Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells *

STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells * THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 13, pp. 9358 –9363, March 30, 2007 © 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells Received for publication, December 28, 2006, and in revised form, January 16, 2007 Published, JBC Papers in Press, February 3, 2007, DOI 10.1074/jbc.C600321200 ‡ ‡1 ‡2,3 ‡3 § Xuexian O. Yang , Athanasia D. Panopoulos , Roza Nurieva , Seon Hee Chang , Demin Wang , ‡ ‡4 Stephanie S. Watowich , and Chen Dong ‡ § From the Department of Immunology, M.D. Anderson Cancer Center, Houston, Texas 77030 and the Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226 Interleukin-17 (IL-17)-producing helper T (TH) cells, named and activator of transcription (STAT) proteins (3, 4). TH1 dif- as TH , TH17, or inflammatory TH (THi), have been recently ferentiation and IFN- production is promoted by IL-12, a het- IL-17 identified as a novel effector lineage. However, how cytokine erodimeric cytokine produced by activated antigen-presenting signals mediate THi differentiation is unclear. We found that cells that signal through STAT4. The IFN--STAT1 pathway in IL-6 functioned to up-regulate IL-23R and that IL-23 synergized turn sustains TH1 development, leading to the induction of with IL-6 in promoting THi generation. STAT3, activated by transcription factor T-bet. On the other hand, IL-4, secreted by both IL-6 and IL-23, plays a critical role in THi development. A activated T cells, drives TH2 polarization in a STAT6-depend- hyperactive form of STAT3 promoted THi development, ent manner, resulting in activation of the transcription factor whereas this differentiation process was greatly impaired in GATA3. STAT3-deficient T cells. Moreover, STAT3 regulated the Recently, a third subset of TH cells, named as TH , TH17, IL-17 expression of retinoic acid receptor-related orphan receptor or inflammatory TH (THi), which produce IL-17, was identified -T (RORt), a THi-specific transcriptional regulator; STAT3 by us as well as other investigators to mediate a pathogenic deficiency impaired RORt expression and led to elevated inflammatory response (5–7). THi cells were also found to pro- expression of T-box expressed in T cells (T-bet) and Forkhead duce IL-17F and IL-22 (5, 7–9). IL-23, sharing a p40 unit with box P3 (Foxp3). Our data thus demonstrate a pathway whereby IL-12, has been first found to regulate IL-17 expression and the cytokines regulate THi differentiation through a selective STAT development or expansion of THi cells in vitro (5–7). More transcription factor that functions to regulate lineage-specific recently, several groups showed that TGF- in the context of gene expression. IL-6 and other inflammatory cytokines supports THi differen- tiation in vitro, independent of IL-23 (10–12), possibly at least in part by regulating the chromatin remodeling of the IL-17-IL- CD4 helper T (TH) cells are essential organizers in 17F locus (13). IL-1 and TNF- may also be involved in pro- immune responses. Upon activation, naive TH cells differenti- moting THi development or in regulating expression of IL-17 at ate into effector cells that have been historically classified into the effector phase (11, 14). two lineages, TH1 and TH2, based on their cytokine secretion The downstream signaling pathways, such as STAT, that and immune regulatory function (1, 2). TH1 cells secret IFN- selectively mediate THi generation are unclear. STAT1 appears and regulate cellular immunity, whereas TH2 cells produce to negatively regulate THi differentiation (7), whereas STAT4 IL-4, IL-5, and IL-13 and mediate the humoral response. The or STAT6 were not involved (6). Recently, Socs3-deficient T cytokine microenvironment during TH activation determines cells were found to exhibit enhanced IL-17 expression; this TH effector differentiation through selective signal transducer effect was associated with enhanced activity of STAT3 in response to IL-23 that could bind to IL-17 and IL-17F promot- * This work was supported by research grants from the National Institutes of ers (15). STAT3 has critical functions in the immune system, Health (to C. D. and D. W.), American Cancer Society (to D. W.), and M. D. Anderson Cancer Center (to S. S. W.). The costs of publication of this article including control of dendritic cell production, inhibition of were defrayed in part by the payment of page charges. This article must macrophage inflammatory signaling, and regulation of steady therefore be hereby marked “advertisement” in accordance with 18 U.S.C. state and emergency granulopoiesis (16–18). However, the pre- Section 1734 solely to indicate this fact. Supported by an National Institutes of Health training grant and an Ameri- cise physiological function of STAT3 in THi lineage differenti- can Legion Auxiliary Award. 2 ation has not been directly addressed. Whether STAT5, Recipient of a scientist development grant from the American Heart another STAT protein that has been shown activated by IL-23R Association. Recipients of postdoctoral fellowships from the Arthritis Foundation. (19), has any function in THi differentiation is also unclear. A Cancer Research Institute Investigator and an M. D. Anderson Cancer Cen- In this study, we show that IL-6 up-regulates expression of ter Trust Fellow. To whom correspondence should be addressed. Fax: 713- IL-23R and that IL-23 synergizes with IL-6 in promoting THi 563-0604; E-mail: [email protected]. The abbreviations used are: TH, CD4 helper T cells; THi, inflammatory TH; differentiation. Retroviral expression of a hyperactive STAT3 STAT, signal transducer and activator of transcription; IL, interleukin; enhances THi cell development. STAT3 deficiency in CD4 T TGF-, transforming growth factor; TNF-, tumor necrosis factor; IFN-, interferon ; RORt, RAR-related orphan receptor -T; RAR, retinoic acid cells results in impaired THi development and a deficiency in receptor; T-bet, T-box expressed in T cells; GATA3, GATA-binding protein 3; RORt, a THi-specific transcription factor recently identified FoxP3, Forkhead box P3; FACS, fluorescence-activated cell sorter; GFP, (20). These data indicate that STAT3 is a cytokine-activated green fluorescent protein; MSCV, murine stem cell virus; IRES, internal ribo- some entry site; CFA, complete Freund’s adjuvant; WT, wild type. essential regulator in THi development. 9358 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 This is an Open Access article under the CC BY license. STAT3 Regulates Generation of IL-17-expressing T Cells MATERIALS AND METHODS IFN-, forward, GATGCATTCATGAGTATTGCCAAGT, and reverse, GTGGACCACTCGGATGAGCTC; T-bet, for- Mice and Immunization—Il-6- and Ifng-deficient mice were ward, CAACAACCCCTTTGCCAAAG, and reverse, TCCCC- purchased from Jackson Laboratories. Stat3 fl and Tie2-Cre CAAGCAGTTGACAGT; GATA3, forward, AGAACCGGCC- mice were generously provided by Drs. Takeda and Koni (21, CCTTATGAA, and reverse, AGTTCGCGCAGGATGTCC; 22) and were bred to yield fl/ Cre and Cre littermates as and -actin, forward, GACGGCCAGGTCATCACTATTG, described (18). Mice were housed in the specific pathogen-free and reverse, AGGAAGGCTGGAAAAGAGCC. The primers animal facility at M.D. Anderson Cancer Center, and the ani- for IL-12R2, IL-23R, IL-17, IL-17F, RORt, Foxp3, and IL-22 mal experiments were performed using protocols approved by were synthesized as described previously (7, 8, 20, 29, 30). the Institutional Animal Care and Use Committee at M.D. Anderson Cancer Center. For immunization, Il-6 knock-out RESULTS AND DISCUSSION and C57BL/6 mice were inoculated with MOG peptide in 35–55 IL-6 Induces IL-23 Responsiveness during THi Differentiation— CFA. 5–7 days later, splenocytes were collected from the IL-6 and IL-23 are both induced in innate immune responses to immunized mice and restimulated with MOG peptide for 3 infectious agents. IL-23 was previously shown to be important in days. In the final 5 h, Golgi-stop (BD Biosciences) was added, the development or expansion of THi cells in vivo (5), whereas IL-6 and IL-17- and IFN--producing cells were analyzed using a BD is potent in THi development in vitro and has recently been shown CytoFix/CytoPerm intracellular staining kit (BD Biosciences) to be necessary in RORt-dependent IL-17 expression in the lam- following the manufacturer’s instructions. ina propria (20). To further examine whether IL-6 is required for TH Differentiation—Naive CD4 T cells were isolated from THi differentiation in vivo, C57BL/6 and Il-6 knock-out mice were spleen and lymph nodes of various strains of mice by immunized with MOG peptide and CFA. 5–7 days later, spleno- AutoMACS (Miltenyi Biotec) selection of CD62L or FACS cytes collected from the immunized mice were restimulated with sorting of CD4CD62LCD44loCD25 T cells after enrich- MOG peptide and stained for CD4, IL-17, and IFN-.In Il-6 ing CD4 T cells by negative selection using rat anti-mouse knock-out mice, THi cells were greatly reduced relative to WT antibodies for CD8, B220, and I-A/I-E and Qiagen BioMag mice, whereas IFN--producing TH1 cells were only moderately goat anti-rat IgG beads. T cells were activated with plate-bound affected (Fig. 1A). anti-CD3 (2 g/ml) and anti-CD28 (2 g/ml) and 50 units/ml IL-6 and IL-23 are thus both important in regulation of THi IL-2 in the presence or absence of 20 ng/ml IL-6 (Peprotech), 50 cells in vivo. We attempted to analyze their functional relation- ng/ml IL-23 (R&D systems), 2 ng/ml TGF- (Sigma-Aldrich), ship during THi differentiation. Because IFN- has been shown 10 g/ml anti-IL-4 (11B11), or 10 g/ml anti-IFN- (XMG1.2), as a potent inhibitor of THi differentiation (6, 7), we next iso- 10 ng/ml TNF-, 10 ng/ml IL-1, or cocktails of these stimuli, lated naive TH cells from IFN--deficient mice and activated as indicated. 4 days after activation, cells were restimulated them with plate-bound anti-CD3 and anti-CD28 in the pres- with 500 ng/ml ionomycin and 50 ng/ml phorbol 12-myristate ence of different cytokines and/or cytokine-neutralizing anti- 13-acetate (Sigma-Aldrich) in the presence of Golgi-stop for bodies. 4–5 days after activation, the differentiated cells were 5 h, after which IL-17- and IFN--producing cells were ana- analyzed by intracellular staining. IL-6 increased the number of lyzed using intracellular staining as described above. Intracel- IL-17-expressing THi cells, which was more pronounced in the lular staining for FoxP3 was performed by using a FoxP3 stain- presence of anti-IL-4 or, even more dramatically, TGF- (Fig. ing kit (eBioscience). 1B). Although IL-23 was a poor inducer of THi differentiation Retroviral Transduction—STAT3C (a gift from J. Darnell’s by itself, the combination of IL-6 and IL-23 led to greatly laboratory) (24) was cloned into the bicistronic retroviral vector enhanced development of THi cells (Fig. 1B). To substantiate pGFP-RV (25). Stat5A and Stat5A 1 6 sequences were cloned the synergy between IL-6 and IL-23, we purified CD4CD25- into a bicistronic retrovirus MSCV-IRES-GFP vector (26). The CD62LhiCD44lo naive TH cells from C57BL/6 mice and acti- expression of the cloned gene and green fluorescent protein vated them with anti-CD3 and anti-CD28 in the presence of (GFP) is under murine stem cell virus (MSCV) promoter con- IL-6 and/or IL-23 for 5 days and analyzed THi differentiation by trol. The ecotropic virus-producing cells GPE86 (27) were intracellular staining. IL-6 weakly induced THi differentiation generated as described previously (28). Naive CD4 T cells (Fig. 1C). Although IL-23 had no effect on its own, it synergized were activated under the indicated conditions for 2 days and with IL-6 in promoting generation of IL-17-expressing TH cells infected with viral supernatants produced by the stable lines as (Fig. 1C). We also observed synergy of IL-6 and IL-23 in THi described previously (25). 2–4 days after infection, the cells differentiation of naive OT-II cells activated with antigen-pre- were tested for IL-17 and IFN- expression using intracellular senting cells in the presence or absence of TGF- (data not staining. In some experiments, GFP cells were sorted by shown). Our data thus not only support a unique function of FACS and subjected to analysis for gene expression. IL-6 in initiating THi differentiation but also, more impor- Quantitative Real-time PCR—Total RNA was prepared from tantly, demonstrate a synergistic action of IL-6 and IL-23. T cells using TRIzol reagent (Invitrogen). cDNA was synthe- To further understand why IL-23 only functions in IL-6- sized using SuperScript reverse transcriptase under priming of treated cells, we stimulated naive TH cells with anti-CD3 and oligo(dT) (Invitrogen), and gene expression was examined in a anti-CD28 for 48 h in the presence of IL-6 and/or IL-23 and Bio-Rad iCycler optical system using the iQ™ SYBR green real- examined expression of IL-23R by real-time RT-PCR analysis. time PCR kit (Bio-Rad Laboratories, Inc.). The data were nor- Interestingly, whereas T cells after activation moderately up- malized to -actin reference. The primers used were (5 to 3): regulated IL-23R mRNA in the presence or absence of IL-23, MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9359 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 1. IL-6 and IL-23 synergize in regulating THi cell development. A, Il-6 knock-out (IL-6 KO) or B6 mice were immunized with MOG/CFA. 5–7 days after immunization, splenocytes were harvested from the immunized mice and restimulated with MOG peptide for 3 days. Cells expressing IL-17 and IFN- were accessed using intracellular staining. Unimmunized B6 control is shown as B6 noim. The experiments were repeated twice with similar results. B, CD4CD62Lhi T cells isolated from Ifng knock-out mice using AutoMACS were activated with plate-bound anti-CD3 and anti-CD28 in the presence or absence of indicated cytokines and/or cytokine-neutralizing antibodies. IL-17-producing cells were tested using intracellular staining. The experiments were repeated twice with similar results. NO, medium. C, FACS-sorted CD4CD25-CD62LhiCD44lo naive T cells from C57BL/6 mice were activated with plate-bound anti-CD3 and anti-CD28 in the presence of indicated cytokines, and IL-17-producing cells were assessed using intracellular staining. D, naive T cells isolated as in C were activated with plate-bound anti-CD3 and anti-CD28 in the absence or presence of IL-23 or IL-6 for 24 h, and IL-23R mRNA expression was examined by real-time PCR. The data shown were normalized to expression of a reference gene -actin, and the expression level in naive T cells was referred as 1. IL-6 increased the expression of IL-23R in activated T cells by We next went on to determine the role of STAT3, which 120-fold (Fig. 1D). Our above results altogether indicate that could be activated by both IL-6 and IL-23 (18, 22), by overex- THi differentiation is initially mediated by IL-6, which induces pressing a hyperactive STAT3 form (STAT3C) (24). Naive IL-23 responsiveness to enhance this differentiation CD4 T cells isolated from Ifng knock-out mice were activated STAT3 Hyperactivation Enhances THi Differentiation— as above and infected with STAT3C and control viruses. Under STAT proteins are key factors mediating cytokine signals dur- neutral conditions or in the presence of TGF- or anti-IL-4, ing TH1 and TH2 differentiation. Although STAT3 is an STAT3C increased IL-17-expressing cells when compared with important target of IL-6, IL-23 has been shown to activate those infected with a control vector. Since the activation of STAT1, STAT3, STAT4, and STAT5 proteins (19). Since STAT3C still requires cytokine-mediated phosphorylation, in STAT1 and STAT4 are not involved in THi differentiation (6, the presence of IL-6 and IL-23 or under THi differentiation 7), we first examined STAT5. We overexpressed WT (STAT5A conditions, STAT3C greatly increased the numbers of IL-17- WT) or a constitutively active form (STAT5A 1 6) (31) of producing cells (Fig. 2A). Similarly, when we infected wild-type STAT5A using the bicistronic retroviral vector MSCV-IRES- CD4 T cells, STAT3C also enhanced THi differentiation GFP during TH differentiation. Naive CD4 T cells isolated under THi but not neutral condition (Fig. 2B). THi cells were from C57BL/6 mice were activated with plate-bound anti-CD3, also reported to produce IL-17F (5, 7). In wild-type cells trans- anti-CD28, and IL-2 in the presence of various polarizing cyto- duced with STAT3C, when compared with those infected by a kines or cytokine blockers, infected on day 2, and subsequently control virus, IL-17F expression was also greatly enhanced (Fig. further differentiated under the polarizing conditions. On day 2C) when we used an antibody specific for IL-17F. 5, IL-17 expression was analyzed in transduced CD4 cells. To further assess the effect of STAT3C during TH cell differ- Under neutral or THi favorable conditions, neither WT entiation, expression of TH lineage-specific genes was exam- STAT5A nor STAT5A 1 6 had any effect on THi development when compared with cells infected with a control virus (data not shown). S. H. Chang and C. Dong, unpublished data. 9360 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 2. STAT3 hyperactivation promotes THi differentiation in vitro. CD4CD62Lhi naive T cells from Ifng-deficient (A)orWT(B) mice were purified by AutoMACS and activated under indicated conditions for 2 days and infected with STAT3C or control viruses. 2 days after infection and culture under the indicated differentiation conditions, the cells expressing IL-17 were examined by intracellular staining. The analysis was gated on CD4GFP cells. The experiment was repeated at least three times with consistent results. C, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses, and the cells expressing IL-17F were analyzed using intracellular staining on gated CD4GFP cells. D, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses under THi conditions. After infection, CD4GFP cells were sorted by FACS, and gene expression was measured by quantitative real-time RT-PCR. The data shown are -fold changes of STAT3C versus vector control normalized to expression of a reference gene -actin. ined in wild-type TH cells that were transduced with vector or from fl/ Cre (Stat3 KO) and Cre (WT) mice were differ- STAT3C virus and differentiated under THi conditions. Using entiated in vitro in the presence of TGF-, IL-6, IL-23, anti- quantitative real-time PCR, when compared with vector con- IFN-, and anti-IL-4 or TGF-, IL-6, IL-1, and TNF- as trol, STAT3C transduction resulted in up-regulation of IL-23R described previously (11). Consistently in both systems, expres- and THi cytokines IL-17 and IL-17F and suppression of TH1- sion of IL-17 by Stat3-deficient T cells was greatly impaired, specific IL-12R2 and IFN- (Fig. 2D). Remarkably, IL-22, a and expression of IFN- was moderately increased (Fig. 3A), cytokine expressed in THi cells that may synergize with IL-17 in indicating an essential role of STAT3 in THi differentiation in inflammation (8, 9), was highly up-regulated in STAT3C-trans- vitro. duced TH cells. Moreover, STAT3 overactivation also reduced In addition to the above cytokine measurement, we also per- GATA3 and T-bet expression but increased the expression of formed real-time RT-PCR analysis on Stat3-sufficient and -de- RORt, a transcription regulator of THi differentiation (20). ficient TH cells that were activated under conditions favoring Thus, STAT3 promotes the THi program and inhibits TH1 and THi differentiation. Consistent with the previous data, we TH2 programs. observed greatly reduced IL-17 as well as IL-17F and IL-22 THi Differentiation Is STAT3-dependent—Our data indicate expression and moderately elevated IFN- expression in Stat3- a potential role of STAT3 in regulating cytokine-mediated THi deficient TH cells (Fig. 3C). IL-23 receptor mRNA expression development. We further examined the role of STAT3 in THi was down-regulated, whereas IL-12R1 was up-regulated in development by using Stat3-deficient CD4 T cells. Mice with the absence of STAT3 (Fig. 3C). Most importantly, expression hematopoietic and endothelial-specific Stat3 deletion were of RORt was greatly reduced in Stat3-deficient TH cells, indi- generated by breeding floxed STAT3 (fl) (22) and Tie2-Cre (21) cating that STAT3 is necessary for RORt expression during strains. Deficiency of STAT3 expression in hematopoietic cells THi differentiation. Moreover, expression of T-bet and Foxp3 from these mice was confirmed by Western blot (data not was increased (Fig. 3C), suggesting that STAT3 may repress shown). Naive CD4CD25-CD62LhiCD44lo T cells isolated TH1 and inducible regulatory T cell differentiation. Indeed, MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9361 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 3. THi differentiation is dependent on STAT3. A–C, FACS-sorted CD4CD25-CD62LhiCD44lo T cells from Stat3 fl/ Tie2-Cre mice (STAT3 KO)or littermate Cre mice (WT) were differentiated under THi conditions. 4 days after polarization, the differentiated cells were assessed for IL-17 or IFN- produc- tion (A) or FoxP3 expression (B) using intracellular staining. Some cells were restimulated with plate-bound anti-CD3, and messenger RNA expression was analyzed by quantitative real-time RT-PCR (C). The data shown are -fold changes of STAT3 KO versus WT control normalized to expression of the -actin reference. D, memory CD4 T cells were isolated from Stat3 KO mice or WT littermate controls were activated with plate-bound anti-CD3 for 24 h, and the cells producing IL-17 or IFN- were assessed by intracellular staining. The data represent at least two independent experiments with consistent results. there was a greater number of Foxp3-expressing TH cells in the and Il-17F genes, which was enhanced in Socs3-deficient T cells absence of STAT3 after T cell activation (Fig. 3B), suggesting (15). This observation suggests that STAT3 may function that the ability of IL-6 to suppress inducible regulatory T cells downstream of IL-23 by directly activating Il-17 and Il-17F generation is dependent on STAT3. gene transcription. Although this may be the case for effector/ To understand whether STAT3 affects THi generation in memory cells, our current study reveals another, perhaps more vivo, CD62LloCD4 memory T cells were analyzed for expres- critical, function of STAT3 during early T cell differentiation in sion of IL-17 and IFN-. In memory T cells, THi and TH1 regulating the expression of RORt, a THi-specific transcrip- populations exhibited a similar pattern as those from in vitro tion regulator. Since RORt overexpression promoted THi dif- differentiation, i.e. impaired IL-17 expression and enhanced ferentiation and its deficiency greatly impaired this process IFN- expression in Stat3 knock-out versus wild-type (Fig. 3D). (20), it may serve as a lineage-specifying master regulator in In addition, expression of IL-17 by  T cells was also impaired THi development. STAT3 may function, analogous to STAT4 in the absence of STAT3 (data not shown). Thus, STAT3 may for TH1 and STAT6 in TH2, to regulate lineage-specific be necessary for THi differentiation in vivo. expression of RORt, which then in turn results in terminal THi cells have been recently identified as a novel lineage of differentiation of THi cells. Taken together, our observations TH cells that mediate inflammatory responses. The molecular suggest that STAT3 is an upstream regulator of RORt. In addi- programs underlying THi differentiation are largely unclear. In tion, Foxp3 expression was elevated in the absence of STAT3, our current study, we find a synergistic function of IL-6 and correlating with a crucial role of IL-6 in suppressing TGF-- IL-23 in THi differentiation. STAT3, activated by IL-6 and induced regulatory T cell differentiation (12). The inhibitory IL-23, is both necessary and sufficient for THi differentiation. function of STAT3 or its downstream target-RORt in Treg Therefore, STAT3 may serve as a selective STAT protein in cells remains to be further examined in the future. cytokine-mediated THi cell differentiation. It is important to In conclusion, we show that STAT3 is an essential regulator determine how STAT3 specifically regulates this process. An activated by cytokine signals to control lineage commitment of earlier report found STAT3 binding to the promoters of Il-17 THi cells. This adds another function of STAT3 in inflamma- 9362 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 STAT3 Regulates Generation of IL-17-expressing T Cells C., Yoshimura, A., Hennighausen, L., and O’Shea, J. J. (2006) Proc. Natl. tion by inducing a subset of adaptive pro-inflammatory cells. Acad. Sci. U. S. A. 103, 8137–8142 STAT3 inhibitors may have additional potential in therapeutic 16. Laouar, Y., Welte, T., Fu, X.-Y., and Flavell, R. A. (2003) Immunity 19, intervention of inflammatory diseases. 903–912 17. Takeda, K., Clausen, B. E., Kaisho, T., Tsujimura, T., Terada, N., Forster, I., Acknowledgments—We thank the Dong laboratory members for their and Akira, S. (1999) Immunity 10, 39–49 help. 18. Panopoulos, A. D., Zhang, L., Snow, J. W., Jones, D. M., Smith, A. M., El Kasmi, K. C., Liu, F., Goldsmith, M. A., Link, D. C., Murray, P. J., and Watowich, S. S. (2006) Blood 108, 3682–3690 REFERENCES 19. Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., 1. Mosmann, T. R., and Coffman, R. L. (1989) Annu. Rev. Immunol. 7, Pflanz, S., Zhang, R., Singh, K. P., Vega, F., To, W., Wagner, J., O’Farrell, 145–173 A.-M., McClanahan, T., Zurawski, S., Hannum, C., Gorman, D., Rennick, 2. Dong, C., and Flavell, R. A. (2000) Arthritis Res. 2, 179–188 D. M., Kastelein, R. A., de Waal Malefyt, R., and Moore, K. W. (2002) 3. Glimcher, L. H., and Murphy, K. M. (2000) Genes Dev. 14, 1693–1711 J. Immunol. 168, 5699–5708 4. Dong, C. (2006) Nat. Rev. Immunol. 6, 329–333 20. Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., La- 5. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., faille, J. J., Cua, D. J., and Littman, D. R. (2006) Cell 126, 1121–1133 Sedgwick, J. D., McClanahan, T., Kastelein, R. A., and Cua, D. J. (2005) J. 21. Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L., and Flavell, Exp. Med. 201, 233–240 R. A. (2001) J. Exp. Med. 193, 741–754 6. Park, H., Li, Z., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, 22. Takeda, K., Kaisho, T., Yoshida, N., Takeda, J., Kishimoto, T., and Akira, S. Y., Hood, L., Zhu, Z., Tian, Q., and Dong, C. (2005) Nat. Immunol. 6, (1998) J. Immunol. 161, 4652–4660 1133–1141 23. Cho, M. L., Kang, J. W., Moon, Y. M., Nam, H. J., Jhun, J. Y., Heo, S. B., Jin, 7. Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L., H. T., Min, S. Y., Ju, J. H., Park, K. S., Cho, Y. G., Yoon, C. H., Park, S. H., Murphy, K. M., and Weaver, C. T. (2005) Nat. Immunol. 6, 1123–1132 Sung, Y. C., and Kim, H. Y. (2006) J. Immunol. 176, 5652–5661 8. Chung, Y., Yang, X., Chang, S. H., Ma, L., Tian, Q., and Dong, C. (2006) 24. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Cell Res. 16, 902–907 Albanese, C., and Darnell, J. E., Jr. (1999) Cell 98, 295–303 9. Liang, S. C., Tan, X.-Y., Luxenberg, D. P., Karim, R., Dunussi-Joannopou- 25. Ouyang, W., Ranganath, S. H., Weindel, K., Bhattacharya, D., Murphy, los, K., Collins, M., and Fouser, L. A. (2006) J. Exp. Med. 203, 2271–2279 T. L., Sha, W. C., and Murphy, K. M. (1998) Immunity 9, 745–755 10. Mangan, P. R., Harrington, L. E., O’Quinn, D. B., Helms, W. S., Bullard, 26. Pear, W. S., Miller, J. P., Xu, L., Pui, J. C., Soffer, B., Quackenbush, R. C., D. C., Elson, C. O., Hatton, R. D., Wahl, S. M., Schoeb, T. R., and Weaver, Pendergast, A. M., Bronson, R., Aster, J. C., Scott, M. L., and Baltimore, D. C. T. (2006) Nature 441, 231–234 (1998) Blood 92, 3780–3792 11. Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M., and Stockinger, 27. Markowitz, D., Goff, S., and Bank, A. (1988) J. Virol. 62, 1120–1124 B. (2006) Immunity 24, 179–189 28. Wen, R., Chen, Y., Xue, L., Schuman, J., Yang, S., Morris, S. W., and Wang, 12. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T. B., Oukka, M., Weiner, D. (2003) J. Biol. Chem. 278, 43654–43662 H. L., and Kuchroo, V. K. (2006) Nature 441, 235–238 29. Kang, H. S., Beak, J. Y., Kim, Y. S., Petrovich, R. M., Collins, J. B., Grissom, 13. Akimzhanov, A. M., Yang, X. O., and Dong, C. (2007) J. Biol. Chem. 282, S. F., and Jetten, A. M. (2006) Biochem. J. 397, 89–99 5969–5972 30. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Nat. Immunol. 4, 14. Sutton, C., Brereton, C., Keogh, B., Mills, K. H. G., and Lavelle, E. C. (2006) 330–336 J. Exp. Med. 203, 1685–1691 31. Onishi, M., Nosaka, T., Misawa, K., Mui, A. L.-F., Gorman, D., McMahon, 15. Chen, Z., Laurence, A., Kanno, Y., Pacher-Zavisin, M., Zhu, B. M., Tato, M., Miyajima, A., and Kitamura, T. (1998) Mol. Cell Biol. 18, 3871–3879 MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9363 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry American Society for Biochemistry and Molecular Biology

STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells *

Download PDF
6 pages

Loading next page...
 
/lp/american-society-for-biochemistry-and-molecular-biology/stat3-regulates-cytokine-mediated-generation-of-inflammatory-helper-t-I0ttdGEWKR

References (30)

Publisher
American Society for Biochemistry and Molecular Biology
Copyright
Copyright © 2007 Elsevier Inc.
ISSN
0021-9258
eISSN
1083-351X
DOI
10.1074/jbc.c600321200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 13, pp. 9358 –9363, March 30, 2007 © 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells Received for publication, December 28, 2006, and in revised form, January 16, 2007 Published, JBC Papers in Press, February 3, 2007, DOI 10.1074/jbc.C600321200 ‡ ‡1 ‡2,3 ‡3 § Xuexian O. Yang , Athanasia D. Panopoulos , Roza Nurieva , Seon Hee Chang , Demin Wang , ‡ ‡4 Stephanie S. Watowich , and Chen Dong ‡ § From the Department of Immunology, M.D. Anderson Cancer Center, Houston, Texas 77030 and the Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226 Interleukin-17 (IL-17)-producing helper T (TH) cells, named and activator of transcription (STAT) proteins (3, 4). TH1 dif- as TH , TH17, or inflammatory TH (THi), have been recently ferentiation and IFN- production is promoted by IL-12, a het- IL-17 identified as a novel effector lineage. However, how cytokine erodimeric cytokine produced by activated antigen-presenting signals mediate THi differentiation is unclear. We found that cells that signal through STAT4. The IFN--STAT1 pathway in IL-6 functioned to up-regulate IL-23R and that IL-23 synergized turn sustains TH1 development, leading to the induction of with IL-6 in promoting THi generation. STAT3, activated by transcription factor T-bet. On the other hand, IL-4, secreted by both IL-6 and IL-23, plays a critical role in THi development. A activated T cells, drives TH2 polarization in a STAT6-depend- hyperactive form of STAT3 promoted THi development, ent manner, resulting in activation of the transcription factor whereas this differentiation process was greatly impaired in GATA3. STAT3-deficient T cells. Moreover, STAT3 regulated the Recently, a third subset of TH cells, named as TH , TH17, IL-17 expression of retinoic acid receptor-related orphan receptor or inflammatory TH (THi), which produce IL-17, was identified -T (RORt), a THi-specific transcriptional regulator; STAT3 by us as well as other investigators to mediate a pathogenic deficiency impaired RORt expression and led to elevated inflammatory response (5–7). THi cells were also found to pro- expression of T-box expressed in T cells (T-bet) and Forkhead duce IL-17F and IL-22 (5, 7–9). IL-23, sharing a p40 unit with box P3 (Foxp3). Our data thus demonstrate a pathway whereby IL-12, has been first found to regulate IL-17 expression and the cytokines regulate THi differentiation through a selective STAT development or expansion of THi cells in vitro (5–7). More transcription factor that functions to regulate lineage-specific recently, several groups showed that TGF- in the context of gene expression. IL-6 and other inflammatory cytokines supports THi differen- tiation in vitro, independent of IL-23 (10–12), possibly at least in part by regulating the chromatin remodeling of the IL-17-IL- CD4 helper T (TH) cells are essential organizers in 17F locus (13). IL-1 and TNF- may also be involved in pro- immune responses. Upon activation, naive TH cells differenti- moting THi development or in regulating expression of IL-17 at ate into effector cells that have been historically classified into the effector phase (11, 14). two lineages, TH1 and TH2, based on their cytokine secretion The downstream signaling pathways, such as STAT, that and immune regulatory function (1, 2). TH1 cells secret IFN- selectively mediate THi generation are unclear. STAT1 appears and regulate cellular immunity, whereas TH2 cells produce to negatively regulate THi differentiation (7), whereas STAT4 IL-4, IL-5, and IL-13 and mediate the humoral response. The or STAT6 were not involved (6). Recently, Socs3-deficient T cytokine microenvironment during TH activation determines cells were found to exhibit enhanced IL-17 expression; this TH effector differentiation through selective signal transducer effect was associated with enhanced activity of STAT3 in response to IL-23 that could bind to IL-17 and IL-17F promot- * This work was supported by research grants from the National Institutes of ers (15). STAT3 has critical functions in the immune system, Health (to C. D. and D. W.), American Cancer Society (to D. W.), and M. D. Anderson Cancer Center (to S. S. W.). The costs of publication of this article including control of dendritic cell production, inhibition of were defrayed in part by the payment of page charges. This article must macrophage inflammatory signaling, and regulation of steady therefore be hereby marked “advertisement” in accordance with 18 U.S.C. state and emergency granulopoiesis (16–18). However, the pre- Section 1734 solely to indicate this fact. Supported by an National Institutes of Health training grant and an Ameri- cise physiological function of STAT3 in THi lineage differenti- can Legion Auxiliary Award. 2 ation has not been directly addressed. Whether STAT5, Recipient of a scientist development grant from the American Heart another STAT protein that has been shown activated by IL-23R Association. Recipients of postdoctoral fellowships from the Arthritis Foundation. (19), has any function in THi differentiation is also unclear. A Cancer Research Institute Investigator and an M. D. Anderson Cancer Cen- In this study, we show that IL-6 up-regulates expression of ter Trust Fellow. To whom correspondence should be addressed. Fax: 713- IL-23R and that IL-23 synergizes with IL-6 in promoting THi 563-0604; E-mail: [email protected]. The abbreviations used are: TH, CD4 helper T cells; THi, inflammatory TH; differentiation. Retroviral expression of a hyperactive STAT3 STAT, signal transducer and activator of transcription; IL, interleukin; enhances THi cell development. STAT3 deficiency in CD4 T TGF-, transforming growth factor; TNF-, tumor necrosis factor; IFN-, interferon ; RORt, RAR-related orphan receptor -T; RAR, retinoic acid cells results in impaired THi development and a deficiency in receptor; T-bet, T-box expressed in T cells; GATA3, GATA-binding protein 3; RORt, a THi-specific transcription factor recently identified FoxP3, Forkhead box P3; FACS, fluorescence-activated cell sorter; GFP, (20). These data indicate that STAT3 is a cytokine-activated green fluorescent protein; MSCV, murine stem cell virus; IRES, internal ribo- some entry site; CFA, complete Freund’s adjuvant; WT, wild type. essential regulator in THi development. 9358 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 This is an Open Access article under the CC BY license. STAT3 Regulates Generation of IL-17-expressing T Cells MATERIALS AND METHODS IFN-, forward, GATGCATTCATGAGTATTGCCAAGT, and reverse, GTGGACCACTCGGATGAGCTC; T-bet, for- Mice and Immunization—Il-6- and Ifng-deficient mice were ward, CAACAACCCCTTTGCCAAAG, and reverse, TCCCC- purchased from Jackson Laboratories. Stat3 fl and Tie2-Cre CAAGCAGTTGACAGT; GATA3, forward, AGAACCGGCC- mice were generously provided by Drs. Takeda and Koni (21, CCTTATGAA, and reverse, AGTTCGCGCAGGATGTCC; 22) and were bred to yield fl/ Cre and Cre littermates as and -actin, forward, GACGGCCAGGTCATCACTATTG, described (18). Mice were housed in the specific pathogen-free and reverse, AGGAAGGCTGGAAAAGAGCC. The primers animal facility at M.D. Anderson Cancer Center, and the ani- for IL-12R2, IL-23R, IL-17, IL-17F, RORt, Foxp3, and IL-22 mal experiments were performed using protocols approved by were synthesized as described previously (7, 8, 20, 29, 30). the Institutional Animal Care and Use Committee at M.D. Anderson Cancer Center. For immunization, Il-6 knock-out RESULTS AND DISCUSSION and C57BL/6 mice were inoculated with MOG peptide in 35–55 IL-6 Induces IL-23 Responsiveness during THi Differentiation— CFA. 5–7 days later, splenocytes were collected from the IL-6 and IL-23 are both induced in innate immune responses to immunized mice and restimulated with MOG peptide for 3 infectious agents. IL-23 was previously shown to be important in days. In the final 5 h, Golgi-stop (BD Biosciences) was added, the development or expansion of THi cells in vivo (5), whereas IL-6 and IL-17- and IFN--producing cells were analyzed using a BD is potent in THi development in vitro and has recently been shown CytoFix/CytoPerm intracellular staining kit (BD Biosciences) to be necessary in RORt-dependent IL-17 expression in the lam- following the manufacturer’s instructions. ina propria (20). To further examine whether IL-6 is required for TH Differentiation—Naive CD4 T cells were isolated from THi differentiation in vivo, C57BL/6 and Il-6 knock-out mice were spleen and lymph nodes of various strains of mice by immunized with MOG peptide and CFA. 5–7 days later, spleno- AutoMACS (Miltenyi Biotec) selection of CD62L or FACS cytes collected from the immunized mice were restimulated with sorting of CD4CD62LCD44loCD25 T cells after enrich- MOG peptide and stained for CD4, IL-17, and IFN-.In Il-6 ing CD4 T cells by negative selection using rat anti-mouse knock-out mice, THi cells were greatly reduced relative to WT antibodies for CD8, B220, and I-A/I-E and Qiagen BioMag mice, whereas IFN--producing TH1 cells were only moderately goat anti-rat IgG beads. T cells were activated with plate-bound affected (Fig. 1A). anti-CD3 (2 g/ml) and anti-CD28 (2 g/ml) and 50 units/ml IL-6 and IL-23 are thus both important in regulation of THi IL-2 in the presence or absence of 20 ng/ml IL-6 (Peprotech), 50 cells in vivo. We attempted to analyze their functional relation- ng/ml IL-23 (R&D systems), 2 ng/ml TGF- (Sigma-Aldrich), ship during THi differentiation. Because IFN- has been shown 10 g/ml anti-IL-4 (11B11), or 10 g/ml anti-IFN- (XMG1.2), as a potent inhibitor of THi differentiation (6, 7), we next iso- 10 ng/ml TNF-, 10 ng/ml IL-1, or cocktails of these stimuli, lated naive TH cells from IFN--deficient mice and activated as indicated. 4 days after activation, cells were restimulated them with plate-bound anti-CD3 and anti-CD28 in the pres- with 500 ng/ml ionomycin and 50 ng/ml phorbol 12-myristate ence of different cytokines and/or cytokine-neutralizing anti- 13-acetate (Sigma-Aldrich) in the presence of Golgi-stop for bodies. 4–5 days after activation, the differentiated cells were 5 h, after which IL-17- and IFN--producing cells were ana- analyzed by intracellular staining. IL-6 increased the number of lyzed using intracellular staining as described above. Intracel- IL-17-expressing THi cells, which was more pronounced in the lular staining for FoxP3 was performed by using a FoxP3 stain- presence of anti-IL-4 or, even more dramatically, TGF- (Fig. ing kit (eBioscience). 1B). Although IL-23 was a poor inducer of THi differentiation Retroviral Transduction—STAT3C (a gift from J. Darnell’s by itself, the combination of IL-6 and IL-23 led to greatly laboratory) (24) was cloned into the bicistronic retroviral vector enhanced development of THi cells (Fig. 1B). To substantiate pGFP-RV (25). Stat5A and Stat5A 1 6 sequences were cloned the synergy between IL-6 and IL-23, we purified CD4CD25- into a bicistronic retrovirus MSCV-IRES-GFP vector (26). The CD62LhiCD44lo naive TH cells from C57BL/6 mice and acti- expression of the cloned gene and green fluorescent protein vated them with anti-CD3 and anti-CD28 in the presence of (GFP) is under murine stem cell virus (MSCV) promoter con- IL-6 and/or IL-23 for 5 days and analyzed THi differentiation by trol. The ecotropic virus-producing cells GPE86 (27) were intracellular staining. IL-6 weakly induced THi differentiation generated as described previously (28). Naive CD4 T cells (Fig. 1C). Although IL-23 had no effect on its own, it synergized were activated under the indicated conditions for 2 days and with IL-6 in promoting generation of IL-17-expressing TH cells infected with viral supernatants produced by the stable lines as (Fig. 1C). We also observed synergy of IL-6 and IL-23 in THi described previously (25). 2–4 days after infection, the cells differentiation of naive OT-II cells activated with antigen-pre- were tested for IL-17 and IFN- expression using intracellular senting cells in the presence or absence of TGF- (data not staining. In some experiments, GFP cells were sorted by shown). Our data thus not only support a unique function of FACS and subjected to analysis for gene expression. IL-6 in initiating THi differentiation but also, more impor- Quantitative Real-time PCR—Total RNA was prepared from tantly, demonstrate a synergistic action of IL-6 and IL-23. T cells using TRIzol reagent (Invitrogen). cDNA was synthe- To further understand why IL-23 only functions in IL-6- sized using SuperScript reverse transcriptase under priming of treated cells, we stimulated naive TH cells with anti-CD3 and oligo(dT) (Invitrogen), and gene expression was examined in a anti-CD28 for 48 h in the presence of IL-6 and/or IL-23 and Bio-Rad iCycler optical system using the iQ™ SYBR green real- examined expression of IL-23R by real-time RT-PCR analysis. time PCR kit (Bio-Rad Laboratories, Inc.). The data were nor- Interestingly, whereas T cells after activation moderately up- malized to -actin reference. The primers used were (5 to 3): regulated IL-23R mRNA in the presence or absence of IL-23, MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9359 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 1. IL-6 and IL-23 synergize in regulating THi cell development. A, Il-6 knock-out (IL-6 KO) or B6 mice were immunized with MOG/CFA. 5–7 days after immunization, splenocytes were harvested from the immunized mice and restimulated with MOG peptide for 3 days. Cells expressing IL-17 and IFN- were accessed using intracellular staining. Unimmunized B6 control is shown as B6 noim. The experiments were repeated twice with similar results. B, CD4CD62Lhi T cells isolated from Ifng knock-out mice using AutoMACS were activated with plate-bound anti-CD3 and anti-CD28 in the presence or absence of indicated cytokines and/or cytokine-neutralizing antibodies. IL-17-producing cells were tested using intracellular staining. The experiments were repeated twice with similar results. NO, medium. C, FACS-sorted CD4CD25-CD62LhiCD44lo naive T cells from C57BL/6 mice were activated with plate-bound anti-CD3 and anti-CD28 in the presence of indicated cytokines, and IL-17-producing cells were assessed using intracellular staining. D, naive T cells isolated as in C were activated with plate-bound anti-CD3 and anti-CD28 in the absence or presence of IL-23 or IL-6 for 24 h, and IL-23R mRNA expression was examined by real-time PCR. The data shown were normalized to expression of a reference gene -actin, and the expression level in naive T cells was referred as 1. IL-6 increased the expression of IL-23R in activated T cells by We next went on to determine the role of STAT3, which 120-fold (Fig. 1D). Our above results altogether indicate that could be activated by both IL-6 and IL-23 (18, 22), by overex- THi differentiation is initially mediated by IL-6, which induces pressing a hyperactive STAT3 form (STAT3C) (24). Naive IL-23 responsiveness to enhance this differentiation CD4 T cells isolated from Ifng knock-out mice were activated STAT3 Hyperactivation Enhances THi Differentiation— as above and infected with STAT3C and control viruses. Under STAT proteins are key factors mediating cytokine signals dur- neutral conditions or in the presence of TGF- or anti-IL-4, ing TH1 and TH2 differentiation. Although STAT3 is an STAT3C increased IL-17-expressing cells when compared with important target of IL-6, IL-23 has been shown to activate those infected with a control vector. Since the activation of STAT1, STAT3, STAT4, and STAT5 proteins (19). Since STAT3C still requires cytokine-mediated phosphorylation, in STAT1 and STAT4 are not involved in THi differentiation (6, the presence of IL-6 and IL-23 or under THi differentiation 7), we first examined STAT5. We overexpressed WT (STAT5A conditions, STAT3C greatly increased the numbers of IL-17- WT) or a constitutively active form (STAT5A 1 6) (31) of producing cells (Fig. 2A). Similarly, when we infected wild-type STAT5A using the bicistronic retroviral vector MSCV-IRES- CD4 T cells, STAT3C also enhanced THi differentiation GFP during TH differentiation. Naive CD4 T cells isolated under THi but not neutral condition (Fig. 2B). THi cells were from C57BL/6 mice were activated with plate-bound anti-CD3, also reported to produce IL-17F (5, 7). In wild-type cells trans- anti-CD28, and IL-2 in the presence of various polarizing cyto- duced with STAT3C, when compared with those infected by a kines or cytokine blockers, infected on day 2, and subsequently control virus, IL-17F expression was also greatly enhanced (Fig. further differentiated under the polarizing conditions. On day 2C) when we used an antibody specific for IL-17F. 5, IL-17 expression was analyzed in transduced CD4 cells. To further assess the effect of STAT3C during TH cell differ- Under neutral or THi favorable conditions, neither WT entiation, expression of TH lineage-specific genes was exam- STAT5A nor STAT5A 1 6 had any effect on THi development when compared with cells infected with a control virus (data not shown). S. H. Chang and C. Dong, unpublished data. 9360 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 2. STAT3 hyperactivation promotes THi differentiation in vitro. CD4CD62Lhi naive T cells from Ifng-deficient (A)orWT(B) mice were purified by AutoMACS and activated under indicated conditions for 2 days and infected with STAT3C or control viruses. 2 days after infection and culture under the indicated differentiation conditions, the cells expressing IL-17 were examined by intracellular staining. The analysis was gated on CD4GFP cells. The experiment was repeated at least three times with consistent results. C, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses, and the cells expressing IL-17F were analyzed using intracellular staining on gated CD4GFP cells. D, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses under THi conditions. After infection, CD4GFP cells were sorted by FACS, and gene expression was measured by quantitative real-time RT-PCR. The data shown are -fold changes of STAT3C versus vector control normalized to expression of a reference gene -actin. ined in wild-type TH cells that were transduced with vector or from fl/ Cre (Stat3 KO) and Cre (WT) mice were differ- STAT3C virus and differentiated under THi conditions. Using entiated in vitro in the presence of TGF-, IL-6, IL-23, anti- quantitative real-time PCR, when compared with vector con- IFN-, and anti-IL-4 or TGF-, IL-6, IL-1, and TNF- as trol, STAT3C transduction resulted in up-regulation of IL-23R described previously (11). Consistently in both systems, expres- and THi cytokines IL-17 and IL-17F and suppression of TH1- sion of IL-17 by Stat3-deficient T cells was greatly impaired, specific IL-12R2 and IFN- (Fig. 2D). Remarkably, IL-22, a and expression of IFN- was moderately increased (Fig. 3A), cytokine expressed in THi cells that may synergize with IL-17 in indicating an essential role of STAT3 in THi differentiation in inflammation (8, 9), was highly up-regulated in STAT3C-trans- vitro. duced TH cells. Moreover, STAT3 overactivation also reduced In addition to the above cytokine measurement, we also per- GATA3 and T-bet expression but increased the expression of formed real-time RT-PCR analysis on Stat3-sufficient and -de- RORt, a transcription regulator of THi differentiation (20). ficient TH cells that were activated under conditions favoring Thus, STAT3 promotes the THi program and inhibits TH1 and THi differentiation. Consistent with the previous data, we TH2 programs. observed greatly reduced IL-17 as well as IL-17F and IL-22 THi Differentiation Is STAT3-dependent—Our data indicate expression and moderately elevated IFN- expression in Stat3- a potential role of STAT3 in regulating cytokine-mediated THi deficient TH cells (Fig. 3C). IL-23 receptor mRNA expression development. We further examined the role of STAT3 in THi was down-regulated, whereas IL-12R1 was up-regulated in development by using Stat3-deficient CD4 T cells. Mice with the absence of STAT3 (Fig. 3C). Most importantly, expression hematopoietic and endothelial-specific Stat3 deletion were of RORt was greatly reduced in Stat3-deficient TH cells, indi- generated by breeding floxed STAT3 (fl) (22) and Tie2-Cre (21) cating that STAT3 is necessary for RORt expression during strains. Deficiency of STAT3 expression in hematopoietic cells THi differentiation. Moreover, expression of T-bet and Foxp3 from these mice was confirmed by Western blot (data not was increased (Fig. 3C), suggesting that STAT3 may repress shown). Naive CD4CD25-CD62LhiCD44lo T cells isolated TH1 and inducible regulatory T cell differentiation. Indeed, MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9361 STAT3 Regulates Generation of IL-17-expressing T Cells FIGURE 3. THi differentiation is dependent on STAT3. A–C, FACS-sorted CD4CD25-CD62LhiCD44lo T cells from Stat3 fl/ Tie2-Cre mice (STAT3 KO)or littermate Cre mice (WT) were differentiated under THi conditions. 4 days after polarization, the differentiated cells were assessed for IL-17 or IFN- produc- tion (A) or FoxP3 expression (B) using intracellular staining. Some cells were restimulated with plate-bound anti-CD3, and messenger RNA expression was analyzed by quantitative real-time RT-PCR (C). The data shown are -fold changes of STAT3 KO versus WT control normalized to expression of the -actin reference. D, memory CD4 T cells were isolated from Stat3 KO mice or WT littermate controls were activated with plate-bound anti-CD3 for 24 h, and the cells producing IL-17 or IFN- were assessed by intracellular staining. The data represent at least two independent experiments with consistent results. there was a greater number of Foxp3-expressing TH cells in the and Il-17F genes, which was enhanced in Socs3-deficient T cells absence of STAT3 after T cell activation (Fig. 3B), suggesting (15). This observation suggests that STAT3 may function that the ability of IL-6 to suppress inducible regulatory T cells downstream of IL-23 by directly activating Il-17 and Il-17F generation is dependent on STAT3. gene transcription. Although this may be the case for effector/ To understand whether STAT3 affects THi generation in memory cells, our current study reveals another, perhaps more vivo, CD62LloCD4 memory T cells were analyzed for expres- critical, function of STAT3 during early T cell differentiation in sion of IL-17 and IFN-. In memory T cells, THi and TH1 regulating the expression of RORt, a THi-specific transcrip- populations exhibited a similar pattern as those from in vitro tion regulator. Since RORt overexpression promoted THi dif- differentiation, i.e. impaired IL-17 expression and enhanced ferentiation and its deficiency greatly impaired this process IFN- expression in Stat3 knock-out versus wild-type (Fig. 3D). (20), it may serve as a lineage-specifying master regulator in In addition, expression of IL-17 by  T cells was also impaired THi development. STAT3 may function, analogous to STAT4 in the absence of STAT3 (data not shown). Thus, STAT3 may for TH1 and STAT6 in TH2, to regulate lineage-specific be necessary for THi differentiation in vivo. expression of RORt, which then in turn results in terminal THi cells have been recently identified as a novel lineage of differentiation of THi cells. Taken together, our observations TH cells that mediate inflammatory responses. The molecular suggest that STAT3 is an upstream regulator of RORt. In addi- programs underlying THi differentiation are largely unclear. In tion, Foxp3 expression was elevated in the absence of STAT3, our current study, we find a synergistic function of IL-6 and correlating with a crucial role of IL-6 in suppressing TGF-- IL-23 in THi differentiation. STAT3, activated by IL-6 and induced regulatory T cell differentiation (12). The inhibitory IL-23, is both necessary and sufficient for THi differentiation. function of STAT3 or its downstream target-RORt in Treg Therefore, STAT3 may serve as a selective STAT protein in cells remains to be further examined in the future. cytokine-mediated THi cell differentiation. It is important to In conclusion, we show that STAT3 is an essential regulator determine how STAT3 specifically regulates this process. An activated by cytokine signals to control lineage commitment of earlier report found STAT3 binding to the promoters of Il-17 THi cells. This adds another function of STAT3 in inflamma- 9362 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 13 •MARCH 30, 2007 STAT3 Regulates Generation of IL-17-expressing T Cells C., Yoshimura, A., Hennighausen, L., and O’Shea, J. J. (2006) Proc. Natl. tion by inducing a subset of adaptive pro-inflammatory cells. Acad. Sci. U. S. A. 103, 8137–8142 STAT3 inhibitors may have additional potential in therapeutic 16. Laouar, Y., Welte, T., Fu, X.-Y., and Flavell, R. A. (2003) Immunity 19, intervention of inflammatory diseases. 903–912 17. Takeda, K., Clausen, B. E., Kaisho, T., Tsujimura, T., Terada, N., Forster, I., Acknowledgments—We thank the Dong laboratory members for their and Akira, S. (1999) Immunity 10, 39–49 help. 18. Panopoulos, A. D., Zhang, L., Snow, J. W., Jones, D. M., Smith, A. M., El Kasmi, K. C., Liu, F., Goldsmith, M. A., Link, D. C., Murray, P. J., and Watowich, S. S. (2006) Blood 108, 3682–3690 REFERENCES 19. Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., 1. Mosmann, T. R., and Coffman, R. L. (1989) Annu. Rev. Immunol. 7, Pflanz, S., Zhang, R., Singh, K. P., Vega, F., To, W., Wagner, J., O’Farrell, 145–173 A.-M., McClanahan, T., Zurawski, S., Hannum, C., Gorman, D., Rennick, 2. Dong, C., and Flavell, R. A. (2000) Arthritis Res. 2, 179–188 D. M., Kastelein, R. A., de Waal Malefyt, R., and Moore, K. W. (2002) 3. Glimcher, L. H., and Murphy, K. M. (2000) Genes Dev. 14, 1693–1711 J. Immunol. 168, 5699–5708 4. Dong, C. (2006) Nat. Rev. Immunol. 6, 329–333 20. Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., La- 5. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., faille, J. J., Cua, D. J., and Littman, D. R. (2006) Cell 126, 1121–1133 Sedgwick, J. D., McClanahan, T., Kastelein, R. A., and Cua, D. J. (2005) J. 21. Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L., and Flavell, Exp. Med. 201, 233–240 R. A. (2001) J. Exp. Med. 193, 741–754 6. Park, H., Li, Z., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, 22. Takeda, K., Kaisho, T., Yoshida, N., Takeda, J., Kishimoto, T., and Akira, S. Y., Hood, L., Zhu, Z., Tian, Q., and Dong, C. (2005) Nat. Immunol. 6, (1998) J. Immunol. 161, 4652–4660 1133–1141 23. Cho, M. L., Kang, J. W., Moon, Y. M., Nam, H. J., Jhun, J. Y., Heo, S. B., Jin, 7. Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L., H. T., Min, S. Y., Ju, J. H., Park, K. S., Cho, Y. G., Yoon, C. H., Park, S. H., Murphy, K. M., and Weaver, C. T. (2005) Nat. Immunol. 6, 1123–1132 Sung, Y. C., and Kim, H. Y. (2006) J. Immunol. 176, 5652–5661 8. Chung, Y., Yang, X., Chang, S. H., Ma, L., Tian, Q., and Dong, C. (2006) 24. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Cell Res. 16, 902–907 Albanese, C., and Darnell, J. E., Jr. (1999) Cell 98, 295–303 9. Liang, S. C., Tan, X.-Y., Luxenberg, D. P., Karim, R., Dunussi-Joannopou- 25. Ouyang, W., Ranganath, S. H., Weindel, K., Bhattacharya, D., Murphy, los, K., Collins, M., and Fouser, L. A. (2006) J. Exp. Med. 203, 2271–2279 T. L., Sha, W. C., and Murphy, K. M. (1998) Immunity 9, 745–755 10. Mangan, P. R., Harrington, L. E., O’Quinn, D. B., Helms, W. S., Bullard, 26. Pear, W. S., Miller, J. P., Xu, L., Pui, J. C., Soffer, B., Quackenbush, R. C., D. C., Elson, C. O., Hatton, R. D., Wahl, S. M., Schoeb, T. R., and Weaver, Pendergast, A. M., Bronson, R., Aster, J. C., Scott, M. L., and Baltimore, D. C. T. (2006) Nature 441, 231–234 (1998) Blood 92, 3780–3792 11. Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M., and Stockinger, 27. Markowitz, D., Goff, S., and Bank, A. (1988) J. Virol. 62, 1120–1124 B. (2006) Immunity 24, 179–189 28. Wen, R., Chen, Y., Xue, L., Schuman, J., Yang, S., Morris, S. W., and Wang, 12. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T. B., Oukka, M., Weiner, D. (2003) J. Biol. Chem. 278, 43654–43662 H. L., and Kuchroo, V. K. (2006) Nature 441, 235–238 29. Kang, H. S., Beak, J. Y., Kim, Y. S., Petrovich, R. M., Collins, J. B., Grissom, 13. Akimzhanov, A. M., Yang, X. O., and Dong, C. (2007) J. Biol. Chem. 282, S. F., and Jetten, A. M. (2006) Biochem. J. 397, 89–99 5969–5972 30. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Nat. Immunol. 4, 14. Sutton, C., Brereton, C., Keogh, B., Mills, K. H. G., and Lavelle, E. C. (2006) 330–336 J. Exp. Med. 203, 1685–1691 31. Onishi, M., Nosaka, T., Misawa, K., Mui, A. L.-F., Gorman, D., McMahon, 15. Chen, Z., Laurence, A., Kanno, Y., Pacher-Zavisin, M., Zhu, B. M., Tato, M., Miyajima, A., and Kitamura, T. (1998) Mol. Cell Biol. 18, 3871–3879 MARCH 30, 2007• VOLUME 282 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 9363

Journal

Journal of Biological Chemistry – American Society for Biochemistry and Molecular Biology

Published: Mar 30, 2007

There are no references for this article.