Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/unpaywall/sequence-specific-binding-protein-of-single-stranded-and-unimolecular-J0Yguwf7M9
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Unpaywall
- ISSN
- 0021-9258
- DOI
- 10.1074/jbc.272.25.15881
- Publisher site
- See Article on Publisher Site
Abstract
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 25, Issue of June 20, pp. 15881–15890, 1997 © 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Sequence-specific Binding Protein of Single-stranded and Unimolecular Quadruplex Telomeric DNA from Rat Hepatocytes* (Received for publication, February 10, 1997, and in revised form, April 16, 1997) Ronit Erlitzki and Michael Fry‡ From the Unit of Biochemistry, The Bruce Rappaport Faculty of Medicine, Technion-Israel Institute of Technology, P. O. Box 9649, Haifa 31096, Israel A rat liver nuclear protein, unimolecular quadruplex The telomere hypothesis of cellular aging and tumorigenesis telomere-binding protein 25, (uqTBP25) is described claims that progressive shortening of telomeres during the life that binds tightly and specifically single-stranded and span of somatic cells leads to the cessation of cell division and unimolecular tetraplex forms of the vertebrate telo- to cellular senescence (15). In contrast, by maintaining a stable meric DNA sequence 5*-d(TTAGGG) -3*. A near homoge- n length of either long or short telomeres, respectively, germ line neous uqTBP25 was purified by ammonium sulfate pre- cells and tumor cells avoid division cycle exit and continue to cipitation, chromatographic separation from other DNA divide infinitely (15). This hypothesis is sustained by data binding proteins, and three steps of column chromatog- showing that whereas telomeric DNA is progressively trimmed raphy. SDS-polyacrylamide gel electrophoresis and Su- in the course of the aging of diverse somatic cells, its length perdexr 200 gel filtration disclosed for uqTBP25 subunit persists in immortal germ line and cancer cells (Refs. 16 –19; and native M values of 25.4 6 0.5 and 25.0 kDa, respec- reviewed in Ref. 15). The progressive shortening of telomeres in tively. Sequences of uqTBP25 tryptic peptides were somatic cells and the contrasting maintenance of their length closely homologous, but not identical, to heterogeneous in indefinitely dividing cells is partly accounted for by their nuclear ribonucleoprotein A1, heterogeneous nuclear different levels of activity of telomerase, the telomeric ribonucleoprotein A2/B1, and single-stranded DNA- G-strand-extending enzyme. Whereas telomerase activity is binding proteins UP1 and HDP-1. Complexes of undetectable in numerous somatic tissues and in dividing pri- uqTBP25 with single-stranded or unimolecular quadru- mary cells, many cancer cells retain an active enzyme (Refs. plex 5*-d(TTAGGG) -3*, respectively, had dissociation 17–21; reviewed in Refs. 22 and 23). That telomerase does not constants, K , of 2.2 or 13.4 nM. Relative to d(TTAGGG) , d 4 exclusively determine telomere length is inferred, however, by complexes with 5*-r(UUAGGG) -3*, blunt-ended duplex the observation that some tumor cells whose telomere length telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher K values. Single base alterations remains stable have no measurable telomerase activity (24), within the d(TTAGGG) repeat increased the K of com- and conversely, an active telomerase is detected in normal bone plexes with uqTBP25 by 9 –215-fold. Association with marrow cells and blood cells (25). Further, the loss of 50 –200- uqTBP25 protected d(TTAGGG) against nuclease diges- nucleotide-long segments of telomeric DNA with each round of tion, suggesting a potential role for the protein in telo- replication of somatic cells (26 –28) suggests that exonucleolytic meric DNA transactions. degradation of the terminus of telomeric DNA may also con- tribute to its progressive trimming. It has been suggested, therefore, that telomeric DNA binding proteins that were iden- Linear eukaryotic chromosomes end with a specialized DNA- tified in diverse species may participate in the complex dynam- protein structure termed the telomere that guards the chromo- ics of elongation and shortening of telomeric DNA (4, 29). Some some terminus against degradative attack or fusion with ends such proteins from different species bind tightly single- of other chromosomes (1– 4). Telomeric DNA consists of evolu- stranded telomeric DNA (30 –33). Other proteins bind to or tionarily conserved short, tandemly repeated nucleotide se- mediate the formation of tetraplex forms of telomeric DNA quences. The telomeric DNA strand, oriented 59 to 39 toward (33– 42). Proteins of a third category selectively associate with the chromosome end (“G-strand”) in all vertebrates, slime the duplex region of telomeric DNA (43– 46). molds, filamentous fungi, and Trypanosoma, is a repeated 59- In this work we describe the purification from rat hepato- d(TTAGGG)-39 sequence paired to a complementary 59-d(C- cytes and characterization of a 25-kDa monomeric protein, CCTAA)-39 strand. At their 39-end, vertebrate telomeres termi- termed uqTBP25, that binds tightly and in a sequence-specific nate with a 12–16-nucleotide-long unpaired overhang of the fashion single-stranded and unimolecular tetraplex forms of G-strand (1–5). This single-stranded tract was shown to be the G-strand of telomeric DNA. A partial amino acid sequence capable of forming in vitro under physiological conditions a of uqTBP25 is closely homologous but not identical with se- hairpin or unimolecular or bimolecular tetrahelical structures quences of hnRNP A1 and hnRNP A2/B1 and their respective (5–14), which may have a role in telomere transactions (5). derivative single-stranded DNA-binding proteins UP1 and HDP-1. Protein uqTBP25 is distinguished from hnRNP A1 and A2/B1 by its molecular size, preferential binding to DNA over * This study was supported in part by grants (to M. F.) from the RNA, and sequence-specific binding to the telomeric DNA United States-Israel Binational Science Fund, the Council for Tobacco G-strand. This protein also differs from UP1 and HDP-1 by Research, the Israel Science Foundation, the Israel Cancer Association, and the Technion VPR Fund-Hedson Fund for Medical Research. The its selective binding to the G-strand of telomeric DNA and costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate The abbreviations used are: hnRNP, heterogenous nuclear ribonu- this fact. cleoprotein; HPLC, high pressure liquid chromatography; DTT, dithio- ‡ To whom correspondence should be addressed: Tel.: 972-4-829- threitol; MalNEt, N-ethylmaleimide; TEMED, N,N,N9,N9-tetramethyl- 5328; Fax: 972-4-851-0735. ethylenediamine; PAGE, polyacrylamide gel electrophoresis. This paper is available on line at http://www.jbc.org 15881 This is an Open Access article under the CC BY license. 15882 Sequence-specific Telomeric DNA-binding Protein TABLE I DNA and RNA oligomers used in this study Oligomer designation Length Nucleotide sequence TeR-5 38-mer 59-GTCGACCCGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA)-39 TeR-4 24-mer 59-d(TTAGGGTTAGGGTTAGGGTTAGGG)-39 TeR-3 23-mer 59-d(GTCGACCCGGGTTAGGGTTAGGG)-39 TeR-2 23-mer 59-d(TAGACATGTTAGGGTTAGGGTTA)-39 TeR-1 17-mer 59-d(TAGACATGTTAGGGTTA)-39 rTeR-4 24-mer 59-r(UUAGGGUUAGGGUUAGGGUUAGGG)-39 TeR-4 C 24-mer 59-d(CCCTAACCCTAACCCTTACCCTTA)-39 TeR-3 C 23-mer 59-d(CCCTAACCCTAACCCGGGTCGAC)-39 a c TeT-4 , 24-mer 59-d(GGGGTTGGGGTTGGGGTTGGGGTT)-39 a c TeT-2 , 23-mer 59-d(TAGACATGTTGGGGTTGGGGTTG)-39 Mut1 TeR-4 24-mer 59-d(TTAGAGTTAGAGTTAGAGTTAGAG)-39 Mut2 TeR-4 24-mer 59-d(TAAGGGTAAGGGTAAGGGTAAGGG)-39 Hook TeR-4 32-mer 59-d(CTGGACCCGGGTTAGGGTTAGGGTTAGGGTTA)-39 Hook TeR-4 C 29-mer 59-d(TAACCCTAACCCTAACCCTAACCCGGGTC)-39 Q 20-mer 59-d(TACAGGGGAGCTGGGGTAGA)-39 Single Q 7-mer 59-(TTGGGT)-39 Anti-Q 20-mer 59-d(TCTACCCCAGCTCCCCTGTA)-39 Clusters of guanine residues are underlined. Clusters of cytosine residues are underlined. Loci of a substituted nucleotide relative to TeR-4 DNA are doubly underlined. parallel quadruplex form of d(CGG) was prepared, and its structure by its failure to significantly stimulate the activity of DNA 8 was verified as previously detailed (49). polymerase a. Electrophoretic Mobility Shift Assays, SDS-PAGE, and Southwestern EXPERIMENTAL PROCEDURES Blotting—The DNA binding activity of uqTBP25 was monitored by 32 electrophoretic mobility shift assay as we described previously (33, 50). Materials and Enzymes—Radioactively 59-labeled [g- P]ATP 32 In a typical assay for the binding of single-stranded TeR-4 or TeR-2 (;3000 Ci/mmol), [a- P]dGTP (;3000 Ci/mmol), Klenow fragment of DNA, 5.0 –15.0 ng of P-59-labeled TeR-2 or TeR-4 DNA was incubated Escherichia coli polymerase I, and molecular mass Rainbowy marker at 4 °C for 20 min with 30 –3000 ng of purified or crude protein fraction proteins were products of Amersham Corp. Synthetic DNA oligomers, in a 15-ml final volume of buffer D (0.5 mM EDTA, 20% glycerol in 25 mM listed in Table I, were purchased from Operon Technologies. The HPLC- Tris-HCl buffer, pH 7.5). The binding mixture was electrophoresed in a purified RNA oligomer r(UUAGGG) (Table I) was a product of Midland Mini PROTEAN II electrophoresis system (Bio-Rad) at 4 °C under 10 Reagent. Boric acid, b-mercaptoethanol, dithiothreitol (DTT), N-ethyl- V/cm through a nondenaturing 6% polyacrylamide gel (acryl/bisacryl- maleimide (MalNEt), poly(dG)zpoly(dC), thymidine 39,59-diphosphate, amide, 30:1.2) in 0.6 3 TBE buffer (1.2 mM EDTA in 0.54 M Tris borate dimethyl sulfate, leupeptin, aprotinin, benzamidine, phenylmethylsul- buffer, pH 8.3) until a bromphenol blue tracking dye migrated 2.5– 4.0 fonyl fluoride, Nonidet P-40, Sephadex G-50, phenyl-Sepharose, pro- cm into the gel. The gels were dried on DE-81 filter paper and exposed teinase K, salmon sperm DNA, soybean trypsin inhibitor, and micro- to x-ray film or to a phosphor imaging plate (Fuji). The proportion of coccal nuclease were supplied by Sigma. DEAE-cellulose (DE-52) and free and uqTBP25-bound TeR DNA was determined by phosphor imag- DE-81 filter paper were the products of Whatman. Total RNA from ing, and their amounts were deduced from the known specific activity of yeast was supplied by Boehringer Mannheim. Bacteriophage T4 the labeled DNA probe. One unit of uqTBP25 DNA binding activity was polynucleotide kinase and RNasin were provided by Promega. Acryl/ defined as the amount of uqTBP25 that bound 66 pmol of single- bisacrylamide (19:1 or 30:1.2) was purchased from Amresco. Bacteri- stranded TeR-2 DNA under the described standard conditions. Stand- ophage T4 gene 32 protein was purchased from Boehringer Mannheim. ard assay conditions were also employed for the binding of tetramolecu- Immunoaffinity-purified calf thymus DNA polymerase a was the gift of lar G4 quadruplex DNA and of double-stranded DNA. Binding of Dr. L. A. Loeb (University of Washington). Kodak XAR5 and Biomax tetraplex G92 TeR DNA or G94 TeR DNA was assayed as described MR-1 autoradiographic film, urea, TEMED, bromphenol blue, and xy- above except that 50 mM KCl or 50 mM NaCl, respectively, was added to lene cyanol FF were supplied by IBI. HiTrap Blue HPLC column and the DNA binding mixture to preserve the quadruplex structure of the Superdexr 200 HPLC gel filtration column were provided by Pharmacia DNA, the 0.6 3 TBE gel running buffer contained 50 mM KCl or 50 mM Biotech Inc. Econo-Pac S HPLC cartridge, reagents for sodium dodecyl NaCl as necessary, and electrophoresis was performed at 4 °C. sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and molecular SDS-PAGE and silver or Coomassie Blue staining of resolved protein weight protein standards were the products of Bio-Rad. Novex provided bands was carried out as we described previously (50). Molecular size Multimarky molecular size protein standards. Biotrace polyvinylidene protein markers were the Amersham Rainbowy, Novex Multimarky, difluoride binding matrix membranes were supplied by Gelman or Bio-Rad prestained or unstained molecular weight standards. Sciences. Southwestern analysis was conducted according to Petracek et al. Preparation of Single-stranded, Double-stranded, and Tetraplex (31) with the minor modifications that we recently introduced (33). DNA Oligomers—Full-length DNA oligomers were purified by electro- TeR-4 DNA binding activity was detected in nuclear extracts by expos- phoresis through a 8 M urea, 15% polyacrylamide denaturing gel (acryl/ ing the electrophoretically resolved proteins to 0.85 mgof P-59-labeled bisacrylamide, 19:1) as we described (47). The purified DNA or RNA TeR-4 DNA in the presence of 50 mM NaCl. oligomers were labeled at their 59-end with P in a bacteriophage T4 Purification of uqTBP25—In a typical preparation, protein uqTBP25 polynucleotide kinase-catalyzed reaction (48). Oligomers were main- was purified to near homogeneity from ;700 g of liver tissue from adult tained in their single-stranded conformation as a 0.25– 0.70 mM solution rats. Salt extracts of nonhistone nuclear proteins were prepared from in 1.0 mM EDTA, 10 mM Tris-HCl buffer, pH 8.0 (TE buffer), and were isolated hepatocyte nuclei as we described elsewhere (52), except that boiled immediately prior to use. Double-stranded telomeric DNA was the composition of the extraction buffer was 0.4 M NaCl, 1 mM phenyl- prepared by annealing a 1.25-fold molar excess of a cytosine-rich se- methylsulfonyl fluoride, 0.1 mM benzamidine, and 10 mg/ml each of the quence with a complementary guanine-rich oligomer, and duplex DNA protease inhibitors soybean trypsin inhibitor, leupeptin, and aprotinin molecules were electrophoretically resolved from residual DNA single in buffer D. The preparation of protein extracts and all of the subse- strands as we described (33). Labeling of a protruding end of the annealed duplex DNA was catalyzed by the Klenow fragment of E. coli quent steps of uqTBP25 purification were conducted at 4 °C. Electro- polymerase I using 59-[a- P]dGTP as we described previously (47). phoretic mobility shift assays and Southwestern analysis showed that Unimolecular (G94) and bimolecular (G92) tetraplex forms of TeR DNA rat liver nuclear extracts contained G94 TeR-4 DNA binding activity were prepared, their stoichiometry was verified, and their stabilization with an approximate molecular size of 24 kDa (see “Results”). This by Hoogsteen bonds was demonstrated, as we described in detail else- protein was further purified by successive steps of ammonium sulfate where (33). Parallel G4 quadruplex forms of oligomers Q and single Q precipitation and column chromatography. Elution profiles of the DNA were prepared according to Sen and Gilbert (48), and their stoichiom- binding activity from the various columns, as assessed by electro- etry was shown to be tetramolecular as recently described (33). The phoretic mobility shift analysis were identical when P-59-labeled sin- Sequence-specific Telomeric DNA-binding Protein 15883 gle-stranded TeR-2 or TeR-4 DNA or unimolecular tetraplex G94 TeR-4 months. DNA were used as probes. In an initial purification step, extract pro- Measurement of the Effect of uqTBP25 on Polymerase a-Catalyzed teins were precipitated by 50% ammonium sulfate and removed by DNA Synthesis—DNA synthesis was conducted for 30 min at 37 °C in a centrifugation. The majority of the TeR DNA binding activity that reaction mixture that contained in a final volume of 25 ml: 20 mM remained in the supernatant was subsequently precipitated by 70% Tris-HCl buffer, pH 7.5, 3.0 mM MgCl , 1.0 mM DTT, 2.1 units of ammonium sulfate. The 70% ammonium sulfate precipitate was resus- immunoaffinity-purified calf thymus DNA polymerase a. The DNA pended in buffer D and was dialyzed overnight at 4 °C against ;200 primer-templates and dNTP substrates were either 1.0 mgof volumes of the same buffer. After adding NaCl to the dialyzed protein poly(dG)zpoly(dC) and 25 mM [a- P]dGTP (specific activity 5,450 cpm/ fraction to a final concentration of 50 mM, it was mixed with heat- pmol) or 0.5 mg of bacteriophage M13mp2 single-stranded DNA primed denatured salmon sperm DNA and incubated for 20 min at 4 °C at a by a 17-mer universal primer and 25 mM concentration of each of the protein:DNA ratio of 30:1 (w/w). Whereas the major TeR-binding pro- four dNTPs and [a- P]dGTP (specific activity 1260 cpm/pmol). Increas- tein qTBP42 (33) and additional single-stranded DNA-binding proteins ing amounts of phenyl-Sepharose-purified uqTBP25 were added to the associated tightly with the denatured DNA, uqTBP25 did not bind reaction mixtures as detailed under “Results.” DNA synthesis was detectably to it. The strong binding of DNA and DNA-protein complexes terminated, acid-insoluble DNA was precipitated, and incorporation of to DEAE-cellulose (53) was subsequently utilized to separate uqTBP25 [ P]dGMP into DNA was measured as described previously (53). from qTBP42 (33) and from additional proteins that associated with Determination of the Amounts of Protein—The Bio-Rad protein assay denatured DNA. The protein-DNA mixture was loaded at a ratio of 4.0 kit was used to determine amounts of protein. mg of protein/ml of packed resin, onto a DE-52 column equilibrated in buffer D containing 50 mM NaCl. The protein-loaded column was RESULTS washed with 0.5 and subsequently with 1.5 packed column volumes of Purification of the Telomeric DNA-binding Protein the equilibration buffer, and bound proteins were eluted by two packed uqTBP25—Activities that bind single-stranded and tetraplex column volumes each of 100 and 225 mM NaCl in buffer D. Electro- phoretic mobility shift analysis and SDS-PAGE separation of UV cross- forms of the vertebrate telomeric sequence TeR-4, 59-d(T- linked TeR-4 DNA-protein complexes, respectively, revealed TeR-4 TAGGG) -39, were detected by electrophoretic mobility shift DNA binding activity and UV cross-linked TeR-4 DNA-protein com- analysis in extracts of nonhistone nuclear proteins from rat plexes of 34 kDa in the 50 mM NaCl wash fractions. Similar analysis did hepatocyte. Southwestern analysis of the unimolecular tetra- not reveal DNA-protein complexes in the 100 mM NaCl fraction; in- plex G94 TeR-4 DNA binding activity detected in replicate stead, multiple complex bands, the dominant of which was qTBP42 (33), nuclear extracts a major protein-G94 TeR-4 DNA complex band were present in the 225 mM NaCl eluate. The 50 mM NaCl eluate fractions were pooled together and dialyzed overnight against ;50 of ;24 kDa and two minor bands of 31 and 33 kDa, respectively volumes of buffer P (0.5 mM EDTA, 20% glycerol in 25 mM NaPO 4 (for a typical analysis, see Fig. 1A). To isolate the ;24-kDa buffer, pH 7.0). The dialyzed fractions were loaded at a ratio of 24.0 mg binding activity, the nuclear extract was initially fractionated of protein/ml of packed resin onto a 5.0-ml Econo-Pac S column equili- by ammonium sulfate precipitation. The major portion of an brated in buffer P and mounted on a GradiFrac low pressure chroma- activity that bound single-stranded TeR-4 or unimolecular tet- tography device (Pharmacia). The loaded column was washed with 7.5 raplex G94 TeR-4 DNA was detected by electrophoretic mobility packed resin volumes of buffer P, and bound proteins were eluted from the column by a linear gradient of 19.5 column volumes of 0.0 –1.0 M shift analysis in the 50 –70% (NH ) SO precipitate. To resolve 4 2 4 NaCl in buffer P. Fifty fractions were collected, and as done in every TeR DNA-specific binding activity from other proteins that subsequent chromatography, aliquots were dialyzed overnight against bind nonspecifically to single-stranded DNA, the resuspended 150 volumes of buffer D and then assayed for G94 TeR-4 DNA binding. and dialyzed 70% ammonium sulfate precipitate was incubated G94 TeR-4 DNA binding activity of uqTBP25 was detected in the 150 – with denatured salmon sperm DNA and than chromatographed 320 mM NaCl eluate both by electrophoretic mobility shift analysis and on a DE-52 column. DNA and DNA-protein complexes strongly by the identification in SDS-PAGE of a ;34-kDa UV-cross-linked pro- tein-TeR-4 DNA complex. The active fractions were pooled together, adsorb to the anion exchanger, whereas some proteins that do dialyzed overnight against 150 volumes of P2 buffer (0.5 mM EDTA, not bind to denatured DNA adsorb weakly to DE-52 (53). Elec- 20% glycerol in 10 mM NaPO , pH 7.0), and loaded at a ratio of 8.5 mg trophoretic mobility shift analysis of G94 TeR-4 DNA binding of protein/ml of packed resin onto a 1.0-ml HiTrap Blue HPLC column activity and SDS-PAGE resolution of UV-cross-linked protein- equilibrated in P2 buffer and mounted on a GradiFrac device. The G94 TeR-4 DNA complexes revealed an electrophoretically re- loaded column was washed by six column volumes of the equilibration tarded 34-kDa complex band in fractions that were eluted from buffer, and adsorbed proteins were eluted by a 21-packed column vol- ume linear gradient of 0.0 – 4.0 M NaCl in P2 buffer. Fifty fractions were DE-52 by 50 mM NaCl (see “Experimental Procedures”). Sev- collected, aliquots were dialyzed, and uqTBP25 binding activity was eral additional proteins, including qTBP42 (33), that formed detected by electrophoretic mobility shift analysis and SDS-PAGE of complexes with denatured DNA and tightly adsorbed to DE-52 UV cross-linked protein-TeR-4 DNA complexes in fractions that were were eluted from the column by 225 mM NaCl (see “Experimen- eluted from HiTrap Blue by 2.5–3.5 M NaCl. Fractions containing the tal Procedures”). The TeR-4 DNA binding activity that was binding activity were pooled together and dialyzed overnight against eluted from DE-52 by 50 mM NaCl was further purified by ;50 volumes of 4.0 M NaCl in buffer S (1.0 mM EDTA in 25 mM Tris-HCl buffer, pH 7.5) and loaded at a ratio of 1.0 mg of protein:1.0 ml of packed successive steps of chromatography on columns of Econo-Pac S, resin onto a phenyl-Sepharose column equilibrated in buffer S. The HiTrap Blue and phenyl-Sepharose. Elution profiles of the TeR loaded column was washed with two packed column volumes of the DNA binding activity from the different columns, as revealed equilibration buffer, and bound proteins were eluted by a stepwise by electrophoretic mobility shift analysis were identical when gradient of 4.0 – 0.0 M NaCl in buffer S followed by a 40% ethylene glycol P-59-labeled single-stranded TeR-2 or unimolecular tetraplex wash to elute proteins that remained adsorbed to phenyl-Sepharose at 0.0 M NaCl. Fractions were collected into Nonidet P-40 (0.05% final G94 TeR-4 DNA were used as probes. SDS-PAGE resolution of concentration), and the activity of uqTBP25 was detected in fractions proteins in the different fractions, and their silver staining that were eluted from the phenyl-Sepharose column by 1.0 – 0.5 M NaCl. demonstrated a progressive depletion of proteins in the course Silver and Coomassie Blue staining of the eluted proteins indicated that of uqTBP25 purification (Fig. 1B). Note a 25-kDa protein band a 25-kDa species was the major protein eluted by 1.0 – 0.5 M NaCl (Fig. that became discernible in the HiTrap Blue fraction of 2C), whereas the majority of the proteins that were loaded onto the uqTBP25 (Fig. 1B). The intensity of Coomassie Blue staining of column were eluted by 40% ethylene glycol. Determination of the pro- tein content of the collected fractions and silver or Coomassie Blue this 25-kDa protein band was directly proportional to the level staining of SDS-PAGE-resolved protein bands was directly performed of TeR-4 DNA binding activity in the HiTrap Blue fractions on fractions that were dialyzed against water. Fractions that were used (results not shown). This protein became highly enriched after for the assay of DNA binding activity were stabilized by the immediate phenyl-Sepharose purification (Fig. 1B). addition soybean trypsin inhibitor protein (200 mg/ml final concentra- Results shown in Fig. 2 indicated that the 25-kDa protein tion), and following their dialysis overnight against ;200 volumes of band, which was purified to near homogeneity by phenyl- buffer D, they were stored in aliquots at 280 °C. Under these storage conditions, the DNA binding activity was fully preserved for at least 4 Sepharose chromatography, corresponded to the TeR DNA 15884 Sequence-specific Telomeric DNA-binding Protein tion by SDS, and sensitivity to proteinase K. The resistance of uqTBP25 to digestion by micrococcal nuclease (Table III) sug- gested that it did not require an essential nucleic acid compo- nent. Binding of TeR-4 DNA by uqTBP25 was not affected by exposure to 8.5 mM MalNEt (Table III), indicating that reduced protein sulfhydryl groups were not directly involved in the protein interaction with DNA. This was also corroborated by the equally efficient renaturation of the 25-kDa protein in Southwestern blotting with or without the presence of b-mer- captoethanol (Fig. 1A). The highly purified uqTBP25 migrated in SDS-PAGE as a 25.4 6 0.4-kDa polypeptide (n 5 6). An apparent molecular size of 25.0 kDa (n 5 2), which was found for native uqTBP25 by Superdex 200r gel filtration, suggested that uqTBP25 was a 25-kDa monomeric protein. Sequence Homology among uqTBP25, Two hnRNP Species, and Their Derivative Single-stranded DNA-binding Pro- teins—To find out whether or not uqTBP25 represented a known protein, sequences of five tryptic peptides of uqTBP25 TM were determined. A computerized search through GenBank revealed all five uqTBP25 peptide sequences to be closely ho- mologous, although not identical, to conserved amino acid se- quences in hnRNP A1 and A2/B1 and in their derivative amino- terminal proteolytic fragments, calf thymus single-stranded FIG.1. Southwestern analysis of G*4 TeR-4 DNA binding activ- ity in nuclear extract and protein purification. A, Southwestern DNA-binding proteins UP1 (58, 61, 64) and mouse HDP-1 (58, blotting of unimolecular tetraplex G94 TeR-4 DNA binding activity in 64), respectively. The sequence of hnRNP A1 that remained nuclear extract from rat hepatocyte. Aliquots of nonhistone nuclear identical in four mammalian species (Table IV) and of its cog- protein extract from rat hepatocytes were either boiled in the presence nate single-stranded binding protein UP1 (58, 61, 64) differed of 85 mM b-mercaptoethanol (b-ME) or were left untreated and without b-mercaptoethanol. The protein samples were electrophoresed through from the corresponding partial sequence of uqTBP25 by 4 an SDS-10% polyacrylamide gel, the resolved proteins were renatured amino acids out of 43 sequenced residues. One dissimilar and exposed to P-59-labeled TeR-4 DNA in the presence of 50 mM amino acid represented a nonconservative G to Q substitution NaCl, and unbound probe was washed (see “Experimental Procedures”). in uqTBP25 peptide IV (Table IV). Most notable, amino acid Shown is an autoradiogram of the dried blotted gel. An arrow marks the position of a major G94 TeR-4 DNA-binding protein band of ;24 kDa. B, sequences of uqTBP25 were clearly distinct from those of SDS-PAGE analysis of proteins in successively purified fractions of cloned rat hnRNP A1 and of rat UP1 (Table IV; Refs. 61 and uqTBP25. Approximately 6 mg of protein of crude nuclear extract and of 62). The dissimilarity between uqTBP25 and rat hnRNP A1 each partially purified fraction of uqTBP25 were electrophoresed extended to their different molecular sizes of 25 and 34.2 kDa, through an SDS-13% polyacrylamide gel, and the resolved protein bands were stained with silver (see “Experimental Procedures”). A respectively (see above, under “Results”; Ref. 61), and uqTBP25 25-kDa protein band that became detectable in the HiTrap Blue frac- differed from both hnRNP A1 and UP1 by its nucleic acid tion and was enriched in the phenyl-Sepharose fraction is marked with binding preferences (see below, under “Results” and “Discus- an arrow. sion”). Hence, despite their close sequence similarity, uqTBP25, hnRNP A1, and UP1 was each a distinct protein. An binding activity. As seen in Fig. 2A, TeR-4 DNA binding activ- extensive sequence similarity was also found for uqTBP25 and ity was detected by mobility shift electrophoresis in phenyl- human hnRNP A2/B1 (Table IV) and its derivative fragment, Sepharose fractions 10 –14 (1.0 – 0.5 M NaCl eluate). Covalent the DNA-binding protein HDP-1 (58, 64). However, six amino UV cross-linking of labeled DNA to the phenyl-Sepharose-re- acid alterations were noted among the 43 sequenced uqTBP25 solved proteins revealed in fractions 10 –14 a 34-kDa protein- residues, two of which, E to A and N to A in uqTBP25 peptide TeR-4 DNA complex (Fig. 2B), whose amount corresponded to V, constituted nonconservative substitutions (Table IV). Differ- the TeR DNA binding activity (Fig. 2A). Finally, SDS-PAGE ences between rat uqTBP25 and human hnRNP A2/B1 also resolution of the phenyl-Sepharose protein fractions showed extended to their different molecular sizes of 25 and 36 –37.4 that the intensity of a Coomassie Blue-stained 25-kDa band, kDa, respectively (Table IV; Ref. 54), and both hnRNP A2/B1 which constituted .80% of the protein content of fractions and HDP-1 differed from uqTBP25 by their nucleic acid bind- 11–13 (Fig. 2C) was well correlated with the level of TeR-4 ing specificity (see below, under “Results” and “Discussion”). DNA binding activity in fractions 10 –14 (Fig. 2A) and with the Sequence Specificity of the Binding of TeR DNA by amount of the UV-cross-linked TeR-4-protein complex in these uqTBP25—The sequence specificity of binding of DNA by fractions (Fig. 2B). The ;25-kDa size of the unimolecular tet- uqTBP25 was first assessed by measurements of the relative raplex G94 TeR-4 DNA binding activity as detected in nuclear association of the protein with P-59-labeled TeR-2 DNA in the extracts by Southwestern analysis (Fig. 1A) as well as the presence of a 50 or 75-fold molar excess of different unlabeled 25-kDa molecular mass of the highly purified active protein competing DNA sequences. Results summarized in Table V (Fig. 2C) and the 34-kDa size of its complex with TeR-4 DNA (Fig. 2B) strongly suggested that the 25-kDa protein repre- indicated that the binding of single-stranded TeR-2 DNA was not diminished significantly when a 50-fold molar excess of sented uqTBP25. Details of a typical purification scheme sum- marized in Table II indicated that, relative to crude nuclear various unlabeled single-stranded DNA sequences was pres- ent. Similar results were obtained in reactions that contained a extract, the phenyl-Sepharose fraction of uqTBP25 was puri- fied more than 1000-fold with a final yield of 2.2%. 75-fold molar excess of the competing sequences over TeR-2 Chemical-Physical Properties of uqTBP25—Some properties DNA (data not shown). Notably, DNA sequences that did or did of uqTBP25 are presented in Table III. That uqTBP25 was not contain guanine clusters were similarly ineffective as com- proteinaceous was demonstrated by its heat lability, inactiva- petitors with TeR-2 DNA. Hence, the guanine-rich oligomers Sequence-specific Telomeric DNA-binding Protein 15885 TABLE II Purification of uqTBP25 The total volume of each fraction obtained in a typical purification procedure of uqTBP25 as well as its protein content and TeR-2 DNA binding activity were measured as described under “Experimental Pro- cedures” except that the assay of P-59-labeled TeR-2 binding was performed in the presence of a 25-fold molar excess of the nonspecific DNA competitor d(C-T) . This competitor DNA associated in crude fractions with DNA-binding proteins other than uqTBP25 but did not significantly bind to uqTBP25 (see Table IV). Total Binding Specific Purification step Yield Purification protein activity activity 3 3 mg units 3 10 units 3 10 /mg % -fold Crude nuclear 12,400.0 3,100.0 0.25 100.0 1.0 extract Ammonium 1,296.0 896.0 0.69 28.9 2.8 sulfate DNA-DEAE 480.0 393.6 0.82 12.7 3.3 cellulose Econo-Pac S 42.83 215.4 5.03 6.9 20.1 HiTrap Blue 5.81 77.3 13.30 2.5 53.2 Phenyl-Sepharose 0.26 69.6 267.70 2.2 1070.8 TABLE III Properties of uqTBP25 Binding of P-59-labeled TeR-4 by phenyl-Sepharose-purified uqTBP25 was conducted under standard conditions without or with the indicated treatments. The uqTBP25-G94 TeR-4 DNA complex was resolved by mobility shift electrophoresis, and its amount was quantified by phosphor imaging. Treatment Percentage of initial activity None 100.0 100 °C, 2 min 52.1 100 °C, 8 min 20.5 Proteinase K digestion 1.5 0.25% SDS 0.0 Micrococcal nuclease 120.6 8.5 mM MalNEt 98.0 uqTBP25 protein (5.9 binding units) was incubated at 37 °C for 60 min with 26.7 mg/ml proteinase K and than incubated with P-59- labeled G94 TeR-4 DNA. Shown is an average result of four independent determinations. uqTBP25 protein (9.2 binding units) was incubated at 37 °C for 50 min with 15.0 mg/ml micrococcal nuclease in the presence of 1.0 mM CaCl . Digestion was terminated by the addition of EGTA and thymi- dine 39,59-diphosphate to final concentrations of 5.0 and 4.0 mM, respec- tively, and the treated protein was incubated with P-59-labeled G94 TeR-4 DNA. Shown is an average result of six determinations. uqTBP25 protein (2.5 binding units) was incubated at 4 °C for 15 min with 8.5 mM MalNEt, and the reaction was terminated by the addi- tion of 15.0 mM DTT. The average result of three experiments is shown. d(G) , the fragile X syndrome expanded sequence d(CGG) , 16 8 FIG.2. TeR-4 DNA binding activity and SDS-PAGE of proteins Tetrahymena telomeric TeT G-strand DNA, and the IgG switch in phenyl-Sepharose-purified fractions of uqTBP25. A HiTrap region sequence oligomer Q did not compete efficiently with Blue-purified fraction of uqTBP25 (1.3 mg of protein) was loaded onto a TeR-2 DNA upon its binding to uqTBP25 (Table V). As a result column of phenyl-Sepharose (1.3-ml packed volume), proteins were eluted by a stepwise gradient of 4.0 – 0.0 M NaCl, and fractions were of quantitative annealing under the standard binding condi- collected into 0.05% Nonidet P-40 (final concentration) as described tions of TeR-4 C DNA to TeR-4 DNA (Ref. 66; our results), the under “Experimental Procedures.” A, mobility shift electrophoresis of labeled single-stranded TeR-4 DNA was eliminated from the fractions resolved by phenyl-Sepharose. Fractions were assayed for reaction, and the efficacy of TeR-4 C DNA as a competitor could P-59-labeled G94 TeR-4 DNA binding activity as detailed under “Ex- perimental Procedures.” B, SDS-PAGE of UV-cross-linked phenyl- not be assessed. However, a direct binding assay failed to Sepharose-resolved proteins. To bind G94 TeR-4 DNA to uqTBP25, reveal the formation of a detectable complex between uqTBP25 6.0-ml aliquots of each phenyl-Sepharose-resolved fraction were incu- and P-59-labeled TeR-4 C DNA when the labeled probe was bated at 4 °C for 15 min with 1.05 pmol of P-59-labeled G94 TeR-4 DNA added at concentrations of up to 560 nM (results not shown). in the presence of 50 mM NaCl in a final volume of 15.0 ml. Protein-DNA complexes were covalently cross-linked by irradiating the samples at Hence, unlike the recently described qTBP42 (33), uqTBP25 4 °C for 5 min in a microtiter plate at a distance of 6 cm from a UVP did not measurably bind to the cytosine-rich telomeric DNA (San Gabriel, CA) UV light source (254 nm, 580 microwatts/cm at 6 strand. An excess of yeast total RNA also failed to compete with inches). The irradiated samples were electrophoresed through an SDS, TeR-2 DNA upon binding to uqTBP25 (Table V), and a direct 13% polyacrylamide gel, which was dried and exposed to autoradio- graphic film. The position of a 34-kDa protein-DNA complex present in binding assay did not detect complex formation between fractions 10 –14 is marked with an arrow. C, Coomassie Blue staining of uqTBP25 and labeled yeast total RNA at up to 200 nM (results SDS-PAGE-resolved phenyl-Sepharose proteins. Electrophoresis and not shown). protein staining were conducted as described under “Experimental To assess more precisely the DNA sequence specificity and Procedures.” An arrow marks the position of the 25-kDa band that was structure specificity of DNA binding by uqTBP25, we deter- eluted into fractions 10 –14. 15886 Sequence-specific Telomeric DNA-binding Protein TABLE IV TABLE V Amino acid sequences of tryptic peptides of uqTBP25 and of Specificity of binding of P-59-labeled TeR-2 DNA by uqTBP25 homologous proteins Protein uqTBP25 (2.5 units) was incubated under standard binding Phenyl-Sepharose-purified uqTBP25 was resolved by SDS-PAGE, conditions with 2.1 pmol of P-59-labeled TeR-2 DNA with or without a and the Coomassie Blue-stained 25-kDa band was excised from the gel, 50-fold molar excess of the listed unlabeled competitor DNA sequences. extracted, and digested by trypsin. Amino acid sequences of select Complexes of uqTBP25 with the labeled TeR-2 DNA were resolved by HPLC-resolved tryptic peptides were determined by standard sequenc- mobility shift electrophoresis and quantified by phosphor imaging. Re- ing technique. The underlined areas mark homologies between the sults are presented as percentage of binding of P-59-labeled Ter-2 uqTBP25 peptides and hnRNP sequences as delineated by a computer- DNA in the presence of competing DNA relative to its binding in the ized search through the GenBank™ sequence data base. absence of competitor DNA. The number of independent determinations for each competing DNA ligand (n) is indicated in parenthesis. In uqTBP25 and homologue Amino acid sequence Reference control determinations under the same experimental conditions, the protein-derived peptides binding of P-59-labeled TeR-2 DNA to uqTBP25 in the presence of an uqTBP25 peptide I equimolar amount of unlabeled TeR-2 DNA was decreased to 50.3 6 IFVGGIK 9.0% (n 5 11). Human hnRNP A2/B1 54,55 LFVGGIK Human hnRNP A1 56,57 IFVGGIK Unlabeled competitor DNA Percentage of initial activity Bovine hnRNP A1 58,59 IFVGGIK (50-fold molar excess) (n) Mouse hnRNPA1 60 IFVGGIK ;d(A) ; 78.2 6 18.2(5) Rat hnRNPA1 61,62 16 IFVGGIK ;d(T) ; 72.9 6 3.7 (4) Xenopus laevis hnRNP A1 63 IFVGGIK ;d(G) ; 76.2 6 12.5(4) ;d(C) ; 82.3 6 15.3(4) uqTBP25 peptide II DYFEQYGK ;d(G-A) ; 79.5 6 16.5(4) Human hnRNP A2/B1 DYFEEYGK 54,55 d(G-C) 77.3 6 18.2(4) Human hnRNP A1 DYFEQYGK 56,57 d(C-T) 71.5 6 13.8(4) Bovine hnRNP A1 DYFEQYGK 58,59 d(CGG) 85.0 6 8.6 (4) Mouse hnRNP A1 DYFEQYGK 60 d(GCC) 76.5 6 11.3(5) Rat hnRNP A1 DYFEQYGK 61,62 TeT-4 95.7 6 21.3(3) X. laevis hnRNP A1 EYFEQYGK 63 Q 68.5 6 4.0 (3) Anti-Q 122.4 6 5.4 (2) uqTBP25 peptide III IVLQK Total yeast RNA 105.9 6 4.6 (4) Human hnRNP A2/B1 54,55 IVLQK The designation ; marks an EcoRI recognition sequence AATTC Human hnRNP A1 56,57 IVIQK and G, respectively, at the 59- and 39-ends of the competing oligomers. Bovine hnRNP A1 58,59 IVIQK The full sequence of these oligonucleotides is presented in Table I. Mouse hnRNP A1 60 IVIQK Based on an average molecular size of 6.5 kDa as determined by Rat hnRNP A1 61,62 IVIQK PAGE, the RNA was added at a 25-fold molar excess over TeR-2 DNA. X. laevis hnRNP A1 63 IVIQK with different structures of TeR DNA or with oligomers closely uqTBP25 peptide IV SGKPGAHVTVK Human hnRNP A2/B1 SGKPGAHVTVK 54,55 homologous to the telomeric sequence. Apparently, complexes Human hnRNP A1 SQRPGAHLTVK 56,57 of uqTBP25 with single-stranded telomeric sequences that con- Bovine hnRNP A1 SQRPGAHLTVK 58,59 tained two or more d(TTAGGG) clusters had nanomolar range Mouse hnRNP A1 SQRPGAHLTVK 60 dissociation constants (Table VI). However, a complex of Rat hnRNP A1 SQRPGAHLTVK 61,62 uqTBP25 with an oligomer that contained a single d(TTAGGG) X. laevis hnRNP A1 SSRPGAHLTVK 63 cluster had a dissociation constant 8.5- or 12.5-fold higher than uqTBP25 peptide V (T)(V)(E)EVDAAMNAR the K values of complexes with oligomers that had two or four Human hnRNP A2/B1 54,55 S M A EVDAAMAAR telomeric repeat units, respectively (Table VI). As shown in Human hnRNP A1 56,57 T V E EVDAAMNAR Table VI, binding of TeR DNA by uqTBP25 was highly se- Bovine hnRNP A1 58,59 T V E EVDAAMNAR quence-specific, such that complexes of uqTBP25 with oli- Mouse hnRNP A1 60 T V E EVDAAMNAR gomers that contained single base substitutions within the Rat hnRNP A1 61,62 T V E EVDAAMNAR TeR-4 DNA repeat unit had considerably elevated K values. X. laevis hnRNP A1 63 S T D EVDAAMTAR d Substituting the single adenosine residue, d(TTAGGG), within The single-stranded binding protein HDP-1 is 100% homologous to the TeR DNA sequence with a guanine, d(TTGGGG), in TeT the amino-terminal end of hnRNP A2/B1, which includes all five se- quences shown in this table (58, 64). DNA increased the K value of the protein-TeT DNA complex The single-stranded binding protein UP1 is 100% homologous to the 215-fold relative to the K of a uqTBP25-TeR-4 DNA complex amino-terminal end of hnRNP A1, which includes all five sequences (Table VI). Similarly, altering the TeR DNA d(TTAGGG) re- shown in this table (58, 61, 64). c peat unit into d(TTAGAG) in Mut1 TeR-4 DNA increased 85- Minor or alternate residues were detected in the NH -terminal fold the K value of the uqTBP25-Mut1 TeR-4 DNA complex three positions of the peptide: D, H, or T, in the first position, T or V in the second, and E or I in the third. (Table VI). Interestingly, an increase of only 9-fold in K value, was obtained when the TeR-4 DNA sequence d(TTAGGG) was mined values of dissociation constants, K , for complexes of changed into d(TAAGGG) in Mut2 TeR-4 DNA (Table VI). uqTBP25 with sequence and structure variants of telomeric That uqTBP25 bound preferentially TeR-4 DNA over the DNA. Fig. 3 shows a typical steady-state binding analysis of homologous rTeR-4 RNA sequence is evident by the 11.6-fold complex formation between uqTBP25 and TeR-2 DNA. A con- higher K of the protein-rTeR-4 complex (Table VI). This pref- stant amount of phenyl-Sepharose-purified uqTBP25 protein erential binding of DNA over RNA contrasts with the proclivity was incubated under standard binding conditions with increas- of several hnRNP species to bind RNA more tightly than DNA ing amounts of P-59-labeled TeR-2 DNA, and formed protein- (Ref. 64; see “Discussion”). A preference of uqTBP25 for single- DNA complexes were separated from unbound DNA by mobil- stranded over double-stranded TeR DNA was demonstrated by ity shift electrophoresis (Fig. 3A). Amounts of protein-bound the 30-fold lower K of its complex with single-stranded TeR-4 and free TeR-2 DNA were determined by phosphor imaging DNA relative to the K of its complex with blunt-ended double- measurements of the respective bands, and the value of the stranded telomeric DNA (Table VI). However, when the double- dissociation constant, K , was inferred from the negative recip- stranded TeR DNA ended with a d(TTAGGG) single-stranded d 2 rocal of the slope of a Scatchard plot of the results (Fig. 3B). overhang, its association with uqTBP25 was as tight as that of Compiled in Table VI are K values for complexes of uqTBP25 single-stranded TeR-4 DNA (Table VI). Of the various forms of d Sequence-specific Telomeric DNA-binding Protein 15887 posed for different lengths of time at 20 °C to 0.30 ng/ml micro- coccal nuclease. The nucleolytic digestion was terminated by adding SDS to a final concentration of 0.25%, and the DNA samples were electrophoresed through a 6% nondenaturing polyacrylamide gel to separate the intact DNA oligomer from its digestion products, which migrated at the front of the gel. The kinetics of breakdown of the unbound or uqTBP25-bound single-stranded TeR-4 DNA indicated that whereas 53 or 77% of the unbound TeR-4 DNA was digested within 1 or 3 min, respectively, only 4 or 9% of the uqTBP25-bound TeR DNA was degraded after exposure to the nuclease for these periods of time (Fig. 4A). To assess the specificity of protection of TeR-4 DNA by uqTBP25 against nucleolytic attack, we examined the effect of the protein on the rate of digestion of the poorly bound TeT-4 DNA (Table VI). As seen in Fig. 4B, 25 or 39% of the unbound TeT-4 DNA were digested after a 1- or 3-min exposure to micrococcal nuclease, and similarly, 41 or 50% of the protein- associated TeT-4 DNA was degraded after digestion for the same periods of time. Hence, uqTBP25-associated TeT-4 DNA was not protected against nucleolytic attack, and its rate of breakdown was even modestly accelerated in the presence of the protein. It appeared, therefore, that the formation of a sequence-specific tight complex between TeR-4 DNA and uqTBP25 was responsible for the observed resistance of the protein-bound telomeric DNA to nuclease attack. The Effect of uqTBP25 on DNA Polymerase a Activity—The single-stranded DNA-binding protein UP1 and uqTBP25 are distinguished from one another by their closely homologous but FIG.3. Determination of the dissociation constant for a nonidentical amino acid sequence (Table IV) and by their mo- uqTBP25-TeR-2 DNA complex. Phenyl-Sepharose-purified uqTBP25 lecular sizes of 22 (58) and 25 kDa, respectively. One charac- protein (12.0 activity units) was incubated at 4 °C for 20 min with teristic property of UP1 is its capacity to enhance the activity of increasing amounts of TeR-2 DNA. The uqTBP25-TeR-2 DNA complex calf thymus polymerase a (51). To further compare uqTBP25 was resolved by mobility shift electrophoresis in a nondenaturing 6% polyacrylamide gel as detailed under “Experimental Procedures.” A, with UP1, we examined the effect of uqTBP25 on polymerase mobility shift electrophoresis pattern of uqTBP25 with increasing a-catalyzed DNA synthesis. Calf thymus polymerase a was amounts of TeR-2 DNA probe. B, Scatchard plot of results shown in A incubated under DNA synthesis reaction conditions with in- above. Quantification of complex formation was conducted by phosphor creasing amounts of uqTBP25 and with either a poly(dG)z imaging. poly(dC) primer-template or with singly primed bacteriophage M13mp2 single-stranded DNA. DNA synthesis was determined tetraplex DNA, only a unimolecular antiparallel G94 TeR-4 by measuring the incorporation of P dGMP into acid-insolu- DNA structure bound tightly to uqTBP25. Although the K ble product DNA (see “Experimental Procedures”). As seen in value of the complex of uqTBP25 with G94 TeR-4 DNA was Fig. 5, the copying of a poly(dC) template strand was inhibited 6-fold higher than that of a uqTBP25-TeR-4 DNA complex by uqTBP25 by up to ;20%, whereas the copying of M13mp2 (Table VI), this difference was due to the required presence of DNA was increased by less than 2-fold. Under the same reac- 50 mM NaCl in the binding mixture. We found that the disso- tion conditions, bacteriophage T4 gene 32 protein inhibited by ciation constant of a complex of uqTBP25 with TeR-2 DNA, up to 90% the copying of poly(dC) by polymerase a and stimu- which could not form a tetraplex structure, was also increased lated the copying of M13mp2 DNA by more than 3-fold (results in the presence of 50 mM KCl from 3.2 6 0.7 3 10 mol/liter not shown). In modestly inhibiting polymerase a-catalyzed (Table VI) to 28.0 6 0.3 3 10 mol/liter (n 5 2) and to 36.0 6 copying of poly(dC) and stimulating M13mp2 DNA copying by 0.9 3 10 mol/liter (n 5 2) in the presence of 50 mM NaCl. It less than 2-fold, uqTBP25 contrasted UP1, which reportedly was concluded, therefore, that the single-stranded and unimo- increased .5- or .10-fold the copying by polymerase a of lecular quadruplex forms of TeR-4 DNA were bound by poly(dC) or of E. coli exonuclease III-treated bacteriophage l uqTBP25 with a very similar affinity. By contrast, a bimolec- DNA template, respectively (51). Hence, unlike UP1, uqTBP25 ular G92 TeR-2 tetraplex DNA bound poorly to uqTBP25, form- did not display a significant polymerase a-stimulatory activity. ing a complex having a K 38-fold higher than the dissociation DISCUSSION constant of a complex with TeR-2 DNA (Table VI). Parallel tetramolecular G4 quadruplex forms of oligomer Q (33, 50), The new mammalian telomeric DNA binding protein single Q (48), or d(CGG) at up to 123 nM (49) did not form uqTBP25, which we describe in this manuscript, associates detectable complexes with the protein (results not shown). tightly and in a sequence-specific manner with single-stranded Hence, our results indicated that uqTBP25 selectively bound and unimolecular tetraplex forms of the G-strand of vertebrate single-stranded and unimolecular tetraplex forms of TeR DNA telomeric DNA. Two or more d(TTAGGG) telomeric DNA re- in a highly sequence-specific fashion. peat units suffice for the formation of uqTBP25-DNA com- Stabilization of uqTBP25-associated Telomeric DNA against plexes that display nanomolar range dissociation constants Nucleolytic Attack—To inquire whether the stability of TeR (Table VI). Various single-stranded sequences, including DNA DNA is affected by its association with uqTBP25, we compared oligomers that do or do not contain guanine clusters as well as the rate of digestion by micrococcal nuclease of unbound and RNA sequences, fail to efficiently compete at a 50- or 75-fold protein-bound single-stranded TeR-4 DNA. Unbound single- molar excess with TeR-2 DNA for complex formation with stranded TeR-4 DNA or its complex with uqTBP25 were ex- uqTBP25 (Table V). The specific binding of vertebrate telo- 15888 Sequence-specific Telomeric DNA-binding Protein TABLE VI Dissociation constants of complexes of uqTBP25 with different DNA sequences and structures The dissociation constants, K , of complexes between phenyl-Sepharose-purified uqTBP25 and the different RNA and DNA sequences and structures were inferred from Scatchard plots of protein-DNA binding kinetics as illustrated in Fig. 3. The number of independently executed plots for the determination of the K value for complexes with each nucleic acid ligand is indicated in parentheses. Nucleic acid ligand K of binding 10 mol/liter Single stranded DNA TeR-4 d(TTAGGG) 2.2 6 1.7 (3) TeR-2 ;d(TTAGGG) ; 3.2 6 0.7 (2) TeR-1 ;d(TTAGGG); 27.4 6 5.1 (4) Sequence homologues of single stranded TeR DNA TeT-4 d(TTGGGG) 475 6 133 (3) TeT-2 ;d(TTGGGG) ; 210 6 40 (2) Mut1 TeR-4 d(TTAGAG) 187 6 30 (3) Mut2 TeR-4 d(TAAGGG) 20.0 6 2.6 (2) rTeR-4 r(UUAGGG) 25.6 6 5.7 (3) Double stranded DNA e b blunt-ended ds TeR Hook TeR-4 z Hook TeR-4 C 66.3 6 4.0 (3) ds TeR with ss G-strand overhang TeR-5 z TeR-3 C 1.6 6 0.5 (3) Tetraplex DNA G94 TeR-4 13.4 6 0.3 (2) G92 TeR-2 122.0 6 9.6 (2) G4 oligomer Q .500 Oligomers were maintained in a single-stranded conformation as described under “Experimental Procedures,” and DNA binding was conducted in the absence of salt to preserve the single-strandedness of the DNA. The full sequence of these oligomers is presented in Table I. The RNA binding reaction was conducted at 4 °C for 20 min in the presence of 0.07 units/ml RNasin, 1.2 mM DTT, 4 mM KCl. Trace activity of RNase present in the highly purified preparation of uqTBP25 was fully inhibited under these conditions, and in a control experiment, the binding of TeR-2 DNA by uqTBP25 was unaffected by the presence of RNasin, DTT, and KCl. Blunt-ended double-stranded DNA and a hybrid that had a single-stranded d(TTAGGG) overhang were annealed and purified as described under “Experimental Procedures.” The blunt-ended Hook TeR-4 z Hook TeR-4 C DNA was internally labeled in a Klenow fragment-catalyzed reaction as described under “Experimental Procedures.” The maintenance of the unimolecular tetraplex form of telomeric DNA, G94 TeR-4, and the DNA binding reaction were conducted in the presence of 50 mM NaCl to preserve the tetraplex structures of a single molecule of telomeric DNA. The bimolecular tetraplex form of telomeric DNA, G92 TeR-2, was prepared, and its stoichiometry was verified as described under “Experi- mental Procedures.” The binding reaction was conducted in the presence of 50 mM KCl to preserve the bimolecular G92 TeR-2 DNA structure. meric DNA by uqTBP25 is further underscored by the greatly that uqTBP25 does not represent rat hnRNP A1 or a derivative reduced affinity of the protein for the DNA ligand when a single thereof. The six-residue difference between the amino acid base substitution is introduced into the telomeric G-strand sequences of rat uqTBP25 and human hnRNP A2/B1 (Table IV) sequence. Thus, K values of complexes of uqTBP25 with d(T- strongly suggest that these two proteins are the products of TGGGG) , d(TTAGAG) or d(TAAGGG) are 215-, 85-, or 9-fold distinct genes. Notably, a 100% identity exists between a par- 4 4 4 higher, respectively, than the K of a complex with d(T- tial sequence of mouse hnRNP A2/B1 and its human homologue TAGGG) (Table VI). (69). It is thus unlikely that the different amino acid sequences The amino acid sequence of five tryptic peptides of uqTBP25 of uqTBP25 and of hnRNP A2/B1 are due to species diversity (Table IV) are closely homologous, but not identical, to se- among homologous proteins. (iii) No detectable complex is quences shared by hnRNP A1 (56 – 63) and hnRNP A2/B1 (54, formed between uqTBP25 and yeast total RNA (Table V; see 55) and by their respective derivative single-stranded DNA- “Results”), and a complex that does form between uqTBP25 and binding proteins UP1 (58, 61, 64) and HDP-1 (58, 64). Notably, r(UUAGGG) has a K value 11.6-fold higher than that of a 4 d a sequence within uqTBP25 peptide I (Table IV), IFVGGI, complex with d(TTAGGG) (Table VI). The propensity of corresponds to the consensus sequence of the RNP2 element, uqTBP25 for binding single-stranded DNA over RNA contrasts LFVGNL, which is common to hnRNP A1, hnRNP A2/B1, UP1, the preference of hnRNP A1 and hnRNP A2/B1 for association and HDP-1 (67). However, despite their close sequence simi- with RNA over single-stranded DNA (64). (iv) Data presented larity, uqTBP25 is disparate from hnRNP A1, hnRNP A2/B1, in Tables V and VI show that uqTBP25 binds d(TTAGGG) UP1, and HDP-1. sequences with a high degree of sequence specificity. By con- uqTBP25 Is Distinct from hnRNP A1 and hnRNP A2/B1— trast, evidence shows that hnRNP A1 and A2/B1 bind RNA Four lines of evidence distinguish uqTBP25 from hnRNP A1 with a low sequence specificity (70), with a notable exception of and hnRNP A2/B1. (i) The 25-kDa molecular mass of uqTBP25 a reported selective binding of d(TTAGGG) by mouse liver (Fig. 2 and “Results”) differs from the 34- and 36 –38-kDa hnRNP A2/B1 (69). molecular sizes of hnRNP A1 and hnRNP A2/B1, respectively uqTBP25 Is Distinct from the Single-stranded Binding Pro- (68). (ii) Out of 43 sequenced amino acid residues in uqTBP25, teins UP1 and HDP-1—Four lines of evidence indicate that 4 or 6, respectively, are different from corresponding residues despite their close size and sequence similarity, uqTBP25 and in hnRNP A1 or A2/B1 (Table IV). The amino acid sequence of UP1 or HDP-1 are distinct proteins. (i) The amino acid se- hnRNP A1 is 100% conserved in human, bovine, mouse, and rat quence of the single-stranded DNA binding proteins UP1 from cells (Ref. 68, Table IV). The finding of different amino acids at calf thymus and HDP-1 from mouse myeloma (51) indicate that matching positions in the rat cell-derived uqTBP25 and in the they are fully homologous to the amino-terminal portion of highly conserved hnRNP A1 (Table IV) indicates, therefore, HnRNP A1 and HnRNP A2/B1, respectively (58, 64). Multiple Sequence-specific Telomeric DNA-binding Protein 15889 FIG.5. The effect of uqTBP25 on DNA polymerase a activity. Calf thymus polymerase a was incubated under DNA synthesis condi- tions with increasing amounts of uqTBP25 and with either a poly(dG)zpoly(dC) primer-template and [a- P]dGTP substrate or with singly primed M13mp2 DNA, [a- P]dGTP, and all four unlabeled dNTP substrates. Reaction mixtures were incubated for 30 min at 37 °C, DNA synthesis was terminated, and the extent of incorporation of [ P]dGMP into product DNA was determined as described under “Experimental Procedures.” Results presented are an average of two independent determinations. f——f, DNA polymerization with a poly(dG)zpoly(dC) primer-template. Incorporation of 9.35 pmol of [ P]dGMP represented 100% activity in the absence of uqTBP25; Œ——Œ, DNA polymerization with a primed M13mp2 DNA template. Incorporation of 0.9 pmol of [ P]dGMP represented 100% activity in the absence of uqTBP25. stretches 18 amino acids long homologous to hnRNP A1, binds d(TTAGGG) with a high sequence specificity. Resemblance FIG.4. uqTBP25 stabilizes TeR-4 DNA against nuclease diges- between human A26 and rat uqTBP25 extends to their similar tion. Samples, 1.0 ng each, of P-59-labeled single-stranded TeR-4 molecular mass, their preferential binding of single-stranded DNA or TeT-4 DNA were incubated at 4 °C for 20 min with or without over blunt-ended double-stranded telomeric sequence, and phenyl-Sepharose-purified uqTBP25 (10.0 activity units). The naked or protein-bound DNA was exposed to 1.5 ng of micrococcal nuclease at their high sequence specificity of d(TTAGGG) binding (71). 20 °C for the indicated periods of time in the presence of 1.0 mM CaCl . Yet, some properties distinguish uqTBP25 from A26. Whereas Nuclease digestion was terminated, and TeR DNA was separated from binding competition results indicate that A26 binds its complex with uqTBP25 by the addition of SDS to a final concentra- r(UUAGGG) more tightly than d(TTAGGG) (71), the tion of 0.25%. The DNA samples were electrophoresed through a non- n n denaturing 6% polyacrylamide gel to separate intact DNA from its uqTBP25-d(TTAGGG) complex has an 11.6-fold lower K than 4 d digestion products, which migrated at the front of the gel. Residual a uqTBP25-r(UUAGGG) complex (Table VI). Additionally, un- intact DNA was quantified by phosphor imaging analysis. A, kinetics of like uqTBP25, which binds TeR-4 and TeR-2 DNA with a nuclease digestion of TeR-4 DNA with or without uqTBP25. The aver- similar affinity (Table VI), A26 binds TeR-2 DNA less tightly age value and S.D. of three independent determinations at each time point are indicated. Œ——Œ, nuclease-treated uqTBP25-bound TeR-4 than TeR-4 DNA (71). Last, A26 fails to bind the substituted DNA; f——f, nuclease-treated unbound TeR-4 DNA. B, kinetics of homologues of r(UUAGGG) (r(CUAGGG) , r(UCAGGG) , 4 4 4 nuclease digestion of TeT-4 DNA with or without uqTBP25. The aver- r(UUGGGG) , or r(UUAAGG) ), but it does bind r(UUAGAG) 4 4 4 age value and S.D. of three independent determinations at each time or r(UUAGGA) (71). By contrast, relative to d(TTAGAG) , point are indicated. Œ——Œ nuclease-treated uqTBP25-bound TeT-4 4 4 DNA; f——f, nuclease-treated unbound TeT-4 DNA. uqTBP25 binds most weakly d(TTGGGG) and d(TTAGAG) , but 4 4 it does associate relatively tightly with d(TAAGGG) (Table VI). amino acid substitutions distinguish uqTBP25 from either UP1 Potential Cellular Function of uqTBP25—The amino acid or HDP-1 and from their respective progenitor proteins sequence of uqTBP25 indicates that it is probably a derivative HnRNP A1 or A2/B1 (Table IV). Hence, it appears that of an hnRNP species that is closely related but not identical to uqTBP25 is not a product of proteolytic cleavage of either hnRNP A1 or A2/B1 (Table VI). Likewise, uqTBP25 is related HnRNP A1 or A2/B1 as are UP1 or HDP-1, respectively. (ii) The to but distinct from the single-stranded DNA-binding proteins 25-kDa size of uqTBP25 differs from the 22- and 27-kDa mo- UP1 and HDP-1. Based on its molecular size and telomeric lecular masses of calf thymus UP1 (58) and mouse myeloma DNA binding specificity, uqTBP25 is most closely similar to HDP-1 (65), respectively. (iii) Whereas UP1 or HDP-1 bind human protein A26 (71). It was argued that the prime target of single-stranded DNA with little or no sequence preference (51, protein A26 is the pre-mRNA splice site but that it could also be 65), uqTBP25 associates selectively with the telomeric se- involved in the binding of telomeric DNA (71). In view of the quence d(TTAGGG) (Tables V and VI). (iv) Unlike UP1, which preferential binding by uqTBP25 of telomeric DNA sequence stimulates .5- or .10-fold the copying by DNA polymerase a of over its RNA homologue and its lack of clear preference for an poly(dC) or of single-stranded DNA templates, respectively intact splice site (Table VI), it might be that this protein inter- (51), uqTBP25 slightly inhibits copying of poly(dC) and increases acts primarily with the G-strand of telomeric DNA rather than by less than 2-fold copying of single-stranded DNA (Fig. 5). with pre-mRNA. By binding the telomeric G-strand overhang, uqTBP25 Is Possibly Related to a Human Cell Telomeric uqTBP25 may protect it against nucleolytic attack (Fig. 4). DNA-binding Protein—A group of related proteins that bind Additionally, uqTBP25 might be instrumental in the stabiliza- the pre-mRNA 39 splice site r(UUAG/G) as well as the telomeric tion of specific structures of telomeric DNA. Hence, by binding sequence d(TTAGGG) was identified in HeLa cells (71). The tightly single-stranded or unimolecular tetraplex forms of d(T- size, antigenicity, nucleic acid binding preference, and partial TAGGG) while binding weakly its bimolecular or tetramolecu- amino sequence of most of these proteins suggested that they lar tetraplex forms, uqTBP25 may stabilize the monomolecular are identical or closely related to hnRNP type A2/B1, D, or E forms of the G-strand overhang and prevent the generation of (71). However, a 26-kDa protein designated A26, which has multimolecular tetraplex structures. 15890 Sequence-specific Telomeric DNA-binding Protein Acknowledgments—We are grateful to G. Sarig and Dr. P. Weisman- 34. Fang, G., and Cech, T. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6056 – 6060 35. Fang, G., and Cech, T. R. (1993) Cell 74, 875– 885 Shomer for help. We thank the Technion Protein Research Center 36. Liu, Z., and Gilbert, W. (1994) Cell 77, 1083–1092 (Professor Arie Admon) for ably performing peptide microsequencing. 37. Giraldo, R., and Rhodes, D. (1994) EMBO J. 13, 2411–2420 38. Giraldo, R., Suzuki, M., Chapman, L., and Rhodes, D. (1994) Proc. Natl. Acad. REFERENCES Sci. U. S. A. 91, 7658 –7662 1. Blackburn, E. H. (1994) Cell 77, 621– 623 39. Schierer, T., and Henderson, E. (1994) Biochemistry 33, 2240 –2246 2. Zakian, V. A. (1995) Science 270, 1601–1607 40. Liu, Z., Lee, A., and Gilbert, W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 3. Greider, C. W. (1996) Annu. Rev. Biochem. 65, 337–365 6002– 6006 4. Lundblad, V., and Wright, W. E. (1996) Cell 87, 369 –375 41. Frantz, J. D., and Gilbert, W. (1995) J. Biol. Chem. 270, 20692–20697 5. Henderson, E. (1995) in Telomeres (Blackburn, E. H., and Greider, C. W., eds.) 42. Frantz, J. D., and Gilbert, W. (1995) J. Biol. Chem. 270, 9413–9419 pp. 11–34, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 43. Coren, J. S., Epstein, E. M., and Vogt, V. M. (1991) Mol. Cell. Biol. 11, 6. Henderson, E., Hardin, C. C., Walk, S. K., Tinnoco, I., Jr., and Blackburn, E. 2282–2290 H. (1987) Cell 51, 899 –908 44. Zhong, Z., Shuie, L., Kaplan, S., and de Lange, T. (1992) Mol. Cell. Biol. 12, 7. Sundquist, W. I., and Klug, A. (1989) Nature 344, 410 – 414 4834 – 4843 8. Williamson, J. R., Raghuraman, M. K., and Cech, T. R. (1989) Cell 59, 871– 880 45. Hanish, J. P., Yanowitz, T., and de Lange, T. (1994) Proc. Natl. Acad. Sci. 9. Balagurumoorthy, P., Brahmachari, S. K., Mohanty, D., Bansal, M., and U. S. A. 91, 8861– 8865 Sasisekharan, V. (1992) Nucleic Acids Res. 20, 4061– 4067 46. Chong, L., van Steensel, B., Broccoli, D., Erdjument-Bromage, H., Hanish, J., 10. Scaria, P. V., Shire, S. T., and Shafer, R. H. (1992) Proc. Natl. Acad. Sci. Tempst, P., and de Lange, T. (1995) Science 270, 1663–1667 U. S. A. 89, 10336 –10340 47. Fry, M., Perrino, F. W., Levy, A., and Loeb, L. A. (1988) Nucleic Acids Res. 16, 11. Kang, C., Zhang, X., Ratliff, R., Moyzis, R., and Rich, A. (1992) Nature 356, 199 –211 126 –131 48. Sen, D., and Gilbert, W. (1992) Methods Enzymol. 211, 191–199 12. Smith, F. W., and Feigon, J. (1992) Biochemistry 32, 8682– 8692 49. Fry, M., and Loeb, L. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4950 – 4954 13. Gupta, G., Garcia, A. E., Guo, Q., Lu, M., and Kallenbach, N. R. (1993) 50. Weisman-Shomer, P., and Fry, M. (1993) J. Biol. Chem. 268, 3306 –3312 Biochemistry 32, 7098 –7103 51. Herrick, G., Delius, H., and Alberts, B. (1976) J. Biol. Chem. 251, 2142–2146 14. Balagurumoorthy, P., and Brahmachari, S. K. (1994) J. Biol. Chem. 269, 21858 –21869 52. Sharf, R., Weisman-Shomer, P., and Fry, M. (1988) Biochemistry 27, 2990 –2997 15. Harley, C. B. (1995) in Telomeres (Blackburn, E. H., and Greider, C. W., eds.) pp. 247–264, Cold Spring Harbor, Cold Spring, NY 53. Fry, M., Lapidot, J., and Weisman-Shomer, P. (1985) Biochemistry 24, 16. Hastie, N. D., Dempster, M., Dunlop, M. G., Thompson, A. M., Green, D. K., 7549 –7556 and Allshire, R. C. (1990) Nature 346, 866 – 868 54. Burd, C. G., Swanson, M. S., Go ¨ rlach, M., and Dreyfuss, G. (1989) Proc. Natl. 17. Shay, J. W., Wright, W. E., Brasiskyte, D., and Van Der Hagen, B. A. (1993) Acad. Sci. U. S. A. 86, 9788 –9792 Oncogene 8, 1407–1413 55. Biamonti, G., Ruggiu, M., Saccone, S., Della Valle, G., and Riva, S. (1994) 18. Klingelhutz, A. J., Barber, S., Smith, P. P., Dyer, K., and McDougall, J. K. Nucleic Acids Res. 22, 1996 –2002 (1994) Mol. Cell. Biol. 14, 961–969 56. Buvoli, M., Biamonti, G., Tsoulfas, P., Bassi, M. T., Ghetti, A., Riva, S., and 19. Counter, C. M., Hirte, H. W., Bacchetti, S., and Harley, C. B. (1994) Proc. Natl. Morandi, C. (1988) Nucleic Acids Res. 16, 3751–3770 Acad. Sci. U. S. A. 91, 2900 –2904 57. Biamonti, G., Buvoli, M., Bassi, M. T., Morandi, C., Cobianchi, F., and Riva, S. 20. de Lange, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2882–2885 (1989) J. Mol. Biol. 207, 491–503 21. Avilion, A. A., Piatyszek, M. A., Gupta, J., Shay, J. W., Bacchetti, S., and 58. Williams, K. R., Stone, K. L., LoPresti, M. B., Merril, B. M., and Planck, S. R. Greider, C. W. (1996) Cancer Res. 56, 645– 650 (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 5666 –5670 22. Harley, C. B., and Villeponteau, B. (1995) Curr. Opin. Genet. Develop. 5, 59. Merril, B. M., LoPresti, M. B., Stone, K. L., and Williams, K. R. (1986) J. Biol. 249 –255 Chem. 261, 878 – 883 23. de Lange, T. (1995) in Telomeres (Blackburn, E. H., and Greider, C. W., eds.) 60. Ben-David, Y., Bani, M. R., Chabot, B., De Koven, A., and Bernstein, A. (1992) pp. 265–293, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Mol. Cell. Biol. 12, 4449 – 4455 24. Bryan, T. M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R. R. (1995) 61. Cobianchi, F., SenGupta, D. N., Zmudzka, B. Z., and Wilson, S. H. (1986) EMBO J. 14, 4240 – 4248 J. Biol. Chem. 261, 3536 –3543 25. Broccoli, D., Young, J. W., and De Lange, T. (1995) Proc. Natl. Acad. Sci. 62. Cobianchi, F., Karpel, R. L., Williams, K. R., Notario, V., and Wilson, S. H. U. S. A. 92, 9082–9086 (1988) J. Biol. Chem. 263, 1063–1071 26. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990) Nature 345, 458 – 460 63. Kay, B. K., Sawhney, R. K., and Wilson, S. H. (1990) Proc. Natl. Acad. Sci. 27. Allsopp, R. C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E., Futcher, U. S. A. 87, 1367–1371 B., Greider, C. W., and Harley, C. B. (1992) Proc. Natl. Acad. Sci. U. S. A. 64. Kumar, A., Williams, K. R., and Szer, W. (1986) J. Biol. Chem. 261, 89, 10114 –10118 11266 –11273 28. Vaziri, H., Scha ¨ chter, F., Uchida, I., Wei, L., Zhu, X., Effros, R., Cohen, D., and 65. Planck, S. R., and Wilson, S. H. (1980) J. Biol. Chem. 255, 11547–11556 Harley, C. B. (1993) Am. J. Hum. Genet. 52, 661– 669 66. McKay, S. J., and Cooke, H. J. (1992) Nucl. Acids. Res. 20, 1387–1391 29. Fang, G., and Cech, T. R. (1995) in Telomeres (Blackburn, E. H., and Greider, 67. Weighardt, F., Biamonti, G., and Riva, S. (1996) BioEssays 18, 747–756 C. W., eds) pp. 69 –105, Cold Spring Harbor Laboratory, Cold Spring 68. Dreyfuss, G., Matunis, M. J., Pin ˜ ol-Roma, S., and Burd, C. G. (1993) Annu. Harbor, NY Rev. Biochem. 62, 289 –321 30. Price, C. M. (1990) Mol. Cell. Biol. 10, 3421–3431 69. McKay, S. J., and Cooke, H. J. (1992) Nucl. Acids Res. 20, 6461– 6464 31. Petracek, M. E., Konkel, L. M. C., Kable, M. L., and Berman, J. (1994) EMBO 70. Schenkel, J., Sekeris, C. E., Alonso, A., and Bautz, E. K. F. (1988) Eur. J. 13, 3648 –3658 32. Cardenas, M. E., Bianchi, A., and de Lange, T. (1993) Genes & Dev. 7, 883– 894 J. Biochem. 171, 565–569 71. Ishikawa, F., Matunis, M., Dreyfuss, G., and Cech, T. R. (1993) Mol. Cell. Biol. 33. Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474 – 4482 13, 4301– 4310
Journal
Journal of Biological Chemistry – Unpaywall
Published: Jun 1, 1997