Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Interferon-γ-induced activation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells

Interferon-γ-induced activation of Signal Transducer and Activator of Transcription 1 (STAT1)... Background: The type-II-cytokine IFN-γ is a pivotal player in innate immune responses but also assumes functions in controlling tumor cell growth by orchestrating cellular responses against neoplastic cells. The role of IFN-γ in melanoma is not fully understood: it is a well-known growth inhibitor of melanoma cells in vitro. On the other hand, IFN-γ may also facilitate melanoma progression. While interferon-regulated genes encoding proteins have been intensively studied since decades, the contribution of miRNAs to effects mediated by interferons is an emerging area of research. We recently described a distinct and dynamic regulation of a whole panel of microRNAs (miRNAs) after IFN-γ-stimulation. The aim of this study was to analyze the transcriptional regulation of miR-29 family members in detail, identify potential interesting target genes and thus further elucidate a potential signaling pathway IFN-γ → Jak→ P-STAT1 → miR-29 → miR-29 target genes and its implication for melanoma growth. Results: Here we show that IFN-γ induces STAT1-dependently a profound up-regulation of the miR-29 primary cluster pri-29a~b-1 in melanoma cell lines. Furthermore, expression levels of pri-29a~b-1 and mature miR-29a and miR-29b were elevated while the pri-29b-2~c cluster was almost undetectable. We observed an inverse correlation between miR-29a/b expression and the proliferation rate of various melanoma cell lines. This finding could be corroborated in cells transfected with either miR-29 mimics or inhibitors. The IFN-γ-induced G1-arrest of melanoma cells involves down-regulation of CDK6, which we proved to be a direct target of miR-29 in these cells. Compared to nevi and normal skin, and metastatic melanoma samples, miR-29a and miR-29b levels were found strikingly elevated in certain patient samples derived from primary melanoma. Conclusions: Our findings reveal that the miR-29a/b1 cluster is to be included in the group of IFN- and STAT-regulated genes. The up-regulated miR-29 family members may act as effectors of cytokine signalling in melanoma and other cancer cells as well as in the immune system. Keywords: IFN-γ, Jak/STAT pathway, STAT1, Signaling, Melanoma, miR-29, Tumor-suppressor * Correspondence: [email protected] Signal Transduction Laboratory, University of Luxembourg, 162A Avenue de la Faïencerie, Luxembourg L-1511, Luxembourg Full list of author information is available at the end of the article © 2012 Schmitt et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 2 of 14 http://www.biosignaling.com/content/10/1/41 Background found several miRNAs to be dynamically regulated fol- In the past decade, small non-coding microRNAs lowing stimulation with IFN-γ [13]. One of the first con- (miRNAs) have been identified as new and important nections between cytokine-induced Jak/STAT signaling players in post-transcriptional gene regulation and ever and miRNAs has been established by Löffler et al., who since, their expression patterns and cellular functions showed that IL-6 increased the expression of oncogenic have been investigated in cancer and other diseases [1,2]. miR-21 via STAT3 activation in myeloma cells [14]. The MiRNA biogenesis can be differentially regulated [3], but signaling cascades involving IL-6 or IFN-α/β/STAT3/ generally starts with the generation of a primary (pri-) miR-21 and others have been confirmed in several types miRNA transcript (several thousand nucleotides long), of cancer and diseases [15-17]. which is subsequently processed into a 70–80 nucleotide In the current study, we have focused on the biochem- precursor form (pre-miRNA), which, following nuclear ical analysis of individual miRNAs regulated by IFN-γ export, is then cleaved into the ~22 nucleotide mature which we have recently identified in a detailed-time miRNA. One strand of the mature duplex is incorporated course microarray experiment [13], and further concen- in the RISC (RNA-induced silencing complex), where trated on the interesting miRNA family miR-29 with its it recognizes, binds to and represses mRNA target three mature members, miR-29a, -29b and -29c. It is sequences [1]. MiRNAs are involved in many fundamen- transcribed into two primary transcripts, pri-29a~b-1 tal cellular processes as they are estimated to control and pri-29b-2~c, from chromosomes 7 and 1, respect- >50% of all protein-coding genes in mammals [4]. ively. MiR-29 family members target the expression of Consequently, they have been implicated in the regula- proteins such as methyltransferases, extracellular matrix tion of processes that promote cancer growth or con- proteins and transcription factors [18-20], which are versely, in processes that might prevent cancers from potentially involved in triggering enhanced invasion, developing. For instance, a cancer cell can emerge fol- migration or proliferation of cells. They are silenced or lowing the over-expression of so-called “oncomirs” (such down-regulated in many types of cancer and have con- as the miR-17-92 family, miR-21, -155, etc.) which down- sequently been assigned tumor-suppressing properties, regulate tumor-suppressors that control cell proliferation. although in some cases also oncogenic roles have been On the other hand, miRNAs that function as tumor- reported [21,22]. Here, we demonstrate a specific and pro- suppressors by targeting cellular oncoproteins (such as found IFN-γ-induced, STAT1-dependent up-regulation let-7 family members, miR-15a, -16, -29, etc.) are fre- of miR-29a and -29b in melanoma cells and importantly, quently down-regulated in cancer tissues [5]. Therapeu- also increased expression in primary melanoma patient tics opting to replace the diminished tumor-suppressor samples (but not in metastatic tumors) whereas the miRNAs are currently being investigated and seem second cluster pri-29b-2~c was consistently undetectable. promising, as miRNAs exhibit high stability as well as Moreover, we provide evidence for the tumor-suppressing high specificity for their target mRNAs [5,6]. properties of miR-29 family members: inhibition of melan- A disease where patients are in urgent need of more oma cell proliferation could be mediated by miR-29a, effective treatments is advanced melanoma, the most which down-regulated CDK6 (cyclin-dependent kinase 6), aggressive form of skin cancer. Metastatic melanoma an important player in cell cycle G1/S transition. Our exhibit a severe resistance to therapy leading to 5-year findings identify the pri-29a~b-1cluster as a novel IFN-γ- survival rates of below 5% [7]. Around 50% of patients regulated gene and open up new connections between exhibit V600E mutations in the cellular kinase BRAF miRNAs, interferon signaling and malignant melanoma, [8]. Recently, the BRAF-inhibitor Zelboraf has been which could lead to novel concepts for potential treat- approved for treatment of late-stage malignant melanoma ment options in the future. patients with V600E mutations, increasing life expectancy by several months [9,10]. Nevertheless, except excision at Results early stages, no curative therapies exist. Routinely, ther- To investigate possible transcriptional regulations of apies against melanoma include IFN-α as an adjuvant miRNAs by STAT transcription factors, several melanoma treatment. Interferons are cytokines and constitute a cell lines were treated with IFN-γ for different time major part of the innate immune response, but they are intervals and were subsequently analyzed by miRNA also recognized for their anti-proliferative properties. We microarray as previously described [13]. The top 10 and others have shown that the type-II-cytokine IFN-γ IFN-γ-induced miRNAs from a microarray experiment, mediates growth inhibition of cancer cells by activating which showed highest differential expression compared the transcription factor STAT1 [11,12]. After IFN-γ to untreated cells, and detailed time-course expression stimulation, STAT1 forms homodimers, which bind to profiles thereof are depicted in Figure 1A and Additional GAS (IFN-γ-activated sequences) elements in the pro- file 1: Figure S1. For further analysis, we focused on moter regions of target genes. Very recently, we have the miR-29 family, as its mature members miR-29a and Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 3 of 14 http://www.biosignaling.com/content/10/1/41 649 bp 29a 29b-1 5’ 3’ Chr7 q32.3 miR-1246 3’ 5’ miR-886-5p miR-3195 miR-424* 504 bp 29b-2 29c miR-3178 Chr1 q32.2 5’ 3’ 3’ miR-29 5’ miR-1979 miR-27a* miR-23a* hsa-miR-29a: 5’-U AGCACCA UC UGAAAUCGGUUA-3’ miR-663 hsa-miR-29b: 5’-U AGCACCA UU UGAAAUCAGUGUU-3’ hsa-miR-29c: 5’-U AGCACCA UU UGAAAUCGGUUA-3’ ISRE: (G/A)(G/A)AANNGAAA(C/G) miR-29a miR-29b-1 GAS: TT(C/A)CNNNAA(A/G) I1 I2 G1 G2 G3 G4G5 chr7: 1 kb chr7: 130.560.000 130.598.268 Figure 1 Top 10 IFN-γ-up-regulated miRNAs. (A) Ten miRNAs with highest positive fold changes (as determined by previous microarray experiments [13]) include miR-29 family members (left). Detailed time course profiles are shown in Additional file 1: Figure S1. The miR-29 family is transcribed from the respective antisense strand from two genetic clusters of chromosomes 7 (pri-29a~b-1) and 1 (pri-29b-2~c) (right). The three mature forms miR-29a/29b/29c share the same seed region (grey box). Differences between the mature sequences are underlined; a nucleotide difference between miR-29a and miR-29c is shown in italics. (B) The presumed pri-29a~b-1 promoter region [22-24] contains five GAS-elements G1-5 (TT(C/A)CNNNAA(A/G)) and two ISRE-elements I1-2 ((G/A)(G/A)AANNGAAA(C/G)) (GRCh37/hg19). miR-29b showed the most robust regulations across all replacement of tyrosine residue 701 crucial for STAT1 tested melanoma cell lines and because of its interesting phosphorylation and dimerization [12]. Thus, transcrip- properties regarding tumor biology. To identify the pres- tion of STAT1 target genes is abolished despite IFN-γ ence of potential IFN-response elements, we performed stimulation. The corresponding control cells A375- in silico screening of the promoter region 5 kb upstream STAT1(wt) express the STAT1 wild-type construct instead of a putative transcription start of pri-29a~b-1 [22-24] [12]. To accurately assess the regulation of the miR-29 and found five GAS-elements (TT(C/A)CNNNAA(A/G)) family by IFN-γ-induced STAT1, we performed time and two ISRE (interferon stimulated response element)- course experiments (Figure 2). Stimulation of A375, elements ((G/A)(G/A)AANNGAAA(C/G)) (Figure 1B). MeWo and A375-STAT1(wt) cell lines with 50 ng/ml of For control purposes, we selected miR-100, which was IFN-γ induced a prominent STAT1 phosphorylation, slightly down-regulated after IFN-γ stimulation and which decreased after 48h of IFN-γ treatment, whereas miR-25, whose levels were not induced in the micro- the STAT1-dominant negative cells A375-STAT1(F) only array experiments. Other regulated candidates included exhibited a delayed and weak P-STAT1 signal after IFN-γ several miRNA star sequences (“miR*” which here repre- stimulation (Figure 2A, see also [25]). Functional activity sents the miR strand, which arises from the 3’-arm of the of the P-STAT1 transcription factor was confirmed by hairpin, while the 5’-arm would be the guide or parent up-regulation of the STAT1 target genes IRF-1 and strand and is conventionally considered as “minor” STAT1 itself, which showed induced expression after product) which are currently being further assessed in 3h and 8h, respectively. our laboratory (Figure 1, Additional file 1: Figure S1). Following stimulation, changes in miRNA expression levels were assessed by qRT-PCR (Figure 2B). A375, The pri-29a~b-1 cluster and mature miR-29a/29b are A375-STAT1(wt) and MeWo cell lines showed a strong regulated by IFN-γ and significant up-regulation (>5 fold) of the pri-29a~b-1 For stimulation experiments with IFN-γ, melanoma cell cluster, starting 24h after IFN-γ stimulation, while ex- lines MeWo and A375, as well as stably transfected pression of the pri-29b-2~c cluster was not altered A375 derivates were used. A375-STAT1(F) represent (Figure 2B, upper panel). Accordingly, miRNA precursors STAT1-dominant negative cells harboring a phenylalanine pre-29a and pre-29b-1 were also augmented whereas Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 4 of 14 http://www.biosignaling.com/content/10/1/41 A A375-STAT1(F) A375-STAT1(wt) A375 MeWo P-Stat1 Stat1 IRF -1 Actin - - IFN-γ 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h 3h 8h 24h 48h 72h (50ng/ml) A375-STAT1(F) A375-STAT1(wt) A375 MeWo *** ** untr 10 10 10 10 3h IFN- 8h *** (50ng/ml) 24h ** *** *** 48h *** ** 72h 5 5 5 Pri a/b-1Pri b-2/c Pri a/b-1Pri b-2/c Pri a/b1 Pri b2/c Pri a/b-1Pri b-2/c 15 15 15 15 ** ** 10 10 10 10 *** *** *** *** *** *** *** *** * *** ** *** *** 5 5 5 ** 5 *** ** * * ** Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c 6 6 6 6 *** *** 4 4 4 4 ** *** *** ** ** ** 2 2 2 2 *** 29a 29b 25 100 29a 29b 25 100 29a 29b 25 100 29a 29b 25 100 4 8 10 2.0 2.0 3 6 1.5 1.5 2 4 1.0 1.0 1 2 0.5 0.5 miR-29a miR-29b miR-29c miR-25 miR-100 miR-29a* miR-29b-1* miR-29c* miR-25* miR-100* miR-29b-2* Figure 2 (See legend on next page.) primary mature precursor REL REL REL REL IFN-γ untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 5 of 14 http://www.biosignaling.com/content/10/1/41 (See figure on previous page.) Figure 2 Expression profiles of miR-29 clusters in melanoma cells. A375-STAT1(F), A375-STAT1(wt), A375 and MeWo melanoma cells were stimulated with IFN-γ for different time points. (A) Western Blot analysis (representative blots of biological triplicates) confirms activation of P-STAT1 and induction of STAT1 and IRF-1 after IFN-γ stimulation while dominant negative A375-STAT1(F) cells show minor effects. (B) Time course study of miRNA-expression after IFNγ-stimulation. Graphs show relative expression (REL) from quantitative qRT-PCR data for the pri-29a~b-1 and the pri-29b-2~c clusters, the precursors pre-29a/29b-1/29b-2/29c and mature miR-29a/29b/25/100. Fold expression was calculated relative to the untreated control and SDs are shown for biological triplicates. Statistical significance was tested with one-way ANOVA, followed by a Dunnett Post-Hoc test with * p<0.05, ** p<0.01 and *** p<0.001. (C) MiRNA and miRNA* expression profiles in A375 cells derived from a more detailed IFN-γ time course miRNA microarray experiment including cells treated with JI1 (IFN-γ stimulation for 72h after pre-treatment with JI1, black and grey dots). Depicted are log2-values of the mean of duplicate microarray experiments. pre-29b-2 and pre-29c levels remained unaffected cluster in rhabdomyosarcoma [28] and B-cell lymphoma (Figure 2B, middle panel). Subsequently, significant up- [23]. Also, mature miR-29a consistently showed higher regulation of both mature miR-29a and miR-29b fol- basal expression levels than miR-29b in all cell lines lowing IFN-γ stimulation was confirmed (Figure 2B, examined (Figure 3B). lower panel). The two control amplifications of miR-100 (slightly down-regulated) and miR-25, which remained MiR-29a/29b expression levels inversely correlate with stable over time following IFN-γ stimulation confirmed growth behavior of melanoma cell lines the initial microarray-based expression profiles (Figure 2B, The classification of miR-29 as tumor-suppressor miRNA lower panel). Similar regulation patterns were also found has been widely accepted and the possibility to use syn- in Jurkat and MT4 T-cells and in HEK293T kidney cells thetic miR-29 as therapeutic agent in treatments of can- (for mature miR-29a, miR-29b, and miR-25, Additional cer seems to become increasingly realistic. Properties file 2: Figure S2). Except for minor expression changes of counteracting the development and spreading of cancer the Pri/Pre-miR-29 species after 72h of IFN-γ treatment, cells that have been observed in vitro and in vivo after no up-regulation was detected in the A375-STAT1(F) miR-29 overexpression include reduced invasion and dominant negative control cells, clearly suggesting that proliferation and induction of apoptosis [29,30]. These STAT1 activity is required for the IFN-γ-induced regula- findings prompted us to analyze a potential correlation tion of miR-29 family members. of basal miR-29 expression levels with cell growth. Figure 2C shows expression results of a detailed time Proliferation of untreated melanoma cell lines was moni- course microarray experiment using IFN-γ-stimulated tored over time (Figure 3C) in order to correlate the A375 cells. In parallel and as described before, cells had growth rate with miR-29a and pri-29a~b-1 basal expres- been pre-treated with Jak inhibitor 1 (JI1), which specif- sion levels obtained from cells harvested 96h after seed- ically inhibits Janus tyrosine kinases and subsequently ing. Melanoma cell lines were grouped in miR-29a and prevented miR-29 up-regulation after IFN-γ stimula- pri-29a~b-1 ‘low-expression’ (A375, MeWo, IGR39, tion [13]. WM9) and ‘high expression’ cell lines (FM55P, FM55M1, Altogether, these data substantiate for the first time SK-Mel30, IGR37) (Figure 3A and B). Generally, cell lines a time-dependent up-regulation of the expression of with lower miR-29a showed an increased proliferation pri-29a~b-1 cluster as well as of the mature miRNAs rate compared to lines with higher basal miR-29a levels miR-29a and -29b in melanoma cells, which is trig- (Figure 3C). Furthermore, the inverse correlation be- gered by IFN-γ-induced STAT1 signaling. tween pri-29a~b-1/miR-29a expression and the prolifera- tion rate of melanoma cell lines might suggest a potential The miR-29b-2~c cluster is undetectable in melanoma cell involvement of miR-29 in anti-proliferative effects on lines, melanocytes and keratinocytes melanoma cells. To follow up these findings, we applied As both miR-29 primary clusters as well as the mature miR-29a/29b mimics to A375 cells, which exhibit a rela- miR-29a/29b showed different basal expression levels in tively low miR-29a/29b basal expression and, vice versa, stimulation experiments and are known to be differen- we applied a miR-29a inhibitor to FM55P cells, which tially expressed in several types of cancer [26,27], we have a high basal miR-29a/29b expression (Figure 3B). next analyzed the miR-29 basal expression profiles in a Proliferation assays with mimics and inhibitors and panel of melanoma cell lines, primary human melano- the corresponding amounts of scrambled controls, NC cytes (NHEM-M2) and HaCaT keratinocytes (Figure 3A (negative control)-mimic and NC-inhibitor, corroborated and B). Pri-29a~b-1 was strongly expressed whereas pri- that miR-29 indeed inhibited growth of melanoma cells: 29b-2~c was almost undetectable in all cell lines ana- transfection of miR-29a/29b mimics caused a remarkable lyzed (Figure 3A). This is in accordance with previous reduction of proliferation as compared to NC-mimic- studies reporting down-regulation of the pri-29b-2~c transfected A375 cells (Figure 3D). In turn, FM55P cells, Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 6 of 14 http://www.biosignaling.com/content/10/1/41 Pri-29a~b-1/29b-2~c basal expression A C WM9 A375 ‘low expression’ Proliferation MeWo A375 IGR39 MeWo FM55M1 ‘high expression’ IGR39 FM55P FM55P SKMel30 IGR37 WM9 HaCaT FM55M1 NHEM-M2 SKMel30 0 5 10 15 20 40 mature miR-29a/b basal expression MeWo IGR37 A375 IGR39 ‘low expression’ WM9 FM55M1 ‘high expression’ 24 36 48 60 72 84 IGR37 time (hrs) FM55P SKMel30 HaCaT NHEM-M2 0 2 4 6 8 10 DE proliferation of miR-29a-inhibitor-transfected FM55P cells proliferation of miR-29a/b-mimic-transfected A375 cells 1.5 2.0 *** 80 1.5 1.0 NC-mimic 1.0 29a 0.5 0.5 inhibitor 29ab 0h 72h 0h 72h mimic NC - inhibitor 0 20 40 60 0 20 40 60 time (hrs) time (hrs) Figure 3 Inverse correlation of miR-29a expression levels and melanoma proliferation. Comparison of basal expression levels of (A) primary miRNA clusters pri-29a~b-1 (blue/red/black bars) and pri-29b-2~c (grey bars) and (B) mature miR-29a (blue/red/black bars) and -Δct 2 miR-29b (grey bars) in NHEM-M2, eight melanoma cell lines and HaCaT keratinocytes. Graphs show 2 x10 with SD of biological triplicates. (C) Mean growth curves of untreated melanoma cell lines over 4 days (biological quadruplicates). Melanoma cell lines with ‘low expression’ of pri-29a~b-1 and miR-29a show faster proliferation whereas cells with a relatively ‘high expression’ proliferate slower. (D,E) Proliferation assay of (black) mimic/inhibitor- and (grey) NC-mimic/NC-inhibitor-transfected cells over 72h in (D) A375 and (E) FM55P cells; representative graphs of four independent experiments. Error bars depict SDs of technical triplicates. The inserted graphs (upper left corners) show the mean confluence of 4 biological replicates at 0h and 72h time points of the proliferation assay. Depicted are ratios of confluence of 29ab-mimic/NC-mimic treated cells (D) and 29a-inhibitor/NC-inhibitor treated cells (E). Error bars show SEM. Significance was assessed by a two-tailed t-test with * p<0.05, ** p<0.01 and *** p<0.001. cell confluence (%) cell confluence (%) cell confluence (%) Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 7 of 14 http://www.biosignaling.com/content/10/1/41 in which miR-29a was inhibited, proliferated faster than (Figure 4A,B). Taken together, these findings indicate NC-inhibitor-transfected control cells (Figure 3E). that both CDK6 and PI3KR1 3’-UTRs are directly tar- geted by miR-29 in melanoma cells; however, only CDK6 MiR-29a/29b down-regulate CDK6, but not PI3K suppression seems to be important in a cellular context. MiR-29 is predicted to regulate more than 1000 human To further explore the relevance of reduced CDK6 levels genes (TargetScanHuman 6.1). We have used a combin- in the cell, we used siRNA against CDK6 and assessed ation of several algorithms (TargetScanHuman 6.1, proliferation over 72h in A375 (Figure 4F) and FM55P Diana-microT v3.0, microRNA.org) to compile a list of cells (Figure 4G). Reduction of CDK6 mRNA and protein potentially interesting genes, which carry predicted level (Additional file 3: Figure S3) led to a clearly dimin- miR-29 target sites. After detailed expression analysis of ished proliferation in both cell lines. potential candidates in melanoma cells and initial screen- ing for their response to miR-29 mimic and inhibitor MiR-29a and miR-29b are up-regulated in primary treatment (data not shown), we concentrated on the melanoma patient samples PI3K regulatory subunit (gene: PI3KR1; protein: PI3K/ Finally, we investigated miR-29a/29b expression profiles p85α) and CDK6, which play important roles in cell cycle in FFPE melanoma patient samples from normal skin, control, cellular signaling and thus, proliferation. Both nevi, primary and metastatic melanoma by qRT-PCR have already been confirmed as miR-29 targets in several (Figure 5). Nevi represent the most appropriate control cancers [31-34]. samples as they contain predominantly melanocytes To assess the effect of miR-29 on CDK6 and PI3K while normal skin samples are mostly composed of kera- expression in melanoma, mRNA and protein levels were tinocytes. In comparison to healthy skin and nevi, both examined after miR-29 mimic or inhibitor treatments by miR-29a and miR-29b showed an up-regulation in pri- qRT-PCR and quantitative immunoblotting, respectively mary melanoma samples whereas in metastatic tumors, (Figure 4A and B). Combined transfection of miR-29a/ expression levels were only slightly enhanced compared to 29b reduced CDK6 mRNA and protein levels in A375 healthy controls. Closer sub-classification of the patient cells as compared to scrambled controls whereas PI3K samples revealed, however, that only two of five patients levels were not affected (Figure 4A). In agreement with demonstrated the enhanced miR-29a/29b expression, in- that, knockdown of miR-29a in FM55P cells resulted in a dicating that expression levels are heterogeneous and will slight up-regulation of CDK6 levels while PI3K levels have to be assessed in larger patient cohorts. remained unchanged (Figure 4B). These data indicate that miR-29 is involved in down-regulation of CDK6 protein while PI3K was not specifically targeted in mel- Discussion anoma cells. CDK6 was also down-regulated in response Generally, expression levels of miRNAs can be regulated to miR-29 induction after IFN-γ stimulation in A375 transcriptionally, by epigenetic silencing or different turn- cells and A375-STAT1(wt) but not in A375-STAT1(F) over times [1,35,36]. The role of cytokines as inducers of cells, suggesting STAT1 dependency (Figure 4C). In con- miRNA expression has recently been proposed in several trast, PI3K levels were reduced in all three cell lines, studies and examples for cytokine-induced miRNA up- hinting at STAT1-independent effects. To further prove or down-regulation include pro-inflammatory signaling regulation of CDK6 by miR-29, we performed luciferase molecules like TNF-α and IL1-β [37,38]. Interferons are assays with reporter constructs containing part of the central players in tumor-immune interactions [39,40]. In CDK6 3’-UTR, its three single miR-29 binding sites as this context, the theory of ‘cancer immunosurveillance’, predicted by TargetScan (www.targetscan.org), part of defined as the immunological protection of the host the PI3KR1-3’-UTR or the miR-29a full complementary against development of cancer, has evoked much interest sequence as a positive control (Figure 4D). Luciferase during the last decade: mediated by the host’s immune activity, as compared to the respective negative control, system, it is triggered by immune recognition of stress dropped by ~60 % for both time points in A375 melanoma ligands or antigens expressed on transformed cells. cells when the CDK6 3’-UTR construct was co-transfected IFN-γ has long been recognized for its crucial role in with miR-29a mimic. The corresponding single binding defense against viral and bacterial infections as well as sites contributed to this suppression significantly with in tumor control [40,41]. It primarily signals through the 38% (BS1), 34% (BS2) and 35% (BS3) (Figure 4E). This Jak/STAT pathway and activated STAT1 homodimers suggests that all three miR-29 binding sites partake in the bind to GAS-elements in promoter regions of target suppression of CDK6. Surprisingly, the PI3KR1 construct genes, while IFN-α/β signal additionally through ISRE– was also significantly suppressed by the miR-29a mimic elements. In our study, we have identified several GAS- in luciferase assays (Figure 4E) while only marginal elements in the proposed pri-29a~b-1 promoter region. effects had been observed on mRNA and protein level IFN-γ stimulation of a control cell line expressing Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 8 of 14 http://www.biosignaling.com/content/10/1/41 miR-29ab-mimic-transfected A375 cells miR-29a-inhibitor-transfected FM55P cells A B cdk6 PI3K cdk6 PI3K 1.5 2.0 1.5 3 1.5 1.0 1.0 1.0 0.5 0.5 1 ** 0.5 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h mRNA mRNA protein protein A375 A375-STAT1(F) A375-STAT1(wt) P-STAT1 CDK6 PI3K Actin IFNγ (50ng/ml) - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h CDK6 - 3’UTR D E BS1 BS2 BS3 5’ 3’ 48h 72h CAUGGUGCUC UUUGGUGCUU UGGGUGCUA CUACCACGAU CUACCACGAU miR-29a UACCACGAU PI3KR1-3’UTR ** BS 5’ 3’ ** 60 ** UAACCAUGGUGCUU ** miR-29a AGUCU - ACCACGAU *** 20 *** 29a - FC UAGCACCAUCUGAAAUCGGUUA miR-29a A375 100 1.5 G 80 1.5 F FM55P si-NC 1.0 1.0 80 * si-NC 0.5 0.5 si-cdk6 si-cdk6 0h 72h 0h 72h 20 40 60 80 20 40 60 80 time (hrs) time (hrs) Figure 4 Effects of miR-29 on target genes CDK6 and PI3K. (A,B) relative mRNA and protein expression levels (REL) of miR-29 target genes CDK6 (dark grey) and PI3K (light grey), assessed 24h, 48h and 72h after mimic/inhibitor transfection compared to NC-mimic/NC-inhibitor controls; graphs show means of biological triplicates ± SD. (C) Down-regulation of miR-29 target proteins CDK6 and PI3K is observed after IFN-γ stimulation of melanoma cells. (D) Schematic overview of CDK6 and PI3KR1 luciferase constructs with positions of conserved miR-29a binding sites predicted by TargetScan (bold) in the CDK6-3'UTR (BS1-3) and PI3KR1-3'UTR (BS) and corresponding miR-29a sequences (italics). (E) Luciferase activity in A375 cells transfected with constructs containing the positive control miR-29a full complementary sequence (29a-FC), parts of CDK6- or PI3K1-3'UTRs or CDK6 single binding sites (BS1-BS3) and miR-29a mimic or NC for 48h and 72h. Relative luciferase activity of miR-29a-transfected samples was normalized to NC-mimic-transfected control samples (luciferase activity of NC-mimic transfected samples was set to 100%). Bars show means of biological triplicates ± SD for each construct. (F) A375 and (G) FM55P cells transfected with CDK6 siRNA (black) show reduced proliferation compared to cells transfected with siRNA NC (grey). Results were reproduced at least in biological duplicates. Inserted bar diagrams show the mean confluence of at least biological triplicates at 0h and 72h. Shown are confluence ratios of si-CDK6/si-NC ± SEM. Significance was assessed by one-way ANOVA followed by a Bonferroni Post-Hoc test (A,B,E) or by a two-tailed t-test (F,G). * p<0.05, ** p<0.01 and *** p<0.001. 29a-FC CDK6-3'UTR CDK6-BS1* CDK6-BS2 CDK6-BS3 PI3KR1-3'UTR REL cell confluence (%) REL REL cell confluence (%) luciferase activity (%) REL Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 9 of 14 http://www.biosignaling.com/content/10/1/41 In our study, analysis of primary and metastatic mel- 3 anoma patient samples revealed increased miR-29a/29b expression in some primary tumor samples in compari- son to normal skin, nevi and metastatic tissue while all metastatic lesions had low levels of these miRNAs. Possibly, IFN-γ, which can be produced by macro- phages, T cells and NK cells induces miR-29 expres- sion via STAT1. miR-29a/29b were only up-regulated in two out of five primary melanoma patients. In this respect, it is interesting to note that IFN-γ producing macrophages have been observed in 70 % of melanoma NS N P M samples [42]. A further evaluation of a larger panel of patient samples including early neoplasia and advanced metastatic stages is needed where a special focus will be placed on immune cell infiltration, interferon con- centration and an interferon-responsive gene signature. miR-29 has very recently been linked to interferon biology: it directly targets IFN-γ [43,44], the transcrip- tion factors Tbet and Eomes crucial for IFN-γ expression [19,44], and the receptor IFNAR1 [45], thereby drastic- ally affecting immune regulation such as T cell polarization and thymic function. NS N P M While this manuscript was in preparation, IFN-γ in- Figure 5 miR-29 expression in patient samples. Analysis of volvement in the regulation of miR-29 expression was miR-29a (upper panel) and miR-29b (lower panel) basal expression also reported by a group studying T cell activation and of individual FFPE-patient samples from NS = normal skin, N = nevi, polarization in autoimmune diseases [44]. We here con- P = primary melanoma and M = metastatic melanoma. All graphs -Δct firmed IFN-γ-induced miR-29 up-regulation in T cells show 2 with Δct= (ct (miR-29a/29b)– ct (RNU5A)). Primary and (Jurkat and MT4, Additional file 2: Figure S2) and have metastatic tumor samples were sorted according to patients (P1-5: P1-circles; P2-rectangles; P3-crosses; P4-triangles; P5-asterisks). also observed this effect in human embryonic kidney cells implying a regulatory mechanism of broader rele- vance. Interestingly, also type I interferons led to an up-regulation of miR-29 (Additional file 2: Figure S2). dominant-negative STAT1 (A375-STAT1(F)) did not Screening of a panel of melanoma cell lines for dif- cause an up-regulation of miR-29, providing strong evi- ferent miR-29 species and family members revealed dence that STAT1 is indeed mediating IFN-γ-induced that the pri-29b-2~c cluster was almost not expressed effects on miR-29 expression levels. and that miR-29a exhibited a much higher basal ex- IFN-γ has anti-proliferative effects on cancer cells pression level than miR-29b. In tumor cells, reduced including melanoma [11,12] and we show here that miR-29 expression is frequently observed and diminished miR-29a, which is induced by IFN-γ exhibited the expression of miRNAs in general is often associated same effects. Overall effects on growth were relatively with enhanced oncogenesis [5,46]. The difference in small, but robust and reproducible, considering that we pri-29a~b-1 and pri-29b-2~c expression levels, which we only manipulated levels of one miRNA and only used w?>havedetected,isconsistentwithothertypes ofcancer,in relatively small amounts of mimics/inhibitors (50 nM/ which the pri-29b-2~c cluster was mostly down-regulated 150 nM) to be as close as possible to physiological rele- [26-28]. The fact that miR-29 family members are often not vance. However, IFN-γ may also facilitate melanoma pro- expressed in cancer cells could be crucial for cancer control: gression: Zaidi et al. have shown that IFN-γ-producing miR-29 down-regulates important genes such as CDC42, macrophages are recruited to the UV-exposed skin and TCL-1 and MCL-1, which normally confer tumor- can stimulate proliferation and migration of melanocytes suppressing traits. In this context, anti-proliferating as as well as induce expression of genes implicated in well as anti-invasive and pro-apoptotic effects have immunoevasion and survival. When added to trans- been observed after miR-29 re-introduction in a variety planted melanoma, these skin-recruited macrophages of cancer cells [29,30]. In line with this, we show anti- enhanced the growth and survival of melanoma. All these proliferative effects of miR-29 and confirm for the first effects were IFN-γ-dependent as demonstrated by anti- time CDK6 as a direct miR-29 target in melanoma cells. body blocking of IFN-γ [42]. This suggests that miR-29-mediated down-regulation of miR-29b basal expression miR-29a basal expression Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 10 of 14 http://www.biosignaling.com/content/10/1/41 CDK6 is involved in decreasing proliferation rates of Methods miR-29a/b-mimic-transfected melanoma cells. SiRNA- Cell lines and patient samples mediated knockdown of CDK6 resulted in reduced Melanoma cell lines A375 (American Type Culture Col- proliferation of melanoma cells similar to what has lection, ATCC), A375-STAT1(F) and A375-STAT1(wt) been shown for other cancer types [47,48]. CDK6 [25], FM55P and FM55M1 (European Searchable Tumor plays a pivotal role in control of G1/S cell cycle tran- Line Database and Cell Bank, ESTDAB), IGR39 and sition [49] and loss thereof is a common event in IGR37 (Deutsche Sammlung von Mikroorganismen und neoplastic growth [50]. Noteworthy, CDK6 has also Zellkulturen, DSMZ), MeWo (Dr. D. Schadendorf, been shown to be a direct miR-29 target in mantle Essen, Germany) and SK-Mel30 (Dr. M. Böhm, Münster, cell lymphoma [31], acute myeloid leukemia [34] and Germany) as well as the T cell lines Jurkat and MT4 cervical cancer [32]. (Dr. C. Devaux, Luxembourg) were maintained in The numerous anti-proliferative effects of IFN-γ in RPMI 1640 supplemented with 10% FCS (PAA), 50 μg/ml many cancers may in part be explained by a G1 arrest in- penicillin, 100 μg/ml streptomycin and 0.5 mmol/l volving down-regulation of G1/S cyclins (cyclins A and E) L-glutamine. The stably transfected A375 cell clones and CDK2/4 [12]. Accordingly, we find that IFN-γ as well A375-STAT1(F) and A375-STAT1(wt) were grown under as miR-29 exhibit anti-proliferative activities in melan- selective pressure with 400 μg/ml Geneticin (G418, oma cells involving down-regulation of cell cycle control Gibco). HaCaT keratinocytes (Dr. N. Fusenig, Heidelberg, players such as CDK6. The relevance of CDK6 activity Germany) and HEK293T were grown in DMEM supple- for melanoma growth is further emphasized by the fact mented with 10% FCS, 50 μg/ml penicillin, 100 μg/ml INK4A that the tumor suppressor p16 (an inhibitor for streptomycin and 2.5% HEPES. NHEM-M2 (normal epi- CDK6 and 4) is deleted in about 50% of melanoma dermal human melanocytes, PromoCell) were cultured in patients [51,52]. Here, we describe for the first time that melanocyte growth medium M2 (PromoCell) and har- CDK6 is a direct target of miR-29 involved in regulating vested after reaching ~50% confluence in a 10 cm cell growth behavior of melanoma cells. culture dish. All cells were maintained in a humidified at- mosphere with 5% CO and were routinely tested to be mycoplasma-negative by PCR. Reagents and media were Conclusion purchased from Lonza unless specified otherwise. Our study extends the current knowledge on the miRNA Ethical approval for use of the patient FFPE (formalin- family miR-29, adding a novel regulatory loop of IFN-γ- fixed paraffin-embedded) and healthy control samples mediated Jak/STAT signaling in melanoma cells. Figure 6 was obtained by the Ethical review board, Freiburg, summarizes the proposed regulatory circuit involving Germany (Reference 196/09). Collection, histopatho- IFN-γ and miR29: IFN-γ, which is e.g. secreted by logical analysis, fixation and RNA extraction were per- macrophages following diverse assaults such as infections formed as described before [54]. In total, RNAs of 5 or UV light induces a STAT1-dependent up-regulation of healthy skin samples, 4 benign nevi, 12 primary and 14 miR-29, which in turn can down-regulate IFN-γ expres- metastatic melanoma samples were analyzed by qRT- sion directly and indirectly via T-bet and Eomes. Down- PCR. The primary and metastatic samples were collected regulation of cell cycle regulators like CDK6 contributes from different parts of the body from a total number to IFN-γ-mediated growth arrest. of 5 melanoma patients. Basal miR-expression levels -Δct We report that the pri-29 b-2~c cluster is almost un- were calculated as 2 with Δct= (ct (miR-29a/29b) – detectable in melanoma, which might markedly reduce ct (RNU5A)) (Figure 5). the ability of the miR-29 family to exhibit its tumor- suppressing properties in these cancer cells. The fact IFN-γ stimulation, RNA extraction, and miRNA microarray that miR-29a and miR-29b had enhanced expression analysis levels in some primary melanoma patients but not in For IFN-γ time course stimulation experiments, 100x10 metastatic tumor samples is in line with many studies cells/well were seeded in 6-well plates (Greiner). Cells showing down-regulation or low levels of miR-29 in were either left untreated or stimulated with 50 ng/ml of various advanced cancers [21,22,31,53]. We hypothesize IFN-γ (PeproTech) for the time periods indicated. 5 μM that the reduced miR-29 expression in cancer cells could Jak inhibitor 1 (JI1, Calbiochem) pre-treatment was be a consequence of diminished IFN-γ signaling in those included (72h JI1-time point) in the detailed time course cells, which might already have escaped immune sur- miRNA microarray experiment one hour before IFN-γ- veillance [41]. In regard to the proposed regulatory cir- stimulation. Samples for RNA extraction and protein cuit, our study may open new connections between the lysates were collected altogether at the end of the treat- immune system, miRNAs and growth control and thus, ment for further analyses by qRT-PCR and Western tumorigenesis. Blotting, respectively. Total RNA was extracted using Y Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 11 of 14 http://www.biosignaling.com/content/10/1/41 UV radiation IFN-γ interferons IFN-γ IFN-γ cytokines IFN-γ recruitment of IFN-γ macrophages cytokine receptors Target cell Jak1 Jak2 Melanoma and P P other cancer cells YY G2 G1 active STAT1 dimer transcription nucleus GAS miR-29 gene PI3K ? miR-29a IFN-γ miR-29b CDK6 T-Bet INK4A EOMES P16 down-regulation of miR-29 target genes Figure 6 The miR-29 family is involved in multiple cellular processes. UV-radiation triggers the recruitment of macrophages to the skin, which secrete cytokines like interferon gamma (IFN-γ). By binding to its receptors, IFN-γ signals through the Jak/STAT pathway triggering subsequent activation of STAT1, which then binds to GAS-elements in the promoter region of target genes and initiates their transcription. IFN-γ-induced, STAT1-dependent up-regulation of miR-29 causes a down-regulation of CDK6, a novel miR-29 target gene in melanoma, which INK4A plays a crucial role in cell cycle G1/S-transition and thus growth control of cancer cells. The cell cycle inhibitor p16 is often deleted in melanoma and its function (inhibition of CDK6) might be compensated by miR-29a/b. IFN-γ-activating transcription factors T-bet and Eomes and IFN-γ itself are also targeted by miR-29. TRIsure (Bioline USA, Inc.) and subsequently treated miRNAs, 5 ng RNA input, 2x iQ SYBR Green Supermix with DNaseI (New England Biolabs) as described before (Bio-Rad) and 10x miRNA-specific primer assay (Qiagen) [54]. Quantity and purity of RNA samples were assessed were used. To detect mRNAs, miRNA primary clusters using a NanoDrop ND-2000 spectrophotometer. Global and precursors, 2x iQ SYBR Supermix and 5 pmol gene- miRNA expression levels were profiled on Affymetrix specific primers (for sequences see Additional file 4: GeneCHip miRNA 2.0 Arrays as described before [13]. Table S1) were used together with 50 ng (mRNA detec- tion) or 125 ng (primary/precursor miRNAs) RNA in- Relative quantification of primary, precursor and mature put. PCR conditions for all qRT-PCR reactions were miRNAs and mRNAs 95°C-3 min; 39x (95°C-15s; 60°C-30s); 95°C-1 min; For FFPE samples and cell lines, 250 ng of total RNA 60°C-1 min, followed by a melt curve analysis (60°C to was reversely transcribed using the miScript Reverse 95°C, increment 0.5°C for 20s) to confirm specificity of Transcription kit (Qiagen) according to the supplied the PCR primers. If not stated otherwise, Ct-values for protocol. Real-time PCR was carried out on a CFX de- mRNA and miRNA species were normalized to at least tection system (Bio-Rad). For quantification of mature three housekeeping genes: TBP (TATA binding protein), Y Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 12 of 14 http://www.biosignaling.com/content/10/1/41 HPRT1 (Hypoxanthine phosphoribosyltransferase 1), and protein lysates were collected 24h, 48h and 72h after CycloA (cyclophilin A) and β-Actin for mRNAs and transfection and subsequently analyzed by RT-qPCR and primary/precursor miRNAs; RNU1A, RNU5A (RNA, western blot. Proliferation was monitored by the IncuCyte U1A/5A small nuclear) and SCARNA17 (small Cajal cell-imaging system as described above. body-specific RNA 17) for mature miRNAs. Based on the geometric mean of the three reference genes, a normalization factor was calculated for each sample CDK6 siRNA transfection using geNorm, a VBA applet for Microsoft Excel [55]. 50x10 cells were transfected with 75nM ON-TARGET The relative amount of each target in each sample was siRNA or siRNA negative control (si-NC) 24h after then corrected by dividing its amount by the corre- seeding in 6-well plates using the HiPerfect transfection sponding normalization factor. Fold changes were cal- reagent according to the manufacturer’s instructions culated by dividing the normalized relative amount of (Qiagen). Proliferation was monitored in the IncuCyte treated samples with the normalized relative amount as described above. CDK6 mRNA and protein levels were of the untreated sample that served as a control. Stat- assessed after 24h, 48h and 72h to confirm efficient istical significance was tested with one-way ANOVA, down-regulation (Additional file 3: Figure S3C,D). followed by a Dunnett Post-Hoc test. Except for the FFPE patient samples, all experiments were performed at least in biological triplicates. P values of <0.05 (*), Luciferase reporter gene assays <0.01 (**) and <0.001 (***) were considered significant. The parts of CDK6 and PI3KR1 (Phosphatidylinositol 3-kinase) 3’UTRs containing miR-29 binding sites, CDK6 miR-29a single binding sites and the miR-29a Western blot analysis full complementary sequence were cloned into the Cell lysis, SDS-PAGE, ECL detection, stripping and re- pmirGLO Dual Luciferase miRNA target expression probing was performed as previously described [56,57] vector (Promega) downstream of the luciferase gene using the following antibodies: Actin (C4, Milipore), (see Additional file 4: Table S1 for primer sequences and Tubulin, IRF-1, STAT1 and CDK6 (Santa Cruz), P-STAT1 oligonucleotides). A375 cells were seeded at a density of (Cell Signaling), p85α (PI3K) (Upstate) and the corre- 50 x10 cells/well in 24-well plates one day before trans- sponding HRP-labeled (ECL detection, Cell Signaling fection. Cells were transiently co-transfected with 500 ng Technology) or fluorophor-coupled (quantification, Li-cor plasmid and 50 nM miR-29a mimic or negative control Biosciences) secondary antibodies. For quantification of for 48h and 72h. Samples were lysed with 1x Passive proteins, signal intensities were assessed with a Li-cor Lysis Buffer (Promega) and luciferase activity was mea- Odyssey Infrared Imaging System (Li-cor Biosciences) sured using the Dual-Luciferase Reporter Assay System and analyzed with the provided software. CDK6 and (Promega) according to the manufacturer’s instructions. p85α signals were normalized to the respective Tubulin Firefly was divided by Renilla activity and normalized to loading controls. the negative control for each construct. Significance was assessed by one-way ANOVA followed by a Bonferroni Real-time proliferation assays Post-Hoc test with * p<0.05, ** p<0.01 and *** p<0.001. 25 x10 cells/well of eight untreated melanoma cell lines Additional files were seeded in 12-well plates and harvested after 96h of real-time monitoring in the IncuCyte live-cell imaging Additional file 1: Figure S1. Schmitt_et_al_2012_Contains a graphical system (Essen Bioscience), which photographed cells in representation of array results: Top 10 up-regulated miRNAs (as listed in phase contrast every 3h. RNA was extracted and miR-29 Figure 1A) after IFN-γ stimulation for the indicated time periods and 72h species were amplified by qRT-PCR as described before JI1. [54] and above. Additional file 2: Figure S2. Schmitt_et_al_2012_Contains bar diagrams of qRT-PCR results: MiR-29a/29b up-regulation after IFN-γ- stimulation and unchanged miR-25 levels in A) HEK293T kidney and B) miRNA mimic/inhibitor transfection Jurkat T cells. C) MiR-29a/29b up-regulation after IFN-α-, IFN-β- and IFN-γ- 100 x10 cells/well were seeded in 6-well plates stimulation (50 ng/ml) in MT4 T cells. and transfected after 24h with 50 nM of each miR-29a Additional file 3: Figure S3. Schmitt_et_al_2012_Contains bar diagrams of qRT-PCR results an western blots: Tracking of miR-29a/29b and miR-29b mimics or with 150 nM miR-29a inhibi- mimics in A375 cells (A) and miR-29a suppression after inhibitor tor or corresponding amounts of negative controls transfection in FM55P cells (B); and knock-down of CDK6 mRNA (C) and (Qiagen) using the DharmafectDuo transfection reagent protein levels (D) in both cell lines. (Dharmacon) according to the supplied protocol; effi- Additional file 4: Table S1. within Schmitt_et_al_2012_Contains primer sequences. Additional Figure legends: Schmitt_et_al_2012_ Contains cient transfection was confirmed by qRT-PCR (Additional additional Figure legends. Powerpoint documents. file 3: Figure S3). For miR-29 target gene expression, RNA Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 13 of 14 http://www.biosignaling.com/content/10/1/41 Competing interests Stat3-mediated induction of microRNA-21 through a highly conserved The authors declare that they have no competing interests. enhancer. Blood 2007, 110:1330–1333. 15. Iliopoulos D, Jaeger SA, Hirsch HA, Bulyk ML, Struhl K: STAT3 activation of Authors’ contributions miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic The study was carried out in collaboration with all authors. MS, DP, SR and switch linking inflammation to cancer. Mol Cell 2010, 39:493–506. CM performed the laboratory experiments and analyzed the results. AWB 16. Yang CH, Yue J, Fan M, Pfeffer LM: IFN induces miR-21 through a performed the in silico analysis of the miR-29 promoter region and provided signal transducer and activator of transcription 3-dependent bioinformatic support. MS, DP and SR drafted the manuscript. DN provided pathway as a suppressive negative feedback on IFN-induced the primary melanoma patient samples and scientific background about the apoptosis. Cancer Res 2010, 70:8108–8116. disease. IB and SK developed the experimental design of the study, 17. Kohanbash G, Okada H: MicroRNAs and STAT interplay. Semin Cancer Biol interpreted results and participated in writing and critical revision of the 2012, 22:70–75. manuscript. All authors read and approved the manuscript. 18. Fabbri M, Garzon R, Cimmino A, Liu Z, Zanesi N, Callegari E, Liu S, Alder H, Costinean S, Fernandez-Cymering C, et al: MicroRNA-29 family reverts Acknowledgments aberrant methylation in lung cancer by targeting DNA M. and SR are supported by an AFR fellowship of the Fonds National de la methyltransferases 3A and 3B. Proc Natl Acad Sci USA 2007, Recherche, Luxembourg (MS: TR-PHD BFR08-077, SR: 4019604). The study 104:15805–15810. was supported by an internal research grant from the University of 19. Steiner DF, Thomas MF, Hu JK, Yang Z, Babiarz JE, Allen CD, Matloubian M, Luxembourg (F1R-LSC-PUL-09MIRN) and by a research grant from the Blelloch R, Ansel KM: MicroRNA-29 regulates T-box transcription factors Fondation Cancer (Luxembourg). We thank Dr. Carole Devaux and Gilles and interferon-gamma production in helper T cells. Immunity 2011, Iserentant (CRP-Santé, Luxembourg) for providing MT4 cells and Dr. Lasse 35:169–181. Sinkkonen for providing pri-29a~b-1 primer sequences. 20. Sengupta S, den Boon JA, Chen IH, Newton MA, Stanhope SA, Cheng YJ, Chen CJ, Hildesheim A, Sugden B, Ahlquist P: MicroRNA 29c is Author details down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs Signal Transduction Laboratory, University of Luxembourg, 162A Avenue de encoding extracellular matrix proteins. Proc Natl Acad Sci USA 2008, la Faïencerie, Luxembourg L-1511, Luxembourg. Life Sciences Research Unit, 105:5874–5878. University of Luxembourg, 162A Avenue de la Faïencerie, Luxembourg 21. Kriegel AJ, Liu Y, Fang Y, Ding X, Liang M: The miR-29 Family: Genomics, L-1511, Luxembourg. Hautklinik, Klinikum Dortmund GmbH, Beurhausstraße Cell Biology, and Relevance to Renal and Cardiovascular Injury. 40, Dortmund 44137, Germany. Physiol Genomics 2012, 44:237–244. 22. Schmitt M, Margue C, Behrmann I, Kreis S: MiRNA-29: a microRNA Family Received: 19 October 2012 Accepted: 27 November 2012 with Tumor-Suppressing and Immune-Modulating Properties. Published: 17 December 2012 Curr Mol Med 2012, in press. 23. Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, References Thomas-Tikhonenko A, Mendell JT: Widespread microRNA repression by 1. Krol J, Loedige I, Filipowicz W: The widespread regulation of microRNA Myc contributes to tumorigenesis. Nat Genet 2008, 40:43–50. biogenesis, function and decay. Nat Rev Genet 2010, 11:597–610. 24. Mott JL, Kurita S, Cazanave SC, Bronk SF, Werneburg NW, Fernandez-Zapico 2. Winter J, Jung S, Keller S, Gregory RI, Diederichs S: Many roads to maturity: ME: Transcriptional suppression of mir-29b-1/mir-29a promoter by microRNA biogenesis pathways and their regulation. c-Myc, hedgehog, and NF-kappaB. J Cell Biochem 2010, 110:1155–1164. Nat Cell Biol 2009, 11:228–234. 25. Kortylewski M, Heinrich PC, Mackiewicz A, Schniertshauer U, Klingmuller U, 3. Davis BN, Hata A: Regulation of MicroRNA Biogenesis: A miRiad of Nakajima K, Hirano T, Horn F, Behrmann I: Interleukin-6 and oncostatin mechanisms. Cell Commun Signal 2009, 7:18. M-induced growth inhibition of human A375 melanoma cells is 4. Friedman RC, Farh KK, Burge CB, Bartel DP: Most mammalian mRNAs STAT-dependent and involves upregulation of the cyclin-dependent are conserved targets of microRNAs. Genome Res 2009, 19:92–105. kinase inhibitor p27/Kip1. Oncogene 1999, 18:3742–3753. 5. Henry JC, Azevedo-Pouly AC, Schmittgen TD: MicroRNA replacement 26. Stamatopoulos B, Meuleman N, Haibe-Kains B, Saussoy P, Van Den Neste E, therapy for cancer. Pharm Res 2011, 28:3030–3042. Michaux L, Heimann P, Martiat P, Bron D, Lagneaux L: microRNA-29c and 6. Kasinski AL, Slack FJ: Epigenetics and genetics. MicroRNAs en route to the microRNA-223 down-regulation has in vivo significance in chronic clinic: progress in validating and targeting microRNAs for cancer lymphocytic leukemia and improves disease risk stratification. therapy. Nat Rev Cancer 2011, 11:849–864. Blood 2009, 113:5237–5245. 7. Miller AJ, Mihm MC Jr: Melanoma. N Engl J Med 2006, 355:51–65. 27. Pekarsky Y, Santanam U, Cimmino A, Palamarchuk A, Efanov A, Maximov V, 8. Ascierto PA, Kirkwood JM, Grob JJ, Simeone E, Grimaldi AM, Maio M, Volinia S, Alder H, Liu CG, Rassenti L, et al: Tcl1 expression in chronic Palmieri G, Testori A, Marincola FM, Mozzillo N: The role of BRAF V600 lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res mutation in melanoma. J Transl Med 2012, 10:85. 2006, 66:11590–11593. 9. Sala E, Mologni L, Truffa S, Gaetano C, Bollag GE, Gambacorti-Passerini C: 28. Wang H, Garzon R, Sun H, Ladner KJ, Singh R, Dahlman J, Cheng A, Hall BM, BRAF silencing by short hairpin RNA or chemical blockade by PLX4032 Qualman SJ, Chandler DS, et al: NF-kappaB-YY1-miR-29 regulatory circuitry in leads to different responses in melanoma and thyroid carcinoma cells. skeletal myogenesis and rhabdomyosarcoma. Cancer Cell 2008, 14:369–381. Mol Cancer Res 2008, 6:751–759. 29. Fang JH, Zhou HC, Zeng C, Yang J, Liu Y, Huang X, Zhang JP, Guan XY, 10. Flaherty KT, Puzanov I, Kim KB, Ribas A, McArthur GA, Sosman JA, O'Dwyer PJ, Zhuang SM: MicroRNA-29b suppresses tumor angiogenesis, invasion, and Lee RJ, Grippo JF, Nolop K, Chapman PB: Inhibition of mutated, activated metastasis by regulating matrix metalloproteinase 2 expression. BRAF in metastatic melanoma. N Engl J Med 2010, 363:809–819. Hepatology 2011, 54:1729–1740. 11. Garbe C, Krasagakis K: Effects of interferons and cytokines on melanoma 30. Xiong Y, Fang JH, Yun JP, Yang J, Zhang Y, Jia WH, Zhuang SM: cells. J Invest Dermatol 1993, 100:239S–244S. Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis 12. Kortylewski M, Komyod W, Kauffmann ME, Bosserhoff A, Heinrich PC, of hepatocellular carcinoma. Hepatology 2010, 51:836–845. Behrmann I: Interferon-gamma-mediated growth regulation of 31. Zhao JJ, Lin J, Lwin T, Yang H, Guo J, Kong W, Dessureault S, Moscinski LC, melanoma cells: involvement of STAT1-dependent and STAT1- Rezania D, Dalton WS, et al: microRNA expression profile and independent signals. J Invest Dermatol 2004, 122:414–422. identification of miR-29 as a prognostic marker and pathogenetic 13. Reinsbach S, Nazarov P, Philippidou D, Schmitt M, Wienecke-Baldacchino factor by targeting CDK6 in mantle cell lymphoma. Blood 2010, A, Muller A, Vallar L, Behrmann I, Kreis S: Dynamic regulation of microRNA 115:2630–2639. expression following Interferon-γ-induced gene transcription. RNA Biol 32. Li Y, Wang F, Xu J, Ye F, Shen Y, Zhou J, Lu W, Wan X, Ma D, Xie X: Progressive 2012, 9:978–989. miRNA expression profiles in cervical carcinogenesis and identification of 14. Loffler D, Brocke-Heidrich K, Pfeifer G, Stocsits C, Hackermuller J, HPV-related target genes for miR-29. J Pathol 2011, 224:484–495. Kretzschmar AK, Burger R, Gramatzki M, Blumert C, Bauer K, et al: 33. Park SY, Lee JH, Ha M, Nam JW, Kim VN: miR-29 miRNAs activate p53 by Interleukin-6 dependent survival of multiple myeloma cells involves the targeting p85 alpha and CDC42. Nat Struct Mol Biol 2009, 16:23–29. Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 14 of 14 http://www.biosignaling.com/content/10/1/41 34. Garzon R, Liu S, Fabbri M, Liu Z, Heaphy CE, Callegari E, Schwind S, Pang J, microRNA target genes in human melanoma. Cancer Res 2010, Yu J, Muthusamy N, et al: MicroRNA-29b induces global DNA 70:4163–4173. hypomethylation and tumor suppressor gene reexpression in acute 55. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, myeloid leukemia by targeting directly DNMT3A and 3B and indirectly Speleman F: Accurate normalization of real-time quantitative RT-PCR DNMT1. Blood 2009, 113:6411–6418. data by geometric averaging of multiple internal control genes. 35. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Genome Biol 2002, 3. research0034.1-0034.11-0031-0034.0011. Cell 2004, 116:281–297. 56. Kreis S, Philippidou D, Margue C, Behrmann I: IL-24: a classic cytokine 36. Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, and/or a potential cure for cancer? J Cell Mol Med 2008, 12:2505–2510. Cigudosa JC, Croce CM, Fernandez-Piqueras J, Malumbres M: Genetic and 57. Haan C, Behrmann I: A cost effective non-commercial ECL-solution for epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 Western blot detections yielding strong signals and low background. oncogene expression. Cancer Cell 2008, 13:496–506. J Immunol Methods 2007, 318:11–19. 37. Roggli E, BritanA,Gattesco S,Lin-MarqN,AbderrahmaniA,MedaP,Regazzi R: Involvement of microRNAs in the cytotoxic effects exerted by doi:10.1186/1478-811X-10-41 proinflammatory cytokines on pancreatic beta-cells. Diabetes 2010, 59:978–986. Cite this article as: Schmitt et al.: Interferon-γ-induced activation of 38. Ruan W, Xu JM, Li SB, Yuan LQ, Dai RP: Effects of down-regulation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells. Cell microRNA-23a on TNF-alpha-induced endothelial cell apoptosis through Communication and Signaling 2012 10:41. caspase-dependent pathways. Cardiovasc Res 2012, 93:623–632. 39. Diamond MS, Kinder M, Matsushita H, Mashayekhi M, Dunn GP, Archambault JM, Lee H, Arthur CD, White JM, Kalinke U, et al: Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J Exp Med 2011, 208:1989–2003. 40. Dunn GP, Koebel CM, Schreiber RD: Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006, 6:836–848. 41. Schreiber RD, Old LJ, Smyth MJ: Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 2011, 331:1565–1570. 42. Zaidi MR, Davis S, Noonan FP, Graff-Cherry C, Hawley TS, Walker RL, Feigenbaum L, Fuchs E, Lyakh L, Young HA, et al: Interferon-gamma links ultraviolet radiation to melanomagenesis in mice. Nature 2011, 469:548–553. 43. Ma F, Xu S, Liu X, Zhang Q, Xu X, Liu M, Hua M, Li N, Yao H, Cao X: The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-gamma. Nat Immunol 2011, 12:861–869. 44. Smith KM, Guerau-de-Arellano M, Costinean S, Williams JL, Bottoni A, Mavrikis Cox G, Satoskar AR, Croce CM, Racke MK, Lovett-Racke AE, Whitacre CC: miR-29ab1 Deficiency Identifies a Negative Feedback Loop Controlling Th1 Bias That Is Dysregulated in Multiple Sclerosis. J Immunol 2012, 189:1567–1576. 45. Papadopoulou AS, Dooley J, Linterman MA, Pierson W, Ucar O, Kyewski B, Zuklys S, Hollander GA, Matthys P, Gray DH, et al: The thymic epithelial microRNA network elevates the threshold for infection-associated thymic involution via miR-29a mediated suppression of the IFN-alpha receptor. Nat Immunol 2012, 13:181–187. 46. Nguyen T, Kuo C, Nicholl MB, Sim MS, Turner RR, Morton DL, Hoon DS: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma. Epigenetics 2011, 6:388–394. 47. Ismail A, Bandla S, Reveiller M, Toia L, Zhou Z, Gooding WE, Kalatskaya I, Stein L, D'Souza M, Litle VR, et al: Early G(1) cyclin-dependent kinases as prognostic markers and potential therapeutic targets in esophageal adenocarcinoma. Clin Cancer Res 2011, 17:4513–4522. 48. Whiteway SL, Harris PS, Venkataraman S, Alimova I, Birks DK, Donson AM, Foreman NK, Vibhakar R: Inhibition of cyclin-dependent kinase 6 suppresses cell proliferation and enhances radiation sensitivity in medulloblastoma cells. J Neurooncol 2012, in press. 49. Grossel MJ, Hinds PW: From cell cycle to differentiation: an expanding role for cdk6. Cell Cycle 2006, 5:266–270. Submit your next manuscript to BioMed Central 50. Musat M, Vax VV, Borboli N, Gueorguiev M, Bonner S, Korbonits M, and take full advantage of: Grossman AB: Cell cycle dysregulation in pituitary oncogenesis. Front Horm Res 2004, 32:34–62. 51. Bennett DC: How to make a melanoma: what do we know of the primary • Convenient online submission clonal events? Pigment Cell Melanoma Res 2008, 21:27–38. • Thorough peer review 52. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PA, Ally DS, Sheahan • No space constraints or color figure charges MD, Clark WH Jr, Tucker MA, Dracopoli NC: Germline p16 mutations in familial melanoma. Nat Genet 1994, 8:15–21. • Immediate publication on acceptance 53. Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T: • Inclusion in PubMed, CAS, Scopus and Google Scholar MicroRNA expression profiling in prostate cancer. Cancer Res 2007, 67:6130–6135. • Research which is freely available for redistribution 54. Philippidou D, Schmitt M, Moser D, Margue C, Nazarov PV, Muller A, Vallar L, Nashan D, Behrmann I, Kreis S: Signatures of microRNAs and selected Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Communication and Signaling Springer Journals

Interferon-γ-induced activation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells

Download PDF
14 pages

Loading next page...
 
/lp/springer-journals/interferon-induced-activation-of-signal-transducer-and-activator-of-Ji2ZOTr7J0

References (60)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Schmitt et al.; licensee BioMed Central Ltd.
Subject
Life Sciences; Cell Biology; Protein-Ligand Interactions; Receptors; Cytokines and Growth Factors
eISSN
1478-811X
DOI
10.1186/1478-811X-10-41
pmid
23245396
Publisher site
See Article on Publisher Site

Abstract

Background: The type-II-cytokine IFN-γ is a pivotal player in innate immune responses but also assumes functions in controlling tumor cell growth by orchestrating cellular responses against neoplastic cells. The role of IFN-γ in melanoma is not fully understood: it is a well-known growth inhibitor of melanoma cells in vitro. On the other hand, IFN-γ may also facilitate melanoma progression. While interferon-regulated genes encoding proteins have been intensively studied since decades, the contribution of miRNAs to effects mediated by interferons is an emerging area of research. We recently described a distinct and dynamic regulation of a whole panel of microRNAs (miRNAs) after IFN-γ-stimulation. The aim of this study was to analyze the transcriptional regulation of miR-29 family members in detail, identify potential interesting target genes and thus further elucidate a potential signaling pathway IFN-γ → Jak→ P-STAT1 → miR-29 → miR-29 target genes and its implication for melanoma growth. Results: Here we show that IFN-γ induces STAT1-dependently a profound up-regulation of the miR-29 primary cluster pri-29a~b-1 in melanoma cell lines. Furthermore, expression levels of pri-29a~b-1 and mature miR-29a and miR-29b were elevated while the pri-29b-2~c cluster was almost undetectable. We observed an inverse correlation between miR-29a/b expression and the proliferation rate of various melanoma cell lines. This finding could be corroborated in cells transfected with either miR-29 mimics or inhibitors. The IFN-γ-induced G1-arrest of melanoma cells involves down-regulation of CDK6, which we proved to be a direct target of miR-29 in these cells. Compared to nevi and normal skin, and metastatic melanoma samples, miR-29a and miR-29b levels were found strikingly elevated in certain patient samples derived from primary melanoma. Conclusions: Our findings reveal that the miR-29a/b1 cluster is to be included in the group of IFN- and STAT-regulated genes. The up-regulated miR-29 family members may act as effectors of cytokine signalling in melanoma and other cancer cells as well as in the immune system. Keywords: IFN-γ, Jak/STAT pathway, STAT1, Signaling, Melanoma, miR-29, Tumor-suppressor * Correspondence: [email protected] Signal Transduction Laboratory, University of Luxembourg, 162A Avenue de la Faïencerie, Luxembourg L-1511, Luxembourg Full list of author information is available at the end of the article © 2012 Schmitt et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 2 of 14 http://www.biosignaling.com/content/10/1/41 Background found several miRNAs to be dynamically regulated fol- In the past decade, small non-coding microRNAs lowing stimulation with IFN-γ [13]. One of the first con- (miRNAs) have been identified as new and important nections between cytokine-induced Jak/STAT signaling players in post-transcriptional gene regulation and ever and miRNAs has been established by Löffler et al., who since, their expression patterns and cellular functions showed that IL-6 increased the expression of oncogenic have been investigated in cancer and other diseases [1,2]. miR-21 via STAT3 activation in myeloma cells [14]. The MiRNA biogenesis can be differentially regulated [3], but signaling cascades involving IL-6 or IFN-α/β/STAT3/ generally starts with the generation of a primary (pri-) miR-21 and others have been confirmed in several types miRNA transcript (several thousand nucleotides long), of cancer and diseases [15-17]. which is subsequently processed into a 70–80 nucleotide In the current study, we have focused on the biochem- precursor form (pre-miRNA), which, following nuclear ical analysis of individual miRNAs regulated by IFN-γ export, is then cleaved into the ~22 nucleotide mature which we have recently identified in a detailed-time miRNA. One strand of the mature duplex is incorporated course microarray experiment [13], and further concen- in the RISC (RNA-induced silencing complex), where trated on the interesting miRNA family miR-29 with its it recognizes, binds to and represses mRNA target three mature members, miR-29a, -29b and -29c. It is sequences [1]. MiRNAs are involved in many fundamen- transcribed into two primary transcripts, pri-29a~b-1 tal cellular processes as they are estimated to control and pri-29b-2~c, from chromosomes 7 and 1, respect- >50% of all protein-coding genes in mammals [4]. ively. MiR-29 family members target the expression of Consequently, they have been implicated in the regula- proteins such as methyltransferases, extracellular matrix tion of processes that promote cancer growth or con- proteins and transcription factors [18-20], which are versely, in processes that might prevent cancers from potentially involved in triggering enhanced invasion, developing. For instance, a cancer cell can emerge fol- migration or proliferation of cells. They are silenced or lowing the over-expression of so-called “oncomirs” (such down-regulated in many types of cancer and have con- as the miR-17-92 family, miR-21, -155, etc.) which down- sequently been assigned tumor-suppressing properties, regulate tumor-suppressors that control cell proliferation. although in some cases also oncogenic roles have been On the other hand, miRNAs that function as tumor- reported [21,22]. Here, we demonstrate a specific and pro- suppressors by targeting cellular oncoproteins (such as found IFN-γ-induced, STAT1-dependent up-regulation let-7 family members, miR-15a, -16, -29, etc.) are fre- of miR-29a and -29b in melanoma cells and importantly, quently down-regulated in cancer tissues [5]. Therapeu- also increased expression in primary melanoma patient tics opting to replace the diminished tumor-suppressor samples (but not in metastatic tumors) whereas the miRNAs are currently being investigated and seem second cluster pri-29b-2~c was consistently undetectable. promising, as miRNAs exhibit high stability as well as Moreover, we provide evidence for the tumor-suppressing high specificity for their target mRNAs [5,6]. properties of miR-29 family members: inhibition of melan- A disease where patients are in urgent need of more oma cell proliferation could be mediated by miR-29a, effective treatments is advanced melanoma, the most which down-regulated CDK6 (cyclin-dependent kinase 6), aggressive form of skin cancer. Metastatic melanoma an important player in cell cycle G1/S transition. Our exhibit a severe resistance to therapy leading to 5-year findings identify the pri-29a~b-1cluster as a novel IFN-γ- survival rates of below 5% [7]. Around 50% of patients regulated gene and open up new connections between exhibit V600E mutations in the cellular kinase BRAF miRNAs, interferon signaling and malignant melanoma, [8]. Recently, the BRAF-inhibitor Zelboraf has been which could lead to novel concepts for potential treat- approved for treatment of late-stage malignant melanoma ment options in the future. patients with V600E mutations, increasing life expectancy by several months [9,10]. Nevertheless, except excision at Results early stages, no curative therapies exist. Routinely, ther- To investigate possible transcriptional regulations of apies against melanoma include IFN-α as an adjuvant miRNAs by STAT transcription factors, several melanoma treatment. Interferons are cytokines and constitute a cell lines were treated with IFN-γ for different time major part of the innate immune response, but they are intervals and were subsequently analyzed by miRNA also recognized for their anti-proliferative properties. We microarray as previously described [13]. The top 10 and others have shown that the type-II-cytokine IFN-γ IFN-γ-induced miRNAs from a microarray experiment, mediates growth inhibition of cancer cells by activating which showed highest differential expression compared the transcription factor STAT1 [11,12]. After IFN-γ to untreated cells, and detailed time-course expression stimulation, STAT1 forms homodimers, which bind to profiles thereof are depicted in Figure 1A and Additional GAS (IFN-γ-activated sequences) elements in the pro- file 1: Figure S1. For further analysis, we focused on moter regions of target genes. Very recently, we have the miR-29 family, as its mature members miR-29a and Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 3 of 14 http://www.biosignaling.com/content/10/1/41 649 bp 29a 29b-1 5’ 3’ Chr7 q32.3 miR-1246 3’ 5’ miR-886-5p miR-3195 miR-424* 504 bp 29b-2 29c miR-3178 Chr1 q32.2 5’ 3’ 3’ miR-29 5’ miR-1979 miR-27a* miR-23a* hsa-miR-29a: 5’-U AGCACCA UC UGAAAUCGGUUA-3’ miR-663 hsa-miR-29b: 5’-U AGCACCA UU UGAAAUCAGUGUU-3’ hsa-miR-29c: 5’-U AGCACCA UU UGAAAUCGGUUA-3’ ISRE: (G/A)(G/A)AANNGAAA(C/G) miR-29a miR-29b-1 GAS: TT(C/A)CNNNAA(A/G) I1 I2 G1 G2 G3 G4G5 chr7: 1 kb chr7: 130.560.000 130.598.268 Figure 1 Top 10 IFN-γ-up-regulated miRNAs. (A) Ten miRNAs with highest positive fold changes (as determined by previous microarray experiments [13]) include miR-29 family members (left). Detailed time course profiles are shown in Additional file 1: Figure S1. The miR-29 family is transcribed from the respective antisense strand from two genetic clusters of chromosomes 7 (pri-29a~b-1) and 1 (pri-29b-2~c) (right). The three mature forms miR-29a/29b/29c share the same seed region (grey box). Differences between the mature sequences are underlined; a nucleotide difference between miR-29a and miR-29c is shown in italics. (B) The presumed pri-29a~b-1 promoter region [22-24] contains five GAS-elements G1-5 (TT(C/A)CNNNAA(A/G)) and two ISRE-elements I1-2 ((G/A)(G/A)AANNGAAA(C/G)) (GRCh37/hg19). miR-29b showed the most robust regulations across all replacement of tyrosine residue 701 crucial for STAT1 tested melanoma cell lines and because of its interesting phosphorylation and dimerization [12]. Thus, transcrip- properties regarding tumor biology. To identify the pres- tion of STAT1 target genes is abolished despite IFN-γ ence of potential IFN-response elements, we performed stimulation. The corresponding control cells A375- in silico screening of the promoter region 5 kb upstream STAT1(wt) express the STAT1 wild-type construct instead of a putative transcription start of pri-29a~b-1 [22-24] [12]. To accurately assess the regulation of the miR-29 and found five GAS-elements (TT(C/A)CNNNAA(A/G)) family by IFN-γ-induced STAT1, we performed time and two ISRE (interferon stimulated response element)- course experiments (Figure 2). Stimulation of A375, elements ((G/A)(G/A)AANNGAAA(C/G)) (Figure 1B). MeWo and A375-STAT1(wt) cell lines with 50 ng/ml of For control purposes, we selected miR-100, which was IFN-γ induced a prominent STAT1 phosphorylation, slightly down-regulated after IFN-γ stimulation and which decreased after 48h of IFN-γ treatment, whereas miR-25, whose levels were not induced in the micro- the STAT1-dominant negative cells A375-STAT1(F) only array experiments. Other regulated candidates included exhibited a delayed and weak P-STAT1 signal after IFN-γ several miRNA star sequences (“miR*” which here repre- stimulation (Figure 2A, see also [25]). Functional activity sents the miR strand, which arises from the 3’-arm of the of the P-STAT1 transcription factor was confirmed by hairpin, while the 5’-arm would be the guide or parent up-regulation of the STAT1 target genes IRF-1 and strand and is conventionally considered as “minor” STAT1 itself, which showed induced expression after product) which are currently being further assessed in 3h and 8h, respectively. our laboratory (Figure 1, Additional file 1: Figure S1). Following stimulation, changes in miRNA expression levels were assessed by qRT-PCR (Figure 2B). A375, The pri-29a~b-1 cluster and mature miR-29a/29b are A375-STAT1(wt) and MeWo cell lines showed a strong regulated by IFN-γ and significant up-regulation (>5 fold) of the pri-29a~b-1 For stimulation experiments with IFN-γ, melanoma cell cluster, starting 24h after IFN-γ stimulation, while ex- lines MeWo and A375, as well as stably transfected pression of the pri-29b-2~c cluster was not altered A375 derivates were used. A375-STAT1(F) represent (Figure 2B, upper panel). Accordingly, miRNA precursors STAT1-dominant negative cells harboring a phenylalanine pre-29a and pre-29b-1 were also augmented whereas Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 4 of 14 http://www.biosignaling.com/content/10/1/41 A A375-STAT1(F) A375-STAT1(wt) A375 MeWo P-Stat1 Stat1 IRF -1 Actin - - IFN-γ 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h 3h 8h 24h 48h 72h (50ng/ml) A375-STAT1(F) A375-STAT1(wt) A375 MeWo *** ** untr 10 10 10 10 3h IFN- 8h *** (50ng/ml) 24h ** *** *** 48h *** ** 72h 5 5 5 Pri a/b-1Pri b-2/c Pri a/b-1Pri b-2/c Pri a/b1 Pri b2/c Pri a/b-1Pri b-2/c 15 15 15 15 ** ** 10 10 10 10 *** *** *** *** *** *** *** *** * *** ** *** *** 5 5 5 ** 5 *** ** * * ** Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c Pre a Pre b-1 Pre b-2 Pre c 6 6 6 6 *** *** 4 4 4 4 ** *** *** ** ** ** 2 2 2 2 *** 29a 29b 25 100 29a 29b 25 100 29a 29b 25 100 29a 29b 25 100 4 8 10 2.0 2.0 3 6 1.5 1.5 2 4 1.0 1.0 1 2 0.5 0.5 miR-29a miR-29b miR-29c miR-25 miR-100 miR-29a* miR-29b-1* miR-29c* miR-25* miR-100* miR-29b-2* Figure 2 (See legend on next page.) primary mature precursor REL REL REL REL IFN-γ untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 untr 0.5 h 3h 6h 12h 24h 48h 72h 96h 72hJI1 Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 5 of 14 http://www.biosignaling.com/content/10/1/41 (See figure on previous page.) Figure 2 Expression profiles of miR-29 clusters in melanoma cells. A375-STAT1(F), A375-STAT1(wt), A375 and MeWo melanoma cells were stimulated with IFN-γ for different time points. (A) Western Blot analysis (representative blots of biological triplicates) confirms activation of P-STAT1 and induction of STAT1 and IRF-1 after IFN-γ stimulation while dominant negative A375-STAT1(F) cells show minor effects. (B) Time course study of miRNA-expression after IFNγ-stimulation. Graphs show relative expression (REL) from quantitative qRT-PCR data for the pri-29a~b-1 and the pri-29b-2~c clusters, the precursors pre-29a/29b-1/29b-2/29c and mature miR-29a/29b/25/100. Fold expression was calculated relative to the untreated control and SDs are shown for biological triplicates. Statistical significance was tested with one-way ANOVA, followed by a Dunnett Post-Hoc test with * p<0.05, ** p<0.01 and *** p<0.001. (C) MiRNA and miRNA* expression profiles in A375 cells derived from a more detailed IFN-γ time course miRNA microarray experiment including cells treated with JI1 (IFN-γ stimulation for 72h after pre-treatment with JI1, black and grey dots). Depicted are log2-values of the mean of duplicate microarray experiments. pre-29b-2 and pre-29c levels remained unaffected cluster in rhabdomyosarcoma [28] and B-cell lymphoma (Figure 2B, middle panel). Subsequently, significant up- [23]. Also, mature miR-29a consistently showed higher regulation of both mature miR-29a and miR-29b fol- basal expression levels than miR-29b in all cell lines lowing IFN-γ stimulation was confirmed (Figure 2B, examined (Figure 3B). lower panel). The two control amplifications of miR-100 (slightly down-regulated) and miR-25, which remained MiR-29a/29b expression levels inversely correlate with stable over time following IFN-γ stimulation confirmed growth behavior of melanoma cell lines the initial microarray-based expression profiles (Figure 2B, The classification of miR-29 as tumor-suppressor miRNA lower panel). Similar regulation patterns were also found has been widely accepted and the possibility to use syn- in Jurkat and MT4 T-cells and in HEK293T kidney cells thetic miR-29 as therapeutic agent in treatments of can- (for mature miR-29a, miR-29b, and miR-25, Additional cer seems to become increasingly realistic. Properties file 2: Figure S2). Except for minor expression changes of counteracting the development and spreading of cancer the Pri/Pre-miR-29 species after 72h of IFN-γ treatment, cells that have been observed in vitro and in vivo after no up-regulation was detected in the A375-STAT1(F) miR-29 overexpression include reduced invasion and dominant negative control cells, clearly suggesting that proliferation and induction of apoptosis [29,30]. These STAT1 activity is required for the IFN-γ-induced regula- findings prompted us to analyze a potential correlation tion of miR-29 family members. of basal miR-29 expression levels with cell growth. Figure 2C shows expression results of a detailed time Proliferation of untreated melanoma cell lines was moni- course microarray experiment using IFN-γ-stimulated tored over time (Figure 3C) in order to correlate the A375 cells. In parallel and as described before, cells had growth rate with miR-29a and pri-29a~b-1 basal expres- been pre-treated with Jak inhibitor 1 (JI1), which specif- sion levels obtained from cells harvested 96h after seed- ically inhibits Janus tyrosine kinases and subsequently ing. Melanoma cell lines were grouped in miR-29a and prevented miR-29 up-regulation after IFN-γ stimula- pri-29a~b-1 ‘low-expression’ (A375, MeWo, IGR39, tion [13]. WM9) and ‘high expression’ cell lines (FM55P, FM55M1, Altogether, these data substantiate for the first time SK-Mel30, IGR37) (Figure 3A and B). Generally, cell lines a time-dependent up-regulation of the expression of with lower miR-29a showed an increased proliferation pri-29a~b-1 cluster as well as of the mature miRNAs rate compared to lines with higher basal miR-29a levels miR-29a and -29b in melanoma cells, which is trig- (Figure 3C). Furthermore, the inverse correlation be- gered by IFN-γ-induced STAT1 signaling. tween pri-29a~b-1/miR-29a expression and the prolifera- tion rate of melanoma cell lines might suggest a potential The miR-29b-2~c cluster is undetectable in melanoma cell involvement of miR-29 in anti-proliferative effects on lines, melanocytes and keratinocytes melanoma cells. To follow up these findings, we applied As both miR-29 primary clusters as well as the mature miR-29a/29b mimics to A375 cells, which exhibit a rela- miR-29a/29b showed different basal expression levels in tively low miR-29a/29b basal expression and, vice versa, stimulation experiments and are known to be differen- we applied a miR-29a inhibitor to FM55P cells, which tially expressed in several types of cancer [26,27], we have a high basal miR-29a/29b expression (Figure 3B). next analyzed the miR-29 basal expression profiles in a Proliferation assays with mimics and inhibitors and panel of melanoma cell lines, primary human melano- the corresponding amounts of scrambled controls, NC cytes (NHEM-M2) and HaCaT keratinocytes (Figure 3A (negative control)-mimic and NC-inhibitor, corroborated and B). Pri-29a~b-1 was strongly expressed whereas pri- that miR-29 indeed inhibited growth of melanoma cells: 29b-2~c was almost undetectable in all cell lines ana- transfection of miR-29a/29b mimics caused a remarkable lyzed (Figure 3A). This is in accordance with previous reduction of proliferation as compared to NC-mimic- studies reporting down-regulation of the pri-29b-2~c transfected A375 cells (Figure 3D). In turn, FM55P cells, Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 6 of 14 http://www.biosignaling.com/content/10/1/41 Pri-29a~b-1/29b-2~c basal expression A C WM9 A375 ‘low expression’ Proliferation MeWo A375 IGR39 MeWo FM55M1 ‘high expression’ IGR39 FM55P FM55P SKMel30 IGR37 WM9 HaCaT FM55M1 NHEM-M2 SKMel30 0 5 10 15 20 40 mature miR-29a/b basal expression MeWo IGR37 A375 IGR39 ‘low expression’ WM9 FM55M1 ‘high expression’ 24 36 48 60 72 84 IGR37 time (hrs) FM55P SKMel30 HaCaT NHEM-M2 0 2 4 6 8 10 DE proliferation of miR-29a-inhibitor-transfected FM55P cells proliferation of miR-29a/b-mimic-transfected A375 cells 1.5 2.0 *** 80 1.5 1.0 NC-mimic 1.0 29a 0.5 0.5 inhibitor 29ab 0h 72h 0h 72h mimic NC - inhibitor 0 20 40 60 0 20 40 60 time (hrs) time (hrs) Figure 3 Inverse correlation of miR-29a expression levels and melanoma proliferation. Comparison of basal expression levels of (A) primary miRNA clusters pri-29a~b-1 (blue/red/black bars) and pri-29b-2~c (grey bars) and (B) mature miR-29a (blue/red/black bars) and -Δct 2 miR-29b (grey bars) in NHEM-M2, eight melanoma cell lines and HaCaT keratinocytes. Graphs show 2 x10 with SD of biological triplicates. (C) Mean growth curves of untreated melanoma cell lines over 4 days (biological quadruplicates). Melanoma cell lines with ‘low expression’ of pri-29a~b-1 and miR-29a show faster proliferation whereas cells with a relatively ‘high expression’ proliferate slower. (D,E) Proliferation assay of (black) mimic/inhibitor- and (grey) NC-mimic/NC-inhibitor-transfected cells over 72h in (D) A375 and (E) FM55P cells; representative graphs of four independent experiments. Error bars depict SDs of technical triplicates. The inserted graphs (upper left corners) show the mean confluence of 4 biological replicates at 0h and 72h time points of the proliferation assay. Depicted are ratios of confluence of 29ab-mimic/NC-mimic treated cells (D) and 29a-inhibitor/NC-inhibitor treated cells (E). Error bars show SEM. Significance was assessed by a two-tailed t-test with * p<0.05, ** p<0.01 and *** p<0.001. cell confluence (%) cell confluence (%) cell confluence (%) Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 7 of 14 http://www.biosignaling.com/content/10/1/41 in which miR-29a was inhibited, proliferated faster than (Figure 4A,B). Taken together, these findings indicate NC-inhibitor-transfected control cells (Figure 3E). that both CDK6 and PI3KR1 3’-UTRs are directly tar- geted by miR-29 in melanoma cells; however, only CDK6 MiR-29a/29b down-regulate CDK6, but not PI3K suppression seems to be important in a cellular context. MiR-29 is predicted to regulate more than 1000 human To further explore the relevance of reduced CDK6 levels genes (TargetScanHuman 6.1). We have used a combin- in the cell, we used siRNA against CDK6 and assessed ation of several algorithms (TargetScanHuman 6.1, proliferation over 72h in A375 (Figure 4F) and FM55P Diana-microT v3.0, microRNA.org) to compile a list of cells (Figure 4G). Reduction of CDK6 mRNA and protein potentially interesting genes, which carry predicted level (Additional file 3: Figure S3) led to a clearly dimin- miR-29 target sites. After detailed expression analysis of ished proliferation in both cell lines. potential candidates in melanoma cells and initial screen- ing for their response to miR-29 mimic and inhibitor MiR-29a and miR-29b are up-regulated in primary treatment (data not shown), we concentrated on the melanoma patient samples PI3K regulatory subunit (gene: PI3KR1; protein: PI3K/ Finally, we investigated miR-29a/29b expression profiles p85α) and CDK6, which play important roles in cell cycle in FFPE melanoma patient samples from normal skin, control, cellular signaling and thus, proliferation. Both nevi, primary and metastatic melanoma by qRT-PCR have already been confirmed as miR-29 targets in several (Figure 5). Nevi represent the most appropriate control cancers [31-34]. samples as they contain predominantly melanocytes To assess the effect of miR-29 on CDK6 and PI3K while normal skin samples are mostly composed of kera- expression in melanoma, mRNA and protein levels were tinocytes. In comparison to healthy skin and nevi, both examined after miR-29 mimic or inhibitor treatments by miR-29a and miR-29b showed an up-regulation in pri- qRT-PCR and quantitative immunoblotting, respectively mary melanoma samples whereas in metastatic tumors, (Figure 4A and B). Combined transfection of miR-29a/ expression levels were only slightly enhanced compared to 29b reduced CDK6 mRNA and protein levels in A375 healthy controls. Closer sub-classification of the patient cells as compared to scrambled controls whereas PI3K samples revealed, however, that only two of five patients levels were not affected (Figure 4A). In agreement with demonstrated the enhanced miR-29a/29b expression, in- that, knockdown of miR-29a in FM55P cells resulted in a dicating that expression levels are heterogeneous and will slight up-regulation of CDK6 levels while PI3K levels have to be assessed in larger patient cohorts. remained unchanged (Figure 4B). These data indicate that miR-29 is involved in down-regulation of CDK6 protein while PI3K was not specifically targeted in mel- Discussion anoma cells. CDK6 was also down-regulated in response Generally, expression levels of miRNAs can be regulated to miR-29 induction after IFN-γ stimulation in A375 transcriptionally, by epigenetic silencing or different turn- cells and A375-STAT1(wt) but not in A375-STAT1(F) over times [1,35,36]. The role of cytokines as inducers of cells, suggesting STAT1 dependency (Figure 4C). In con- miRNA expression has recently been proposed in several trast, PI3K levels were reduced in all three cell lines, studies and examples for cytokine-induced miRNA up- hinting at STAT1-independent effects. To further prove or down-regulation include pro-inflammatory signaling regulation of CDK6 by miR-29, we performed luciferase molecules like TNF-α and IL1-β [37,38]. Interferons are assays with reporter constructs containing part of the central players in tumor-immune interactions [39,40]. In CDK6 3’-UTR, its three single miR-29 binding sites as this context, the theory of ‘cancer immunosurveillance’, predicted by TargetScan (www.targetscan.org), part of defined as the immunological protection of the host the PI3KR1-3’-UTR or the miR-29a full complementary against development of cancer, has evoked much interest sequence as a positive control (Figure 4D). Luciferase during the last decade: mediated by the host’s immune activity, as compared to the respective negative control, system, it is triggered by immune recognition of stress dropped by ~60 % for both time points in A375 melanoma ligands or antigens expressed on transformed cells. cells when the CDK6 3’-UTR construct was co-transfected IFN-γ has long been recognized for its crucial role in with miR-29a mimic. The corresponding single binding defense against viral and bacterial infections as well as sites contributed to this suppression significantly with in tumor control [40,41]. It primarily signals through the 38% (BS1), 34% (BS2) and 35% (BS3) (Figure 4E). This Jak/STAT pathway and activated STAT1 homodimers suggests that all three miR-29 binding sites partake in the bind to GAS-elements in promoter regions of target suppression of CDK6. Surprisingly, the PI3KR1 construct genes, while IFN-α/β signal additionally through ISRE– was also significantly suppressed by the miR-29a mimic elements. In our study, we have identified several GAS- in luciferase assays (Figure 4E) while only marginal elements in the proposed pri-29a~b-1 promoter region. effects had been observed on mRNA and protein level IFN-γ stimulation of a control cell line expressing Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 8 of 14 http://www.biosignaling.com/content/10/1/41 miR-29ab-mimic-transfected A375 cells miR-29a-inhibitor-transfected FM55P cells A B cdk6 PI3K cdk6 PI3K 1.5 2.0 1.5 3 1.5 1.0 1.0 1.0 0.5 0.5 1 ** 0.5 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h 24h 48h 72h mRNA mRNA protein protein A375 A375-STAT1(F) A375-STAT1(wt) P-STAT1 CDK6 PI3K Actin IFNγ (50ng/ml) - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h - 3h 8h 24h 48h 72h CDK6 - 3’UTR D E BS1 BS2 BS3 5’ 3’ 48h 72h CAUGGUGCUC UUUGGUGCUU UGGGUGCUA CUACCACGAU CUACCACGAU miR-29a UACCACGAU PI3KR1-3’UTR ** BS 5’ 3’ ** 60 ** UAACCAUGGUGCUU ** miR-29a AGUCU - ACCACGAU *** 20 *** 29a - FC UAGCACCAUCUGAAAUCGGUUA miR-29a A375 100 1.5 G 80 1.5 F FM55P si-NC 1.0 1.0 80 * si-NC 0.5 0.5 si-cdk6 si-cdk6 0h 72h 0h 72h 20 40 60 80 20 40 60 80 time (hrs) time (hrs) Figure 4 Effects of miR-29 on target genes CDK6 and PI3K. (A,B) relative mRNA and protein expression levels (REL) of miR-29 target genes CDK6 (dark grey) and PI3K (light grey), assessed 24h, 48h and 72h after mimic/inhibitor transfection compared to NC-mimic/NC-inhibitor controls; graphs show means of biological triplicates ± SD. (C) Down-regulation of miR-29 target proteins CDK6 and PI3K is observed after IFN-γ stimulation of melanoma cells. (D) Schematic overview of CDK6 and PI3KR1 luciferase constructs with positions of conserved miR-29a binding sites predicted by TargetScan (bold) in the CDK6-3'UTR (BS1-3) and PI3KR1-3'UTR (BS) and corresponding miR-29a sequences (italics). (E) Luciferase activity in A375 cells transfected with constructs containing the positive control miR-29a full complementary sequence (29a-FC), parts of CDK6- or PI3K1-3'UTRs or CDK6 single binding sites (BS1-BS3) and miR-29a mimic or NC for 48h and 72h. Relative luciferase activity of miR-29a-transfected samples was normalized to NC-mimic-transfected control samples (luciferase activity of NC-mimic transfected samples was set to 100%). Bars show means of biological triplicates ± SD for each construct. (F) A375 and (G) FM55P cells transfected with CDK6 siRNA (black) show reduced proliferation compared to cells transfected with siRNA NC (grey). Results were reproduced at least in biological duplicates. Inserted bar diagrams show the mean confluence of at least biological triplicates at 0h and 72h. Shown are confluence ratios of si-CDK6/si-NC ± SEM. Significance was assessed by one-way ANOVA followed by a Bonferroni Post-Hoc test (A,B,E) or by a two-tailed t-test (F,G). * p<0.05, ** p<0.01 and *** p<0.001. 29a-FC CDK6-3'UTR CDK6-BS1* CDK6-BS2 CDK6-BS3 PI3KR1-3'UTR REL cell confluence (%) REL REL cell confluence (%) luciferase activity (%) REL Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 9 of 14 http://www.biosignaling.com/content/10/1/41 In our study, analysis of primary and metastatic mel- 3 anoma patient samples revealed increased miR-29a/29b expression in some primary tumor samples in compari- son to normal skin, nevi and metastatic tissue while all metastatic lesions had low levels of these miRNAs. Possibly, IFN-γ, which can be produced by macro- phages, T cells and NK cells induces miR-29 expres- sion via STAT1. miR-29a/29b were only up-regulated in two out of five primary melanoma patients. In this respect, it is interesting to note that IFN-γ producing macrophages have been observed in 70 % of melanoma NS N P M samples [42]. A further evaluation of a larger panel of patient samples including early neoplasia and advanced metastatic stages is needed where a special focus will be placed on immune cell infiltration, interferon con- centration and an interferon-responsive gene signature. miR-29 has very recently been linked to interferon biology: it directly targets IFN-γ [43,44], the transcrip- tion factors Tbet and Eomes crucial for IFN-γ expression [19,44], and the receptor IFNAR1 [45], thereby drastic- ally affecting immune regulation such as T cell polarization and thymic function. NS N P M While this manuscript was in preparation, IFN-γ in- Figure 5 miR-29 expression in patient samples. Analysis of volvement in the regulation of miR-29 expression was miR-29a (upper panel) and miR-29b (lower panel) basal expression also reported by a group studying T cell activation and of individual FFPE-patient samples from NS = normal skin, N = nevi, polarization in autoimmune diseases [44]. We here con- P = primary melanoma and M = metastatic melanoma. All graphs -Δct firmed IFN-γ-induced miR-29 up-regulation in T cells show 2 with Δct= (ct (miR-29a/29b)– ct (RNU5A)). Primary and (Jurkat and MT4, Additional file 2: Figure S2) and have metastatic tumor samples were sorted according to patients (P1-5: P1-circles; P2-rectangles; P3-crosses; P4-triangles; P5-asterisks). also observed this effect in human embryonic kidney cells implying a regulatory mechanism of broader rele- vance. Interestingly, also type I interferons led to an up-regulation of miR-29 (Additional file 2: Figure S2). dominant-negative STAT1 (A375-STAT1(F)) did not Screening of a panel of melanoma cell lines for dif- cause an up-regulation of miR-29, providing strong evi- ferent miR-29 species and family members revealed dence that STAT1 is indeed mediating IFN-γ-induced that the pri-29b-2~c cluster was almost not expressed effects on miR-29 expression levels. and that miR-29a exhibited a much higher basal ex- IFN-γ has anti-proliferative effects on cancer cells pression level than miR-29b. In tumor cells, reduced including melanoma [11,12] and we show here that miR-29 expression is frequently observed and diminished miR-29a, which is induced by IFN-γ exhibited the expression of miRNAs in general is often associated same effects. Overall effects on growth were relatively with enhanced oncogenesis [5,46]. The difference in small, but robust and reproducible, considering that we pri-29a~b-1 and pri-29b-2~c expression levels, which we only manipulated levels of one miRNA and only used w?>havedetected,isconsistentwithothertypes ofcancer,in relatively small amounts of mimics/inhibitors (50 nM/ which the pri-29b-2~c cluster was mostly down-regulated 150 nM) to be as close as possible to physiological rele- [26-28]. The fact that miR-29 family members are often not vance. However, IFN-γ may also facilitate melanoma pro- expressed in cancer cells could be crucial for cancer control: gression: Zaidi et al. have shown that IFN-γ-producing miR-29 down-regulates important genes such as CDC42, macrophages are recruited to the UV-exposed skin and TCL-1 and MCL-1, which normally confer tumor- can stimulate proliferation and migration of melanocytes suppressing traits. In this context, anti-proliferating as as well as induce expression of genes implicated in well as anti-invasive and pro-apoptotic effects have immunoevasion and survival. When added to trans- been observed after miR-29 re-introduction in a variety planted melanoma, these skin-recruited macrophages of cancer cells [29,30]. In line with this, we show anti- enhanced the growth and survival of melanoma. All these proliferative effects of miR-29 and confirm for the first effects were IFN-γ-dependent as demonstrated by anti- time CDK6 as a direct miR-29 target in melanoma cells. body blocking of IFN-γ [42]. This suggests that miR-29-mediated down-regulation of miR-29b basal expression miR-29a basal expression Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 10 of 14 http://www.biosignaling.com/content/10/1/41 CDK6 is involved in decreasing proliferation rates of Methods miR-29a/b-mimic-transfected melanoma cells. SiRNA- Cell lines and patient samples mediated knockdown of CDK6 resulted in reduced Melanoma cell lines A375 (American Type Culture Col- proliferation of melanoma cells similar to what has lection, ATCC), A375-STAT1(F) and A375-STAT1(wt) been shown for other cancer types [47,48]. CDK6 [25], FM55P and FM55M1 (European Searchable Tumor plays a pivotal role in control of G1/S cell cycle tran- Line Database and Cell Bank, ESTDAB), IGR39 and sition [49] and loss thereof is a common event in IGR37 (Deutsche Sammlung von Mikroorganismen und neoplastic growth [50]. Noteworthy, CDK6 has also Zellkulturen, DSMZ), MeWo (Dr. D. Schadendorf, been shown to be a direct miR-29 target in mantle Essen, Germany) and SK-Mel30 (Dr. M. Böhm, Münster, cell lymphoma [31], acute myeloid leukemia [34] and Germany) as well as the T cell lines Jurkat and MT4 cervical cancer [32]. (Dr. C. Devaux, Luxembourg) were maintained in The numerous anti-proliferative effects of IFN-γ in RPMI 1640 supplemented with 10% FCS (PAA), 50 μg/ml many cancers may in part be explained by a G1 arrest in- penicillin, 100 μg/ml streptomycin and 0.5 mmol/l volving down-regulation of G1/S cyclins (cyclins A and E) L-glutamine. The stably transfected A375 cell clones and CDK2/4 [12]. Accordingly, we find that IFN-γ as well A375-STAT1(F) and A375-STAT1(wt) were grown under as miR-29 exhibit anti-proliferative activities in melan- selective pressure with 400 μg/ml Geneticin (G418, oma cells involving down-regulation of cell cycle control Gibco). HaCaT keratinocytes (Dr. N. Fusenig, Heidelberg, players such as CDK6. The relevance of CDK6 activity Germany) and HEK293T were grown in DMEM supple- for melanoma growth is further emphasized by the fact mented with 10% FCS, 50 μg/ml penicillin, 100 μg/ml INK4A that the tumor suppressor p16 (an inhibitor for streptomycin and 2.5% HEPES. NHEM-M2 (normal epi- CDK6 and 4) is deleted in about 50% of melanoma dermal human melanocytes, PromoCell) were cultured in patients [51,52]. Here, we describe for the first time that melanocyte growth medium M2 (PromoCell) and har- CDK6 is a direct target of miR-29 involved in regulating vested after reaching ~50% confluence in a 10 cm cell growth behavior of melanoma cells. culture dish. All cells were maintained in a humidified at- mosphere with 5% CO and were routinely tested to be mycoplasma-negative by PCR. Reagents and media were Conclusion purchased from Lonza unless specified otherwise. Our study extends the current knowledge on the miRNA Ethical approval for use of the patient FFPE (formalin- family miR-29, adding a novel regulatory loop of IFN-γ- fixed paraffin-embedded) and healthy control samples mediated Jak/STAT signaling in melanoma cells. Figure 6 was obtained by the Ethical review board, Freiburg, summarizes the proposed regulatory circuit involving Germany (Reference 196/09). Collection, histopatho- IFN-γ and miR29: IFN-γ, which is e.g. secreted by logical analysis, fixation and RNA extraction were per- macrophages following diverse assaults such as infections formed as described before [54]. In total, RNAs of 5 or UV light induces a STAT1-dependent up-regulation of healthy skin samples, 4 benign nevi, 12 primary and 14 miR-29, which in turn can down-regulate IFN-γ expres- metastatic melanoma samples were analyzed by qRT- sion directly and indirectly via T-bet and Eomes. Down- PCR. The primary and metastatic samples were collected regulation of cell cycle regulators like CDK6 contributes from different parts of the body from a total number to IFN-γ-mediated growth arrest. of 5 melanoma patients. Basal miR-expression levels -Δct We report that the pri-29 b-2~c cluster is almost un- were calculated as 2 with Δct= (ct (miR-29a/29b) – detectable in melanoma, which might markedly reduce ct (RNU5A)) (Figure 5). the ability of the miR-29 family to exhibit its tumor- suppressing properties in these cancer cells. The fact IFN-γ stimulation, RNA extraction, and miRNA microarray that miR-29a and miR-29b had enhanced expression analysis levels in some primary melanoma patients but not in For IFN-γ time course stimulation experiments, 100x10 metastatic tumor samples is in line with many studies cells/well were seeded in 6-well plates (Greiner). Cells showing down-regulation or low levels of miR-29 in were either left untreated or stimulated with 50 ng/ml of various advanced cancers [21,22,31,53]. We hypothesize IFN-γ (PeproTech) for the time periods indicated. 5 μM that the reduced miR-29 expression in cancer cells could Jak inhibitor 1 (JI1, Calbiochem) pre-treatment was be a consequence of diminished IFN-γ signaling in those included (72h JI1-time point) in the detailed time course cells, which might already have escaped immune sur- miRNA microarray experiment one hour before IFN-γ- veillance [41]. In regard to the proposed regulatory cir- stimulation. Samples for RNA extraction and protein cuit, our study may open new connections between the lysates were collected altogether at the end of the treat- immune system, miRNAs and growth control and thus, ment for further analyses by qRT-PCR and Western tumorigenesis. Blotting, respectively. Total RNA was extracted using Y Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 11 of 14 http://www.biosignaling.com/content/10/1/41 UV radiation IFN-γ interferons IFN-γ IFN-γ cytokines IFN-γ recruitment of IFN-γ macrophages cytokine receptors Target cell Jak1 Jak2 Melanoma and P P other cancer cells YY G2 G1 active STAT1 dimer transcription nucleus GAS miR-29 gene PI3K ? miR-29a IFN-γ miR-29b CDK6 T-Bet INK4A EOMES P16 down-regulation of miR-29 target genes Figure 6 The miR-29 family is involved in multiple cellular processes. UV-radiation triggers the recruitment of macrophages to the skin, which secrete cytokines like interferon gamma (IFN-γ). By binding to its receptors, IFN-γ signals through the Jak/STAT pathway triggering subsequent activation of STAT1, which then binds to GAS-elements in the promoter region of target genes and initiates their transcription. IFN-γ-induced, STAT1-dependent up-regulation of miR-29 causes a down-regulation of CDK6, a novel miR-29 target gene in melanoma, which INK4A plays a crucial role in cell cycle G1/S-transition and thus growth control of cancer cells. The cell cycle inhibitor p16 is often deleted in melanoma and its function (inhibition of CDK6) might be compensated by miR-29a/b. IFN-γ-activating transcription factors T-bet and Eomes and IFN-γ itself are also targeted by miR-29. TRIsure (Bioline USA, Inc.) and subsequently treated miRNAs, 5 ng RNA input, 2x iQ SYBR Green Supermix with DNaseI (New England Biolabs) as described before (Bio-Rad) and 10x miRNA-specific primer assay (Qiagen) [54]. Quantity and purity of RNA samples were assessed were used. To detect mRNAs, miRNA primary clusters using a NanoDrop ND-2000 spectrophotometer. Global and precursors, 2x iQ SYBR Supermix and 5 pmol gene- miRNA expression levels were profiled on Affymetrix specific primers (for sequences see Additional file 4: GeneCHip miRNA 2.0 Arrays as described before [13]. Table S1) were used together with 50 ng (mRNA detec- tion) or 125 ng (primary/precursor miRNAs) RNA in- Relative quantification of primary, precursor and mature put. PCR conditions for all qRT-PCR reactions were miRNAs and mRNAs 95°C-3 min; 39x (95°C-15s; 60°C-30s); 95°C-1 min; For FFPE samples and cell lines, 250 ng of total RNA 60°C-1 min, followed by a melt curve analysis (60°C to was reversely transcribed using the miScript Reverse 95°C, increment 0.5°C for 20s) to confirm specificity of Transcription kit (Qiagen) according to the supplied the PCR primers. If not stated otherwise, Ct-values for protocol. Real-time PCR was carried out on a CFX de- mRNA and miRNA species were normalized to at least tection system (Bio-Rad). For quantification of mature three housekeeping genes: TBP (TATA binding protein), Y Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 12 of 14 http://www.biosignaling.com/content/10/1/41 HPRT1 (Hypoxanthine phosphoribosyltransferase 1), and protein lysates were collected 24h, 48h and 72h after CycloA (cyclophilin A) and β-Actin for mRNAs and transfection and subsequently analyzed by RT-qPCR and primary/precursor miRNAs; RNU1A, RNU5A (RNA, western blot. Proliferation was monitored by the IncuCyte U1A/5A small nuclear) and SCARNA17 (small Cajal cell-imaging system as described above. body-specific RNA 17) for mature miRNAs. Based on the geometric mean of the three reference genes, a normalization factor was calculated for each sample CDK6 siRNA transfection using geNorm, a VBA applet for Microsoft Excel [55]. 50x10 cells were transfected with 75nM ON-TARGET The relative amount of each target in each sample was siRNA or siRNA negative control (si-NC) 24h after then corrected by dividing its amount by the corre- seeding in 6-well plates using the HiPerfect transfection sponding normalization factor. Fold changes were cal- reagent according to the manufacturer’s instructions culated by dividing the normalized relative amount of (Qiagen). Proliferation was monitored in the IncuCyte treated samples with the normalized relative amount as described above. CDK6 mRNA and protein levels were of the untreated sample that served as a control. Stat- assessed after 24h, 48h and 72h to confirm efficient istical significance was tested with one-way ANOVA, down-regulation (Additional file 3: Figure S3C,D). followed by a Dunnett Post-Hoc test. Except for the FFPE patient samples, all experiments were performed at least in biological triplicates. P values of <0.05 (*), Luciferase reporter gene assays <0.01 (**) and <0.001 (***) were considered significant. The parts of CDK6 and PI3KR1 (Phosphatidylinositol 3-kinase) 3’UTRs containing miR-29 binding sites, CDK6 miR-29a single binding sites and the miR-29a Western blot analysis full complementary sequence were cloned into the Cell lysis, SDS-PAGE, ECL detection, stripping and re- pmirGLO Dual Luciferase miRNA target expression probing was performed as previously described [56,57] vector (Promega) downstream of the luciferase gene using the following antibodies: Actin (C4, Milipore), (see Additional file 4: Table S1 for primer sequences and Tubulin, IRF-1, STAT1 and CDK6 (Santa Cruz), P-STAT1 oligonucleotides). A375 cells were seeded at a density of (Cell Signaling), p85α (PI3K) (Upstate) and the corre- 50 x10 cells/well in 24-well plates one day before trans- sponding HRP-labeled (ECL detection, Cell Signaling fection. Cells were transiently co-transfected with 500 ng Technology) or fluorophor-coupled (quantification, Li-cor plasmid and 50 nM miR-29a mimic or negative control Biosciences) secondary antibodies. For quantification of for 48h and 72h. Samples were lysed with 1x Passive proteins, signal intensities were assessed with a Li-cor Lysis Buffer (Promega) and luciferase activity was mea- Odyssey Infrared Imaging System (Li-cor Biosciences) sured using the Dual-Luciferase Reporter Assay System and analyzed with the provided software. CDK6 and (Promega) according to the manufacturer’s instructions. p85α signals were normalized to the respective Tubulin Firefly was divided by Renilla activity and normalized to loading controls. the negative control for each construct. Significance was assessed by one-way ANOVA followed by a Bonferroni Real-time proliferation assays Post-Hoc test with * p<0.05, ** p<0.01 and *** p<0.001. 25 x10 cells/well of eight untreated melanoma cell lines Additional files were seeded in 12-well plates and harvested after 96h of real-time monitoring in the IncuCyte live-cell imaging Additional file 1: Figure S1. Schmitt_et_al_2012_Contains a graphical system (Essen Bioscience), which photographed cells in representation of array results: Top 10 up-regulated miRNAs (as listed in phase contrast every 3h. RNA was extracted and miR-29 Figure 1A) after IFN-γ stimulation for the indicated time periods and 72h species were amplified by qRT-PCR as described before JI1. [54] and above. Additional file 2: Figure S2. Schmitt_et_al_2012_Contains bar diagrams of qRT-PCR results: MiR-29a/29b up-regulation after IFN-γ- stimulation and unchanged miR-25 levels in A) HEK293T kidney and B) miRNA mimic/inhibitor transfection Jurkat T cells. C) MiR-29a/29b up-regulation after IFN-α-, IFN-β- and IFN-γ- 100 x10 cells/well were seeded in 6-well plates stimulation (50 ng/ml) in MT4 T cells. and transfected after 24h with 50 nM of each miR-29a Additional file 3: Figure S3. Schmitt_et_al_2012_Contains bar diagrams of qRT-PCR results an western blots: Tracking of miR-29a/29b and miR-29b mimics or with 150 nM miR-29a inhibi- mimics in A375 cells (A) and miR-29a suppression after inhibitor tor or corresponding amounts of negative controls transfection in FM55P cells (B); and knock-down of CDK6 mRNA (C) and (Qiagen) using the DharmafectDuo transfection reagent protein levels (D) in both cell lines. (Dharmacon) according to the supplied protocol; effi- Additional file 4: Table S1. within Schmitt_et_al_2012_Contains primer sequences. Additional Figure legends: Schmitt_et_al_2012_ Contains cient transfection was confirmed by qRT-PCR (Additional additional Figure legends. Powerpoint documents. file 3: Figure S3). For miR-29 target gene expression, RNA Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 13 of 14 http://www.biosignaling.com/content/10/1/41 Competing interests Stat3-mediated induction of microRNA-21 through a highly conserved The authors declare that they have no competing interests. enhancer. Blood 2007, 110:1330–1333. 15. Iliopoulos D, Jaeger SA, Hirsch HA, Bulyk ML, Struhl K: STAT3 activation of Authors’ contributions miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic The study was carried out in collaboration with all authors. MS, DP, SR and switch linking inflammation to cancer. Mol Cell 2010, 39:493–506. CM performed the laboratory experiments and analyzed the results. AWB 16. Yang CH, Yue J, Fan M, Pfeffer LM: IFN induces miR-21 through a performed the in silico analysis of the miR-29 promoter region and provided signal transducer and activator of transcription 3-dependent bioinformatic support. MS, DP and SR drafted the manuscript. DN provided pathway as a suppressive negative feedback on IFN-induced the primary melanoma patient samples and scientific background about the apoptosis. Cancer Res 2010, 70:8108–8116. disease. IB and SK developed the experimental design of the study, 17. Kohanbash G, Okada H: MicroRNAs and STAT interplay. Semin Cancer Biol interpreted results and participated in writing and critical revision of the 2012, 22:70–75. manuscript. All authors read and approved the manuscript. 18. Fabbri M, Garzon R, Cimmino A, Liu Z, Zanesi N, Callegari E, Liu S, Alder H, Costinean S, Fernandez-Cymering C, et al: MicroRNA-29 family reverts Acknowledgments aberrant methylation in lung cancer by targeting DNA M. and SR are supported by an AFR fellowship of the Fonds National de la methyltransferases 3A and 3B. Proc Natl Acad Sci USA 2007, Recherche, Luxembourg (MS: TR-PHD BFR08-077, SR: 4019604). The study 104:15805–15810. was supported by an internal research grant from the University of 19. Steiner DF, Thomas MF, Hu JK, Yang Z, Babiarz JE, Allen CD, Matloubian M, Luxembourg (F1R-LSC-PUL-09MIRN) and by a research grant from the Blelloch R, Ansel KM: MicroRNA-29 regulates T-box transcription factors Fondation Cancer (Luxembourg). We thank Dr. Carole Devaux and Gilles and interferon-gamma production in helper T cells. Immunity 2011, Iserentant (CRP-Santé, Luxembourg) for providing MT4 cells and Dr. Lasse 35:169–181. Sinkkonen for providing pri-29a~b-1 primer sequences. 20. Sengupta S, den Boon JA, Chen IH, Newton MA, Stanhope SA, Cheng YJ, Chen CJ, Hildesheim A, Sugden B, Ahlquist P: MicroRNA 29c is Author details down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs Signal Transduction Laboratory, University of Luxembourg, 162A Avenue de encoding extracellular matrix proteins. Proc Natl Acad Sci USA 2008, la Faïencerie, Luxembourg L-1511, Luxembourg. Life Sciences Research Unit, 105:5874–5878. University of Luxembourg, 162A Avenue de la Faïencerie, Luxembourg 21. Kriegel AJ, Liu Y, Fang Y, Ding X, Liang M: The miR-29 Family: Genomics, L-1511, Luxembourg. Hautklinik, Klinikum Dortmund GmbH, Beurhausstraße Cell Biology, and Relevance to Renal and Cardiovascular Injury. 40, Dortmund 44137, Germany. Physiol Genomics 2012, 44:237–244. 22. Schmitt M, Margue C, Behrmann I, Kreis S: MiRNA-29: a microRNA Family Received: 19 October 2012 Accepted: 27 November 2012 with Tumor-Suppressing and Immune-Modulating Properties. Published: 17 December 2012 Curr Mol Med 2012, in press. 23. Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, References Thomas-Tikhonenko A, Mendell JT: Widespread microRNA repression by 1. Krol J, Loedige I, Filipowicz W: The widespread regulation of microRNA Myc contributes to tumorigenesis. Nat Genet 2008, 40:43–50. biogenesis, function and decay. Nat Rev Genet 2010, 11:597–610. 24. Mott JL, Kurita S, Cazanave SC, Bronk SF, Werneburg NW, Fernandez-Zapico 2. Winter J, Jung S, Keller S, Gregory RI, Diederichs S: Many roads to maturity: ME: Transcriptional suppression of mir-29b-1/mir-29a promoter by microRNA biogenesis pathways and their regulation. c-Myc, hedgehog, and NF-kappaB. J Cell Biochem 2010, 110:1155–1164. Nat Cell Biol 2009, 11:228–234. 25. Kortylewski M, Heinrich PC, Mackiewicz A, Schniertshauer U, Klingmuller U, 3. Davis BN, Hata A: Regulation of MicroRNA Biogenesis: A miRiad of Nakajima K, Hirano T, Horn F, Behrmann I: Interleukin-6 and oncostatin mechanisms. Cell Commun Signal 2009, 7:18. M-induced growth inhibition of human A375 melanoma cells is 4. Friedman RC, Farh KK, Burge CB, Bartel DP: Most mammalian mRNAs STAT-dependent and involves upregulation of the cyclin-dependent are conserved targets of microRNAs. Genome Res 2009, 19:92–105. kinase inhibitor p27/Kip1. Oncogene 1999, 18:3742–3753. 5. Henry JC, Azevedo-Pouly AC, Schmittgen TD: MicroRNA replacement 26. Stamatopoulos B, Meuleman N, Haibe-Kains B, Saussoy P, Van Den Neste E, therapy for cancer. Pharm Res 2011, 28:3030–3042. Michaux L, Heimann P, Martiat P, Bron D, Lagneaux L: microRNA-29c and 6. Kasinski AL, Slack FJ: Epigenetics and genetics. MicroRNAs en route to the microRNA-223 down-regulation has in vivo significance in chronic clinic: progress in validating and targeting microRNAs for cancer lymphocytic leukemia and improves disease risk stratification. therapy. Nat Rev Cancer 2011, 11:849–864. Blood 2009, 113:5237–5245. 7. Miller AJ, Mihm MC Jr: Melanoma. N Engl J Med 2006, 355:51–65. 27. Pekarsky Y, Santanam U, Cimmino A, Palamarchuk A, Efanov A, Maximov V, 8. Ascierto PA, Kirkwood JM, Grob JJ, Simeone E, Grimaldi AM, Maio M, Volinia S, Alder H, Liu CG, Rassenti L, et al: Tcl1 expression in chronic Palmieri G, Testori A, Marincola FM, Mozzillo N: The role of BRAF V600 lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res mutation in melanoma. J Transl Med 2012, 10:85. 2006, 66:11590–11593. 9. Sala E, Mologni L, Truffa S, Gaetano C, Bollag GE, Gambacorti-Passerini C: 28. Wang H, Garzon R, Sun H, Ladner KJ, Singh R, Dahlman J, Cheng A, Hall BM, BRAF silencing by short hairpin RNA or chemical blockade by PLX4032 Qualman SJ, Chandler DS, et al: NF-kappaB-YY1-miR-29 regulatory circuitry in leads to different responses in melanoma and thyroid carcinoma cells. skeletal myogenesis and rhabdomyosarcoma. Cancer Cell 2008, 14:369–381. Mol Cancer Res 2008, 6:751–759. 29. Fang JH, Zhou HC, Zeng C, Yang J, Liu Y, Huang X, Zhang JP, Guan XY, 10. Flaherty KT, Puzanov I, Kim KB, Ribas A, McArthur GA, Sosman JA, O'Dwyer PJ, Zhuang SM: MicroRNA-29b suppresses tumor angiogenesis, invasion, and Lee RJ, Grippo JF, Nolop K, Chapman PB: Inhibition of mutated, activated metastasis by regulating matrix metalloproteinase 2 expression. BRAF in metastatic melanoma. N Engl J Med 2010, 363:809–819. Hepatology 2011, 54:1729–1740. 11. Garbe C, Krasagakis K: Effects of interferons and cytokines on melanoma 30. Xiong Y, Fang JH, Yun JP, Yang J, Zhang Y, Jia WH, Zhuang SM: cells. J Invest Dermatol 1993, 100:239S–244S. Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis 12. Kortylewski M, Komyod W, Kauffmann ME, Bosserhoff A, Heinrich PC, of hepatocellular carcinoma. Hepatology 2010, 51:836–845. Behrmann I: Interferon-gamma-mediated growth regulation of 31. Zhao JJ, Lin J, Lwin T, Yang H, Guo J, Kong W, Dessureault S, Moscinski LC, melanoma cells: involvement of STAT1-dependent and STAT1- Rezania D, Dalton WS, et al: microRNA expression profile and independent signals. J Invest Dermatol 2004, 122:414–422. identification of miR-29 as a prognostic marker and pathogenetic 13. Reinsbach S, Nazarov P, Philippidou D, Schmitt M, Wienecke-Baldacchino factor by targeting CDK6 in mantle cell lymphoma. Blood 2010, A, Muller A, Vallar L, Behrmann I, Kreis S: Dynamic regulation of microRNA 115:2630–2639. expression following Interferon-γ-induced gene transcription. RNA Biol 32. Li Y, Wang F, Xu J, Ye F, Shen Y, Zhou J, Lu W, Wan X, Ma D, Xie X: Progressive 2012, 9:978–989. miRNA expression profiles in cervical carcinogenesis and identification of 14. Loffler D, Brocke-Heidrich K, Pfeifer G, Stocsits C, Hackermuller J, HPV-related target genes for miR-29. J Pathol 2011, 224:484–495. Kretzschmar AK, Burger R, Gramatzki M, Blumert C, Bauer K, et al: 33. Park SY, Lee JH, Ha M, Nam JW, Kim VN: miR-29 miRNAs activate p53 by Interleukin-6 dependent survival of multiple myeloma cells involves the targeting p85 alpha and CDC42. Nat Struct Mol Biol 2009, 16:23–29. Schmitt et al. Cell Communication and Signaling 2012, 10:41 Page 14 of 14 http://www.biosignaling.com/content/10/1/41 34. Garzon R, Liu S, Fabbri M, Liu Z, Heaphy CE, Callegari E, Schwind S, Pang J, microRNA target genes in human melanoma. Cancer Res 2010, Yu J, Muthusamy N, et al: MicroRNA-29b induces global DNA 70:4163–4173. hypomethylation and tumor suppressor gene reexpression in acute 55. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, myeloid leukemia by targeting directly DNMT3A and 3B and indirectly Speleman F: Accurate normalization of real-time quantitative RT-PCR DNMT1. Blood 2009, 113:6411–6418. data by geometric averaging of multiple internal control genes. 35. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Genome Biol 2002, 3. research0034.1-0034.11-0031-0034.0011. Cell 2004, 116:281–297. 56. Kreis S, Philippidou D, Margue C, Behrmann I: IL-24: a classic cytokine 36. Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, and/or a potential cure for cancer? J Cell Mol Med 2008, 12:2505–2510. Cigudosa JC, Croce CM, Fernandez-Piqueras J, Malumbres M: Genetic and 57. Haan C, Behrmann I: A cost effective non-commercial ECL-solution for epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 Western blot detections yielding strong signals and low background. oncogene expression. Cancer Cell 2008, 13:496–506. J Immunol Methods 2007, 318:11–19. 37. Roggli E, BritanA,Gattesco S,Lin-MarqN,AbderrahmaniA,MedaP,Regazzi R: Involvement of microRNAs in the cytotoxic effects exerted by doi:10.1186/1478-811X-10-41 proinflammatory cytokines on pancreatic beta-cells. Diabetes 2010, 59:978–986. Cite this article as: Schmitt et al.: Interferon-γ-induced activation of 38. Ruan W, Xu JM, Li SB, Yuan LQ, Dai RP: Effects of down-regulation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells. Cell microRNA-23a on TNF-alpha-induced endothelial cell apoptosis through Communication and Signaling 2012 10:41. caspase-dependent pathways. Cardiovasc Res 2012, 93:623–632. 39. Diamond MS, Kinder M, Matsushita H, Mashayekhi M, Dunn GP, Archambault JM, Lee H, Arthur CD, White JM, Kalinke U, et al: Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J Exp Med 2011, 208:1989–2003. 40. Dunn GP, Koebel CM, Schreiber RD: Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006, 6:836–848. 41. Schreiber RD, Old LJ, Smyth MJ: Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 2011, 331:1565–1570. 42. Zaidi MR, Davis S, Noonan FP, Graff-Cherry C, Hawley TS, Walker RL, Feigenbaum L, Fuchs E, Lyakh L, Young HA, et al: Interferon-gamma links ultraviolet radiation to melanomagenesis in mice. Nature 2011, 469:548–553. 43. Ma F, Xu S, Liu X, Zhang Q, Xu X, Liu M, Hua M, Li N, Yao H, Cao X: The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-gamma. Nat Immunol 2011, 12:861–869. 44. Smith KM, Guerau-de-Arellano M, Costinean S, Williams JL, Bottoni A, Mavrikis Cox G, Satoskar AR, Croce CM, Racke MK, Lovett-Racke AE, Whitacre CC: miR-29ab1 Deficiency Identifies a Negative Feedback Loop Controlling Th1 Bias That Is Dysregulated in Multiple Sclerosis. J Immunol 2012, 189:1567–1576. 45. Papadopoulou AS, Dooley J, Linterman MA, Pierson W, Ucar O, Kyewski B, Zuklys S, Hollander GA, Matthys P, Gray DH, et al: The thymic epithelial microRNA network elevates the threshold for infection-associated thymic involution via miR-29a mediated suppression of the IFN-alpha receptor. Nat Immunol 2012, 13:181–187. 46. Nguyen T, Kuo C, Nicholl MB, Sim MS, Turner RR, Morton DL, Hoon DS: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma. Epigenetics 2011, 6:388–394. 47. Ismail A, Bandla S, Reveiller M, Toia L, Zhou Z, Gooding WE, Kalatskaya I, Stein L, D'Souza M, Litle VR, et al: Early G(1) cyclin-dependent kinases as prognostic markers and potential therapeutic targets in esophageal adenocarcinoma. Clin Cancer Res 2011, 17:4513–4522. 48. Whiteway SL, Harris PS, Venkataraman S, Alimova I, Birks DK, Donson AM, Foreman NK, Vibhakar R: Inhibition of cyclin-dependent kinase 6 suppresses cell proliferation and enhances radiation sensitivity in medulloblastoma cells. J Neurooncol 2012, in press. 49. Grossel MJ, Hinds PW: From cell cycle to differentiation: an expanding role for cdk6. Cell Cycle 2006, 5:266–270. Submit your next manuscript to BioMed Central 50. Musat M, Vax VV, Borboli N, Gueorguiev M, Bonner S, Korbonits M, and take full advantage of: Grossman AB: Cell cycle dysregulation in pituitary oncogenesis. Front Horm Res 2004, 32:34–62. 51. Bennett DC: How to make a melanoma: what do we know of the primary • Convenient online submission clonal events? Pigment Cell Melanoma Res 2008, 21:27–38. • Thorough peer review 52. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PA, Ally DS, Sheahan • No space constraints or color figure charges MD, Clark WH Jr, Tucker MA, Dracopoli NC: Germline p16 mutations in familial melanoma. Nat Genet 1994, 8:15–21. • Immediate publication on acceptance 53. Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T: • Inclusion in PubMed, CAS, Scopus and Google Scholar MicroRNA expression profiling in prostate cancer. Cancer Res 2007, 67:6130–6135. • Research which is freely available for redistribution 54. Philippidou D, Schmitt M, Moser D, Margue C, Nazarov PV, Muller A, Vallar L, Nashan D, Behrmann I, Kreis S: Signatures of microRNAs and selected Submit your manuscript at www.biomedcentral.com/submit

Journal

Cell Communication and Signaling – Springer Journals

Published: Dec 17, 2012

There are no references for this article.