC (300 mginT b P N ) was applied under the 1 2 20 5 0.1 100 same conditions. Adenylyl Cyclase Assay—Activity was assayed in a 100-ml final vol- ume for 10–20 min at 30 °C in the presence of 10 mM MgCl (18). Recombinant IC , IIC , and IIC -D3 were premixed on ice for 10 min 1 2 2 before assay. Recombinant G was purified and activated as described sa (19, 20). Membranes of Sf9 cells that expressed IM C -(1–570), IM C - 1 1 1 1 (1–484), IM C , and IIM C were prepared as described (21). 2 2 2 2 RESULTS AND DISCUSSION Expression of IC IIC ,IC , and IIC —A soluble adenylyl 1 2 1 2 cyclase was constructed by linking the conserved cytoplasmic domains from type I (C ) and type II (C ) adenylyl cyclases (15). 1 2 The resulting protein, IC IIC , could be activated by G and 1 2 sa forskolin, and the activated enzyme could be inhibited by P-site inhibitors. IC IIC was tagged with hexa-histidine and the 1 2 HA1 epitope at the N terminus to facilitate the detection and purification (Fig. 1A). Hexo-histidine allowed affinity purifica- tion using immobilized metal affinity chromatography (e.g. us- FIG.1. Properties of soluble type I-type II adenylyl cyclase ing Ni-NTA resin), and the HA1 epitope permitted the detec- constructs expressed in E. coli. A, the top shows a model of mam- malian adenylyl cyclase with each of its regions labeled. ACI 5 type I tion of recombinant protein using monoclonal antibody made enzyme; ACII 5 type II enzyme. Below are shown the constructs used by hybridoma, 12CA5 (20, 22). High speed supernatant of ly- in this work. The first four include, at their amino termini, a hexa- sates from both E. coli BL21DE3 and SG22094 cells that ex- histidine and a HA1 epitope tag with a short linker to create the EcoRI pressed IC IIC had increased forskolin-stimulated adenylyl and NcoI restriction sites. B, adenylyl cyclase activities and protein 1 2 expression of the IC IIC construct in protease-deficient E. coli strains, cyclase activities, and the enzyme activities were higher (4– 1 2 BL21DE3 and SG22094. Samples (10 ml) were taken for enzyme assay 120-fold) in lysates of cells that were harvested after 8–19 h of and immunoblot assay with either 12CA5 or C2-1077 antibodies at the IPTG induction than after only 2–4 h of IPTG induction (Fig. indicated times after IPTG induction. C, adenylyl cyclase activities for 1B) (23). Using monoclonal antibody 12CA5 and anti-peptide a mixture of 10 ml of a bacterial lysate (from BL21DE3 cells) containing the components at the top that were obtained after the indicated hours antiserum C2-1077 (detecting the N and C terminus of IC IIC , 1 2 of induction with IPTG and 10 ml of an lysate (from BL21-DE3 cells) respectively), the expected 60-kDa protein was detected (Fig. containing either IIC or IC . The immunoblot shows the amount of the 2 1 1B). While the lysates from the later times after IPTG induc- component at the top after the indicated hours of induction by IPTG. p.i. tion had higher forskolin-stimulated enzyme activity, they did 5 post-IPTG induction. Adenylyl cyclase activity is shown as 21 21 nmolzmin zmg . Data are representative of two experiments. not have increased amounts of 60-kDa full-length protein. This suggested that the majority of adenylyl cyclase activity from IC IIC was proteolyzed after 4–19 h of IPTG induction and antiserum C2-1077, suggesting that there is a prominent cleav- 1 2 that the proteolyzed product was catalytically active. Expres- age at the junction between IC and IIC . To investigate 1 2 sion of IC IIC in protease-deficient strains, BL21DE3 (Lon ), whether the complex of IC and IIC was part of a catalytically 1 2 1 2 2 2 2 SG22094 (Lon , Clp ), or SG21163 (Lon , htpR) did not en- active species of the proteolyzed IC IIC , HA1 and hexo-histi- 1 2 hance the accumulation of full-length 60-kDa protein (Fig. 1B, dine-tagged IC and IIC were expressed separately. Using the 1 2 data not shown for SG21163) (23, 24). monoclonal antibody from 12CA5, the 30- and 31-kDa proteins A 30-kDa proteolytic fragment of IC IIC was detected using were detected in high speed supernatants of lysates from E. coli 1 2 Soluble Adenylyl Cyclase 10943 FIG.2. Purification of IC and IIC -D3. A, purification on a Ni- 1 2 NTA column. Lysates of E. coli that expressed IC , IIC , and IIC -D3 1 2 2 (1.5 ml) were passed through a 0.3-ml Ni-NTA column, and proteins that flowed through the column were collected. The column was subse- quently washed with 1.5 ml of wash 1 buffer, T b N P , and that of 20 5 500 0.1 wash 2 buffer, T b N I P . The column was then eluted with 1.5 ml 20 5 100 20 0.1 of T b N I P . Lane 1, load; lane 2, flow-through; lane 3, wash 1; 20 5 100 150 0.1 lane 4, wash 2; and lane 5, eluate. Total adenylyl cyclase activities (nmolzmin )ofIC , IIC , and IIC -D3 lysates were 72, 38, and 75, 1 2 2 respectively. Activities of flow-throughs, washes, and eluates are given as a percentage of adenylyl cyclase activity applied. Immunoblot was performed with antibody, 12CA5. Data are representative of two exper- FIG.3. Enzyme activity of a mixture of IC and IIC -D3 (0.2 mg 1 2 iments. B, Coomassie Blue stain of purified IC (0.2 mg) and IIC -D3(5 each). A, activation by forskolin; B, activation by G -GTPgS; C, syn- 1 2 sa mg). C, immunoblot of purified IC and IIC -D3 (100 ng each). ergistic activation by G -GTPgS and forskolin; D, inhibition by 29- 1 2 sa deoxy-39-AMP. The concentration of GTPgS-G is 200 nM in C. Sum sa (Fsk1G ) is the sum of adenylyl cyclase activities observed in the sa TABLE I presence of forskolin or GTPgS-G alone; Fsk 1 G is adenylyl cyclase sa sa Adenylyl cyclase activity of purified IC and IIC -D3 1 2 activity observed in the presence of both GTPgS-G and forskolin. The sa Purified IC (10 mg), IIC -D3 (20 mg), and IC 1 IIC -D3 (0.2 mg each) means 6 S.E. are representative of two experiments. 1 2 1 2 21 21 were assayed for adenylyl cyclase activity (nmol z min z mg ). G - sa GTPgS(8 mM), forskolin (100 mM), and G -GTPgS 1 forskolin (200 nM sa and 100 mM, respectively) were added as indicated. Enzyme the hexo-histidine tag. When lysates containing IC were Addition mixed with lysates containing IIC and applied to Ni-NTA IC IIC -D3IC1 IIC -D3 1 2 1 2 column, most of adenylyl cyclase did not bind to the column 21 21 nmol z min z mg (data not shown). This indicated that the binding between IC 0.02 0.01 3 and IIC was not strong enough for copurification of IC and 2 1 G -GTPgS 0.02 0.01 3900 sa IIC . Forskolin 0.02 0.01 3340 G -GTPgS 1 forskolin 0.02 0.01 8200 sa To purify IIC , we used IIC -D3, a construct that deleted 36 2 2 N-terminal amino acids of IIC , residues that are not conserved among mammalian adenylyl cyclases. HA1 and hexo-histidine- tagged IIC -D3 protein was expressed as a soluble protein, that expressed IC or IIC (expected molecular mass as 27 and based on immunoblot, and formed G - and forskolin-regulated 1 2 sa 31 kDa, respectively), indicating that the IC and IIC protein adenylyl cyclase when mixed with lysate containing IC in vitro 1 2 1 were stable, soluble proteins. Adenylyl cyclase activities of E. (Fig. 1C). IIC -D3 could be purified by Ni-NTA and, after sub- coli lysates that expressed either IC or IIC were not different sequent chromatography on FPLC-Mono Q, 95% pure protein 1 2 from those of lysates of E. coli that carried the control vector (29 kDa) was obtained (Fig. 2B). Its identity was confirmed by 21 21 (;0.01 nmolzmin zmg ). However, mixing of the lysates, each immunoblot (Fig. 2C). The recovery of adenylyl cyclase activity expressing one of these constructs, resulted in high enzyme was about 35%, and the yields for IIC -D3 proteins were 2 mg 21 21 activity (2–9 nmolzmin zmg , Fig. 1C). The enzyme activity from each liter of E. coli culture. correlated generally with expression (monitored by immuno- Characterization of Purified IC and IIC -D3—Purified IC 1 2 1 blot) of IC and IIC from cells (Fig. 1C). and IIC -D3 proteins by themselves had little enzyme activity 1 2 2 Purification of IC and IIC —IC could be purified by Ni- (Table I). Mixing of IC and IIC -D3 proteins resulted in G - 1 2 1 1 2 sa NTA (Fig. 2A). The enriched IC could be further purified using and forskolin-stimulated activity (Table I, Fig. 3, A and B). As a FPLC Mono Q column and Superdex 200 gel filtration. The it did for IC IIC , GTPgS-G acted synergistically with fors- 1 2 sa 30-kDa protein was the adenylyl cyclase (indicated by arrow kolin in activating mixed IC and IIC -D3, while 29-d-39-AMP 1 2 and verified based on enzyme activity and immunoblot, Fig. 2, inhibited the activity (Fig. 3, C and D). NaCl inhibited the B and C). A 29-kDa protein was a major contaminant. The activity of mixed IC and IIC -D3 (IC 5 300 mM, not shown). 1 2 50 recovery of forskolin-stimulated adenylyl cyclase activity was The highest turnover number for adenylyl cyclase activity of only 5%, and the yield was 50 mg from each liter of E. coli mixed IC and IIC -D3 (when activated by G and forskolin 1 2 sa culture. simultaneously) was 8.2 s , similar to rates of the purified The same procedure did not succeed in the purification of native and recombinant type I adenylyl cyclase (19, 25, 26). IIC . The majority of the adenylyl cyclase activity from IIC did Thus, the purified soluble adenylyl cyclase has the proper 2 2 not bind to Ni-NTA, probably due to proteolysis or masking of catalytic and regulatory properties and could be used as a 10944 Soluble Adenylyl Cyclase FIG.5. Superdex 200 gel filtration chromatography of purified IC , IIC -D3, mixed IC and IIC -D3, and an extract containing 1 2 1 2 IC IIC using T E D N (A) and T D N with 10 mM MgCl ,1 1 2 20 1 1 500 20 1 100 2 FIG.4. Complementation of adenylyl cyclase activity. A, mM ATP, and forskolin (B). Molecular size markers (Bio-Rad) are complementation of IC by IIC -D3. B, complementation of IM C -(1– 1 2 1 1 thyroglobin (670 kDa), g-globulin (158 kDa), chicken ovalbumin (44 570) or IM C -(1–484) by IIC -D3. C, complementation of IM C or 1 1 2 1 1 kDa), and horse myoglobin (17 kDa). A, total activity values of the IIM C by IC . Purified IC (20 ng), or Sf9 cell membranes (20 mg) 2 2 1 1 purified IC (5 mg), IIC -D3(5 mg), mixed IC (0.5 mg) and IIC -D3(5 mg), 1 2 1 2 containing IM C -(1–570) or IM C -(1–484) were mixed with the indi- 1 1 1 1 and an extract containing IC IIC (300 mg) were 80, 183, 47, and 9.9 1 2 cated quantities of IIC -D3 on ice for 10 min before the assay. Sf9 cell 2 21 nmolzmin , respectively. B, total activity values of the purified IC (5 membranes containing IM C or IIM C (20 mg) were mixed with the 1 1 2 2 mg), IIC -D3(5 mg), mixed IC (1 mg) and IIC -D3 (50 mg), and an extract 2 1 2 indicated quantities of IC . Adenylyl cyclase assays were performed at containing IC IIC (300 mg) were 82.5, 66.2, 115.8, and 6.37 1 2 30 °C in the presence of 100 mM forskolin (A, Fsk, B, and C)or100 mM nmolzmin , respectively. Data are representative of two experiments. forskolin and 200 nM GTPgS-G (A, Fsk1G ). The means 6 S.E. are sa sa representative of two experiments. enzyme activity of lysates containing IC IIC . When IC alone 1 2 1 model system for the biochemical and structural analysis of was applied, a major peak of adenylyl cyclase activity consist- mammalian adenylyl cyclase. ent with a globular 55 kDa was observed; the shift from 30- to Increased concentrations of IIC -D3 markedly increased ad- 55-kDa protein was due to the lower concentration of NaCl. enylyl cyclase activity when added to a fixed amount of IC (6 This suggested that IC might exist as a dimer or as a non- 1 1 nM) (Fig. 4A). The half-saturable concentration (EC )of globular protein at lower salt concentrations (100 mM). When IIC -D3 for forskolin- and G -GTPgS-activated activity was the mixture of IC (1 mg) and IIC -D3 (50 mg) was tested, a peak 2 sa 1 2 0.8 and 1.3 mM, respectively. When G and forskolin were used of adenylyl cyclase activity consistent with 45-kDa proteins sa together, EC of IIC -D3 fell about 10-fold to 0.08 mM. This was observed. The shift in elution profile suggested that IC 50 2 1 suggested that the synergistic effects of G -GTPgS and for- and IIC -D3 did interact. The low apparent molecular mass (45 sa 2 skolin on enzyme activity reflected an increase in the affinity of kDa instead of the expected 60 kDa) could be accounted for by IC and IIC -D3 for each other. dissociation of the complex of IC and IIC -D3 and/or an un- 1 2 1 2 Purified IC or IIC -D3 were subjected to gel filtration on usual shape of the complex. 1 2 Pharmacia Superdex 200 using T E D N as the buffer. A Complementation of IC and IIC -D3 by the Halves of Adeny- 20 1 1 500 1 2 major peak of adenylyl cyclase activity consistent with a glob- lyl Cyclases—Although IC and IIC did form a complex with 1 2 ular 30-kDa protein was observed, half of the size for the adenylyl cyclase activity, we failed to detect enzyme activity enzyme activity of lysates containing IC IIC (Fig. 5A). The when two cytoplasmic domains from type I enzyme (IC and 1 2 1 molecular size did not shift for the mixture of IC and IIC -D3, IC ) were used (linked or a mixture of IC and IC ) (not shown). 1 2 2 1 2 presumably due to the low affinity between two molecules To investigate the relative affinity of IC for either IC or IIC , 1 2 2 (Fig. 5A). we tested the ability of IC to complement the carboxyl-termi- To investigate whether a complex of IC and IIC -D3 could be nal half of type I or type II enzyme (IM C and IIM C ) (Fig. 1 2 2 2 2 2 detected, gel filtration was performed in the presence of for- 4C). As reported previously, the truncation mutants of type I skolin under the conditions for the enzyme assay (forskolin, 1 and type II adenylyl cyclases that consisted of either the amino- mM ATP, and 10 mM MgCl and the minimal concentration (100 terminal half (INM C -(1–570) and INM C -(1–484)) or the 2 1 1 1 1 mM) of NaCl; Fig. 5B). A major peak of adenylyl cyclase activity carboxyl-terminal half (IM C and IIM C ) of the protein had 2 2 2 2 consistent with a globular 30-kDa protein was observed when no detectable adenylyl cyclase activity when expressed alone; the purified IIC -D3 was applied alone, half of the size for the however, coexpression of the amino- and the carboxyl-terminal 2 Soluble Adenylyl Cyclase 10945 Acknowledgments—We thank Susan Gottesman for providing halves resulted in G - and forskolin-regulated adenylyl cy- sa SG22094 and SG21163, Richard Lerner for hybridoma, 12CA5, and clase activity (Fig. 1A) (21). IC and IIC -D3 each had no 1 2 Chester Drum, Wolfgang Epstein, and Mitchel Villereal for their help- adenylyl cyclase activity alone, and Sf9 cell membranes con- ful suggestions. taining the amino- or carboxyl-terminal halves of adenylyl cy- clase had enzymatic activities that were similar to the control REFERENCES cell membranes (that containing b-galactosidase) (Fig. 4, B and 1. Feinstein, P. G., Schrader, K. A., Bakalyar, H. A., Tang, W. J., Krupinski, J., Gilman, A. G., and Reed, R. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, C). When IIC -D3 was added to Sf9 cell membranes containing 10173–10177 either INM C -(1–570) or INM C -(1–484), there was up to a 1 1 1 1 2. Bakalyar, H. A., and Reed, R. R. (1990) Science 250, 1403–1406 40-fold increase in forskolin-stimulated adenylyl cyclase activ- 3. Krupinski, J., Coussen, F., Bakalyar, H. A., Tang, W. J., Feinstein, P. G., Orth, K., Reed, R. R., and Gilman, A. G. (1989) Science 244, 1558–1564 ity (Fig. 4B). In contrast, there was no increase in enzyme 4. Gao, B., and Gilman, A. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, activity when IIC -D3 was mixed with Sf9 cell membranes 10178–10182 containing IM C . When IC was reconstituted with Sf9 cell 5. Katsushika, S., Chen, L., Kawabe, J., Nilakantan, R., Halnon, N. J., and 2 2 1 Homcy, C. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8774–8778 membranes containing IIM C , there was up to a 20-fold in- 2 2 6. Cali, J. J., Zwaagstra, J. C., Mons, N., Cooper, D. M., and Krupinski, J. (1994) crease in forskolin-stimulated adenylyl cyclase activity (Fig. J. Biol. Chem. 269, 12190–12195 4C). However, only a 3–4-fold increase in enzyme activity was 7. Yoshimura, M., and Cooper, D. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6716–6720 observed when IC was reconstituted with Sf9 cell membranes 8. Premont, R. T., Chen, J., Ma, H. W., Ponnapalli, M., and Iyengar, R. (1992) containing IM C . The EC of IC to reconstitute adenylyl 2 2 50 1 Proc. Natl. Acad. Sci. U. S. A. 89, 9809–9813 cyclase activity of IIM C was at least 10-fold lower than that 9. Ishikawa, Y., Katsushika, S., Chen, L., Halnon, N. J., Kawabe, J., and Homcy, 2 2 C. J. (1992) J. Biol. Chem. 267, 13553–13557 of IM C . 2 2 10. Watson, P. A., Krupinski, J., Kempinski, A. M., and Frankenfield, C. D. (1994) There has been considerable speculation about the roles of J. Biol. Chem. 269, 28893–28898 11. Paterson, J. M., Smith, S. M., Harmar, A. J., and Antoni, F. A. (1995) Biochem. the transmembrane domains of adenylyl cyclases (12). The Biophys. Res. Commun. 214, 1000–1008 transmembrane domains target adenylyl cyclase to the plasma 12. Tang, W. J., and Gilman, A. G. (1992) Cell 70, 869–872 membrane for interaction with, and thereby regulation by, G 13. Garbers, D. L., and Lowe, D. G. (1994) J. Biol. Chem. 269, 30741–30744 14. Taussig, R., and Gilman, A. G. (1995) J. Biol. Chem. 270, 1–4 proteins. Our studies indicate that the two cytoplasmic do- 15. Tang, W. J., and Gilman, A. G. (1995) Science 268, 1769–1772 mains of mammalian adenylyl cyclases do not appear to have 16. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254 high affinity for each other. EC for IIC to complex with IC 17. Harlow, E., and Lane, D. (1988) Antibodies: a Laboratory Manual, Cold Spring 50 2 1 Harbor Laboratory, Cold Spring Harbor, NY is 0.8 and 1.3 mM in forskolin- and G -stimulated activity, sa 18. Salomon, Y., Londos, C., and Rodbell, M. (1976) Anal. Biochem. 58, 541–548 respectively. 19. Tang, W. J., Krupinski, J., and Gilman, A. G. (1991) J. Biol. Chem. 266, 8595–8603 Affinity between two natural linked cytoplasmic domains 20. Lee, E., Linder, M. E., and Gilman, A. G. (1994) Methods Enzymol. 237, (IC and IC ) is at least 10-fold less than that between IC 1 2 1 146–160 and IIC . Thus, the transmembrane domain (M ) could link 21. Tang, W. J., Stanzel, M., and Gilman, A. G. (1995) Biochemistry 34, 2 2 14563–14572 and facilitate the interaction of the two cytoplasmic domains 22. Field, J., Nikawa, J.-I., Broek, D., MacDonald, B., Rodgers, L., Wilson, I. A., by creating a high local concentration. It remains to be de- Lerner, R. A., and Wigler, M. (1988) Mol. Cell Biol. 8, 2159–2165 termined whether the transmembrane domains have addi- 23. Gottesman, S. (1990) Methods Enzymol. 185, 119–129 24. Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 189, 113–130 tional functions, such as altering the interaction between two 25. Taussig, R., Quarmby, L. M., and Gilman, A. G. (1993) J. Biol. Chem. 268, cytoplasmic domains for regulations or serving as pore 9–12 structures. 26. Smigel, M. D. (1986) J. Biol. Chem. 261, 1976–1982

Journal

Journal of Biological Chemistry – Unpaywall

Published: May 1, 1996

There are no references for this article.