Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Isoforms of the class II transactivator protein

Isoforms of the class II transactivator protein Abstract The class II transactivator (CIITA) controls both the constitutive and IFN‐γ inducible expression of HLA‐D genes. In addition, through the squelching of another transactivator CREB‐binding protein, CIITA was more recently shown to have a wider cellular function, including cell cycle control or cellular response to IFN‐γ and IL‐4. However, due to its low expression level, its analysis mainly relies on the study of recombinant overexpressed forms of the protein. We report here the analysis of native CIITA in various cell types. We first show the precise timing of CIITA protein expression in a fibroblast cell line in response to IFN‐γ. This expression is observed 2 h after the cytokine addition with a peak of expression ranging from 16 to 24 h. We next show the existence of two major isoforms of the CIITA protein differentially expressed in fibroblast, B lymphocyte or melanoma cell lines. We present the first demonstration that these isoforms originate from alternative translation initiation codons. We finally show that CIITA isoforms translocate to the nucleus with an apparently similar efficiency. Our data therefore demonstrate the existence of CIITA isoforms whose respective ratio depends on the cell type examined. However, we present evidence for a modulation of this ratio in a melanoma cell line with an abnormal constitutive expression of MHC class II molecules. gene regulation, HLA, melanoma, MHC, promoter, transcription Introduction MHC class II genes HLA‐DR, ‐DP and ‐DQ encode polymorphic cell‐surface heterodimeric complexes consisting of two transmembrane glycoproteins chains α and β (1). Through the presentation of exogenous peptides to Th cells, MHC class II molecules play a pivotal role in the cellular and humoral immune response. A tight regulation of HLA‐D expression is crucial for the control of the immune response. Indeed, constitutive expression of MHC class II is restricted primarily to specialized antigen‐presenting cells, such as B lymphocytes, dendritic cells, thymic epithelium and macrophages. However, MHC class II expression can be induced in other cell types by a number of inflammatory stimuli [reviewed in (2)], the most potent being IFN‐γ. Regulation of MHC class II expression occurs essentially at the transcriptional level. The promoter region of HLA‐D and invariant chain (Ii) encoding genes contain several conserved cis‐acting motifs, the W, X1, X2 and Y boxes (3). The trimeric complex RFX, composed of RFX5 (4), RFXANK (5) and RFXAP (6), binds to the X1 region. X2BP (CREB) binds to the X2 box (7) and a trimeric complex, NF‐Y, composed of NF‐YA, NF‐YB and NF‐YC, recognizes the Y box (8). However, all these transcription factors are not sufficient for HLA‐D expression. An additional non‐DNA binding protein, the class II transactivator (CIITA), is required for the formation of the transcriptional complex. Indeed, in vitro and in vivo analyses have shown that CIITA interacts with the RFX5 and RFXANK subunits of RFX, in addition to NF‐YB, NF‐YC and CREB, thereby creating the appropriate transcriptional scaffold required for HLA‐D gene expression (9). The CIITA protein has a complex structure with an N‐terminal acidic region identified as a transactivation domain (10,11) which binds components of the basal transcription machinery (11) and CREB‐binding protein (CBP) (12). In addition, different motifs have been involved in the nuclear translocation of CIITA, a GTP‐binding motif (13), nuclear localization sequences (14–16) and C‐terminal leucine‐rich repeats (17). More recently, both the central GTP‐binding domain and the leucine‐rich region have been shown as essential for CIITA dimerization (18–20). In contrast to the ubiquitous NFY, RFX and CREB transcription factors, the pattern of expression of CIITA is tissue specific. Indeed, CIITA is expressed constitutively in B lymphocytes (21) and in immature dendritic cells (22). It is IFN‐γ‐responsive in other cell types like fibroblasts (23). CIITA and MHC class II expression are related not only qualitatively, but also quantitatively (24), and CIITA is therefore considered as the master regulator of MHC class II expression. The transcriptional regulation of the CIITA gene, MHC2TA, is controlled by multiple promoters. Each promoter precedes an alternative first exon that is spliced to a common second exon. Promoters I and III of MHC2TA are constitutively active in dendritic and B cells respectively (25,26). Promoter IV, active in endothelial and fibroblast cells, is responsive to IFN‐γ (26). In addition, a distal enhancer upstream promoter III is also IFN‐γ‐responsive in different cell types, even though in a minor mode compared to the induction from promoter IV (27). In addition to its essential role in MHC class II expression, CIITA was more recently described as presenting a wider cellular effect. Indeed CIITA was shown to repress the transcription of different genes, encoding either IL‐4 (28,29), Fas ligand (30), collagen α2, cyclin D1 or thymidine kinase (31). The repressive effect of CIITA was demonstrated to occur through the squelching of CBP, another dose‐limited transactivator. These highly interesting data therefore evidence the involvement of CIITA concerning cell cycle, cellular responses to IFN‐γ or matrix formation. They might additionally give further hints about the putative consequences of CIITA expression abnormalities which have been observed in various tumor cell types (32–35). Due to its extremely low expression level, little is known about the CIITA protein in its native form. Indeed most studies have been performed in transfected cells overexpressing recombinant and tagged forms of the protein. Here, we have analyzed native CIITA protein in various cell lines, its kinetics of expression in response to IFN‐γ and its capacity to translocate into the nucleus. We have evidenced two major isoforms of the CIITA protein, differentially expressed in B lymphocytes and fibroblast cell lines, and generated by an alternative usage of translation initiation codons. The possibility that tumor cells might express specific CIITA isoforms was also examined. Our study thus reveals an important degree of complexity in translational and post‐translational events of CIITA protein expression. Methods Cell lines and IFN The following cell lines were maintained in RPMI 1640 medium (Gibco/BRL, Rockville, MD) supplemented with 10% FCS and antibiotics: BUA, a sarcoma virus (SV‐40)‐transformed human fibroblast; ROB, a Epstein–Barr virus‐established B lymphocyte cell line; HeLa, a cervical carcinoma cell line; RJ225, a CIITA‐defective B lymphocyte; and HT144, 42/95 and M74, melanoma cell lines kindly provided by E. Tartour (INSERM U255, Institut des Cordeliers, Paris, France). Purified recombinant human IFN‐γ was kindly provided by Roussel‐Uclaf (Romainville, France) and was quantified with an anti‐viral assay using vesicular stomatitis virus. It was used at a final concentration of 250 U/ml, which allows both weak anti‐proliferative effects and efficient HLA‐D molecule cell‐surface expression in the BUA cell line. RT‐PCR analysis Total RNA was extracted using TRIzol (Gibco/BRL) following the manufacturer’s instructions. First‐strand cDNA was synthesized from 1 µg RNA using 200 ng oligo(dT) (Boehringer Mannheim, Mannheim, Germany), 500 µM each dNTP, 20 U RNAsin (Promega, Madison, WI) and 200 U Omniscript reverse transcriptase from Qiagen (Valencia, CA). PCR amplification was performed with 2.5 U Taq polymerase from Qiagen and 0.5 µM specific oligonucleotide primer pairs. GAPDH was used as internal control for cDNA concentration with a primer concentration of 0.05 µM. The amplification profile involved denaturation at 95°C for 45 s, primer annealing at a specific temperature for 45 s and primer extension at 72°C for 1.5 min on a thermocycler (model PTC 200; MJ Research, Watertown, MA). The nucleotide sequences of the different primers were described previously (34), except for HLA‐DMA, where the sense and anti‐sense primers were 5′‐GGTTGGCTGGGTTGGTAGC‐3′ and 5′‐GCTGGCATCAAACTCTGGT‐3′ respectively. The numbers of amplification cycles applied were: 24 cycles for HLA‐DQB and ‐DPB; 25 cycles for HLA‐DPA; 28 cycles for HLA‐DRA, ‐DRB, ‐DQA, ‐DMA and Ii; 29 cycles for MHC2TA; and 34 cycles for HLA‐DMB. For the co‐amplification of GAPDH and IRF‐1 (Fig.2), a 64°C annealing temperature was applied, with 25 cycles of amplification, and a 0.17 µM concentration of the GAPDH primers (sense: 5′‐GTCGTATTGGGCGCCTGGTCAC‐3′ and anti‐sense: 5′‐AGGGGCCATCCACAGTCTTCTG‐3′). Flow cytometry Indirect immunofluorescence assays were done with a FACScan (Becton Dickinson, Mountain View, CA) using the CellQuest program with the following primary mAb: L243 (anti‐DR) (Becton Dickinson), B7/21 (anti‐DP) (36), SPV‐L3 from Immunotech (Marseille, France) or 33.1 (37) (anti‐DQ) and W6/32 (anti‐HLA‐A, ‐B, ‐C) from Serotec (Oxford, UK). For indirect immunofluorescence assays cells were next labeled with the FITC‐labeled goat anti‐IgG mAb from Biosys (Compiègne, France). Immunoprecipitation and Western blot analysis For total cell extracts, cells were lysed in high salt buffer (10 mM HEPES, pH 7.9, 0.4 M NaCl, 1.5 mM MgCl2, 0.1 mM EGTA and 5% glycerol) containing 0.5% NP‐40 (Sigma, St Louis, MO). For nuclear and cytoplasmic fractions, cells were first swollen in hypotonic buffer (5 mM KCl, 1 mM MgCl2 and 20 mM HEPES, pH 7.9) containing an antiprotease cocktail, then lysed with a dounce homogenizer with a type B pestle. Cytoplasmic fractions were recovered in the supernatant of these extracts after a 10 min centrifugation at 1000 g. Nuclei present in the pellet were further washed twice in hypotonic buffer containing 0.5% NP‐40 and 0.25% deoxycholic acid. Nuclei were next lysed in high salt buffer containing 0.5% NP‐40. Protein concentrations were determined with the BioRad (Hercules, CA) protein assay according to the manufacturer’s instructions. Immunoprecipitations of CIITA were performed on 350–1700 µg total cell extracts, on 150–550 µg nuclear extracts or on 1000–4800 µg cytoplasmic fractions, which correspond to a similar number of cells. For each experiment and cell type, the precise values are indicated in the figure legends. Immunoprecipitation of CIITA was performed with a polyclonal rabbit anti‐human CIITA (76) directed against a peptide (726GEIKDKELPQYLALTR741) and immunoaffinity purified through a CNBr‐activated Sepharose 4B column (Amersham Pharmacia Biotech, Piscataway, NJ) coupled to the peptide. Lysates were cleared for 2 h with Protein G–Sepharose (Amersham Pharmacia Biotech), and CIITA proteins were next immunoprecipitated overnight with 1.5–3 µg of affinity‐purified polyclonal anti‐CIITA antibodies per sample. Immune complexes were recovered by binding for 30 min to protein G–Sepharose, resolved on a 6% SDS–PAGE and absorbed to a nitrocellulose membrane (Hybond ECL; Amersham Pharmacia Biotech). Western blot analysis was performed with the monoclonal mouse anti‐human CIITA clone 7‐1H from R & D Systems (Minneapolis, MN). Blocking was performed overnight in PBS/Tween buffer containing 2.5% milk. Incubation with 1.5 µg of mAb was for 2 h at room temperature in PBS/Tween buffer containing 0.25% milk. Immunoreactive bands were visualized with the ECL or ECL Plus Western blotting system (Amersham Pharmacia Biotech). To control the quality of the cellular fractions, proportional amounts of immunoprecipitated nuclear and cytoplasmic fractions were further analyzed by Western blot with anti‐actin or anti‐RFX5 antibodies. The anti‐actin antibody is the monoclonal MAB1501R (used at 0.5 µg/ml) from Chemicon (Temecula, CA). The anti‐RFX5 (used at 0.68 µg/ml) is a rabbit polyclonal from Rockland Immunochemicals (Gilbertsville, PA). Western blot was performed as described above, except that samples were run on 8 or 10% acrylamide gels and that blocking of the membranes was performed in 5% milk. Mutagenesis Mutagenesis was performed with the Quick Change Site‐Directed Mutagenesis kit from Stratagene (La Jolla, CA) following the instructions of the manufacturer. The CIITA–IRES construct contains the 3.5‐kb coding region of the CIITA cDNA cloned into the pIRESNeo vector from Clontech (Palo Alto, CA). Based on the published sequence (Genbank accession no. X74301), mutagenesis led to the G118A or A188G substitutions where the first and second Met codons (M1 and M25) were respectively replaced by the ATA and GTG codons. The G118A mutation, generating the F‐CIITA–IRES construct, was created with the following primer: 5′‐GGGATTCCTACACAATACGTTGCCTGGCTC‐3′. The mutation of M25, leading to the B‐CIITA–IRES construct, was made with the 5′‐CTCACAGTGTGCCACCGTGGAGTTGGGGCC‐3′ primer. Mutagenized clones were identified by nucleotide sequencing with a DNA Sequencer 370A from Perkin Elmer (Norwalk, CT). Transfections HeLa cells were transfected with 20 µg of plasmid construct (empty pIRESNeo, F‐CIITA–IRES or B‐CIITA–IRES) by electroporation with the ECM apparatus using 500 µF, 300 V and 200 Ω conditions. The 42/95 melanoma cell line was transfected with the Effecten reagent from Qiagen as described previously (34). Cells were first selected in 0.4 or 0.35 mg/ml G418 for the HeLa and 42/95 transfected cells respectively, then subcloned by limiting dilution. Two clones per type of construct were further studied. Results Kinetics of CIITA expression To our knowledge, the kinetics of CIITA protein expression in response to IFN‐γ have not been defined. Deduction of the kinetics based on MHC2TA transcript expression was ambiguous, as published data are not in full agreement (23,38). In addition, it was important to obtain an insight on the protein stability and on the precise timing of expression of CIITA respective to its transcript and to HLA‐D expression. The kinetics were studied in a fibroblast cell line (BUA) in response to IFN‐γ. Unless indicated, all the analyses were performed on RNA, cells and protein samples prepared from the same batches of cells that were plated, IFN‐γ induced and retrieved at the same time. The data presented here originate from a complete set of experiments, representative of several independent manipulations. CIITA protein expression was analyzed by immunoprecipitation followed by a Western blot analysis. In a first set of experiments, the protein was detected 3 h after the cytokine addition (Fig. 1A). To further refine the time of appearance of CIITA, distinct experiments were additionally performed with shorter IFN‐γ induction periods and longer exposures of the film (Fig. 1B). The CIITA protein was then barely detectable at 2 h and was clearly observed at 2.5 h of IFN‐γ treatment. The expression of the CIITA protein peaked after a 16‐h induction. In independent experiments, this peak was obtained between 16 and 24 h (Fig. 1A and data not shown), preceding the decrease in the amount of protein. To assess the immunoprecipitations were quantitative, protein extracts from the same cellular batches were directly analyzed by Western blot. Although bands were extremely faint due to the low concentration of the intracellular CIITA protein, this direct Western blot analysis led to similar kinetics (data not shown). In agreement with the appearance of the CIITA protein 2 h after IFN‐γ addition, and in contrast with a previous publication (23), MHC2TA transcripts were detected by RT‐PCR as early as 30 min after IFN‐γ treatment (Fig. 2). This timing of expression was similar to IRF‐1, an IFN‐γ early response gene.HLA‐D transcript expression, analyzed by RT‐PCR (Fig. 3), was not coordinated in the BUA cells following the addition of the cytokine: HLA‐DRA, ‐DRB, ‐DMB and Ii transcripts were first observed after 6 h of treatment; HLA‐DPA, ‐DPB, ‐DQB and ‐DMA expression was stimulated after 12 h of IFN‐γ induction; HLA‐DQA transcripts were detected only after 24 h. When increasing the number of amplification cycles, thereby avoiding misinterpretation linked to the different expression levels of the HLA‐D genes, a similar non‐coordinated pattern of expression was observed (data not shown). We finally analyzed by flow cytometry the kinetics of HLA‐DR, ‐DP and ‐DQ cell‐surface expression in the fibroblast cell line (Fig. 4). HLA‐DR and ‐DP cell‐surface proteins were detected as early as 12 and 24 h respectively after IFN‐γ addition, and increased over the next 60 h. As expected from the above RT‐PCR experiments, cell‐surface HLA‐DQ expression was delayed to be clearly expressed after a 72 h induction. In summary, MHC2TA transcripts are observed 30 min after treatment with the cytokine, the CIITA protein appears between 2 and 2.5 h with a peak at ∼16–24 h, and HLA‐DR transcripts and cell‐surface protein are detected after 6 and 12 h of incubation with the cytokine respectively. Isoforms of the CIITA protein The above kinetics reveal that the CIITA protein does not appear as a single band. Indeed, in Fig. 1, the CIITA protein was observed in the BUA fibroblast cell line as one major band of 128 kDa with additional minor bands. When analyzing the CIITA protein in another MHC class II‐inducible cell line, HeLa, a similar pattern was obtained (Fig. 5A). However, this pattern was different in the ROB B lymphocyte cell line (Fig. 5A), with the major band presenting a higher apparent mol. wt of 132 kDa. The data therefore suggested that tissue‐specific isoforms of CIITA might be expressed in fibroblasts or in B lymphocytes. In addition, the expression of CIITA was analyzed in melanoma cell lines. In the IFN‐γ‐induced 42/95 (Fig. 5B) and M74 (see below) cell lines, the 128‐kDa band was the major isoform, as expected with cell lines expressing MHC class II in response to the cytokine. In contrast, the HT144 melanoma cell line, presenting constitutive expression of MHC class II molecules, displays both isoforms of CIITA (Fig. 5B). Transcription of MHC2TA mainly initiates from promoter IV in fibroblasts induced by IFN‐γ and from promoter III in B lymphocytes (26). In addition, we have shown previously that melanoma cell lines display a differential promoter usage of MHC2TA, thereby affecting their MHC class II cell‐surface phenotype (34). In melanoma cells presenting IFN‐γ‐dependent HLA‐D expression, MHC2TA transcription initiates mainly from promoter IV. In contrast, in melanoma cell lines expressing HLA‐D constitutively, MHC2TA transcription abnormally initiates from promoter III in the absence of the cytokine. This suggested that the different forms of CIITA proteins observed in these cell lines might be related to differential promoter usage. Indeed, transcripts initiated from promoter IV display one AUG within a perfect Kozak context (21). However, for transcripts initiated from promoter III, an upstream AUG might be used (26), thereby leading to a protein containing an additional 24‐amino‐acid stretch in its N‐terminal part (Fig. 6A). To further confirm this hypothesis, two constructs of the CIITA cDNA cloned in the pIRESNeo vector were generated through mutagenesis. In the F‐CIITA–IRES construct, the first coding ATG of the cDNA was replaced by ATA (G118A) and in the B‐CIITA construct the second ATG codon was replaced by GTG (A188G) (Fig. 6A). The F‐CIITA–IRES and B‐CIITA–IRES constructs were thereby expected to allow the exclusive expression of a 1106‐ or 1130‐amino‐acid form of the CIITA protein respectively. These were next transfected in the HeLa cell line and two G418‐resistant clones per construct were isolated. Each of these clones express all three HLA‐D isotypes (data not shown). The immunoprecipitation of CIITA from total extracts of these transfected cells showed that the F‐CIITA–IRES construct led to the expression of a 12‐kDa recombinant protein presenting the same electrophoretic mobility weight as the CIITA protein expressed in the IFN‐γ‐induced HeLa cell line (Fig. 6B). Accordingly, the B‐CIITA–IRES construct generates a 132‐kDa recombinant protein presenting the same electrophoretic mobility weight as that observed in the HT144 cells (Fig. 6B) and in B lymphocytes (not shown). Similar data were obtained with the 42/95 melanoma cell line transfected with the same constructs (see below). These data therefore show that the major band of CIITA (F‐CIITA) detected in the BUA and 42/95 cell lines treated with IFN‐γ is initiated from the ATG common to all transcripts and present in exon 2 of MHC2TA. In the cell lines where MHC2TA transcripts initiate from promoter III, a longer form of the CIITA protein (B‐CIITA) is additionally expressed, corresponding to the protein initiated from the ATG encoded by the first exon exclusively present in transcripts initiated from this promoter. Nuclear translocation of the CIITA isoforms Through the above study, we have observed that the amount of CIITA protein is 4–6 times weaker in B lymphocytes than in fibroblast cell lines treated by IFN‐γ (see Fig. 5 and legend). This point was quite surprising as the level of expression of MHC class II molecules at the cell surface is higher in B lymphocytes than in fibroblasts (∼1‐log difference between the ROB and BUA cell lines as determined by flow cytometry). To explain these contradictory data we hypothesized that the F‐CIITA isoform might be less efficient in its capacity to translocate to the nucleus. Cell fractionation was thus performed with clones of the 42/95 melanoma cell line transfected with the F‐CIITA–IRES or B‐CIITA–IRES constructs which express different amounts of the recombinant CIITA protein. Immunoprecipitation of CIITA was next done on total, cytoplasmic or nuclear extracts. RFX5 and actin antibodies were used as controls respectively for the nuclear and cytoplasmic contents of the extracts. As depicted in Fig. 7, whatever the isoform of CIITA considered, the amount of each CIITA isoform in the nucleus reflects its total amount in the cell line. The same analysis was performed with the HeLa transfected cells expressing the CIITA isoforms (Fig. 8). Here, again, both isoforms translocate to the nucleus with a relative nuclear concentration paralleling the total amount of CIITA protein. These data therefore suggest that both isoforms translocate to the nucleus within comparable ranges. Considering the fact that overexpression might modulate the regulation of CIITA translocation, the HT144 melanoma cell line was next studied. This cell line presents the advantage of co‐expressing the B‐CIITA and F‐CIITA isoforms. It was then possible to compare the intracellular localization of both CIITA native isoforms through cell fractionation studies. Figure 9 shows that both isoforms of CIITA are present in the nucleus within ratios that are quite similar to that observed for total extracts, thereby confirming that both CIITA isoforms translocate in a similar fashion. The above experiments on overexpressed recombinant forms of CIITA are compatible with the hypothesis that CIITA translocation to the nucleus is not due to a limitation in its nuclear concentration. To verify this point on the native CIITA protein, we used the properties of two melanoma cell lines, 42/95 and M74. As seen in Fig. 10(A), which depicts kinetics of CIITA expression in these cell lines, the amount of CIITA protein in total extracts is considerably higher in the M74 cell line compared to the 42/95 cells. When examining the amount of CIITA protein in the nucleus of both cell lines (Fig. 10B), immunoprecipitation revealed that the amount of protein in the nuclear extracts reflects the total amount of protein, thereby showing that CIITA accumulates in the nucleus without a severe limitation in its nuclear concentration. Taken as a whole our data indicate that F‐CIITA and B‐CIITA isoforms accumulate in the nucleus with a similar efficiency, and that they both activate expression of all three HLA‐D isotypes. In addition we have shown that this accumulation is not severely limited as cells overexpressing either recombinant or native CIITA proteins display high amounts of the protein in the nucleus. Discussion To avoid the biases linked to the study of overexpressed recombinant and tagged forms of proteins, we have chosen to study native CIITA protein. Despite the difficulty in detecting this protein due to its low intracellular concentration, we present here the first description of IFN‐γ‐induced native CIITA protein expression. This study was performed on an established fibroblast cell line, as these cells behave similarly to primary dermal fibroblasts for the induction of HLA‐DR in response to IFN‐γ treatment (39). CIITA protein expression peaks after 16 or 24 h of IFN‐γ treatment depending on the experiments (Fig. 1 and data not shown) and rapidly decreases. The kinetics are not specific for the BUA cell line, as we have obtained similar data with another fibroblast cell line (data not shown) and the 42/95 melanoma cell line (Fig. 10). Interestingly, the recent analysis of H4 histone acetylation of the HLA‐DRA promoter through chromatin immunoprecipitation assay of CIITA and real‐time PCR (40) has led to a kinetics of response to IFN‐γ which is superimposed to the kinetics of CIITA protein expression described here. This suggests that the nuclear transcriptional complex formation is not noticeably delayed after CIITA synthesis. Our data also indicate that the decrease in CIITA binding to the HLA‐DRA promoter that has been observed for a 48‐h IFN‐γ treatment (40) is linked to the decrease of CIITA concentration in the cell line (Fig. 1). Taken together, these data suggest a brief association of CIITA with the nuclear transcriptional complex bound to the HLA‐D promoters and a short half‐life of the protein. Kinetics of cell‐surface HLA‐D expression, HLA‐D or MHC2TA transcripts in response to IFN‐γ have been described by others (23,38,41–44). However, these reports examined either HLA‐D or CIITA expression, and assembling these data was difficult as various cell types and IFN‐γ preparations with different specific activities were used. We therefore describe here the complete sequence of events in a single cellular system, establishing the timing of CIITA protein synthesis relative to MHC2TA and HLA‐D transcript expression. In good agreement with the detection of the protein 2 h after the cytokine addition, we have shown that the MHC2TA transcript is detected as early as 30 min after IFN‐γ induction in the BUA cell line (Fig. 2). This is in discrepancy with a previous analysis of MHC2TA kinetics which described a 2 h delay for the appearance of the transcript (23). This might be explained by the RNase protection assay used in the latter report which is less sensitive than the RT‐PCR method applied here. Accordingly, another report using a RT‐PCR method showed the MHC2TA transcript 1 h after the cytokine addition (38). In addition, we have shown that HLA‐DRA and ‐DRB transcript expression began between 3 and 6 h after cytokine addition (Fig. 3). Here, again, the kinetics are in agreement with the expression of the CIITA protein appearing ∼1–4 h earlier (Fig. 1). The clear non‐coordination of expression of the different isotype chains of the HLA‐D genes in response to IFN‐γ might be explained by the fact that the transcription of certain HLA‐D genes might await the accumulation of sufficient amounts of a specific isoform of CIITA. However, we have observed that, at least when overexpressed, both F‐CIITA and B‐CIITA isoforms can induce all three HLA‐D isotype expression (data not shown). Alternatively, given the lack of pre‐association of the transcription factors in the HeLa cells in the absence of IFN‐γ‐induced CIITA (45), the association of the transcriptional complex to the different HLA‐D promoters might occur within variable timings. Indeed, the transcription factors were shown to display differential affinities for these promoters (46). The differential kinetics could also relate to a requirement for specific CIITA concentrations in the nucleus. It has been demonstrated that the expression of HLA‐DQ depends on higher amounts of CIITA compared to other isotypes (24). Accordingly, in our report, HLA‐DQA transcription begins when CIITA is at its optimal concentration (Figs 1 and 3). We have presented here the first evidence that CIITA appears as one major band of 128 kDa in an IFN‐γ‐treated fibroblast cell line (Fig. 1). In addition, immunoprecipitation of native CIITA in B lymphocyte cell lines was shown to lead to the detection of two major bands (Fig. 5), in agreement with a recent publication (22). Through the use of melanoma cell lines and transfected cells, we have demonstrated that these bands, with apparent mol. wt of 128 and 132 kDa, correspond to different isoforms of CIITA which originate from alternative translation initiation codons (Fig. 6). The resulting F‐CIITA and B‐CIITA isoforms differ from 24 amino acids with theoretical mol. wt of 121 and 124 kDa respectively. The corresponding apparent mol. wt of 128 and 132 kDa obtained through electrophoresis might be explained by the acidic isoelectric point of the protein or by post‐translational modifications. In addition, we have often observed that the 128‐ and 132‐kDa bands appear as doublets both in their native or recombinant forms, which is suggestive of a phosphorylated state of CIITA. Indeed, a faint labeling of CIITA has been observed using anti‐P Ser antibodies, suggesting the presence of phosphorylated serine residues in the CIITA protein (G. Barbieri, unpublished data). Accordingly, serine phosphorylation has been recently described for the recombinant protein labeled with inorganic phosphate (47). A lower mol. wt band of CIITA (with an apparent mol. wt of 124 kDa) with a minor intensity was observed in the BUA fibroblast, 42/95 and HT144 melanoma, and ROB B lymphocyte cell lines. This band is likely not a degradation product as it was not detected in the HeLa and 42/95 transfected cell lines. This band might therefore originate from an alternative splicing of the MHC2TA transcripts, as described previously in B lymphocytes (10). A high mol. wt band (with an apparent mol. wt of 141 kDa) is detected in the ROB, BUA and HeLa cells lines (Fig. 5), but is not present in the transfected cells (Fig. 6), suggesting that this band is not created by a post‐translational modification of CIITA. One hypothesis is that this band might be the dendritic form of CIITA (DC‐CIITA) (22) whose theoretical mol. wt is 132 kDa. The MHC2TA gene presents a complex transcript initiation with alternative usage of at least three promoters (26). This is quite puzzling as one can question the role of different ‘tissue‐specific’ promoters when a certain leakiness in the control of their usage is observed. Indeed, in fibroblast cell lines, given the presence of the IFN‐γ‐responsive enhancer (48), transcripts initiated from promoter III were estimated to represent 16% of the total CIITA‐encoding messengers (26). Interestingly, when the expression of the CIITA isoforms is considered, discrepancies with these results appear. In IFN‐responsive cell lines, B‐CIITA is usually very faint or undetectable (Figs 5–7). As MHC2TA transcripts initiated from promoter III display both translation initiation AUG and thereby might express both isoforms of CIITA, our above data indicate that the usage of the first AUG is rare in fibroblasts. Conversely, in the HT144 melanoma cell line, MHC2TA transcripts are initiated, in the absence of IFN‐γ, from promoter III only (34). However, our data evidence the expression of both CIITA isoforms in this cell line (Figs 5 and 6), thereby indicating an alternative usage of both AUGs from transcripts initiated from promoter III. It is tempting to suggest that the F‐CIITA and B‐CIITA isoforms have different properties. As mentioned above, even though cell‐surface MHC class II expression in B lymphocytes is higher than in IFN‐γ‐treated fibroblasts, our data are suggestive of a significantly lower amount of CIITA protein in lymphocytes compared to the fibroblasts. B‐CIITA might be more stable, more active or might have a longer half‐life in the transcriptional complex. Indeed DC‐CIITA was demonstrated to display a higher activity than B‐CIITA (49). The difference between the B‐CIITA and F‐CIITA isoforms lies in the N‐terminal 24 amino acids. The interaction of CIITA with CBP was described to occur within the first 102 amino acids of the B‐CIITA isoform (12) and was more recently delimitated within amino acids 59–94 of B‐CIITA (31). It has been additionally shown that CBP can acetylate CIITA on lysine residues and that this acetylation affects CIITA translocation into the nucleus (16). A weaker interaction of CIITA with CBP could then result in variable abilities concerning nuclear translocation. The hypothesis of a different efficiency in the nuclear transport of CIITA isoforms was, however, dismissed here. Analysis of the HT144 melanoma cell line has indicated that both CIITA isoforms accumulate in similar amounts in the nucleus (Fig. 10). These data were further confirmed with the analysis of the 42/95 and HeLa cells transfected with either form of CIITA (Figs 8 and 9). Within the hypothesis that B‐CIITA is more efficient in its interaction with CBP, one might otherwise propose that B‐CIITA is more efficiently acetylated than the F‐CIITA isoform and that this acetylated form of CIITA presents a longer half‐life. This would be in agreement with a recent publication showing that the histone acetylase activity of CBP or pCAF is not necessary for the transcriptional activity of CIITA (50). We propose here that this activity might be required further downstream for increased CIITA stability. The respective roles of the two acetylated lysine residues of CIITA (16) should be studied within this perspective. One can additionally propose that the strength of the CIITA–CBP interaction modulates the subset of genes repressed by CIITA. Indeed, recent reports have demonstrated that CIITA can squelch CBP, and therefore interfere with cell growth and IFN response (31) or cytokine production (29). Within this context, the constitutive expression of CIITA in melanoma is an interesting point. Constitutive expression of HLA‐DR has been associated with a bad prognosis for primary melanoma (51). One possibility is that the poor prognosis is actually associated with the constitutive expression of CIITA or alternatively with the abnormal shift from a quasi‐exclusive expression of F‐CIITA to a mixture of both F‐CIITA and B‐CIITA [(34) and this report]. The isoforms might have synergistic or antagonistic interactions. Alternatively, different combinations of the CIITA isoforms might play differential roles depending on the cell type examined. Indeed the demonstration of CIITA dimerization (18–20) leads to the proposal that F‐CIITA homodimers, B‐CIITA homodimers or F/B‐CIITA heterodimers could have different activities or stabilities. In addition the co‐existence of different isoforms of CIITA raises the question of the introduction of N‐terminal tags to B‐CIITA cDNAs, which likely lead to the synthesis of non‐negligible amounts of non‐tagged F‐CIITA isoforms. This point should be considered if both isoforms compete or synergize for specific functions. CIITA is a highly complex molecule presenting an intricate transcriptional, yet leaky tissue‐specific regulation, in addition to a tissue‐specific control of its translation initiation sites. Future studies must now uncover the functions of its different isoforms and their inter‐relations. Acknowledgements This research was supported in part by Association pour la Recherche contre le Cancer, Fondecyt (8000011) and Ecos/Conicyt (C99S02), INSERM Progrès, and Fondation de France. J. V. was supported by a fellowship from the Ligue Nationale contre le Cancer, then from the Fondation pour la Recherche Médicale. G. B. was supported by a grant from the INSERM, then from the Fondation de France. V. D. was supported by a grant from the Association pour la Recherche contre le Cancer. Abbreviations CBP—CREB‐binding protein CIITA—class II transactivator Ii—invariant chain View largeDownload slide Fig. 1. Kinetics of CIITA protein expression in response to IFN‐γ. Total cell extracts (650 µg) from the BUA fibroblasts, untreated and treated with IFN‐γ (250 U/ml) for the indicated times, were immunoprecipitated using anti‐CIITA antibodies. The immunocomplexes were resolved in a 6% acrylamide gel and revealed by Western blot analysis with 1.5 µg/ml 7‐1H monoclonal anti‐human CIITA antibody. (A) The CIITA proteins were immunoprecipitated using 2 µg monoclonal anti‐human CIITA antibody per sample. (B) The immunoprecipitation analysis was performed using 2.5 µg 76 polyclonal anti‐human CIITA antibody per protein sample. The arrows mark the first appearance of detectable induction of the CIITA protein. View largeDownload slide Fig. 1. Kinetics of CIITA protein expression in response to IFN‐γ. Total cell extracts (650 µg) from the BUA fibroblasts, untreated and treated with IFN‐γ (250 U/ml) for the indicated times, were immunoprecipitated using anti‐CIITA antibodies. The immunocomplexes were resolved in a 6% acrylamide gel and revealed by Western blot analysis with 1.5 µg/ml 7‐1H monoclonal anti‐human CIITA antibody. (A) The CIITA proteins were immunoprecipitated using 2 µg monoclonal anti‐human CIITA antibody per sample. (B) The immunoprecipitation analysis was performed using 2.5 µg 76 polyclonal anti‐human CIITA antibody per protein sample. The arrows mark the first appearance of detectable induction of the CIITA protein. View largeDownload slide Fig. 2. Kinetics of MHC2TA and IRF‐1 transcript expression in response to IFN‐γ. The fibroblast BUA cell line was incubated with medium or with IFN‐γ (250 U/ml) for various time periods. Total RNA was extracted and subjected to RT‐PCR analysis with primers specific for MHC2TA using 29 amplification cycles. IRF‐1 and GAPDH transcript expression is included to control respectively IFN‐γ treatment efficiency and cDNA concentrations of the different samples with a 25‐cycle amplification. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 2. Kinetics of MHC2TA and IRF‐1 transcript expression in response to IFN‐γ. The fibroblast BUA cell line was incubated with medium or with IFN‐γ (250 U/ml) for various time periods. Total RNA was extracted and subjected to RT‐PCR analysis with primers specific for MHC2TA using 29 amplification cycles. IRF‐1 and GAPDH transcript expression is included to control respectively IFN‐γ treatment efficiency and cDNA concentrations of the different samples with a 25‐cycle amplification. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 3. Kinetics of HLA‐D gene expression in response to IFN‐γ. Total RNA was extracted from the BUA fibroblast cell line untreated and treated with IFN‐γ (250 U/ml) for the indicated times. The RT‐PCR analysis was performed using different HLA‐D‐specific primers, in addition to Ii. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 3. Kinetics of HLA‐D gene expression in response to IFN‐γ. Total RNA was extracted from the BUA fibroblast cell line untreated and treated with IFN‐γ (250 U/ml) for the indicated times. The RT‐PCR analysis was performed using different HLA‐D‐specific primers, in addition to Ii. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 4. Kinetics of the cell‐surface expression of MHC class II and I molecules in response to IFN‐γ. The BUA fibroblasts, untreated or IFN‐γ‐induced (250 U/ml) for the indicated time, were incubated with mAb specific for HLA‐DR (L243), HLA‐DP (B7/21), HLA‐DQ (SPV‐L3) and HLA‐B‐C (W6/32). A FITC‐labeled monoclonal anti‐IgG antibody was used to reveal the binding of the primary antibodies (filled profile) using cytofluorometry. Isotype controls appear as open profiles. View largeDownload slide Fig. 4. Kinetics of the cell‐surface expression of MHC class II and I molecules in response to IFN‐γ. The BUA fibroblasts, untreated or IFN‐γ‐induced (250 U/ml) for the indicated time, were incubated with mAb specific for HLA‐DR (L243), HLA‐DP (B7/21), HLA‐DQ (SPV‐L3) and HLA‐B‐C (W6/32). A FITC‐labeled monoclonal anti‐IgG antibody was used to reveal the binding of the primary antibodies (filled profile) using cytofluorometry. Isotype controls appear as open profiles. View largeDownload slide Fig. 5. Expression of the CIITA protein in cell lines from various tissular origins. (A) Total cell extracts from the BUA fibroblast (Fib) or the HeLa cell lines (900 µg protein/sample), or from the RJ2.2.5 or ROB B lymphocyte (LB) cell lines (3600 µg protein/sample) were immunoprecipitated with 3 µg polyclonal antibody. (B) Total cell extracts from the BUA fibroblast or the 42/95 and HT144 melanoma cell lines (600 µg protein/sample) were immunoprecipitated with 2 µg anti‐CIITA polyclonal antibody. (–) Untreated cells; (+) cells treated for 16 h with 250 U/ml IFN‐γ. View largeDownload slide Fig. 5. Expression of the CIITA protein in cell lines from various tissular origins. (A) Total cell extracts from the BUA fibroblast (Fib) or the HeLa cell lines (900 µg protein/sample), or from the RJ2.2.5 or ROB B lymphocyte (LB) cell lines (3600 µg protein/sample) were immunoprecipitated with 3 µg polyclonal antibody. (B) Total cell extracts from the BUA fibroblast or the 42/95 and HT144 melanoma cell lines (600 µg protein/sample) were immunoprecipitated with 2 µg anti‐CIITA polyclonal antibody. (–) Untreated cells; (+) cells treated for 16 h with 250 U/ml IFN‐γ. View largeDownload slide Fig. 6. Creation and analysis of the F‐CIITA and B‐CIITA recombinant proteins. (A) Site‐directed mutagenesis of the CIITA cDNA cloned in the pIRES‐Neo vector led to G118A or A188G substitutions. The first and second Met codons (Met1 and Met25) were respectively replaced by the ATA and GTG codons, thereby generating the F‐CIITA–IRES and B‐CIITA–IRES constructs. (B) Both constructs were transfected in the HeLa cell line and two G418‐resistant clones were recovered per construct. Immunoprecipitation of CIITA was performed on total extracts (900 µg protein) with 3 µg polyclonal anti‐CIITA antibody. Protein samples were extracted from the HeLa transfected clones and from the HeLa and HT144 cell lines treated (+) or untreated (–) with 250 U/ml IFN‐γ for 16 h. View largeDownload slide Fig. 6. Creation and analysis of the F‐CIITA and B‐CIITA recombinant proteins. (A) Site‐directed mutagenesis of the CIITA cDNA cloned in the pIRES‐Neo vector led to G118A or A188G substitutions. The first and second Met codons (Met1 and Met25) were respectively replaced by the ATA and GTG codons, thereby generating the F‐CIITA–IRES and B‐CIITA–IRES constructs. (B) Both constructs were transfected in the HeLa cell line and two G418‐resistant clones were recovered per construct. Immunoprecipitation of CIITA was performed on total extracts (900 µg protein) with 3 µg polyclonal anti‐CIITA antibody. Protein samples were extracted from the HeLa transfected clones and from the HeLa and HT144 cell lines treated (+) or untreated (–) with 250 U/ml IFN‐γ for 16 h. View largeDownload slide Fig. 7. Localization of CIITA in cellular fractions of the 42/95 cells transfected with pIRES‐Neo or with the F‐CIITA–IRES or B‐CIITA–IRES constructs. The 42/95 Neo clone was either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total protein extracts (900 µg protein), nuclear protein (150 µg protein) or cytoplasmic protein (1092 µg protein) fractions with 3, 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the supernatants of the immunoprecipitated samples (CIITA‐depleted protein extracts), RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 14 µg total protein extract, 2 µg nuclear or 14 µg cytoplasmic protein extract. Samples used to examine RFX5 presence contain 4 µg nuclear or 28 µg cytoplasmic protein extract. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 7. Localization of CIITA in cellular fractions of the 42/95 cells transfected with pIRES‐Neo or with the F‐CIITA–IRES or B‐CIITA–IRES constructs. The 42/95 Neo clone was either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total protein extracts (900 µg protein), nuclear protein (150 µg protein) or cytoplasmic protein (1092 µg protein) fractions with 3, 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the supernatants of the immunoprecipitated samples (CIITA‐depleted protein extracts), RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 14 µg total protein extract, 2 µg nuclear or 14 µg cytoplasmic protein extract. Samples used to examine RFX5 presence contain 4 µg nuclear or 28 µg cytoplasmic protein extract. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 8. Detection of CIITA in the nuclear and cytoplasmic fractions of the HeLa cells expressing the F‐CIITA or B‐CIITA CIITA isoforms. Untransfected HeLa cells were treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1700 µg), nuclear (550 µg) or cytoplasmic (4830 µg) protein fractions with 3, 2.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein extracts, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 2.5 µg nuclear or 20 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 3 µg nuclear or 25 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 8. Detection of CIITA in the nuclear and cytoplasmic fractions of the HeLa cells expressing the F‐CIITA or B‐CIITA CIITA isoforms. Untransfected HeLa cells were treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1700 µg), nuclear (550 µg) or cytoplasmic (4830 µg) protein fractions with 3, 2.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein extracts, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 2.5 µg nuclear or 20 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 3 µg nuclear or 25 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 9. Cytoplasmic and nuclear localization of the CIITA isoforms in the HT144 cell line. Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1000 µg), nuclear (174 µg) or cytoplasmic (1974 µg) protein fractions with 3, 1 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein fractions, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 1.5 µg nuclear or 16.5 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 4 µg nuclear or 44 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 9. Cytoplasmic and nuclear localization of the CIITA isoforms in the HT144 cell line. Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1000 µg), nuclear (174 µg) or cytoplasmic (1974 µg) protein fractions with 3, 1 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein fractions, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 1.5 µg nuclear or 16.5 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 4 µg nuclear or 44 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 10. Expression and nuclear translocation of CIITA in the 42/95 and M74 melanoma cell lines. (A) Kinetics of expression of the CIITA protein in the melanoma cell lines in response to IFN‐γ (250 U/ml). CIITA was immunoprecipitated from total protein fractions (360 µg) with 1.5 µg of anti‐CIITA polyclonal antibody. Actin expression was analyzed on CIITA‐depleted protein fractions (4 µg protein) by Western blot with a 1/2000 dilution of the anti‐actin antibody. (B) Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+) prior to cell fractionation. Samples of 212 µg nuclear or 2755 µg cytoplasmic protein fractions were immunoprecipitated with 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. Actin and RFX5 expression was next determined on CIITA‐depleted protein fraction. Samples for actin expression contained 2 µg nuclear or 16 µg cytoplasmic protein fraction. Samples for RFX5 expression contained 3.5 µg nuclear or 28 µg cytoplasmic protein fraction. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 10. Expression and nuclear translocation of CIITA in the 42/95 and M74 melanoma cell lines. (A) Kinetics of expression of the CIITA protein in the melanoma cell lines in response to IFN‐γ (250 U/ml). CIITA was immunoprecipitated from total protein fractions (360 µg) with 1.5 µg of anti‐CIITA polyclonal antibody. Actin expression was analyzed on CIITA‐depleted protein fractions (4 µg protein) by Western blot with a 1/2000 dilution of the anti‐actin antibody. (B) Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+) prior to cell fractionation. Samples of 212 µg nuclear or 2755 µg cytoplasmic protein fractions were immunoprecipitated with 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. Actin and RFX5 expression was next determined on CIITA‐depleted protein fraction. Samples for actin expression contained 2 µg nuclear or 16 µg cytoplasmic protein fraction. Samples for RFX5 expression contained 3.5 µg nuclear or 28 µg cytoplasmic protein fraction. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. References 1 Germain, R. N. 1994. MHC‐dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell  76: 287. Google Scholar 2 Glimcher, L. H. and Kara, C. J. 1992. Sequences and factors: a guide to MHC class II transcription. Annu. Rev. Immunol.  10: 13. Google Scholar 3 Dorn, A., Durand, B., Marfing, C., LeMeur, M., Benoist, C. and Mathis, D. 1987. Conserved major histocompatibility complex class II boxes X and Y are transcriptional control elements and specifically bind nuclear proteins. Proc. Natl Acad. Sci. USA  84: 6249. Google Scholar 4 Steimle, V., Durand, B., Barras, E., Zufferey, M., Hadam, M. R., Mach, B. and Reith, W. 1995. A novel DNA‐binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev.  9: 1021. Google Scholar 5 Masternak, K., Barras, E., Zufferey, M., Conrad, B., Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, D. F., Mach, B. and Reith, W. 1998. A gene encoding a novel RFX‐associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat. Genet.  20: 273. Google Scholar 6 Durand, B., Sperisen, P., Emery, P., Barras, E., Zufferey, M., Mach, B. and Reith, W. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J.  16: 1045. Google Scholar 7 Moreno, C. S., Emery, P., West, J. E., Durand, B., Reith, W., Mach, B. and Boss, J. M. 1995. Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. J. Immunol.  155: 4313. Google Scholar 8 Dorn, A., Bollekens, J., Staub, A., Benoist, C. and Mathis, D. 1987. A multiplicity of CCAAT box‐binding proteins. Cell  50: 863. Google Scholar 9 Zhu, X. S., Linhoff, M. W., Li, G., Chin, K. C., Maity, S. N. and Ting, J. P. 2000. Transcriptional scaffold: CIITA interacts with NF‐Y, RFX, and CREB To cause stereospecific regulation of the class II major histocompatibility complex promoter. Mol. Cell. Biol.  20: 6051. Google Scholar 10 Riley, J. L., Westerheide, S. D., Price, J. A., Brown, J. A. and Boss, J. M. 1995. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity  2: 533. Google Scholar 11 Fontes, J. D., Jiang, B. and Peterlin, B. M. 1997. The class II trans‐activator CIITA interacts with the TBP‐associated factor TAFII32. Nucleic Acids Res.  25: 2522. Google Scholar 12 Kretsovali, A., Agalioti, T., Spilianakis, C., Tzortzakaki, E., Merika, M. and Papamatheakis, J. 1998. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol. Cell. Biol.  18: 6777. Google Scholar 13 Chin, K. C., Li, G. G. and Ting, J. P. 1997. Importance of acidic, proline/serine/threonine‐rich, and GTP‐binding regions in the major histocompatibility complex class II transactivator: generation of transdominant‐negative mutants. Proc. Natl Acad. Sci. USA  94: 2501. Google Scholar 14 Cressman, D. E., Chin, K. C., Taxman, D. J. and Ting, J. P. 1999. A defect in the nuclear translocation of CIITA causes a form of type II bare lymphocyte syndrome. Immunity  10: 163. Google Scholar 15 Cressman, D. E., O’Connor, W. J., Greer, S. F., Zhu, X. S. and Ting, J. P. 2001. Mechanisms of nuclear import and export that control the subcellular localization of class ii transactivator. J. Immunol.  167: 3626. Google Scholar 16 Spilianakis, C., Papamatheakis, J. and Kretsovali, A. 2000. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol. Cell. Biol.  20: 8489. Google Scholar 17 Hake, S. B., Masternak, K., Kammerbauer, C., Janzen, C., Reith, W. and Steimle, V. 2000. CIITA leucine‐rich repeats control nuclear localization, in vivo recruitment to the major histocompatibility complex (MHC) class II enhanceosome, and MHC class II gene transactivation. Mol. Cell. Biol.  20: 7716. Google Scholar 18 Linhoff, M. W., Harton, J. A., Cressman, D. E., Martin, B. K. and Ting, J. P. 2001. Two distinct domains within CIITA mediate self‐association: involvement of the GTP‐binding and leucine‐rich repeat domains. Mol. Cell. Biol.  21: 3001. Google Scholar 19 Sisk, T. J., Roys, S. and Chang, C. H. 2001. Self‐association of CIITA and its transactivation potential. Mol. Cell. Biol.  21: 4919. Google Scholar 20 Kretsovali, A., Spilianakis, C., Dimakopoulos, A., Makatounakis, T. and Papamatheakis, J. 2001. Self‐association of class ii transactivator correlates with its intracellular localization and transactivation. J. Biol. Chem.  276: 32191. Google Scholar 21 Steimle, V., Otten, L. A., Zufferey, M. and Mach, B. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell  75: 135. Google Scholar 22 Landmann, S., Muhlethaler‐Mottet, A., Bernasconi, L., Suter, T., Waldburger, J. M., Masternak, K., Arrighi, J. F., Hauser, C., Fontana, A. and Reith, W. 2001. Maturation of dendritic cells is accompanied by rapid transcriptional silencing of class II transactivator (CIITA) expression. J. Exp. Med.  194: 379. Google Scholar 23 Steimle, V., Siegrist, C. A., Mottet, A., Lisowska‐Grospierre, B. and Mach, B. 1994. Regulation of MHC class II expression by interferon‐gamma mediated by the transactivator gene CIITA. Science  265: 106. Google Scholar 24 Otten, L. A., Steimle, V., Bontron, S. and Mach, B. 1998. Quantitative control of MHC class II expression by the transactivator CIITA. Eur. J. Immunol.  28: 473. Google Scholar 25 Lennon, A. M., Ottone, C., Rigaud, G., Deaven, L. L., Longmire, J., Fellous, M., Bono, R. and Alcaide‐Loridan, C. 1997. Isolation of a B‐cell‐specific promoter for the human class II transactivator. Immunogenetics  45: 266. Google Scholar 26 Muhlethaler‐Mottet, A., Otten, L. A., Steimle, V. and Mach, B. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J.  16: 2851. Google Scholar 27 Piskurich, J. F., Linhoff, M. W., Wang, Y. and Ting, J. P. 1999. Two distinct gamma interferon‐inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor beta. Mol. Cell. Biol.  19: 431. Google Scholar 28 Gourley, T., Roys, S., Lukacs, N. W., Kunkel, S. L., Flavell, R. A. and Chang, C. H. 1999. A novel role for the major histocompatibility complex class II transactivator CIITA in the repression of IL‐4 production. Immunity  10: 377. Google Scholar 29 Sisk, T. J., Gourley, T., Roys, S. and Chang, C. H. 2000. MHC class II transactivator inhibits IL‐4 gene transcription by competing with NF‐AT to bind the coactivator CREB binding protein (CBP)/p300. J. Immunol.  165: 2511. Google Scholar 30 Gourley, T. S. and Chang, C. H. 2001. The class II transactivator prevents activation‐induced cell death by inhibiting Fas ligand gene expression. J. Immunol.  166: 2917. Google Scholar 31 Zhu, X. S. and Ting, J. P. 2001. A 36‐amino‐acid region of CIITA is an effective Inhibitor of CBP: novel mechanism of gamma interferon‐mediated suppression of collagen alpha(2)(I) and other promoters. Mol. Cell. Biol.  21: 7078. Google Scholar 32 Lennon, A., Ottone, C., Peijnenburg, A., Hamon‐Benais, C., Colland, F., Gobin, S., van den Elsen, P., Fellous, M., Bono, R. and Alcaide‐Loridan, C. 1996. The RAG cell line defines a new complementation group of MHC class II deficiency. Immunogenetics  43: 352. Google Scholar 33 Lu, Y., Ussery, G. D., Muncaster, M. M., Gallie, B. L. and Blanck, G. 1994. Evidence for retinoblastoma protein (RB) dependent and independent IFN‐γ responses: RB coordinately rescues IFN‐γ induction of MHC class II gene transcription in noninducible breast carcinoma cells. Oncogene  9: 1015. Google Scholar 34 Deffrennes, V., Vedrenne, J., Stolzenberg, M. C., Piskurich, J., Barbieri, G., Ting, J. P., Charron, D. and Alcaide‐Loridan, C. 2001. Constitutive expression of MHC class II genes in melanoma cell lines results from the transcription of class II transactivator abnormally initiated from its B cell‐specific promoter. J. Immunol.  167: 98. Google Scholar 35 Naves, R., Lennon, A. M., Barbieri, G., Reyes, L., Puga, G., Salas, L., Deffrennes, V., Rosemblatt, M., Fellous, M., Charron, D., Alcaide‐Loridan, C. and Bono, M. R. 2002. MHC class‐II deficient tumor cell lines with a defective expression of the class II transactivator (CIITA). Int. Immunol.  14: 1. Google Scholar 36 Watson, A. J., DeMars, R., Trowbridge, I. S. and Bach, F. H. 1983. Detection of a novel human class II HLA antigen. Nature  304: 358. Google Scholar 37 Marti, G. E., Kuo, M. C., Shaw, S., Chang, C. C., Demars, R., Sogn, J. A., Coligan, J. E. and Kindt, T. J. 1983. A novel HLA‐D/DR‐like antigen specific for human B lymphoid cells. Biochemica l evidence for similarity to but nonidentity with known HLA‐D/DR antigens. J. Exp. Med.  158: 1924. Google Scholar 38 Chang, C. H., Fontes, J. D., Peterlin, M. and Flavell, R. A. 1994. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J. Exp. Med.  180: 1367. Google Scholar 39 Lisowska‐Grospierre, B., Durandy, A., Virelizier, J. L., Fischer, A. and Griscelli, C. 1983. Combined immunodeficiency with defective expression of HLA antigens: modulation of an abnormal HLA and functional studies. Birth Defects  19: 87. Google Scholar 40 Beresford, G. W. and Boss, J. M. 2001. CIITA coordinates multiple histone acetylation modifications at the HLA‐DRA promoter. Nat. Immunol.  2: 652. Google Scholar 41 Capobianchi, M. R., Ameglio, F., Tosi, R. and Dolei, A. 1985. Differences in the expression and release of DR, BR, and DQ molecules in human cells treated with recombinant interferon gamma: comparison to other interferons. Hum. Immunol.  13: 1. Google Scholar 42 Teyton, L., Lotteau, V., Turmel, P., Arenzana‐Seisdedos, F., Virelizier, J. L., Pujol, J. P., Loyau, G., Piatier‐Tonneau, D., Auffray, C. and Charron, D. J. 1987. HLA DR, DQ, and DP antigen expression in rheumatoid synovial cells: a biochemical and quantitative study. J. Immunol.  138: 1730. Google Scholar 43 Takiguchi, M., Ting, J. P., Buessow, S. C., Boyer, C., Gillespie, Y. and Frelinger, J. A. 1985. Response of glioma cells to interferon‐gamma: increase in class II RNA, protein and mixed lymphocyte reaction‐stimulating ability. Eur. J. Immunol.  15: 809. Google Scholar 44 Chin, K. C., Mao, C., Skinner, C., Riley, J. L., Wright, K. L., Moreno, C. S., Stark, G. R., Boss, J. M. and Ting, J. P. 1994. Molecular analysis of G1B and G3A IFN‐ gamma mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity  1: 687. Google Scholar 45 Villard, J., Muhlethaler‐Mottet, A., Bontron, S., Mach, B. and Reith, W. 1999. CIITA‐induced occupation of MHC class II promoters is independent of the cooperative stabilization of the promoter‐bound multi‐protein complexes. Int. Immunol.  11: 461. Google Scholar 46 Reith, W., Kobr, M., Emery, P., Durand, B., Siegrist, C.‐A. and Mach, B. 1994. Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters. J. Biol. Chem.  269: 20020. Google Scholar 47 Li, G., Harton, J. A., Zhu, X. and Ting, J. P. 2001. Downregulation of CIITA function by protein kinase a (PKA)‐mediated phosphorylation: mechanism of prostaglandin E, cyclic AMP, and PKA inhibition of class II major histocompatibility complex expression in monocytic lines. Mol. Cell. Biol.  21: 4626. Google Scholar 48 Piskurich, J. F., Wang, Y., Linhoff, M. W., White, L. C. and Ting, J. P. 1998. Identification of distinct regions of 5′ flanking DNA that mediate constitutive, IFN‐gamma, STAT1, and TGF‐beta‐regulated expression of the class II transactivator gene. J. Immunol.  160: 233. Google Scholar 49 Nickerson, K., Sisk, T. J., Inohara, N., Yee, C. S., Kennell, J., Cho, M. C., Yannie, P. J., II, Nunez, G. and Chang, C. H. 2001. Dendritic cell‐specific MHC class II transactivator contains a caspase recruitment domain that confers potent transactivation activity. J. Biol. Chem.  276: 19089. Google Scholar 50 Harton, J. A., Zika, E. and Ting, J. P. 2001. The histone acetyltransferase domains of CBP and pCAF are not necessary for cooperativity with CIITA. J. Biol. Chem.  20: 20. Google Scholar 51 Zaloudik, J., Moore, M., Ghosh, A. K., Mechl, Z. and Rejthar, A. 1988. DNA content and MHC class II antigen expression in malignant melanoma: clinical course. J. Clin. Pathol.  41: 1078. Google Scholar Author notes 1INSERM U396, Centre de Recherches Biomédicales des Cordeliers and Laboratoire d’Immunologie et d’Histocompatibilité, APHP, Hôpital St Louis, 75270 Paris, France 2INSERM U429, Hôpital Necker Enfants‐Malades, 75015 Paris, France 3Departamento de Biologia, Facultad de Ciencias, Universidad de Chile, Santiago, Chile 4Permanent address: Istituto di Biologia dello Sviluppo, CNR, 90146 Palermo, Italy http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Immunology Oxford University Press

Isoforms of the class II transactivator protein

Download PDF
10 pages

Loading next page...
 
/lp/oxford-university-press/isoforms-of-the-class-ii-transactivator-protein-I7S7OLxUZW

References (56)

Publisher
Oxford University Press
ISSN
0953-8178
eISSN
1460-2377
DOI
10.1093/intimm/dxf060
Publisher site
See Article on Publisher Site

Abstract

Abstract The class II transactivator (CIITA) controls both the constitutive and IFN‐γ inducible expression of HLA‐D genes. In addition, through the squelching of another transactivator CREB‐binding protein, CIITA was more recently shown to have a wider cellular function, including cell cycle control or cellular response to IFN‐γ and IL‐4. However, due to its low expression level, its analysis mainly relies on the study of recombinant overexpressed forms of the protein. We report here the analysis of native CIITA in various cell types. We first show the precise timing of CIITA protein expression in a fibroblast cell line in response to IFN‐γ. This expression is observed 2 h after the cytokine addition with a peak of expression ranging from 16 to 24 h. We next show the existence of two major isoforms of the CIITA protein differentially expressed in fibroblast, B lymphocyte or melanoma cell lines. We present the first demonstration that these isoforms originate from alternative translation initiation codons. We finally show that CIITA isoforms translocate to the nucleus with an apparently similar efficiency. Our data therefore demonstrate the existence of CIITA isoforms whose respective ratio depends on the cell type examined. However, we present evidence for a modulation of this ratio in a melanoma cell line with an abnormal constitutive expression of MHC class II molecules. gene regulation, HLA, melanoma, MHC, promoter, transcription Introduction MHC class II genes HLA‐DR, ‐DP and ‐DQ encode polymorphic cell‐surface heterodimeric complexes consisting of two transmembrane glycoproteins chains α and β (1). Through the presentation of exogenous peptides to Th cells, MHC class II molecules play a pivotal role in the cellular and humoral immune response. A tight regulation of HLA‐D expression is crucial for the control of the immune response. Indeed, constitutive expression of MHC class II is restricted primarily to specialized antigen‐presenting cells, such as B lymphocytes, dendritic cells, thymic epithelium and macrophages. However, MHC class II expression can be induced in other cell types by a number of inflammatory stimuli [reviewed in (2)], the most potent being IFN‐γ. Regulation of MHC class II expression occurs essentially at the transcriptional level. The promoter region of HLA‐D and invariant chain (Ii) encoding genes contain several conserved cis‐acting motifs, the W, X1, X2 and Y boxes (3). The trimeric complex RFX, composed of RFX5 (4), RFXANK (5) and RFXAP (6), binds to the X1 region. X2BP (CREB) binds to the X2 box (7) and a trimeric complex, NF‐Y, composed of NF‐YA, NF‐YB and NF‐YC, recognizes the Y box (8). However, all these transcription factors are not sufficient for HLA‐D expression. An additional non‐DNA binding protein, the class II transactivator (CIITA), is required for the formation of the transcriptional complex. Indeed, in vitro and in vivo analyses have shown that CIITA interacts with the RFX5 and RFXANK subunits of RFX, in addition to NF‐YB, NF‐YC and CREB, thereby creating the appropriate transcriptional scaffold required for HLA‐D gene expression (9). The CIITA protein has a complex structure with an N‐terminal acidic region identified as a transactivation domain (10,11) which binds components of the basal transcription machinery (11) and CREB‐binding protein (CBP) (12). In addition, different motifs have been involved in the nuclear translocation of CIITA, a GTP‐binding motif (13), nuclear localization sequences (14–16) and C‐terminal leucine‐rich repeats (17). More recently, both the central GTP‐binding domain and the leucine‐rich region have been shown as essential for CIITA dimerization (18–20). In contrast to the ubiquitous NFY, RFX and CREB transcription factors, the pattern of expression of CIITA is tissue specific. Indeed, CIITA is expressed constitutively in B lymphocytes (21) and in immature dendritic cells (22). It is IFN‐γ‐responsive in other cell types like fibroblasts (23). CIITA and MHC class II expression are related not only qualitatively, but also quantitatively (24), and CIITA is therefore considered as the master regulator of MHC class II expression. The transcriptional regulation of the CIITA gene, MHC2TA, is controlled by multiple promoters. Each promoter precedes an alternative first exon that is spliced to a common second exon. Promoters I and III of MHC2TA are constitutively active in dendritic and B cells respectively (25,26). Promoter IV, active in endothelial and fibroblast cells, is responsive to IFN‐γ (26). In addition, a distal enhancer upstream promoter III is also IFN‐γ‐responsive in different cell types, even though in a minor mode compared to the induction from promoter IV (27). In addition to its essential role in MHC class II expression, CIITA was more recently described as presenting a wider cellular effect. Indeed CIITA was shown to repress the transcription of different genes, encoding either IL‐4 (28,29), Fas ligand (30), collagen α2, cyclin D1 or thymidine kinase (31). The repressive effect of CIITA was demonstrated to occur through the squelching of CBP, another dose‐limited transactivator. These highly interesting data therefore evidence the involvement of CIITA concerning cell cycle, cellular responses to IFN‐γ or matrix formation. They might additionally give further hints about the putative consequences of CIITA expression abnormalities which have been observed in various tumor cell types (32–35). Due to its extremely low expression level, little is known about the CIITA protein in its native form. Indeed most studies have been performed in transfected cells overexpressing recombinant and tagged forms of the protein. Here, we have analyzed native CIITA protein in various cell lines, its kinetics of expression in response to IFN‐γ and its capacity to translocate into the nucleus. We have evidenced two major isoforms of the CIITA protein, differentially expressed in B lymphocytes and fibroblast cell lines, and generated by an alternative usage of translation initiation codons. The possibility that tumor cells might express specific CIITA isoforms was also examined. Our study thus reveals an important degree of complexity in translational and post‐translational events of CIITA protein expression. Methods Cell lines and IFN The following cell lines were maintained in RPMI 1640 medium (Gibco/BRL, Rockville, MD) supplemented with 10% FCS and antibiotics: BUA, a sarcoma virus (SV‐40)‐transformed human fibroblast; ROB, a Epstein–Barr virus‐established B lymphocyte cell line; HeLa, a cervical carcinoma cell line; RJ225, a CIITA‐defective B lymphocyte; and HT144, 42/95 and M74, melanoma cell lines kindly provided by E. Tartour (INSERM U255, Institut des Cordeliers, Paris, France). Purified recombinant human IFN‐γ was kindly provided by Roussel‐Uclaf (Romainville, France) and was quantified with an anti‐viral assay using vesicular stomatitis virus. It was used at a final concentration of 250 U/ml, which allows both weak anti‐proliferative effects and efficient HLA‐D molecule cell‐surface expression in the BUA cell line. RT‐PCR analysis Total RNA was extracted using TRIzol (Gibco/BRL) following the manufacturer’s instructions. First‐strand cDNA was synthesized from 1 µg RNA using 200 ng oligo(dT) (Boehringer Mannheim, Mannheim, Germany), 500 µM each dNTP, 20 U RNAsin (Promega, Madison, WI) and 200 U Omniscript reverse transcriptase from Qiagen (Valencia, CA). PCR amplification was performed with 2.5 U Taq polymerase from Qiagen and 0.5 µM specific oligonucleotide primer pairs. GAPDH was used as internal control for cDNA concentration with a primer concentration of 0.05 µM. The amplification profile involved denaturation at 95°C for 45 s, primer annealing at a specific temperature for 45 s and primer extension at 72°C for 1.5 min on a thermocycler (model PTC 200; MJ Research, Watertown, MA). The nucleotide sequences of the different primers were described previously (34), except for HLA‐DMA, where the sense and anti‐sense primers were 5′‐GGTTGGCTGGGTTGGTAGC‐3′ and 5′‐GCTGGCATCAAACTCTGGT‐3′ respectively. The numbers of amplification cycles applied were: 24 cycles for HLA‐DQB and ‐DPB; 25 cycles for HLA‐DPA; 28 cycles for HLA‐DRA, ‐DRB, ‐DQA, ‐DMA and Ii; 29 cycles for MHC2TA; and 34 cycles for HLA‐DMB. For the co‐amplification of GAPDH and IRF‐1 (Fig.2), a 64°C annealing temperature was applied, with 25 cycles of amplification, and a 0.17 µM concentration of the GAPDH primers (sense: 5′‐GTCGTATTGGGCGCCTGGTCAC‐3′ and anti‐sense: 5′‐AGGGGCCATCCACAGTCTTCTG‐3′). Flow cytometry Indirect immunofluorescence assays were done with a FACScan (Becton Dickinson, Mountain View, CA) using the CellQuest program with the following primary mAb: L243 (anti‐DR) (Becton Dickinson), B7/21 (anti‐DP) (36), SPV‐L3 from Immunotech (Marseille, France) or 33.1 (37) (anti‐DQ) and W6/32 (anti‐HLA‐A, ‐B, ‐C) from Serotec (Oxford, UK). For indirect immunofluorescence assays cells were next labeled with the FITC‐labeled goat anti‐IgG mAb from Biosys (Compiègne, France). Immunoprecipitation and Western blot analysis For total cell extracts, cells were lysed in high salt buffer (10 mM HEPES, pH 7.9, 0.4 M NaCl, 1.5 mM MgCl2, 0.1 mM EGTA and 5% glycerol) containing 0.5% NP‐40 (Sigma, St Louis, MO). For nuclear and cytoplasmic fractions, cells were first swollen in hypotonic buffer (5 mM KCl, 1 mM MgCl2 and 20 mM HEPES, pH 7.9) containing an antiprotease cocktail, then lysed with a dounce homogenizer with a type B pestle. Cytoplasmic fractions were recovered in the supernatant of these extracts after a 10 min centrifugation at 1000 g. Nuclei present in the pellet were further washed twice in hypotonic buffer containing 0.5% NP‐40 and 0.25% deoxycholic acid. Nuclei were next lysed in high salt buffer containing 0.5% NP‐40. Protein concentrations were determined with the BioRad (Hercules, CA) protein assay according to the manufacturer’s instructions. Immunoprecipitations of CIITA were performed on 350–1700 µg total cell extracts, on 150–550 µg nuclear extracts or on 1000–4800 µg cytoplasmic fractions, which correspond to a similar number of cells. For each experiment and cell type, the precise values are indicated in the figure legends. Immunoprecipitation of CIITA was performed with a polyclonal rabbit anti‐human CIITA (76) directed against a peptide (726GEIKDKELPQYLALTR741) and immunoaffinity purified through a CNBr‐activated Sepharose 4B column (Amersham Pharmacia Biotech, Piscataway, NJ) coupled to the peptide. Lysates were cleared for 2 h with Protein G–Sepharose (Amersham Pharmacia Biotech), and CIITA proteins were next immunoprecipitated overnight with 1.5–3 µg of affinity‐purified polyclonal anti‐CIITA antibodies per sample. Immune complexes were recovered by binding for 30 min to protein G–Sepharose, resolved on a 6% SDS–PAGE and absorbed to a nitrocellulose membrane (Hybond ECL; Amersham Pharmacia Biotech). Western blot analysis was performed with the monoclonal mouse anti‐human CIITA clone 7‐1H from R & D Systems (Minneapolis, MN). Blocking was performed overnight in PBS/Tween buffer containing 2.5% milk. Incubation with 1.5 µg of mAb was for 2 h at room temperature in PBS/Tween buffer containing 0.25% milk. Immunoreactive bands were visualized with the ECL or ECL Plus Western blotting system (Amersham Pharmacia Biotech). To control the quality of the cellular fractions, proportional amounts of immunoprecipitated nuclear and cytoplasmic fractions were further analyzed by Western blot with anti‐actin or anti‐RFX5 antibodies. The anti‐actin antibody is the monoclonal MAB1501R (used at 0.5 µg/ml) from Chemicon (Temecula, CA). The anti‐RFX5 (used at 0.68 µg/ml) is a rabbit polyclonal from Rockland Immunochemicals (Gilbertsville, PA). Western blot was performed as described above, except that samples were run on 8 or 10% acrylamide gels and that blocking of the membranes was performed in 5% milk. Mutagenesis Mutagenesis was performed with the Quick Change Site‐Directed Mutagenesis kit from Stratagene (La Jolla, CA) following the instructions of the manufacturer. The CIITA–IRES construct contains the 3.5‐kb coding region of the CIITA cDNA cloned into the pIRESNeo vector from Clontech (Palo Alto, CA). Based on the published sequence (Genbank accession no. X74301), mutagenesis led to the G118A or A188G substitutions where the first and second Met codons (M1 and M25) were respectively replaced by the ATA and GTG codons. The G118A mutation, generating the F‐CIITA–IRES construct, was created with the following primer: 5′‐GGGATTCCTACACAATACGTTGCCTGGCTC‐3′. The mutation of M25, leading to the B‐CIITA–IRES construct, was made with the 5′‐CTCACAGTGTGCCACCGTGGAGTTGGGGCC‐3′ primer. Mutagenized clones were identified by nucleotide sequencing with a DNA Sequencer 370A from Perkin Elmer (Norwalk, CT). Transfections HeLa cells were transfected with 20 µg of plasmid construct (empty pIRESNeo, F‐CIITA–IRES or B‐CIITA–IRES) by electroporation with the ECM apparatus using 500 µF, 300 V and 200 Ω conditions. The 42/95 melanoma cell line was transfected with the Effecten reagent from Qiagen as described previously (34). Cells were first selected in 0.4 or 0.35 mg/ml G418 for the HeLa and 42/95 transfected cells respectively, then subcloned by limiting dilution. Two clones per type of construct were further studied. Results Kinetics of CIITA expression To our knowledge, the kinetics of CIITA protein expression in response to IFN‐γ have not been defined. Deduction of the kinetics based on MHC2TA transcript expression was ambiguous, as published data are not in full agreement (23,38). In addition, it was important to obtain an insight on the protein stability and on the precise timing of expression of CIITA respective to its transcript and to HLA‐D expression. The kinetics were studied in a fibroblast cell line (BUA) in response to IFN‐γ. Unless indicated, all the analyses were performed on RNA, cells and protein samples prepared from the same batches of cells that were plated, IFN‐γ induced and retrieved at the same time. The data presented here originate from a complete set of experiments, representative of several independent manipulations. CIITA protein expression was analyzed by immunoprecipitation followed by a Western blot analysis. In a first set of experiments, the protein was detected 3 h after the cytokine addition (Fig. 1A). To further refine the time of appearance of CIITA, distinct experiments were additionally performed with shorter IFN‐γ induction periods and longer exposures of the film (Fig. 1B). The CIITA protein was then barely detectable at 2 h and was clearly observed at 2.5 h of IFN‐γ treatment. The expression of the CIITA protein peaked after a 16‐h induction. In independent experiments, this peak was obtained between 16 and 24 h (Fig. 1A and data not shown), preceding the decrease in the amount of protein. To assess the immunoprecipitations were quantitative, protein extracts from the same cellular batches were directly analyzed by Western blot. Although bands were extremely faint due to the low concentration of the intracellular CIITA protein, this direct Western blot analysis led to similar kinetics (data not shown). In agreement with the appearance of the CIITA protein 2 h after IFN‐γ addition, and in contrast with a previous publication (23), MHC2TA transcripts were detected by RT‐PCR as early as 30 min after IFN‐γ treatment (Fig. 2). This timing of expression was similar to IRF‐1, an IFN‐γ early response gene.HLA‐D transcript expression, analyzed by RT‐PCR (Fig. 3), was not coordinated in the BUA cells following the addition of the cytokine: HLA‐DRA, ‐DRB, ‐DMB and Ii transcripts were first observed after 6 h of treatment; HLA‐DPA, ‐DPB, ‐DQB and ‐DMA expression was stimulated after 12 h of IFN‐γ induction; HLA‐DQA transcripts were detected only after 24 h. When increasing the number of amplification cycles, thereby avoiding misinterpretation linked to the different expression levels of the HLA‐D genes, a similar non‐coordinated pattern of expression was observed (data not shown). We finally analyzed by flow cytometry the kinetics of HLA‐DR, ‐DP and ‐DQ cell‐surface expression in the fibroblast cell line (Fig. 4). HLA‐DR and ‐DP cell‐surface proteins were detected as early as 12 and 24 h respectively after IFN‐γ addition, and increased over the next 60 h. As expected from the above RT‐PCR experiments, cell‐surface HLA‐DQ expression was delayed to be clearly expressed after a 72 h induction. In summary, MHC2TA transcripts are observed 30 min after treatment with the cytokine, the CIITA protein appears between 2 and 2.5 h with a peak at ∼16–24 h, and HLA‐DR transcripts and cell‐surface protein are detected after 6 and 12 h of incubation with the cytokine respectively. Isoforms of the CIITA protein The above kinetics reveal that the CIITA protein does not appear as a single band. Indeed, in Fig. 1, the CIITA protein was observed in the BUA fibroblast cell line as one major band of 128 kDa with additional minor bands. When analyzing the CIITA protein in another MHC class II‐inducible cell line, HeLa, a similar pattern was obtained (Fig. 5A). However, this pattern was different in the ROB B lymphocyte cell line (Fig. 5A), with the major band presenting a higher apparent mol. wt of 132 kDa. The data therefore suggested that tissue‐specific isoforms of CIITA might be expressed in fibroblasts or in B lymphocytes. In addition, the expression of CIITA was analyzed in melanoma cell lines. In the IFN‐γ‐induced 42/95 (Fig. 5B) and M74 (see below) cell lines, the 128‐kDa band was the major isoform, as expected with cell lines expressing MHC class II in response to the cytokine. In contrast, the HT144 melanoma cell line, presenting constitutive expression of MHC class II molecules, displays both isoforms of CIITA (Fig. 5B). Transcription of MHC2TA mainly initiates from promoter IV in fibroblasts induced by IFN‐γ and from promoter III in B lymphocytes (26). In addition, we have shown previously that melanoma cell lines display a differential promoter usage of MHC2TA, thereby affecting their MHC class II cell‐surface phenotype (34). In melanoma cells presenting IFN‐γ‐dependent HLA‐D expression, MHC2TA transcription initiates mainly from promoter IV. In contrast, in melanoma cell lines expressing HLA‐D constitutively, MHC2TA transcription abnormally initiates from promoter III in the absence of the cytokine. This suggested that the different forms of CIITA proteins observed in these cell lines might be related to differential promoter usage. Indeed, transcripts initiated from promoter IV display one AUG within a perfect Kozak context (21). However, for transcripts initiated from promoter III, an upstream AUG might be used (26), thereby leading to a protein containing an additional 24‐amino‐acid stretch in its N‐terminal part (Fig. 6A). To further confirm this hypothesis, two constructs of the CIITA cDNA cloned in the pIRESNeo vector were generated through mutagenesis. In the F‐CIITA–IRES construct, the first coding ATG of the cDNA was replaced by ATA (G118A) and in the B‐CIITA construct the second ATG codon was replaced by GTG (A188G) (Fig. 6A). The F‐CIITA–IRES and B‐CIITA–IRES constructs were thereby expected to allow the exclusive expression of a 1106‐ or 1130‐amino‐acid form of the CIITA protein respectively. These were next transfected in the HeLa cell line and two G418‐resistant clones per construct were isolated. Each of these clones express all three HLA‐D isotypes (data not shown). The immunoprecipitation of CIITA from total extracts of these transfected cells showed that the F‐CIITA–IRES construct led to the expression of a 12‐kDa recombinant protein presenting the same electrophoretic mobility weight as the CIITA protein expressed in the IFN‐γ‐induced HeLa cell line (Fig. 6B). Accordingly, the B‐CIITA–IRES construct generates a 132‐kDa recombinant protein presenting the same electrophoretic mobility weight as that observed in the HT144 cells (Fig. 6B) and in B lymphocytes (not shown). Similar data were obtained with the 42/95 melanoma cell line transfected with the same constructs (see below). These data therefore show that the major band of CIITA (F‐CIITA) detected in the BUA and 42/95 cell lines treated with IFN‐γ is initiated from the ATG common to all transcripts and present in exon 2 of MHC2TA. In the cell lines where MHC2TA transcripts initiate from promoter III, a longer form of the CIITA protein (B‐CIITA) is additionally expressed, corresponding to the protein initiated from the ATG encoded by the first exon exclusively present in transcripts initiated from this promoter. Nuclear translocation of the CIITA isoforms Through the above study, we have observed that the amount of CIITA protein is 4–6 times weaker in B lymphocytes than in fibroblast cell lines treated by IFN‐γ (see Fig. 5 and legend). This point was quite surprising as the level of expression of MHC class II molecules at the cell surface is higher in B lymphocytes than in fibroblasts (∼1‐log difference between the ROB and BUA cell lines as determined by flow cytometry). To explain these contradictory data we hypothesized that the F‐CIITA isoform might be less efficient in its capacity to translocate to the nucleus. Cell fractionation was thus performed with clones of the 42/95 melanoma cell line transfected with the F‐CIITA–IRES or B‐CIITA–IRES constructs which express different amounts of the recombinant CIITA protein. Immunoprecipitation of CIITA was next done on total, cytoplasmic or nuclear extracts. RFX5 and actin antibodies were used as controls respectively for the nuclear and cytoplasmic contents of the extracts. As depicted in Fig. 7, whatever the isoform of CIITA considered, the amount of each CIITA isoform in the nucleus reflects its total amount in the cell line. The same analysis was performed with the HeLa transfected cells expressing the CIITA isoforms (Fig. 8). Here, again, both isoforms translocate to the nucleus with a relative nuclear concentration paralleling the total amount of CIITA protein. These data therefore suggest that both isoforms translocate to the nucleus within comparable ranges. Considering the fact that overexpression might modulate the regulation of CIITA translocation, the HT144 melanoma cell line was next studied. This cell line presents the advantage of co‐expressing the B‐CIITA and F‐CIITA isoforms. It was then possible to compare the intracellular localization of both CIITA native isoforms through cell fractionation studies. Figure 9 shows that both isoforms of CIITA are present in the nucleus within ratios that are quite similar to that observed for total extracts, thereby confirming that both CIITA isoforms translocate in a similar fashion. The above experiments on overexpressed recombinant forms of CIITA are compatible with the hypothesis that CIITA translocation to the nucleus is not due to a limitation in its nuclear concentration. To verify this point on the native CIITA protein, we used the properties of two melanoma cell lines, 42/95 and M74. As seen in Fig. 10(A), which depicts kinetics of CIITA expression in these cell lines, the amount of CIITA protein in total extracts is considerably higher in the M74 cell line compared to the 42/95 cells. When examining the amount of CIITA protein in the nucleus of both cell lines (Fig. 10B), immunoprecipitation revealed that the amount of protein in the nuclear extracts reflects the total amount of protein, thereby showing that CIITA accumulates in the nucleus without a severe limitation in its nuclear concentration. Taken as a whole our data indicate that F‐CIITA and B‐CIITA isoforms accumulate in the nucleus with a similar efficiency, and that they both activate expression of all three HLA‐D isotypes. In addition we have shown that this accumulation is not severely limited as cells overexpressing either recombinant or native CIITA proteins display high amounts of the protein in the nucleus. Discussion To avoid the biases linked to the study of overexpressed recombinant and tagged forms of proteins, we have chosen to study native CIITA protein. Despite the difficulty in detecting this protein due to its low intracellular concentration, we present here the first description of IFN‐γ‐induced native CIITA protein expression. This study was performed on an established fibroblast cell line, as these cells behave similarly to primary dermal fibroblasts for the induction of HLA‐DR in response to IFN‐γ treatment (39). CIITA protein expression peaks after 16 or 24 h of IFN‐γ treatment depending on the experiments (Fig. 1 and data not shown) and rapidly decreases. The kinetics are not specific for the BUA cell line, as we have obtained similar data with another fibroblast cell line (data not shown) and the 42/95 melanoma cell line (Fig. 10). Interestingly, the recent analysis of H4 histone acetylation of the HLA‐DRA promoter through chromatin immunoprecipitation assay of CIITA and real‐time PCR (40) has led to a kinetics of response to IFN‐γ which is superimposed to the kinetics of CIITA protein expression described here. This suggests that the nuclear transcriptional complex formation is not noticeably delayed after CIITA synthesis. Our data also indicate that the decrease in CIITA binding to the HLA‐DRA promoter that has been observed for a 48‐h IFN‐γ treatment (40) is linked to the decrease of CIITA concentration in the cell line (Fig. 1). Taken together, these data suggest a brief association of CIITA with the nuclear transcriptional complex bound to the HLA‐D promoters and a short half‐life of the protein. Kinetics of cell‐surface HLA‐D expression, HLA‐D or MHC2TA transcripts in response to IFN‐γ have been described by others (23,38,41–44). However, these reports examined either HLA‐D or CIITA expression, and assembling these data was difficult as various cell types and IFN‐γ preparations with different specific activities were used. We therefore describe here the complete sequence of events in a single cellular system, establishing the timing of CIITA protein synthesis relative to MHC2TA and HLA‐D transcript expression. In good agreement with the detection of the protein 2 h after the cytokine addition, we have shown that the MHC2TA transcript is detected as early as 30 min after IFN‐γ induction in the BUA cell line (Fig. 2). This is in discrepancy with a previous analysis of MHC2TA kinetics which described a 2 h delay for the appearance of the transcript (23). This might be explained by the RNase protection assay used in the latter report which is less sensitive than the RT‐PCR method applied here. Accordingly, another report using a RT‐PCR method showed the MHC2TA transcript 1 h after the cytokine addition (38). In addition, we have shown that HLA‐DRA and ‐DRB transcript expression began between 3 and 6 h after cytokine addition (Fig. 3). Here, again, the kinetics are in agreement with the expression of the CIITA protein appearing ∼1–4 h earlier (Fig. 1). The clear non‐coordination of expression of the different isotype chains of the HLA‐D genes in response to IFN‐γ might be explained by the fact that the transcription of certain HLA‐D genes might await the accumulation of sufficient amounts of a specific isoform of CIITA. However, we have observed that, at least when overexpressed, both F‐CIITA and B‐CIITA isoforms can induce all three HLA‐D isotype expression (data not shown). Alternatively, given the lack of pre‐association of the transcription factors in the HeLa cells in the absence of IFN‐γ‐induced CIITA (45), the association of the transcriptional complex to the different HLA‐D promoters might occur within variable timings. Indeed, the transcription factors were shown to display differential affinities for these promoters (46). The differential kinetics could also relate to a requirement for specific CIITA concentrations in the nucleus. It has been demonstrated that the expression of HLA‐DQ depends on higher amounts of CIITA compared to other isotypes (24). Accordingly, in our report, HLA‐DQA transcription begins when CIITA is at its optimal concentration (Figs 1 and 3). We have presented here the first evidence that CIITA appears as one major band of 128 kDa in an IFN‐γ‐treated fibroblast cell line (Fig. 1). In addition, immunoprecipitation of native CIITA in B lymphocyte cell lines was shown to lead to the detection of two major bands (Fig. 5), in agreement with a recent publication (22). Through the use of melanoma cell lines and transfected cells, we have demonstrated that these bands, with apparent mol. wt of 128 and 132 kDa, correspond to different isoforms of CIITA which originate from alternative translation initiation codons (Fig. 6). The resulting F‐CIITA and B‐CIITA isoforms differ from 24 amino acids with theoretical mol. wt of 121 and 124 kDa respectively. The corresponding apparent mol. wt of 128 and 132 kDa obtained through electrophoresis might be explained by the acidic isoelectric point of the protein or by post‐translational modifications. In addition, we have often observed that the 128‐ and 132‐kDa bands appear as doublets both in their native or recombinant forms, which is suggestive of a phosphorylated state of CIITA. Indeed, a faint labeling of CIITA has been observed using anti‐P Ser antibodies, suggesting the presence of phosphorylated serine residues in the CIITA protein (G. Barbieri, unpublished data). Accordingly, serine phosphorylation has been recently described for the recombinant protein labeled with inorganic phosphate (47). A lower mol. wt band of CIITA (with an apparent mol. wt of 124 kDa) with a minor intensity was observed in the BUA fibroblast, 42/95 and HT144 melanoma, and ROB B lymphocyte cell lines. This band is likely not a degradation product as it was not detected in the HeLa and 42/95 transfected cell lines. This band might therefore originate from an alternative splicing of the MHC2TA transcripts, as described previously in B lymphocytes (10). A high mol. wt band (with an apparent mol. wt of 141 kDa) is detected in the ROB, BUA and HeLa cells lines (Fig. 5), but is not present in the transfected cells (Fig. 6), suggesting that this band is not created by a post‐translational modification of CIITA. One hypothesis is that this band might be the dendritic form of CIITA (DC‐CIITA) (22) whose theoretical mol. wt is 132 kDa. The MHC2TA gene presents a complex transcript initiation with alternative usage of at least three promoters (26). This is quite puzzling as one can question the role of different ‘tissue‐specific’ promoters when a certain leakiness in the control of their usage is observed. Indeed, in fibroblast cell lines, given the presence of the IFN‐γ‐responsive enhancer (48), transcripts initiated from promoter III were estimated to represent 16% of the total CIITA‐encoding messengers (26). Interestingly, when the expression of the CIITA isoforms is considered, discrepancies with these results appear. In IFN‐responsive cell lines, B‐CIITA is usually very faint or undetectable (Figs 5–7). As MHC2TA transcripts initiated from promoter III display both translation initiation AUG and thereby might express both isoforms of CIITA, our above data indicate that the usage of the first AUG is rare in fibroblasts. Conversely, in the HT144 melanoma cell line, MHC2TA transcripts are initiated, in the absence of IFN‐γ, from promoter III only (34). However, our data evidence the expression of both CIITA isoforms in this cell line (Figs 5 and 6), thereby indicating an alternative usage of both AUGs from transcripts initiated from promoter III. It is tempting to suggest that the F‐CIITA and B‐CIITA isoforms have different properties. As mentioned above, even though cell‐surface MHC class II expression in B lymphocytes is higher than in IFN‐γ‐treated fibroblasts, our data are suggestive of a significantly lower amount of CIITA protein in lymphocytes compared to the fibroblasts. B‐CIITA might be more stable, more active or might have a longer half‐life in the transcriptional complex. Indeed DC‐CIITA was demonstrated to display a higher activity than B‐CIITA (49). The difference between the B‐CIITA and F‐CIITA isoforms lies in the N‐terminal 24 amino acids. The interaction of CIITA with CBP was described to occur within the first 102 amino acids of the B‐CIITA isoform (12) and was more recently delimitated within amino acids 59–94 of B‐CIITA (31). It has been additionally shown that CBP can acetylate CIITA on lysine residues and that this acetylation affects CIITA translocation into the nucleus (16). A weaker interaction of CIITA with CBP could then result in variable abilities concerning nuclear translocation. The hypothesis of a different efficiency in the nuclear transport of CIITA isoforms was, however, dismissed here. Analysis of the HT144 melanoma cell line has indicated that both CIITA isoforms accumulate in similar amounts in the nucleus (Fig. 10). These data were further confirmed with the analysis of the 42/95 and HeLa cells transfected with either form of CIITA (Figs 8 and 9). Within the hypothesis that B‐CIITA is more efficient in its interaction with CBP, one might otherwise propose that B‐CIITA is more efficiently acetylated than the F‐CIITA isoform and that this acetylated form of CIITA presents a longer half‐life. This would be in agreement with a recent publication showing that the histone acetylase activity of CBP or pCAF is not necessary for the transcriptional activity of CIITA (50). We propose here that this activity might be required further downstream for increased CIITA stability. The respective roles of the two acetylated lysine residues of CIITA (16) should be studied within this perspective. One can additionally propose that the strength of the CIITA–CBP interaction modulates the subset of genes repressed by CIITA. Indeed, recent reports have demonstrated that CIITA can squelch CBP, and therefore interfere with cell growth and IFN response (31) or cytokine production (29). Within this context, the constitutive expression of CIITA in melanoma is an interesting point. Constitutive expression of HLA‐DR has been associated with a bad prognosis for primary melanoma (51). One possibility is that the poor prognosis is actually associated with the constitutive expression of CIITA or alternatively with the abnormal shift from a quasi‐exclusive expression of F‐CIITA to a mixture of both F‐CIITA and B‐CIITA [(34) and this report]. The isoforms might have synergistic or antagonistic interactions. Alternatively, different combinations of the CIITA isoforms might play differential roles depending on the cell type examined. Indeed the demonstration of CIITA dimerization (18–20) leads to the proposal that F‐CIITA homodimers, B‐CIITA homodimers or F/B‐CIITA heterodimers could have different activities or stabilities. In addition the co‐existence of different isoforms of CIITA raises the question of the introduction of N‐terminal tags to B‐CIITA cDNAs, which likely lead to the synthesis of non‐negligible amounts of non‐tagged F‐CIITA isoforms. This point should be considered if both isoforms compete or synergize for specific functions. CIITA is a highly complex molecule presenting an intricate transcriptional, yet leaky tissue‐specific regulation, in addition to a tissue‐specific control of its translation initiation sites. Future studies must now uncover the functions of its different isoforms and their inter‐relations. Acknowledgements This research was supported in part by Association pour la Recherche contre le Cancer, Fondecyt (8000011) and Ecos/Conicyt (C99S02), INSERM Progrès, and Fondation de France. J. V. was supported by a fellowship from the Ligue Nationale contre le Cancer, then from the Fondation pour la Recherche Médicale. G. B. was supported by a grant from the INSERM, then from the Fondation de France. V. D. was supported by a grant from the Association pour la Recherche contre le Cancer. Abbreviations CBP—CREB‐binding protein CIITA—class II transactivator Ii—invariant chain View largeDownload slide Fig. 1. Kinetics of CIITA protein expression in response to IFN‐γ. Total cell extracts (650 µg) from the BUA fibroblasts, untreated and treated with IFN‐γ (250 U/ml) for the indicated times, were immunoprecipitated using anti‐CIITA antibodies. The immunocomplexes were resolved in a 6% acrylamide gel and revealed by Western blot analysis with 1.5 µg/ml 7‐1H monoclonal anti‐human CIITA antibody. (A) The CIITA proteins were immunoprecipitated using 2 µg monoclonal anti‐human CIITA antibody per sample. (B) The immunoprecipitation analysis was performed using 2.5 µg 76 polyclonal anti‐human CIITA antibody per protein sample. The arrows mark the first appearance of detectable induction of the CIITA protein. View largeDownload slide Fig. 1. Kinetics of CIITA protein expression in response to IFN‐γ. Total cell extracts (650 µg) from the BUA fibroblasts, untreated and treated with IFN‐γ (250 U/ml) for the indicated times, were immunoprecipitated using anti‐CIITA antibodies. The immunocomplexes were resolved in a 6% acrylamide gel and revealed by Western blot analysis with 1.5 µg/ml 7‐1H monoclonal anti‐human CIITA antibody. (A) The CIITA proteins were immunoprecipitated using 2 µg monoclonal anti‐human CIITA antibody per sample. (B) The immunoprecipitation analysis was performed using 2.5 µg 76 polyclonal anti‐human CIITA antibody per protein sample. The arrows mark the first appearance of detectable induction of the CIITA protein. View largeDownload slide Fig. 2. Kinetics of MHC2TA and IRF‐1 transcript expression in response to IFN‐γ. The fibroblast BUA cell line was incubated with medium or with IFN‐γ (250 U/ml) for various time periods. Total RNA was extracted and subjected to RT‐PCR analysis with primers specific for MHC2TA using 29 amplification cycles. IRF‐1 and GAPDH transcript expression is included to control respectively IFN‐γ treatment efficiency and cDNA concentrations of the different samples with a 25‐cycle amplification. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 2. Kinetics of MHC2TA and IRF‐1 transcript expression in response to IFN‐γ. The fibroblast BUA cell line was incubated with medium or with IFN‐γ (250 U/ml) for various time periods. Total RNA was extracted and subjected to RT‐PCR analysis with primers specific for MHC2TA using 29 amplification cycles. IRF‐1 and GAPDH transcript expression is included to control respectively IFN‐γ treatment efficiency and cDNA concentrations of the different samples with a 25‐cycle amplification. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 3. Kinetics of HLA‐D gene expression in response to IFN‐γ. Total RNA was extracted from the BUA fibroblast cell line untreated and treated with IFN‐γ (250 U/ml) for the indicated times. The RT‐PCR analysis was performed using different HLA‐D‐specific primers, in addition to Ii. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 3. Kinetics of HLA‐D gene expression in response to IFN‐γ. Total RNA was extracted from the BUA fibroblast cell line untreated and treated with IFN‐γ (250 U/ml) for the indicated times. The RT‐PCR analysis was performed using different HLA‐D‐specific primers, in addition to Ii. The arrows mark the first appearance of detectable stimulation or induction of the RT‐PCR products. View largeDownload slide Fig. 4. Kinetics of the cell‐surface expression of MHC class II and I molecules in response to IFN‐γ. The BUA fibroblasts, untreated or IFN‐γ‐induced (250 U/ml) for the indicated time, were incubated with mAb specific for HLA‐DR (L243), HLA‐DP (B7/21), HLA‐DQ (SPV‐L3) and HLA‐B‐C (W6/32). A FITC‐labeled monoclonal anti‐IgG antibody was used to reveal the binding of the primary antibodies (filled profile) using cytofluorometry. Isotype controls appear as open profiles. View largeDownload slide Fig. 4. Kinetics of the cell‐surface expression of MHC class II and I molecules in response to IFN‐γ. The BUA fibroblasts, untreated or IFN‐γ‐induced (250 U/ml) for the indicated time, were incubated with mAb specific for HLA‐DR (L243), HLA‐DP (B7/21), HLA‐DQ (SPV‐L3) and HLA‐B‐C (W6/32). A FITC‐labeled monoclonal anti‐IgG antibody was used to reveal the binding of the primary antibodies (filled profile) using cytofluorometry. Isotype controls appear as open profiles. View largeDownload slide Fig. 5. Expression of the CIITA protein in cell lines from various tissular origins. (A) Total cell extracts from the BUA fibroblast (Fib) or the HeLa cell lines (900 µg protein/sample), or from the RJ2.2.5 or ROB B lymphocyte (LB) cell lines (3600 µg protein/sample) were immunoprecipitated with 3 µg polyclonal antibody. (B) Total cell extracts from the BUA fibroblast or the 42/95 and HT144 melanoma cell lines (600 µg protein/sample) were immunoprecipitated with 2 µg anti‐CIITA polyclonal antibody. (–) Untreated cells; (+) cells treated for 16 h with 250 U/ml IFN‐γ. View largeDownload slide Fig. 5. Expression of the CIITA protein in cell lines from various tissular origins. (A) Total cell extracts from the BUA fibroblast (Fib) or the HeLa cell lines (900 µg protein/sample), or from the RJ2.2.5 or ROB B lymphocyte (LB) cell lines (3600 µg protein/sample) were immunoprecipitated with 3 µg polyclonal antibody. (B) Total cell extracts from the BUA fibroblast or the 42/95 and HT144 melanoma cell lines (600 µg protein/sample) were immunoprecipitated with 2 µg anti‐CIITA polyclonal antibody. (–) Untreated cells; (+) cells treated for 16 h with 250 U/ml IFN‐γ. View largeDownload slide Fig. 6. Creation and analysis of the F‐CIITA and B‐CIITA recombinant proteins. (A) Site‐directed mutagenesis of the CIITA cDNA cloned in the pIRES‐Neo vector led to G118A or A188G substitutions. The first and second Met codons (Met1 and Met25) were respectively replaced by the ATA and GTG codons, thereby generating the F‐CIITA–IRES and B‐CIITA–IRES constructs. (B) Both constructs were transfected in the HeLa cell line and two G418‐resistant clones were recovered per construct. Immunoprecipitation of CIITA was performed on total extracts (900 µg protein) with 3 µg polyclonal anti‐CIITA antibody. Protein samples were extracted from the HeLa transfected clones and from the HeLa and HT144 cell lines treated (+) or untreated (–) with 250 U/ml IFN‐γ for 16 h. View largeDownload slide Fig. 6. Creation and analysis of the F‐CIITA and B‐CIITA recombinant proteins. (A) Site‐directed mutagenesis of the CIITA cDNA cloned in the pIRES‐Neo vector led to G118A or A188G substitutions. The first and second Met codons (Met1 and Met25) were respectively replaced by the ATA and GTG codons, thereby generating the F‐CIITA–IRES and B‐CIITA–IRES constructs. (B) Both constructs were transfected in the HeLa cell line and two G418‐resistant clones were recovered per construct. Immunoprecipitation of CIITA was performed on total extracts (900 µg protein) with 3 µg polyclonal anti‐CIITA antibody. Protein samples were extracted from the HeLa transfected clones and from the HeLa and HT144 cell lines treated (+) or untreated (–) with 250 U/ml IFN‐γ for 16 h. View largeDownload slide Fig. 7. Localization of CIITA in cellular fractions of the 42/95 cells transfected with pIRES‐Neo or with the F‐CIITA–IRES or B‐CIITA–IRES constructs. The 42/95 Neo clone was either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total protein extracts (900 µg protein), nuclear protein (150 µg protein) or cytoplasmic protein (1092 µg protein) fractions with 3, 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the supernatants of the immunoprecipitated samples (CIITA‐depleted protein extracts), RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 14 µg total protein extract, 2 µg nuclear or 14 µg cytoplasmic protein extract. Samples used to examine RFX5 presence contain 4 µg nuclear or 28 µg cytoplasmic protein extract. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 7. Localization of CIITA in cellular fractions of the 42/95 cells transfected with pIRES‐Neo or with the F‐CIITA–IRES or B‐CIITA–IRES constructs. The 42/95 Neo clone was either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total protein extracts (900 µg protein), nuclear protein (150 µg protein) or cytoplasmic protein (1092 µg protein) fractions with 3, 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the supernatants of the immunoprecipitated samples (CIITA‐depleted protein extracts), RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 14 µg total protein extract, 2 µg nuclear or 14 µg cytoplasmic protein extract. Samples used to examine RFX5 presence contain 4 µg nuclear or 28 µg cytoplasmic protein extract. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 8. Detection of CIITA in the nuclear and cytoplasmic fractions of the HeLa cells expressing the F‐CIITA or B‐CIITA CIITA isoforms. Untransfected HeLa cells were treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1700 µg), nuclear (550 µg) or cytoplasmic (4830 µg) protein fractions with 3, 2.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein extracts, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 2.5 µg nuclear or 20 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 3 µg nuclear or 25 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 8. Detection of CIITA in the nuclear and cytoplasmic fractions of the HeLa cells expressing the F‐CIITA or B‐CIITA CIITA isoforms. Untransfected HeLa cells were treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1700 µg), nuclear (550 µg) or cytoplasmic (4830 µg) protein fractions with 3, 2.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein extracts, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 2.5 µg nuclear or 20 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 3 µg nuclear or 25 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 9. Cytoplasmic and nuclear localization of the CIITA isoforms in the HT144 cell line. Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1000 µg), nuclear (174 µg) or cytoplasmic (1974 µg) protein fractions with 3, 1 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein fractions, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 1.5 µg nuclear or 16.5 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 4 µg nuclear or 44 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 9. Cytoplasmic and nuclear localization of the CIITA isoforms in the HT144 cell line. Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+). Immunoprecipitation of CIITA was performed on total (1000 µg), nuclear (174 µg) or cytoplasmic (1974 µg) protein fractions with 3, 1 or 3 µg of anti‐CIITA polyclonal antibody respectively. In the CIITA‐depleted protein fractions, RFX5 and actin protein expression was examined by Western blot. Samples for the detection of actin contain 1.5 µg nuclear or 16.5 µg cytoplasmic protein fractions. Samples used to examine RFX5 presence contain 4 µg nuclear or 44 µg cytoplasmic protein fractions. The anti‐RFX5 and anti‐actin antibodies were used at 1/1000 and 1/2000 dilutions respectively. View largeDownload slide Fig. 10. Expression and nuclear translocation of CIITA in the 42/95 and M74 melanoma cell lines. (A) Kinetics of expression of the CIITA protein in the melanoma cell lines in response to IFN‐γ (250 U/ml). CIITA was immunoprecipitated from total protein fractions (360 µg) with 1.5 µg of anti‐CIITA polyclonal antibody. Actin expression was analyzed on CIITA‐depleted protein fractions (4 µg protein) by Western blot with a 1/2000 dilution of the anti‐actin antibody. (B) Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+) prior to cell fractionation. Samples of 212 µg nuclear or 2755 µg cytoplasmic protein fractions were immunoprecipitated with 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. Actin and RFX5 expression was next determined on CIITA‐depleted protein fraction. Samples for actin expression contained 2 µg nuclear or 16 µg cytoplasmic protein fraction. Samples for RFX5 expression contained 3.5 µg nuclear or 28 µg cytoplasmic protein fraction. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. View largeDownload slide Fig. 10. Expression and nuclear translocation of CIITA in the 42/95 and M74 melanoma cell lines. (A) Kinetics of expression of the CIITA protein in the melanoma cell lines in response to IFN‐γ (250 U/ml). CIITA was immunoprecipitated from total protein fractions (360 µg) with 1.5 µg of anti‐CIITA polyclonal antibody. Actin expression was analyzed on CIITA‐depleted protein fractions (4 µg protein) by Western blot with a 1/2000 dilution of the anti‐actin antibody. (B) Cells were either untreated (–) or treated with 250 U/ml IFN‐γ for 16 h (+) prior to cell fractionation. Samples of 212 µg nuclear or 2755 µg cytoplasmic protein fractions were immunoprecipitated with 1.5 or 3 µg of anti‐CIITA polyclonal antibody respectively. Actin and RFX5 expression was next determined on CIITA‐depleted protein fraction. Samples for actin expression contained 2 µg nuclear or 16 µg cytoplasmic protein fraction. Samples for RFX5 expression contained 3.5 µg nuclear or 28 µg cytoplasmic protein fraction. The anti‐RFX5 and anti‐actin antibodies were respectively used at 1/1000 and 1/2000 dilutions. References 1 Germain, R. N. 1994. MHC‐dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell  76: 287. Google Scholar 2 Glimcher, L. H. and Kara, C. J. 1992. Sequences and factors: a guide to MHC class II transcription. Annu. Rev. Immunol.  10: 13. Google Scholar 3 Dorn, A., Durand, B., Marfing, C., LeMeur, M., Benoist, C. and Mathis, D. 1987. Conserved major histocompatibility complex class II boxes X and Y are transcriptional control elements and specifically bind nuclear proteins. Proc. Natl Acad. Sci. USA  84: 6249. Google Scholar 4 Steimle, V., Durand, B., Barras, E., Zufferey, M., Hadam, M. R., Mach, B. and Reith, W. 1995. A novel DNA‐binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev.  9: 1021. Google Scholar 5 Masternak, K., Barras, E., Zufferey, M., Conrad, B., Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, D. F., Mach, B. and Reith, W. 1998. A gene encoding a novel RFX‐associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat. Genet.  20: 273. Google Scholar 6 Durand, B., Sperisen, P., Emery, P., Barras, E., Zufferey, M., Mach, B. and Reith, W. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J.  16: 1045. Google Scholar 7 Moreno, C. S., Emery, P., West, J. E., Durand, B., Reith, W., Mach, B. and Boss, J. M. 1995. Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. J. Immunol.  155: 4313. Google Scholar 8 Dorn, A., Bollekens, J., Staub, A., Benoist, C. and Mathis, D. 1987. A multiplicity of CCAAT box‐binding proteins. Cell  50: 863. Google Scholar 9 Zhu, X. S., Linhoff, M. W., Li, G., Chin, K. C., Maity, S. N. and Ting, J. P. 2000. Transcriptional scaffold: CIITA interacts with NF‐Y, RFX, and CREB To cause stereospecific regulation of the class II major histocompatibility complex promoter. Mol. Cell. Biol.  20: 6051. Google Scholar 10 Riley, J. L., Westerheide, S. D., Price, J. A., Brown, J. A. and Boss, J. M. 1995. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity  2: 533. Google Scholar 11 Fontes, J. D., Jiang, B. and Peterlin, B. M. 1997. The class II trans‐activator CIITA interacts with the TBP‐associated factor TAFII32. Nucleic Acids Res.  25: 2522. Google Scholar 12 Kretsovali, A., Agalioti, T., Spilianakis, C., Tzortzakaki, E., Merika, M. and Papamatheakis, J. 1998. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol. Cell. Biol.  18: 6777. Google Scholar 13 Chin, K. C., Li, G. G. and Ting, J. P. 1997. Importance of acidic, proline/serine/threonine‐rich, and GTP‐binding regions in the major histocompatibility complex class II transactivator: generation of transdominant‐negative mutants. Proc. Natl Acad. Sci. USA  94: 2501. Google Scholar 14 Cressman, D. E., Chin, K. C., Taxman, D. J. and Ting, J. P. 1999. A defect in the nuclear translocation of CIITA causes a form of type II bare lymphocyte syndrome. Immunity  10: 163. Google Scholar 15 Cressman, D. E., O’Connor, W. J., Greer, S. F., Zhu, X. S. and Ting, J. P. 2001. Mechanisms of nuclear import and export that control the subcellular localization of class ii transactivator. J. Immunol.  167: 3626. Google Scholar 16 Spilianakis, C., Papamatheakis, J. and Kretsovali, A. 2000. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol. Cell. Biol.  20: 8489. Google Scholar 17 Hake, S. B., Masternak, K., Kammerbauer, C., Janzen, C., Reith, W. and Steimle, V. 2000. CIITA leucine‐rich repeats control nuclear localization, in vivo recruitment to the major histocompatibility complex (MHC) class II enhanceosome, and MHC class II gene transactivation. Mol. Cell. Biol.  20: 7716. Google Scholar 18 Linhoff, M. W., Harton, J. A., Cressman, D. E., Martin, B. K. and Ting, J. P. 2001. Two distinct domains within CIITA mediate self‐association: involvement of the GTP‐binding and leucine‐rich repeat domains. Mol. Cell. Biol.  21: 3001. Google Scholar 19 Sisk, T. J., Roys, S. and Chang, C. H. 2001. Self‐association of CIITA and its transactivation potential. Mol. Cell. Biol.  21: 4919. Google Scholar 20 Kretsovali, A., Spilianakis, C., Dimakopoulos, A., Makatounakis, T. and Papamatheakis, J. 2001. Self‐association of class ii transactivator correlates with its intracellular localization and transactivation. J. Biol. Chem.  276: 32191. Google Scholar 21 Steimle, V., Otten, L. A., Zufferey, M. and Mach, B. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell  75: 135. Google Scholar 22 Landmann, S., Muhlethaler‐Mottet, A., Bernasconi, L., Suter, T., Waldburger, J. M., Masternak, K., Arrighi, J. F., Hauser, C., Fontana, A. and Reith, W. 2001. Maturation of dendritic cells is accompanied by rapid transcriptional silencing of class II transactivator (CIITA) expression. J. Exp. Med.  194: 379. Google Scholar 23 Steimle, V., Siegrist, C. A., Mottet, A., Lisowska‐Grospierre, B. and Mach, B. 1994. Regulation of MHC class II expression by interferon‐gamma mediated by the transactivator gene CIITA. Science  265: 106. Google Scholar 24 Otten, L. A., Steimle, V., Bontron, S. and Mach, B. 1998. Quantitative control of MHC class II expression by the transactivator CIITA. Eur. J. Immunol.  28: 473. Google Scholar 25 Lennon, A. M., Ottone, C., Rigaud, G., Deaven, L. L., Longmire, J., Fellous, M., Bono, R. and Alcaide‐Loridan, C. 1997. Isolation of a B‐cell‐specific promoter for the human class II transactivator. Immunogenetics  45: 266. Google Scholar 26 Muhlethaler‐Mottet, A., Otten, L. A., Steimle, V. and Mach, B. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J.  16: 2851. Google Scholar 27 Piskurich, J. F., Linhoff, M. W., Wang, Y. and Ting, J. P. 1999. Two distinct gamma interferon‐inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor beta. Mol. Cell. Biol.  19: 431. Google Scholar 28 Gourley, T., Roys, S., Lukacs, N. W., Kunkel, S. L., Flavell, R. A. and Chang, C. H. 1999. A novel role for the major histocompatibility complex class II transactivator CIITA in the repression of IL‐4 production. Immunity  10: 377. Google Scholar 29 Sisk, T. J., Gourley, T., Roys, S. and Chang, C. H. 2000. MHC class II transactivator inhibits IL‐4 gene transcription by competing with NF‐AT to bind the coactivator CREB binding protein (CBP)/p300. J. Immunol.  165: 2511. Google Scholar 30 Gourley, T. S. and Chang, C. H. 2001. The class II transactivator prevents activation‐induced cell death by inhibiting Fas ligand gene expression. J. Immunol.  166: 2917. Google Scholar 31 Zhu, X. S. and Ting, J. P. 2001. A 36‐amino‐acid region of CIITA is an effective Inhibitor of CBP: novel mechanism of gamma interferon‐mediated suppression of collagen alpha(2)(I) and other promoters. Mol. Cell. Biol.  21: 7078. Google Scholar 32 Lennon, A., Ottone, C., Peijnenburg, A., Hamon‐Benais, C., Colland, F., Gobin, S., van den Elsen, P., Fellous, M., Bono, R. and Alcaide‐Loridan, C. 1996. The RAG cell line defines a new complementation group of MHC class II deficiency. Immunogenetics  43: 352. Google Scholar 33 Lu, Y., Ussery, G. D., Muncaster, M. M., Gallie, B. L. and Blanck, G. 1994. Evidence for retinoblastoma protein (RB) dependent and independent IFN‐γ responses: RB coordinately rescues IFN‐γ induction of MHC class II gene transcription in noninducible breast carcinoma cells. Oncogene  9: 1015. Google Scholar 34 Deffrennes, V., Vedrenne, J., Stolzenberg, M. C., Piskurich, J., Barbieri, G., Ting, J. P., Charron, D. and Alcaide‐Loridan, C. 2001. Constitutive expression of MHC class II genes in melanoma cell lines results from the transcription of class II transactivator abnormally initiated from its B cell‐specific promoter. J. Immunol.  167: 98. Google Scholar 35 Naves, R., Lennon, A. M., Barbieri, G., Reyes, L., Puga, G., Salas, L., Deffrennes, V., Rosemblatt, M., Fellous, M., Charron, D., Alcaide‐Loridan, C. and Bono, M. R. 2002. MHC class‐II deficient tumor cell lines with a defective expression of the class II transactivator (CIITA). Int. Immunol.  14: 1. Google Scholar 36 Watson, A. J., DeMars, R., Trowbridge, I. S. and Bach, F. H. 1983. Detection of a novel human class II HLA antigen. Nature  304: 358. Google Scholar 37 Marti, G. E., Kuo, M. C., Shaw, S., Chang, C. C., Demars, R., Sogn, J. A., Coligan, J. E. and Kindt, T. J. 1983. A novel HLA‐D/DR‐like antigen specific for human B lymphoid cells. Biochemica l evidence for similarity to but nonidentity with known HLA‐D/DR antigens. J. Exp. Med.  158: 1924. Google Scholar 38 Chang, C. H., Fontes, J. D., Peterlin, M. and Flavell, R. A. 1994. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J. Exp. Med.  180: 1367. Google Scholar 39 Lisowska‐Grospierre, B., Durandy, A., Virelizier, J. L., Fischer, A. and Griscelli, C. 1983. Combined immunodeficiency with defective expression of HLA antigens: modulation of an abnormal HLA and functional studies. Birth Defects  19: 87. Google Scholar 40 Beresford, G. W. and Boss, J. M. 2001. CIITA coordinates multiple histone acetylation modifications at the HLA‐DRA promoter. Nat. Immunol.  2: 652. Google Scholar 41 Capobianchi, M. R., Ameglio, F., Tosi, R. and Dolei, A. 1985. Differences in the expression and release of DR, BR, and DQ molecules in human cells treated with recombinant interferon gamma: comparison to other interferons. Hum. Immunol.  13: 1. Google Scholar 42 Teyton, L., Lotteau, V., Turmel, P., Arenzana‐Seisdedos, F., Virelizier, J. L., Pujol, J. P., Loyau, G., Piatier‐Tonneau, D., Auffray, C. and Charron, D. J. 1987. HLA DR, DQ, and DP antigen expression in rheumatoid synovial cells: a biochemical and quantitative study. J. Immunol.  138: 1730. Google Scholar 43 Takiguchi, M., Ting, J. P., Buessow, S. C., Boyer, C., Gillespie, Y. and Frelinger, J. A. 1985. Response of glioma cells to interferon‐gamma: increase in class II RNA, protein and mixed lymphocyte reaction‐stimulating ability. Eur. J. Immunol.  15: 809. Google Scholar 44 Chin, K. C., Mao, C., Skinner, C., Riley, J. L., Wright, K. L., Moreno, C. S., Stark, G. R., Boss, J. M. and Ting, J. P. 1994. Molecular analysis of G1B and G3A IFN‐ gamma mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity  1: 687. Google Scholar 45 Villard, J., Muhlethaler‐Mottet, A., Bontron, S., Mach, B. and Reith, W. 1999. CIITA‐induced occupation of MHC class II promoters is independent of the cooperative stabilization of the promoter‐bound multi‐protein complexes. Int. Immunol.  11: 461. Google Scholar 46 Reith, W., Kobr, M., Emery, P., Durand, B., Siegrist, C.‐A. and Mach, B. 1994. Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters. J. Biol. Chem.  269: 20020. Google Scholar 47 Li, G., Harton, J. A., Zhu, X. and Ting, J. P. 2001. Downregulation of CIITA function by protein kinase a (PKA)‐mediated phosphorylation: mechanism of prostaglandin E, cyclic AMP, and PKA inhibition of class II major histocompatibility complex expression in monocytic lines. Mol. Cell. Biol.  21: 4626. Google Scholar 48 Piskurich, J. F., Wang, Y., Linhoff, M. W., White, L. C. and Ting, J. P. 1998. Identification of distinct regions of 5′ flanking DNA that mediate constitutive, IFN‐gamma, STAT1, and TGF‐beta‐regulated expression of the class II transactivator gene. J. Immunol.  160: 233. Google Scholar 49 Nickerson, K., Sisk, T. J., Inohara, N., Yee, C. S., Kennell, J., Cho, M. C., Yannie, P. J., II, Nunez, G. and Chang, C. H. 2001. Dendritic cell‐specific MHC class II transactivator contains a caspase recruitment domain that confers potent transactivation activity. J. Biol. Chem.  276: 19089. Google Scholar 50 Harton, J. A., Zika, E. and Ting, J. P. 2001. The histone acetyltransferase domains of CBP and pCAF are not necessary for cooperativity with CIITA. J. Biol. Chem.  20: 20. Google Scholar 51 Zaloudik, J., Moore, M., Ghosh, A. K., Mechl, Z. and Rejthar, A. 1988. DNA content and MHC class II antigen expression in malignant melanoma: clinical course. J. Clin. Pathol.  41: 1078. Google Scholar Author notes 1INSERM U396, Centre de Recherches Biomédicales des Cordeliers and Laboratoire d’Immunologie et d’Histocompatibilité, APHP, Hôpital St Louis, 75270 Paris, France 2INSERM U429, Hôpital Necker Enfants‐Malades, 75015 Paris, France 3Departamento de Biologia, Facultad de Ciencias, Universidad de Chile, Santiago, Chile 4Permanent address: Istituto di Biologia dello Sviluppo, CNR, 90146 Palermo, Italy

Journal

International Immunology – Oxford University Press

Published: Aug 1, 2002

There are no references for this article.