Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Genetic Mapping of Activity Determinants within Cellular Prion Proteins

Genetic Mapping of Activity Determinants within Cellular Prion Proteins THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 53, Issue of December 31, pp. 55443–55454, 2004 © 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Genetic Mapping of Activity Determinants within Cellular Prion Proteins N-TERMINAL MODULES IN PrP OFFSET PRO-APOPTOTIC ACTIVITY OF THE DOPPEL HELIX B/B REGION* Received for publication, April 29, 2004, and in revised form, September 29, 2004 Published, JBC Papers in Press, September 29, 2004, DOI 10.1074/jbc.M404794200 Bettina Drisaldi‡, Janaky Coomaraswamy‡, Peter Mastrangelo‡, Bob Strome‡, Jing Yang‡, Joel C. Watts‡, M. Azhar Chishti‡, Melissa Marvi‡, Otto Windl§, Rosemary Ahrens‡, Franc¸ois Major¶, Man-Sun Sy, Hans Kretzschmar**, Paul E. Fraser‡ ‡‡, Howard T. J. Mount‡§§, and David Westaway‡¶¶ From the ‡Centre for Research in Neurodegenerative Diseases, ‡‡Department of Medical Biophysics, the §§Department of Medicine, and the ¶¶Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5S 3H2, Canada, §Veterinary Laboratories Agency, Weybridge, Surrey KT15 3NB, United Kingdom, the ¶Departement d’Informatique et de Recherche Operationelle, Universite´ de Montreal, Montre´al, Quebec H3C 3J7, Canada, Institute of Pathology, Case Western Reserve University, Cleveland, Ohio 44106, and **Ludwig-Maximilians University, 81377 Munich, Germany The PrP-like Doppel (Dpl) protein causes apoptotic of prion infections, it is well accepted that a profound structural death of cerebellar neurons in transgenic mice, a proc- remodeling involving a templated conformational change cul- ess prevented by expression of the wild type (wt) cellu- minates in the formation of protease-resistant and infectivity- C C lar prion protein, PrP . Internally deleted forms of PrP associated forms of the prion protein commonly denoted as Sc resembling Dpl such as PrP32–121 produce a similar PrP . In the case of inherited prion diseases such as familial PrP -sensitive pro-apoptotic phenotype in transgenic Creuzfeldt-Jakob disease, insertional or missense mutations in mice. Here we demonstrate that these phenotypic at- the human PrP gene (PRNP, denoted Prnp in the mice) result tributes of wt Dpl, wt PrP , and PrP132–121 can be C in abnormal forms of PrP that may, in some instances, mis- accurately recapitulated by transfected mouse cerebel- fold and accumulate in the endoplasmic reticulum. However, lar granule cell cultures. This system was then explored insights into the normal function of PrP , and the extent to by mutagenesis of the co-expressed prion proteins to which conformational alterations might participate in this reveal functional determinants. By this means, neuro- function, have proven hard to come by because of difficulties in protective activity of wt PrP was shown to be nullified connecting in vitro and in vivo data. For example, in vitro by a deletion of the N-terminal charged region impli- protein binding partners have proven difficult to authenticate cated in endocytosis and retrograde axonal transport by in vivo genetic analyses, and conversely, in vivo genetic (PrP23–28), by deletion of all five octarepeats (PrP51– analyses of PrP have been limited to defining determinants 90), or by glycine replacement of four octarepeat histi- required for prion replication and binding to an as yet uncloned dine residues required for selective binding of copper partner protein designated protein X (2, 3). Other recent areas ions (Prnp“H/G”). In the case of Dpl, overlapping dele- of interest and controversy concern the basis of neurotoxicity tions defined a requirement for the gene interval encod- and the existence and function of cytoplasmic forms of PrP ing helices B and B (Dpl101–125). These data suggest contributions of copper binding and neuronal traffick- (4–9). ing to wt PrP function in vivo and place constraints Discovery of the Doppel (Dpl) protein has provided a new upon current hypotheses to explain Dpl/PrP antago- opportunity to scrutinize these issues. Dpl is a prion-like pro- nism by competitive ligand binding. Further implemen- tein encoded by Prnd gene, displaying 24% identity with the tation of this assay should provide a fuller understand- C-terminal two-thirds of PrP (10, 11). The Dpl protein resem- ing of the attributes and subcellular localizations bles an N-terminally truncated version of PrP , lacking the required for activity of these enigmatic proteins. octarepeats motifs and a conformationally plastic region essen- tial for the capacity to sustain prion replication. On the other hand, PrP and Dpl are both GPI-anchored proteins (12, 13), Prion disease pathogenesis involves the formation of abnor- bear generally similar -helical C-terminal domain structures C 1 mal forms of the cellular prion protein (PrP ) (1). In the case (14, 15), and share an ability to bind copper ions in a selective manner in vitro (16–18). Whereas PrP mRNA is expressed in the central nervous system and many peripheral tissues, the * This work was supported by the Canadian Institutes of Health most notable site of Dpl expression is the testis. Although Dpl Research Grants MOP363377 and MSC46763, Natural Sciences and Engineering Research Council of Canada Grant PGSA266137-2004, the is not thought to convert to a protease-resistant isoform anal- Sc Premier’s Research Excellence Award from the Government of Ontario, ogous to PrP or to support the process of prion replication (19, and the Alzheimer Society of Ontario. The costs of publication of this 20), expression in the central nervous system causes apoptotic article were defrayed in part by the payment of page charges. This death of both granule and Purkinje cells, determining a severe article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. To whom correspondence should be addressed: Centre for Research in Neurodegenerative Diseases, Tanz Neuroscience Bldg., 6 Queen’s mouse Doppel gene; Tg, transgenic; GFP, green fluorescent protein; Park Crescent West, Toronto, Ontario M5S 3H2, Canada. Tel.: 416-978- CGN, cerebellar granule neurons; Ac-DEVD-CHO, N-Acetyl-Asp-Glu- 1556; Fax: 416-978-1878; E-mail: [email protected]. Val-Asp-al; GPI, glycosylphosphatidylinositol; ORF, open reading 1 C The abbreviations used are: PrP , cellular prion protein; Dpl, Dop- frame; wt, wild type; ANOVA, analysis of variance; PBS, phosphate- Sc pel protein; PrP , scrapie prion protein; Prnp, mouse prion gene; Prnd, buffered saline. This paper is available on line at http://www.jbc.org 55443 This is an Open Access article under the CC BY license. 55444 Genetic Assay of PrP and Doppel nadino Ghetti. These mice on a hybrid 129/B6 background were used in ataxic phenotype in Dpl-expressing transgenic mice (10, 20– their 13th backcross to the B6 strain, with B6 mice from the same 22). Of note, the toxic effect of Dpl upon both granule and supplier (Charles River) comprising a source of Prnp cells. For some Purkinje neurons is counteracted by wt PrP , and interactions experiments Tg(SHaPrP)7 mice maintained in a B6 congenic back- between PrP and Dpl have been equated with antagonistic ground (35) (a gift from G. Carlson) or non-Tg littermates were also activities of the two mature proteins enacted at the cell surface used as a source of donor cells. Primary cultures of cerebellar granule (10, 23, 24). Furthermore, internally deleted forms of PrP re- cells were prepared from P6–7-day animals as described previously (7, 36). After 4 days in vitro, granule cells were transfected in minimum sembling Dpl are also cytotoxic (25). essential medium with 2 g of pBud-GFP vectors using Lipofectamine The many biochemical similarities between Dpl and PrP 2000 (Invitrogen) for 30 min before replacing the media with K25S. and recurring connections between PrP itself and apoptosis 24 h post-transfection, cells were fixed in 4% paraformaldehyde for 30 (9, 26–28) have suggested that analysis of Dpl-induced neuro- min. N2a neuroblastoma cells were transfected as described previously degeneration might provide insights into the biology and (10). Where described, 20 M of Ac-DEVD-CHO (Sigma) was added to pathobiology of prion proteins (23, 24, 29). To distinguish be- the cultures after transfection. Measurement of Cell Death—Cell death was quantified by staining tween theories to account for the neurotoxicity of Dpl and the C the cells with the blue fluorescent dye Hoechst 33342, which stains counteracting effect of PrP (29–31) and yet avoid the logistics chromatin. Transfected neurons (GFP-positive) were scored as healthy of assessing many alleles in transgenic mice, we have estab- or apoptotic by morphological criteria (i.e. chromatin condensation, lished a cell culture assay compatible with saturation mutagen- nuclear fragmentation, cytoplasm blebbing, and neuritic degeneration) esis. This assay reveals close concordance with analyses of (37, 38). Each graph represents at least three independent experiments Prnp alleles performed in transgenic mice and has yielded performed in triplicate in which about 150–200 neurons were individ- ually examined using a fluorescent Zeiss Axiovert inverted microscope. insights into some attributes required for bioactivity of these Immunofluorescence—Immunofluorescence experiments were per- two proteins. formed 24 h after transfection with pBud-GFP vectors. Cells were fixed in 4% paraformaldehyde and washed three times with PBS. For inter- EXPERIMENTAL PROCEDURES nal staining cells were incubated for 1 min at room temperature in PBS Plasmid Construction—Dpl point mutants and deletions were gen- containing 0.5% Triton X-100. Cells were then incubated for 30 min in erated via site-directed mutagenesis performed on the wild type Dpl blocking solution (PBS, 2% goat serum) and then overnight in primary ORF (10) (in pcDNA3.0; Invitrogen) using a Pfu DNA polymerase- antibody (-Dpl E6977, a gift from S. Prusiner) diluted 1:300 in blocking mediated mutagenesis system (Quickchange, Stratagene). Mutagenic solution. Cells were washed three times with PBS, incubated in block- PCRs were digested with restriction enzyme DpnI (target sequence, ing solution for 15 min, and then incubated with the secondary antibody m6 5-G ATC-3), specific for methylated and hemi-methylated DNA, in (Cy-3 1:300, Jackson ImmunoResearch) for1hat room temperature. order to eliminate parental DNA template. Products were then trans- Monoclonal antibody 7A12 binding between residues 90 and 145 was formed into Escherichia coli and verified by sequence analysis using used (1:300) for immunodetection of PrP (39), in conjunction with an two coding strand and two anti-coding strand sequencing primers. AlexaFluor594-conjugated anti-mouse secondary antibody (Invitrogen) Authenticated mutants were subsequently transferred into pBud.GFP and a block solution of Hanks’ buffered salt solution containing mag- (pBud.CE4 vector, Invitrogen) by standard restriction enzyme cloning nesium and calcium, 10% goat serum, 1 mM HEPES, pH 7.4, and 2% for transfection experiments. Mutagenic oligonucleotide primer used to horse serum. Cells were washed three times with PBS and viewed at generate the Dpl mutants (5 to 3, with reverse complement oligo- room temperature with a Zeiss Axiovert inverted microscope using an nucleotides omitted for the sake of brevity) were as follows: Dpl- Achrostigmat 40/0.55 LD objective. Pictures were taken with a Kodak (G155Ter), CGATTTCTGGCTGGAAAGGTGATCAGCGCTTCGGGT- Digital camera (DC290) using the Kodak Microscopy Documentation CGC; Dpl(29–49), ACGGTCAAGGCAAGGGGCGCCCGGGTAGCTG- System MDS2900 software for the image acquisition. AGAACCGC; Dpl(50–90), GCGGCGGCCAGATCACCGAATACTAC- Immunoblotting—Cells were harvested in 50 mM Tris-HCl, pH 7.5, GAAGGCTGCTCTGA; Dpl(91–149), GGCAGTTCCCTGATGGGATC- containing 0.5% SDS and assayed for total protein using the BCA assay TTCTGGCTGGAAAGGGGAGC; Dpl(91–125), GGCAGTTCCCTGAT- (Pierce). 50 g protein samples were loaded on Tris-glycine SDS-poly- GGGATCCAGGATAGCAAGCTCCACCAGCG; Dpl(126–149), GCTG- acrylamide gels and then blotted to nitrocellulose membranes. For AGTTCTCCCGGGAGAAGTTCTGGCTGGAAAGGGGAGC; Dpl- immunoblotting, membrane was incubated with the polyclonal anti- (91–100), CTATTGGCAGTTCCCTGATGGGATCACCAAGGAGATG- body E6977 at 1:4000 overnight, and antibody binding was revealed by CTGGTGACCAGC; Dpl(101–125), CGAAGGCTGCTCTGAAGCCAA- using an ECL detection system (Amersham Biosciences). A Dpl N- CGTGCAGGATAGCAAGCTCCACCAGCG; Dpl(91–125), GGCAGTT- terminal peptide antigen corresponding to residues 27–39 was synthe- CCCTGATGGGATCCAGGATAGCAAGCTCCACCAGCG-3; Dpl- sized by solid phase techniques and purified by reverse phase high (91,92TerTer), GGCAGTTCCCTGATGGGATCTAGTAGGAAGGCTGC- pressure liquid chromatography. This peptide was covalently linked to TCTGAAGCCAACG; PrP51–90, CCTGGAGGCAACCGTTACCCAG- keyhole limpet hemocyanin via a disulfide linkage made possible by the GAGGGGGTACCCATAATCAG; PrP(23–28), GACTATGTGGACTGA- addition of a cysteine residue at the peptide C terminus. A total of three TGTCGGCCTCTGC2GGAGGGTGGAACACCGGTGGAAGCCGG; PrP- rabbits were immunized with peptide-keyhole limpet hemocyanin com- (32–121), AAGCGGCCAAAGCCTGGAGGGTGGGGGGGCCTTGGT- plexes for each peptide antigen and were then subsequently given GGCTACATGC; and PrPS232ter, GACGGGAGAAGATCCAGCTAGG- booster injections at 7-day intervals. Antisera collected for each peptide ACCGTGCTTTTCTCCTCC. To mobilize the Prnp “H/G” allele from a were pooled, and IgG was precipitated with ammonium sulfate. Anti- heterologous cloning vector, we used the seamless cloning technique bodies were then affinity-purified with Sulfo-link-agarose (Pierce) cou- (Stratagene) and primers located in flanking regions of the Prnp coding pled with the appropriate peptide. This final purification is required to region (AGTTACTCTTCGGACTGATGTCGGCCTCTGC and AGTTAC- remove nonspecific interactions of other antibodies present in either in TCTTCTGCCCCAGCTGCCGCAGCCC). To create the Dpl-GPS1-1 allele, the pre- or post-immune serum. a Doppel cDNA was mutagenized with the transposon-based “GPS” RESULTS mutagenesis system (New England Biolabs), digested with Pme1 to excise the transposon, and re-ligated to create a 15-bp insert. The A Transgene-based Assay for Dpl Toxicity—Based upon sus- position of the resulting 5-amino acid insertion was established by ceptibility to toxicity engendered by Dpl and mutant PrP trans- sequencing. The wt Prnp allele used as a basis for mutagenesis was genes in vivo (as well as the results presented below), we first derived from a Prnp cDNA (32). This was modified to include a NotI investigated primary cerebellar granule cell cultures to evalu- site in the 5 leader sequence encoded by exon 2 (33) adjacent to a ate the toxic action of recombinant proteins. However, a failure naturally occurring KpnI site and a second NotI site 80 bp downstream of the termination codon. The PrpS232ter and PrP51–90 alleles were to recapitulate the protective effect of endogenous PrP , as well made using the QuikChange system. These alleles were excised with as the high (micromolar) concentrations of recombinant Dpl NotI and inserted into the NotI site of the pcDNA3.0 polylinker region. required to induce apoptotic cell death (not shown), suggested All mutant alleles were sequenced on both strands to exclude the an exploration of alternative paradigms. The availability of Dpl presence of extraneous lesions introduced during in vitro mutagenesis and PrP alleles assessed previously in Tg mice provided the procedures. impetus to develop a gene-based bioassay. Cell Culture and Transfection—Breeding pairs from a re-derived 0/0 colony of Zrch1 Prnp mice (34) were a generous gift from Dr. Ber- To obviate biohazard issues arising from the use of viral Genetic Assay of PrP and Doppel 55445 0/0 FIG.1. Doppel transgene expression in Prnp cerebellar granule cells induces neurodegeneration. A, fluorescence micrographs of 0/0 cerebellar granule cells derived from Prnp mice, transfected with pBud-GFP-empty vector (e.v.) and pBud-GFP-Dpl. GFP-positive neurons (a, c, e, and g) were identified, and nuclear morphology was analyzed for signs of neurodegeneration, after staining with Hoechst 44333 (b, d, f, and g). A higher number of GFP-positive cells showing nuclear fragmentation, neuritic degeneration, and pyknotic nuclei were found in Dpl-transfected neurons (white arrows, d and h) compared with empty vector-transfected cells (b and f). (Scale bar in this and subsequent figures  20 m.) B, neurons transfected by GFP-wtDpl show twice the rate of death compared with neurons transfected with GFP empty vector. 21 h after transfection there is a statistically significant difference in the death induced by wt Dpl versus empty vector. Data are mean  S.E. of 12 independent experiments (Student’s t test, *, p  0.0001). vectors to express mammalian prion and prion-like genes, we days after culturing in vitro (“DIV 4”). Cerebellar neuronal developed a protocol based upon delivery of naked DNA. In this cultures were fixed with 4% paraformaldehyde and stained transient transfection system, primary cultures of granule neu- with the DNA dye Hoechst 44333 to visualize nuclear morphol- rons were transfected with bigenic expression plasmids by a ogy 24 h following transfection. Transfected neurons were ob- liposome-based method. In this way it was possible to obtain tained at a frequency between 1 and 2%, as analyzed by fluo- simultaneous expression of green fluorescent protein (GFP) to rescence microscopy for GFP expression, and were scored denote the subset of cells successfully transfected (and thereby without knowledge of plasmid genotype for signs of cellular expressing the Prnd alleles under study), without recourse to death. We found that a population of granule cells transfected use the GFP-prion protein fusions of undefined biological ac- with wt Doppel showed a 2-fold elevated level of apoptotic tivity. Accordingly, pBud-CE4 bigenic vectors were used to death above empty vector controls, as indicated by nuclear clone a variety of Prnd alleles (all with identical 5- and 3- morphology visualized with Hoechst stain (Fig. 1A) (37, 38, 40). untranslated sequences) and GFP genes under the control of This 2-fold increase was similar to that observed in other two different promoters (cytomegalovirus and EF-1, respec- culture paradigms of neurodegenerative disease (37, 38) and tively). These plasmids were then used to transfect post-mitotic was observed in more than 12 independent transfection exper- primary cerebellar granule cells at postnatal day 10 or 11, 4 iments, each performed in triplicate (p  0.0001, Fig. 1B). To be 55446 Genetic Assay of PrP and Doppel FIG.2. A high percentage of GFP-positive neurons also express Doppel after transfection with bigenic vectors. A, immunofluores- cence analysis of GFP-positive neurons after transfection with both pBud-GFP vector and derivatives also harboring Dpl or PrP coding regions. Cells were fixed and stained with antibody -Doppel (E6977) followed by Cy 3-red-conjugated secondary antibody or -PrP 7A12 and Alexa- Fluor594-conjugated secondary antibody. Top row, GFP-expressing neurons; bottom row, Dpl or PrP immunostaining, as noted. B, 94% of the GFP-expressing cells in pBUD-GFP-Dpl bigenic plasmids were also positive for Doppel cell-surface immunofluorescence. certain that each neuron expressing the GFP marker gene also ing that PrP expression was capable of rescuing the toxic expressed Dpl, transfected neurons were analyzed by immuno- phenotype induced by Dpl expression. In a further experiment, 0/0 fluorescence using the polyclonal Doppel antibody E6977 (20) we tested the effect of co-transfecting Prnp granule cells with and visualized by using a secondary antibody conjugated with both a GFP/Dpl plasmid and a wt PrP transgene encoded by a Cy-3. Over 94% of the green fluorescent neurons also exhibited second expression vector. Here co-transfection of a PrP -ex- cell-surface immunofluorescence with the anti-Doppel antibody pressing plasmid with the Dpl-expressing plasmid (3:1 ratio by (Fig. 2). Taken together, these data suggest that Doppel trans- mass) completely blocked toxicity produced by the Dpl trans- gene expression in cerebellar granule cells induces cell death. gene (Fig. 3B). In other experiments we confirmed the ability of C C PrP Expression Blocks Dpl-induced Toxicity—A key crite- bigenic pBUD-GFPPrP plasmids to support PrP expression, rion to assess the accuracy of the in vitro model described above as assessed by immunostaining with the monoclonal antibody is the protective effect of PrP expression, as this has been 7A12 (Fig. 2). Further control experiments, where plasmids documented in all transgenic paradigms examined to date (20, encoding GFP or a red fluorescent protein were mixed, revealed 22, 41, 42). Because cerebellar cells overexpressing hamster a high frequency of co-transfection, with 93% of cells expressing PrP derived from Tg(SHaPrP)7 mice (35) were resistant to the GFP also expressing red fluorescent protein (Fig. 3C). In sum- toxic effect of Dpl (not shown), as in Tg mice (20, 43), we mary, these results establish a protective effect of PrP ,asis investigated whether this was also the case for PrP expressed the case in vivo in transgenic mice. at endogenous levels. For this purpose, cerebellar granule cells Doppel Induces Neurodegeneration by an Apoptotic Mecha- were cultured from C57/B6 wt PrP-expressing mice (i.e. nism—As noted above, morphological studies on Dpl-trans- Prnp cells) and transfected with both Doppel-GFP and fected cells were consistent with apoptotic cell death, in accord empty vector-GFP constructs. The percentage of cellular death with studies performed on TgDpl mice, where features of apo- (Fig. 3A) did not increase in Dpl-transfected neurons, confirm- ptosis were apparent within degenerating granule neurons Genetic Assay of PrP and Doppel 55447 FIG.3. Doppel is not toxic in wt PrP-expressing cells. A, cerebellar granule cells from Prnp mice express- ing endogenous wt PrP are resistant to the neurotoxic effect of Dpl expression. Data are from three independent experi- ments each done in triplicate. Student’s t test revealed no significant difference be- tween cells transfected with Dpl and 0/0 empty vector (e.v.; p 0.92). B, Prnp granule cells were co-transfected with pBud-GFP-e.v.  pBud-GFP-wt PrP and pBud-GFP-Dpl pBud-GFP-wtPrP (ratio 1:3). PrP expression is able to rescue the Dpl-induced toxic phenotype. ANOVA, *, p  0.007. C, Prnp granule neurons were co-transfected with pBud-GFP-e.v. and pCX-dsRed (molar ratio 1:3). Al- though most fluorescing neurons (88%) (bar 1) showed the simultaneous expres- sion of both GFP (green) and red fluores- cent proteins (red), few cells showed sin- gle color fluorescence (red, bar 2; green, bar 3), indicating a high efficiency of co- transfection of the two independent plasmids. (20). To extend these findings, immunocytochemical staining (PHGG(G/S)WGQ 3 PGGG(G/S)WGQ ). Plasmids encoding a 4 4 was performed with an antibody specific for the cleaved form of PrP allele deleted for the basically charged region (PrP23–28) caspase-3 (44). Cells with nuclear apoptotic morphology were implicated in cell-trafficking events and interactions with pro- also found to be positive for a neo-epitope generated by tein X (47, 48) or with a stop codon prior to the GPI signal caspase-3 proteolytic activation (Fig. 4A). In a further experi- peptide (PrPS232ter) were also investigated in the same man- ment, granule cells were transfected with Dpl and control con- ner (Fig. 5, A and B). None of these Prnp alleles exhibited structs in the presence or absence of 20 M of Ac-DEVD-CHO, toxicity above background levels, but with the exception of the a synthetic peptide inhibitor of caspases 3, 6, 7, 8, and 10 (44). S232ter allele, neither did they protect against the pro-apo- Survival of Dpl-transfected neurons was markedly increased ptotic action of Dpl. “Nonprotective” PrP alleles (PrP23–28 by Ac-DEVD-CHO (Fig. 4B), suggesting that caspase activity is and PrP51–90 shown, Fig. 2A) were nonetheless associated required for Doppel-induced cell death. Taken together, the with immunostaining, arguing against the trivial effects of data from Figs. 1–4 demonstrate the utility of the transgene- these internal deletions upon gene expression. based approach over delivery of recombinant proteins, and this To investigate further the accuracy of our cellular model for methodology was used for subsequent studies. Doppel neurotoxicity, we also tested the effect of pathogenic Mutational Analysis of Neuroprotective Activity of PrP — “octarepeat insertion” PrP alleles found in diseases classified Because (i) copper binding is a potential mechanism whereby as either familial Creuzfeldt-Jakob disease or Gerstmann- PrP and Dpl might compete (18), (ii) the major Cu(II) binding Stra¨ussler Scheinker disease. These alleles behave as domi- domain maps within the octarepeat region of PrP (16, 45), and nant traits and, unlike the situation for Dpl, do not behave (iii) internal N-terminal deletions of PrP are stably expressed differently when expressed in the presence or absence of en- but nontoxic (46) (whereas larger deletions such as PrP32– dogenous mouse Prnp alleles (49). The mutant PRNP allele 121 and PrP32–134 are toxic (25)), we hypothesized that one (encoding an additional eight octarepeats above the five pres- neuroprotective region within PrP might lie within the octare- ent in wt PRNP alleles) used for this experiment was derived peat sequences. Accordingly, we tested the activity of a co- from a Gerstmann-Stra¨ussler Scheinker patient (50). A result- transfected PrP51–90 allele lacking all five octarepeats, as ing “octa13” Prnp allele was cloned into the pBud bigenic vector 0/0 / well as an allele where each histidine residue within the copper and analyzed in Prnp and Prnp cerebellar granule cell 0/0 / binding octarepeats was converted to a glycine residue cultures. Both Prnp and Prnp cultures proved susceptible 55448 Genetic Assay of PrP and Doppel nal region, followed by a globular C-terminal structured do- main comprised of helices A, B/B, and C as well as two short -strands. Two disulfide bonds (between residues 93 and 148 and between residues 103 and 143) cross-link helices B/B and C (13, 15). A series of three large deletion mutant alleles (29–49, 50–90, and 91–149) were created to encompass these structural elements. In addition, smaller deletions (91– 125, 91–100, 101–125, and 126–149) were created within the boundaries of the most C-terminal large deletion (Fig. 6A). These mutant alleles were transferred to the bigenic expres- sion vector and assessed as per the previous assays. The results of these assays indicated that toxicity mapped to the central region of the protein, as the 91–149 allele reduced toxicity to base-line levels. Smaller deletions of this region were inform- ative and further mapped the toxic activity to sequences lying between codons 101 and 125. Conversely, alleles affecting helix C (a reciprocal Dpl-(126–149) sub-deletion and an allele cre- ated by linker insertion at codon 135) retained full toxic activ- ity. All other deletion alleles retained both their toxic activity and their sensitivity to the presence of PrP expression (Fig. 6B and Table II). In parallel experiments, we also assessed the expression of the corresponding mutant proteins in transient transfections of N2a neuroblastoma cells (Fig. 7). C-terminal deletion mutants were immunodetected by using an N-terminal Dpl antibody (in the case of the Dpl29–49, mutant protein expression was visualized with the E6977 antibody raised against a C-terminal epitope). Each of these deletion alleles lacking pro-apoptotic activity was nonetheless capable of encoding a stable protein, although, depending upon the particular deletion interval, ap- propriately smaller than the wt allele and/or devoid of the electrophoretic heterogeneity deriving from glycosylation of Asn-99 and Asn-111. DISCUSSION A Cellular Assay for Prnp/Prnd Interactions We have adopted a gene-based approach to dissect the an- tagonistic activities of PrP and Dpl, a methodology that is not necessarily dependent upon a priori assumptions concerning either biochemical mechanism or cellular site of action. Our assay for activities encoded by the Prnd and Prnp genes is based upon transfection of cerebellar granule cell neurons, one FIG.4. Doppel-induced neuronal death is apoptotic. A, fluores- of the target cells for Dpl toxicity observed in vivo, and also a 0/0 cence micrographs of Prnp cerebellar granule cells transfected with target population for an apparently similar syndrome produced pBud-GFP-empty vector (e.v.) and pBud-GFP-Dpl. Although neurons by expression of N-terminally truncated forms of PrP (20, 25, transfected with the empty vector appeared nonapoptotic (1st row), a higher percentage of Dpl-expressing neurons (2nd and 3rd rows) 51, 52). This assay for Dpl toxicity measures apoptosis, as showed an apoptotic phenotype characterized by nuclear condensation defined by nuclear morphology, the action of a pan-caspase and fragmentation (Hoechst staining: middle column, 2nd and 3rd C inhibitor and activation of caspase 3, and is blocked by PrP rows) and simultaneous expression of the active caspase-3 form (immu- expression from an endogenous Prnp gene or supplied from a nofluorescence with polyclonal active-caspase-3 antibody, right-hand 0/0 column, 2nd and 3rd rows). B, Prnp granule cells were transfected co-transfected transgene. It is important to stress that some with both pBud-GFP-empty-vector and pBud-GFP-Dpl constructs in Prnp alleles tested here in CGNs have close equivalents that the presence of 20 M of Ac-DEVD-CHO, an inhibitor of caspases 3, 6, have recently been assessed in Tg mice (43), and results ob- 7, 8, and 10. The inhibitor could rescue Doppel-induced neurotoxicity. tained in the two systems are remarkably similar (Table I). In ANOVA, *, p  0.0055. our assay, N-terminal PrP deletions to remove the octarepeats are nontoxic, as is the case in Tg mice (53). Furthermore, Dpl to the toxic effect (Fig. 5C), providing a close parallel to the toxicity in granule cells is not blocked by PrP alleles deleted for behavior of a pathogenic PrP transgene encoding 14 octare- all five octarepeats (PrP51–90), offering a parallel to an N- peats (49) and thus comprising a control for the fidelity of the granule cell transfection assay. Finally, the PrP32–121 allele terminally deleted Prnp allele (PrP23–88) tested in Tg mice. A second Prnp allele with a larger deletion (PrP32–121) is was sensitive to Prnp genotype, as is also the case in mice (25). Similarities in the performance of Prnp alleles in Tg mice and toxic, yet sensitive to co-expression of wt Prnp,as in vivo (25). Finally, an octarepeat expansion familial prion disease allele cultured cells are summarized in Table I. Prior analyses have indicated these Prnp mutations have little effect upon the (octa13) comprised a third internal control. This was pro-apo- ptotic to an equal or greater extent as Dpl but insensitive to the ability to produce robust levels of PrP expression, although in some instances they influence trafficking (as discussed below). presence of wt Prnp alleles, as is indeed the case for expression Pro-apoptotic Properties of Dpl Deletion Mutants—The NMR of an octa14 allele (“PG14”) assayed in Tg mice (49). A practical structure of Dpl is characterized by an unstructured N-termi- consequence of these findings is that it may be possible to Genetic Assay of PrP and Doppel 55449 FIG.5. Prnp alleles analyzed in the CGN assay. A, panel of PrP mutants that have been tested in co-transfection exper- iments to detect the protective domain of PrP in Dpl-mediated neurodegeneration. Helices A–C are represented as rectan- gles, and the two short -strands are rep- resented by rectangles with horizontal shading. Mutants represent an N-termi- nal deletion protein (PrP23–28), an octa- repeat deletion protein (PrP51–90), a molecule where each histidine residue within the copper-binding octarepeats was converted to a glycine residue (PHGG(G/S)WGQ 3 PGGG(G/S)WGQ ), 4 4 “H/G”), and a PrP molecule lacking the GPI anchor (PrPS232ter). B, co-transfec- 0/0 tion experiments in Prnp cerebellar granule cells were performed to analyze the protective domain of PrP (upper graph). pBud-GFP-wtPrP, pBud-GFP- PrP51–90, pBud-GFP-PrPS232ter, pBud-GFP-PrP23–28, and pBud-GFP- PrP-H/G constructs were transfected alone (data not shown) and in the pres- ence of pBud-GFP-empty vector (e.v.)or pBud-GFP-Dpl. None of the PrP mutants showed intrinsic toxicity when trans- fected alone (data not shown). Whereas PrP23–28, PrP51–90, and PrP-H/G are incapable of rescuing Dpl-induced neuro- toxicity, PrPS232ter is fully protective. ANOVA (#, p  0.0001 versus empty vec- tor; **, p  0.0051 versus evwtPrP; *, p  0.0004 versus evwtPrP; ***, p 0.0211 versus evwtPrP). C, as a fur- ther control for the reliability of the cel- 0/0 / lular model, both Prnp and Prnp cerebellar granule cells were transfected with pBud-GFP-PrPOcta13, an octare- peat insertion PrP mutant bearing eight additional octarepeats and with pBud- GFP-PrP32–121 (“Shmerling syndrome” allele). The PrPOcta13 allele was neuro- toxic in both PrP knock-out and PrP - expressing cells, behaving unlike Doppel and PrP32–121 as a dominant trait, and thus further confirming the accuracy of our cellular system. ANOVA (*, p 0.0001; **, p  0.0001; #, p 0.44). 55450 Genetic Assay of PrP and Doppel TABLE I Similar actions of Prnp alleles in granule cell neurons and transgenic mice Pro-apoptotic activity Pro-apoptotic activity in Offsets pro-apoptotic 0/0 / in Prnp neurons? Prnp neurons? effect of Dpl? a Prnp allele Ref. for Tg mice CGN Tg mice CGN Tg mice CGN Tg mice wt No No No No Yes Yes 20, 22, 42, 43, Deleted for all 5 octarepeats No No No No No No 53 c d Altered octarepeat histidines No No No Not done No Not done This paper Deletion of residues 32–121 Yes Yes No No NA NA 25 f g f g Octarepeat expansion Yes Yes Yes Yes NA NA 49, 85 For all data regarding apoptosis in CGNs, see this paper. Prnp allele with a 51–90 deletion was assayed in CGNs, and Prnp alleles with 23–88 or 32–93 deletions were assayed in Tg mice. Each octarepeat histidine was converted to a glycine residue; see main text. d C 0/0 No overt pathologic abnormalities in Tg mice with 1 endogenous PrP expression were assessed in a Prnp genetic background at 15 months of age (O. Windl and H. Kretzschmar, manuscript in preparation). NA indicates not applicable. This result is from an assay of Prnp alleles with a total of 13 octarepeat units. This result is from an assay of Prnp alleles with a total of 14 octarepeat units. predict neurotoxic properties of novel Prnp alleles by analyses With regard to the known properties and functions of the PrP in CGN cells prior to the creation of Tg mice. domains defined by genetic mapping, the charged region While results of our genetic assays are in close accord with in KKRPKP removed by the PrP23–28 deletion contributes to vivo paradigms, we failed to establish a parallel assay based the action of dominant negative PrP alleles that inhibit con- C Sc upon treatment of cerebellar cells with natively folded recom- version of wt PrP to PrP (48). This region is also implicated binant Dpl and PrP (prepared as described previously (13, 54)). in targeting, in the form of a weak nuclear localization signal 0/0 Although Cui et al. (55) have described toxicity for Prnp cells (perhaps only germane to the pathogenesis of PRNP alleles produced by a Dpl-(127–151) peptide at a concentration of 10 encoding truncated forms of PrP (63)), in controlling a tran- M or more, the significance of these treatments and their sition from raft-like domains to clathrin-coated pits (47), and in pharmacological sequelae is unclear, because toxicity was dynein-mediated retrograde axonal transport (64). Features of blocked by PrP-(106–126), an aggregating peptide widely used the octarepeat sequences include selective Cu(II) binding in as a model for PrP-related neurotoxicity (56). Residues 127– vitro (65, 66) and again a relationship to trafficking signals. 151 in the vicinity of helix C were excluded (by three different Thus octarepeat sequences serve to facilitate basal and/or alleles) from an obligatory role in toxicity in our genetic exper- Cu(II)-stimulated endocytosis (67–70) and kinesin-mediated iments (Table II). anterograde axonal transport (64). Although there has been recent interest in “cytoplasmic” PrP (5), such species are Activity Determinants in PrP and Dpl thought to be neurotoxic rather than neuroprotective in cere- C C bellar neurons. We are currently aware of no data from the PrP —Our data thus far reveal two determinants in PrP granule cell assay that supports action of PrP outside of the that, when deleted or otherwise mutated, result in an inability compartments of the secretory and endocytic pathways (8, 9). to protect against Dpl-mediated toxicity. The first is defined by PrP regions scrutinized to date do not lie in the globular the charged motif KKRPKP at the N terminus of mature PrP portion of the molecule, and prior studies have indicated they (PrP23–28), and the second corresponds to the octarepeat have no overt effect upon stability either in cultured cells region (PrP51–90). Of note, a similar octarepeat deletion al- and/or the central nervous system (47, 53, 71). Although the lele failed to protect against Bax-mediated cell death of human effects of these mutations upon PrP half-life in CGNs cannot neurons (26) and cell death induced by serum deprivation of a 0/0 be excluded, we suggest an influence upon trafficking and Prnp neuronal cell line (57, 58). Missense mutations substi- delivery is more plausible. In addition to the effect of N-termi- tuting octarepeat histidine residues for glycine (PHGG(G/ nal sequences described here, it is likely that yet other deter- S)WGQ 3 PGGG(G/S)WGQ ) also inactivated the protective 4 4 minants of neuroprotective activity map elsewhere within effect of PrP (Fig. 5). Not all mutant PrP alleles scrutinized PrP. here lead to loss of protective activity, however, arguing that Doppel—In contrast to Prnp, deletion analysis of a Prnd PrP is not indiscriminately sensitive to perturbation. For ex- cDNA has revealed only major determinants necessary for ample, a Prnp allele impaired in its ability to undergo GPI pro-apoptotic activity. This maps within nucleotides 303–375 of anchor addition exhibited protective activity comparable with a the ORF, corresponding to residues 101–125 encompassing wt allele, as was also the case for a similar allele tested in the helix B/B. Landmark features within this interval include context Bax-initiated apoptosis (26). Although the high fre- cysteine 109 and asparagine 111 (contributing to the N-termi- quency at which granule cells are co-transfected when exposed nal linkage of the “inner” disulfide bond and an N-linked gly- to mixtures of two plasmids indicates that transgene-encoded cosylation site, respectively), but both Cys-109 and Asn-111 Dpl and PrP proteins likely co-exist within the same cells in have close equivalents in PrP . Therefore, these particular our paradigm, it is of interest to note that effects in trans (in a determinants seem unlikely to contribute to the neurotoxic cellular sense) have been noted in other paradigms. In these activity of Dpl. More broadly, the panel of mutant Dpl alleles experiments, wt PrP expressed in cerebellar granule cells was described here, as well as data deriving from other point mu- able to abrogate death of Purkinje cells determined by a tations, suggests that complete folding and maturation of PrP32–134 transgene expressed from a Purkinje cell-specific globular -helical domain of Dpl is not required for toxic “L7” promoter (52). Whether cell-surface shed or donated PrP activity. (59–61), or other GPI anchor-less forms of PrP (which may Although antagonistic actions of Prnp and Prnd (or deleted nonetheless retain membrane association) (62) similar to the protein encoded by the S232ter and PrPGPI alleles (this pa- per and Ref. 26), contribute to neuroprotective effects discerned in Tg mice remains to be established. B. Drisaldi, manuscript in preparation. Genetic Assay of PrP and Doppel 55451 FIG.6. Neurotoxic properties of Doppel mutants. A, representation of wt Dpl and Dpl mutants representing 7 deletions along the entire coding region of the molecule (Dpl29–49, Dpl50–90, Dpl91–149, Dpl91–125, Dpl126–149, Dpl91–100, and Dpl101–125), one 5-bp insertion mutant in the middle of C helix (Dpl-GPS1-1), a stop codon mutant at GPI anchor site 155, and a double termination truncation mutant at site 92. Helices A–C are represented as rectangles, and the two short -strands are represented by rectangles with horizontal shading. B, Dpl 0/0 deletion mutants were transfected into Prnp granule neurons. Although deletions in both the N-terminal and middle regions of Dpl protein did not change Dpl neurotoxic activity, both deletion of helices B/B C and subsequently the sub-deletion of the kinked helix B/B only abolished Dpl toxicity (upper graph). ANOVA, *, p  0.0001 versus empty vector; #, p 0.36. Of note, Dpl GPI anchor is not required to induce toxicity. C, / C C all deletion mutants were transfected in Prnp granule cells in order to confirm the Dpl/PrP paradigm (bottom graph). PrP expression protected neurons from the pro-apoptotic activity associated with wt and mutant Dpl. ANOVA, p 0.22. 55452 Genetic Assay of PrP and Doppel TABLE II Pro-apoptotic properties of Prnd alleles Prnd alleles encode a 0/0 a / Prnd alleles Pro-apoptotic activity in Prnp cells Pro-apoptotic activity in Prnp cells b stable proteins Dpl wt Yes (p  0.0001) No Yes Dpl29–49 Yes (p  0.0001) No Yes Dpl50–90 Yes (p  0.0001) No Yes Dpl91–149 No No Yes Dpl91–125 No No Yes Dpl126–149 Yes (p  0.0001) No Yes Dpl91–100 Yes (p  0 .0002) No Yes Dpl101–125 No No Yes Dpl-G155ter Yes (p  0.0001) No Low expression Dpl-GPS 1–1 Yes (p  0.0001) No Yes Dpl-91,92terter No Not done Not done Pro-apoptotic effect was assessed in CGNs when expressed in the context of pBud-GFP plasmids and using empty vector transfected cells as negative controls. Data were derived from acute transfections of mouse neuroblastoma N2a cells; see Fig. 7. ptotic (Fig. 6). Thus it would appear that the pro-apoptotic activity of Dpl is dependent upon translation of ORF nucleo- tides 303–375 and hence upon a biochemical property of the central region of the Doppel molecule. Distinct from the analogous region of PrP, the NMR struc- ture of this region of Dpl reveals a kink, dividing it into B and B helices of 16 (residues 101–116) and 9 (residues 117–125) residues, respectively (14, 15, 78, 79). In our genetic analyses, the region including residues 101–125 can exert a pro-apoptotic effect in the absence of Aor C (Fig. 6), but it is unclear whether residues 101–125 in solution adopt an interrupted helical conformation in the absence of other portions of the protein; for example, in the NMR structure the kinked region involves a hydrogen bond between Asn-117 and Phe-60 in the first -strand (15), and a synthetic peptide corresponding to the helix B region assessed in phosphate buffer was characterized by a random coil signature (55). The interval defined by the 101–125-residue deletion has also attracted prior interest as overlapping a Cu(II)-binding site defined by fluorescence quenching, equilibrium dialysis binding, and mass spectromet- ric analysis of a Dpl-(101–145) peptide (18). Whether competi- tive binding of copper contributes to the antagonistic actions of these proteins is uncertain, however, because the Dpl-(101– 145) peptide used to define Cu binding also includes sequences from helix C. Further analysis of this active region by satura- tion mutagenesis would appear to be in order. FIG.7. Expression of mutant Doppel proteins in N2a cells. A, expression of Dpl alleles in N2a cells. Neuroblastoma cells were Understanding and Manipulating PrP transiently transfected with plasmids used in cerebellar granule cells in Health and Disease for toxicity assays. Samples were immunoblotted from a 10 to 20% Tris-glycine gradient gel. Lanes 1 and 8, empty vector; lanes 2 and 9, What are the implications of our findings with respect to wt Dpl; lanes 3 and 10, Dpl29–49; lane 4, Dpl50–90; lane 5, prion replication in infectious diseases such as scrapie and DplG155ter; lane 6, DplGPS1-1. Protein expression was tested using bovine spongiform encephalopathy? Dominant negative alleles Dpl antibody raised against N-terminal residues 27–39 (lanes 1–6)or E6977 against full-length Dpl- (27–154) (lanes 8–10). Mature wt Dpl of PrP comprise an important avenue with regard to targeted is highly glycosylated and visible as a heterodisperse signal centered therapy, but it is unclear whether trans-dominant Prnp muta- near an apparent molecular mass of 28 kDa (lanes 2 and 9). Dpl tions lying within a putative protein X-binding site (3, 80) G155ter (lane 5) is expressed at a low level, and the GPS1-1 insertion confer resistance equally to all prion strains. On the other allele is not associated with the heterodisperse signal typically indic- hand, prior experiments strongly suggest that wt Dpl is intrin- ative of glycosylation (lane 6). B, protein expression tested using N-terminal Dpl antibody. Lane 11, empty vector; lane 12, wt Dpl; lane sically incapable of conversion to a -sheet pathogenic confor- 13, Dpl91–149; lane 14, Dpl91–125; lane 15, Dpl126–149; lane mation in the presence of infectious prions (15, 20, 81). By 16, Dpl91–100; lane 17, Dpl101–125. defining a Prnd101–125 allele as non-neurotoxic, our studies now provide a basis for the design of hybrid Dpl-PrP molecules Sc forms of Prnp,“PrP”) have traditionally been equated with resistant to pathologic refolding initiated by PrP . Such hybrid protein activities (24, 25, 72), because unusual secondary struc- molecules might form the basis for new strategies to interfere tures have been proposed for Prnp mRNA (73–75) and conver- with prion replication in trans or to create PrP-related proteins C C sion of PrP to protease-resistant forms is facilitated by cellu- that retain important physiological properties of PrP (82–84), lar RNAs (76, 77), we also considered RNA-based mechanisms. yet are innately resistant to prion infections. To exclude biological properties of this ribonucleotide sequence With regard to discerning the active sites and physiological as a basis for pro-apoptotic activity, we created a Prnd allele attributes of cellular prion proteins, there has been much in- C Sc with tandem stop codons inserted just upstream of this position terest in the requirements of PrP for conversion to PrP in (Dpl91,92terter). Unlike wt Dpl, this allele was not pro-apo- transformed cells, but comparatively few studies focusing upon Genetic Assay of PrP and Doppel 55453 Masliah, E., Gilden, D., Oldstone, M. B., Conti, B., and Williamson, R. A. other biological readouts of activity, and few using primary (2004) Science 303, 1514–1516 cultures of adult neurons. To the best of our knowledge, the 28. Diarra-Mehrpour, M., Arrabal, S., Jalil, A., Pinson, X., Gaudin, C., Pietu, G., Pitaval, A., Ripoche, H., Eloit, M., Dormont, D., and Chouaib, S. (2004) system described is the first to be calibrated in vivo via the Cancer Res. 64, 719–727 performance of benchmark Prnp alleles tested in Tg mice, and 29. Aguzzi, A., and Polymenidou, M. (2004) Cell 116, 313–327 is also compatible with saturation mutagenesis. Our studies 30. Wong, B. S., Liu, T., Paisley, D., Li, R., Pan, T., Chen, S. G., Perry, G., Petersen, R. B., Smith, M. A., Melton, D. W., Gambetti, P., Brown, D. R., thus far have defined a contribution of N-terminal PrP se- and Sy, M. S. (2001) Mol. Cell. Neurosci. 17, 768–775 quences in neuroprotection, and it is of interest to note a close 31. Westaway, D., Hood, L. E., and Prusiner, S. B. (2004) in Prion Biology and Diseases (Prusiner, S. B., ed) 2nd Ed., pp. 283–304, Cold Spring Harbor concordance between deletion intervals and features required Laboratory Press, Cold Spring Harbor, NY for anterograde and retrograde axonal transport (64). It is 32. Locht, C., Chesebro, B., Race, R., and Keith, J. M. (1986) Proc. Natl. Acad. Sci. possible that these determinants would have been overlooked U. S. A. 83, 6372–6376 33. Westaway, D., Cooper, C., Turner, S., Da Costa, M., Carlson, G. A., and in cellular paradigms that do not use differentiated neurons, Prusiner, S. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6418–6422 and that further iterations of the granule cell transfection 34. Bu¨ eler, H., Fischer, M., Lang, Y., Bluethmann, H., Lipp, H.-P., DeArmond, assay will lead to a genetic definition of structures and subcel- S. J., Prusiner, S. B., Aguet, M., and Weissmann, C. (1992) Nature 356, 577–582 lular localizations required for the bioactivity of PrP . Whether 35. Prusiner, S., Scott, M., Foster, D., Westaway, D., and DeArmond, S. (1990) Cell these bioactive forms coincide with the abundant cell-surface 63, 673–686 36. Miller, T. M., and Johnson, E. M., Jr. (1996) J. Neurosci. 16, 7487–7495 displayed molecules detected by routine biochemical and cyto- 37. Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M. E. (1998) Cell 95, logical analysis remains to be established. 55–66 38. Sanchez, I., Xu, C. J., Juo, P., Kakizaka, A., Blenis, J., and Yuan, J. (1999) Acknowledgments—We thank Kefeng Qin for help in the early Neuron 22, 623–633 phases of this work; S. Prusiner for E6977 antibody; J.-L. Laplanche 39. Li, R., Liu, T., Wong, B. S., Pan, T., Morillas, M., Swietnicki, W., O’Rourke, K., and J.-F. Foncin for DNA from the “octa13” kindred; E. Flechsig and Gambetti, P., Surewicz, W. K., and Sy, M. S. (2000) J. Mol. Biol. 301, 0/0 567–573 Umberto DeBoni for plasmids; B. Ghetti for a stock of Prnp mice; and 40. Levkovitz, Y., and Baraban, J. M. (2001) J. Neurosci. 21, 5893–5901 George Carlson, Janice Robertson, David Williams, and Gerold 41. Nishida, N., Tremblay, P., Sugimoto, T., Shigematsu, K., Shirabe, S., Petrom- Schmitt-Ulms for discussions. illi, C., Pilkuhn, S., Nakaoke, R., Atarashi, R., Houtani, T., Torchia, M., Sakaguchi, S., DeArmond, S. J., Prusiner, S. B., and Katamine, S. (1999) REFERENCES Lab. Investig. 79, 689–697 42. Anderson, L., Rossi, D., Linehan, J., Brandner, S., and Weissmann, C. (2004) 1. Prusiner, S. B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13363–13383 Proc. Natl. Acad. Sci. U. S. A. 101, 3644–3649 2. Telling, G. C., Scott, M., Mastrianni, J., Gabizon, R., Torchia, M., Cohen, F. E., 43. Atarashi, R., Nishida, N., Shigematsu, K., Goto, S., Kondo, T., Sakaguchi, S., DeArmond, S. J., and Prusiner, S. B. (1995) Cell 83, 79–90 and Katamine, S. (2003) J. Biol. Chem. 278, 28944–28949 3. Kaneko, K., Zulianello, L., Scott, M., Cooper, C. M., Wallace, A. C., James, 44. Nicholson, D. W., Ali, A., Thornberry, N. A., Vaillancourt, J. P., Ding, C. K., T. L., Cohen, F. E., and Prusiner, S. B. (1997) Proc. Natl. Acad. Sci. U. S. A. Gallant, M., Gareau, Y., Griffin, P. R., Labelle, M., Lazebnik, Y. A., Mun- 94, 10069–10074 day, N., Sayyaparaju, M., Smulson, M. E., Yamin, T.-T., Yu, V. L., and 4. Ma, J., and Lindquist, S. (1999) Nat. Cell Biol. 1, 358–361 Miller, D. K. (1995) Nature 376, 37–43 5. Ma, J., Wollmann, R., and Lindquist, S. (2002) Science 298, 1781–1785 45. Viles, J. H., Cohen, F. E., Prusiner, S. B., Goodin, D. B., Wright, P. E., and 6. Yedidia, Y., Horonchik, L., Tzaban, S., Yanai, A., and Taraboulos, A. (2001) Dyson, H. J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2042–2047 EMBO J. 20, 5383–5391 46. Fischer, M., Rulicke, T., Raeber, A., Sailer, A., Moser, M., Oesch, B., Brandner, 7. Drisaldi, B., Stewart, R. S., Adles, C., Stewart, L. R., Quaglio, E., Biasini, E., S., Aguzzi, A., and Weissmann, C. (1996) EMBO J. 15, 1255–1264 Fioriti, L., Chiesa, R., and Harris, D. A. (2003) J. Biol. Chem. 278, 47. Sunyach, C., Jen, A., Deng, J., Fitzgerald, K. T., Frobert, Y., Grassi, J., 21732–21743 McCaffrey, M. W., and Morris, R. (2003) EMBO J. 22, 3591–3601 8. Mironov, A., Jr., Latawiec, D., Wille, H., Bouzamondo-Bernstein, E., Legname, 48. Zulianello, L., Kaneko, K., Scott, M., Erpel, S., Han, D., Cohen, F. E., and G., Williamson, R. A., Burton, D., DeArmond, S. J., Prusiner, S. B., and Prusiner, S. B. (2000) J. Virol. 74, 4351–4360 Peters, P. J. (2003) J. Neurosci. 23, 7183–7193 49. Chiesa, R., Drisaldi, B., Quaglio, E., Migheli, A., Piccardo, P., Ghetti, B., and 9. Roucou, X., Guo, Q., Zhang, Y., Goodyer, C. G., and LeBlanc, A. C. (2003) Harris, D. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5574–5579 J. Biol. Chem. 278, 40877–40881 50. Foncin, J.-F., Cardot, J.-L., Martinet, Y., and Arnott, G. (1982) Rev. Neurol. 10. Moore, R., Lee, I., Silverman, G. S., Harrison, P., Strome, R., Heinrich, C., (Paris) 138, 123–135 Karunaratne, A., Pasternak, S. H., Chishti, M. A., Liang, Y., Mastrangelo, 51. Chesebro, B. (2002) EMBO Rep. 3, 1123–1126 P., Wang, K., Smit, A. F. A., Katamine, S., Carlson, G. A., Cohen, F. E., 52. Flechsig, E., Hegyi, I., Leimeroth, R., Zuniga, A., Rossi, D., Cozzio, A., Prusiner, S. B., Melton, D. W., Tremblay, P., Hood, L. E., and Westaway, D. Schwarz, P., Rulicke, T., Gotz, J., Aguzzi, A., and Weissmann, C. (2003) (1999) J. Mol. Biol. 293, 797–817 EMBO J. 22, 3095–3101 11. Westaway, D., and Carlson, G. A. (2002) Trends Biochem. Sci. 27, 301–307 53. Flechsig, E., Shmerling, D., Hegyi, I., Raeber, A. J., Fischer, M., Cozzio, A., von 12. Stahl, N., Borchelt, D. R., Hsiao, K., and Prusiner, S. B. (1987) Cell 51, Mering, C., Aguzzi, A., and Weissmann, C. (2000) Neuron 27, 399–408 229–240 54. Qin, K., Yang, D. S., Yang, Y., Chishti, M. A., Meng, L. J., Kretzschmar, H. A., 13. Silverman, G. L., Qin, K., Moore, R. C., Yang, Y., Mastrangelo, P., Tremblay, Yip, C. M., Fraser, P. E., and Westaway, D. (2000) J. Biol. Chem. 275, P., Prusiner, S. B., Cohen, F. E., and Westaway, D. (2000) J. Biol. Chem. 19121–19131 275, 26834–26841 55. Cui, T., Holme, A., Sassoon, J., and Brown, D. R. (2003) Mol. Cell. Neurosci. 23, 14. Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R., and Wuth- 144–155 rich, K. (1996) Nature 382, 180–183 56. Forloni, G., Angeretti, N., Chiesa, R., Monzani, E., Salmona, M., Bugiani, O., 15. Mo, H., Moore, R. C., Cohen, F. E., Westaway, D., Prusiner, S. B., Wright, P. E., and Tagliavini, F. (1993) Nature 362, 543–546 and Dyson, H. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 2352–2357 57. Kuwahara, C., Takeuchi, A. M., Nishimura, T., Haraguchi, K., Kubosaki, A., 16. Hornshaw, M. P., McDermott, J. R., and Candy, J. M. (1995) Biochem. Biophys. Matsumoto, Y., Saeki, K., Yokoyama, T., Itohara, S., and Onodera, T. (1999) Res. Commun. 207, 621–629 Nature 400, 225–226 17. Sto¨ckel, J., Safar, J., Wallace, A. C., Cohen, F. E., and Prusiner, S. B. (1998) 58. Sakudo, A., Lee, D. C., Saeki, K., Nakamura, Y., Inoue, K., Matsumoto, Y., Biochemistry 37, 7185–7193 Itohara, S., and Onodera, T. (2003) Biochem. Biophys. Res. Commun. 308, 18. Qin, K., Coomaraswamy, J., Mastrangelo, P., Yang, Y., Lugowski, S., Petrom- 660–667 illi, C., Prusiner, S. B., Fraser, P. E., Goldberg, J. M., Chakrabartty, A., and 59. Stahl, N., Baldwin, M. A., Burlingame, A. L., and Prusiner, S. B. (1990) Westaway, D. (2003) J. Biol. Chem. 278, 8888–8896 Biochemistry 29, 8879–8884 19. Behrens, A., Brandner, S., Genoud, N., and Aguzzi, A. (2001) EMBO Rep. 2, 60. Borchelt, D. R., Rogers, M., Stahl, N., Telling, G., and Prusiner, S. B. (1993) 347–352 20. Moore, R., Mastrangelo, P., Bouzamondo, E., Heinrich, C., Legname, G., Glycobiology 3, 319–329 61. Liu, T., Li, R., Pan, T., Liu, D., Petersen, R. B., Wong, B. S., Gambetti, P., and Prusiner, S. B., Hood, L., Westaway, D., DeArmond, S., and Tremblay, P. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 15288–15293 Sy, M. S. (2002) J. Biol. Chem. 277, 47671–47678 62. Walmsley, A. R., Zeng, F., and Hooper, N. M. (2003) J. Biol. Chem. 278, 21. Sakaguchi, S., Katamine, S., Nishida, N., Moriuchi, R., Shigematsu, K., Sugi- moto, T., Nakatani, A., Kataoka, Y., Houtani, T., Shirabe, S., Okada, H., 37241–37248 63. Gu, Y., Hinnerwisch, J., Fredricks, R., Kalepu, S., Mishra, R. S., and Singh, N. Hasegawa, S., Miyamoto, T., and Noda, T. (1996) Nature 380, 528–531 22. Rossi, D., Cozzio, A., Flechsig, E., Klein, M. A., Rulicke, T., Aguzzi, A., and (2003) Neurobiol. Dis. 12, 133–149 64. Hachiya, N. S., Watanabe, K., Yamada, M., Sakasegawa, Y., and Kaneko, K. Weissmann, C. (2001) EMBO J. 20, 694–702 23. Mastrangelo, P., and Westaway, D. (2001) Gene (Amst.) 275, 1–18 (2004) Biochem. Biophys. Res. Commun. 315, 802–807 65. Qin, K., Yang, Y., Mastrangelo, P., and Westaway, D. (2002) J. Biol. Chem. 24. Behrens, A., and Aguzzi, A. (2002) Trends Neurosci. 25, 150–154 25. Shmerling, D., Hegyi, I., Fischer, M., Blattler, T., Brandner, S., Gotz, J., 277, 1981–1990, and references therein Rulicke, T., Flechsig, E., Cozzio, A., C., von Mering, C., Hangartner, C., 66. Lehmann, S. (2002) Curr. Opin. Chem. Biol. 6, 187–192, and references Aguzzi, A., and Weissmann, C. (1998) Cell 93, 203–214 therein 26. Bounhar, Y., Zhang, Y., Goodyer, C. G., and LeBlanc, A. (2001) J. Biol. Chem. 67. Shyng, S.-L., Moulder, K. L., Lesko, A., and Harris, D. A. (1995) J. Biol. Chem. 276, 39145–39149 270, 14793–14800 27. Solforosi, L., Criado, J. R., McGavern, D. B., Wirz, S., Sanchez-Alavez, M., 68. Pauly, P. C., and Harris, D. A. (1998) J. Biol. Chem. 273, 33107–33110 Sugama, S., DeGiorgio, L. A., Volpe, B. T., Wiseman, E., Abalos, G., 69. Sumudhu, W., Perera, W. S., and Hooper, N. M. (2001) Curr. Biol. 11, 519–523 55454 Genetic Assay of PrP and Doppel 70. Nunziante, M., Gilch, S., and Schatzl, H. M. (2003) J. Biol. Chem. 278, 79. Luhrs, T., Riek, R., Guntert, P., and Wuthrich, K. (2003) J. Mol. Biol. 326, 3726–3734 1549–1557 71. Suppattapone, S., and Rees, J. (2004) in Prions and Prion Diseases (Telling, G., 80. Perrier, V., Kaneko, K., Safar, J., Vergara, J., Tremblay, P., DeArmond, S. J., ed) pp. 83–102, Horizon Scientific Press, Wymondham, UK Cohen, F. E., Prusiner, S. B., and Wallace, A. C. (2002) Proc. Natl. Acad. 72. Legname, G., Nelken, P., Guan, Z., Kanyo, Z. F., DeArmond, S. J., and Sci. U. S. A. 97, 6073–6078 Prusiner, S. B. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 16285–16290 81. Nicholson, E. M., Mo, H., Prusiner, S. B., Cohen, F. E., and Marqusee, S. (2002) 73. Wills, P. R., and Hughes, A. J. (1990) J. Acquired Immune Defic. Syndr. 3, J. Mol. Biol. 316, 807–815 95–97 82. Collinge, J., Whittington, M. A., Sidle, K. C., Smith, C. J., Palmer, M. S., 74. Wills, P. R. (1992) J. Theor. Biol. 159, 523–527 Clarke, A. R., and Jefferys, J. G. R. (1994) Nature 370, 295–297 75. Luck, R., Steger, G., and Riesner, D. (1996) J. Mol. Biol. 258, 813–826 83. Lledo, P.-M., Tremblay, P., DeArmond, S. J., Prusiner, S. B., and Nicoll, R. A. 76. Deleault, N. R., Lucassen, R. W., and Supattapone, S. (2003) Nature 425, (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2403–2407 717–720 84. Tobler, I., Gaus, S. E., DeBoer, T., Achermann, P., Fischer, M., Rulicke, T., 77. Adler, V., Zeiler, B., Kryukov, V., Kascsak, R., Rubenstein, R., and Grossman, Moser, M., Oesch, B., McBride, P. A., and Manson, J. C. (1996) Nature 380, A. (2003) J. Mol. Biol. 332, 47–57 639–642 78. James, T. L., Liu, H., Ulyanov, N. B., Farr-Jones, S., Zhang, H., Donne, D. G., Kaneko, K., Groth, D., Mehlhorn, I., Prusiner, S. B., and Cohen, F. E. (1997) 85. Chiesa, R., Piccardo, P., Ghetti, B., and Harris, D. A. (1998) Neuron 21, Proc. Natl. Acad. Sci. U. S. A. 94, 10086–10091 1339–1351 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Genetic Mapping of Activity Determinants within Cellular Prion Proteins

Download PDF
12 pages

Loading next page...
 
/lp/unpaywall/genetic-mapping-of-activity-determinants-within-cellular-prion-HCBzwrem1V

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m404794200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 53, Issue of December 31, pp. 55443–55454, 2004 © 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Genetic Mapping of Activity Determinants within Cellular Prion Proteins N-TERMINAL MODULES IN PrP OFFSET PRO-APOPTOTIC ACTIVITY OF THE DOPPEL HELIX B/B REGION* Received for publication, April 29, 2004, and in revised form, September 29, 2004 Published, JBC Papers in Press, September 29, 2004, DOI 10.1074/jbc.M404794200 Bettina Drisaldi‡, Janaky Coomaraswamy‡, Peter Mastrangelo‡, Bob Strome‡, Jing Yang‡, Joel C. Watts‡, M. Azhar Chishti‡, Melissa Marvi‡, Otto Windl§, Rosemary Ahrens‡, Franc¸ois Major¶, Man-Sun Sy, Hans Kretzschmar**, Paul E. Fraser‡ ‡‡, Howard T. J. Mount‡§§, and David Westaway‡¶¶ From the ‡Centre for Research in Neurodegenerative Diseases, ‡‡Department of Medical Biophysics, the §§Department of Medicine, and the ¶¶Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5S 3H2, Canada, §Veterinary Laboratories Agency, Weybridge, Surrey KT15 3NB, United Kingdom, the ¶Departement d’Informatique et de Recherche Operationelle, Universite´ de Montreal, Montre´al, Quebec H3C 3J7, Canada, Institute of Pathology, Case Western Reserve University, Cleveland, Ohio 44106, and **Ludwig-Maximilians University, 81377 Munich, Germany The PrP-like Doppel (Dpl) protein causes apoptotic of prion infections, it is well accepted that a profound structural death of cerebellar neurons in transgenic mice, a proc- remodeling involving a templated conformational change cul- ess prevented by expression of the wild type (wt) cellu- minates in the formation of protease-resistant and infectivity- C C lar prion protein, PrP . Internally deleted forms of PrP associated forms of the prion protein commonly denoted as Sc resembling Dpl such as PrP32–121 produce a similar PrP . In the case of inherited prion diseases such as familial PrP -sensitive pro-apoptotic phenotype in transgenic Creuzfeldt-Jakob disease, insertional or missense mutations in mice. Here we demonstrate that these phenotypic at- the human PrP gene (PRNP, denoted Prnp in the mice) result tributes of wt Dpl, wt PrP , and PrP132–121 can be C in abnormal forms of PrP that may, in some instances, mis- accurately recapitulated by transfected mouse cerebel- fold and accumulate in the endoplasmic reticulum. However, lar granule cell cultures. This system was then explored insights into the normal function of PrP , and the extent to by mutagenesis of the co-expressed prion proteins to which conformational alterations might participate in this reveal functional determinants. By this means, neuro- function, have proven hard to come by because of difficulties in protective activity of wt PrP was shown to be nullified connecting in vitro and in vivo data. For example, in vitro by a deletion of the N-terminal charged region impli- protein binding partners have proven difficult to authenticate cated in endocytosis and retrograde axonal transport by in vivo genetic analyses, and conversely, in vivo genetic (PrP23–28), by deletion of all five octarepeats (PrP51– analyses of PrP have been limited to defining determinants 90), or by glycine replacement of four octarepeat histi- required for prion replication and binding to an as yet uncloned dine residues required for selective binding of copper partner protein designated protein X (2, 3). Other recent areas ions (Prnp“H/G”). In the case of Dpl, overlapping dele- of interest and controversy concern the basis of neurotoxicity tions defined a requirement for the gene interval encod- and the existence and function of cytoplasmic forms of PrP ing helices B and B (Dpl101–125). These data suggest contributions of copper binding and neuronal traffick- (4–9). ing to wt PrP function in vivo and place constraints Discovery of the Doppel (Dpl) protein has provided a new upon current hypotheses to explain Dpl/PrP antago- opportunity to scrutinize these issues. Dpl is a prion-like pro- nism by competitive ligand binding. Further implemen- tein encoded by Prnd gene, displaying 24% identity with the tation of this assay should provide a fuller understand- C-terminal two-thirds of PrP (10, 11). The Dpl protein resem- ing of the attributes and subcellular localizations bles an N-terminally truncated version of PrP , lacking the required for activity of these enigmatic proteins. octarepeats motifs and a conformationally plastic region essen- tial for the capacity to sustain prion replication. On the other hand, PrP and Dpl are both GPI-anchored proteins (12, 13), Prion disease pathogenesis involves the formation of abnor- bear generally similar -helical C-terminal domain structures C 1 mal forms of the cellular prion protein (PrP ) (1). In the case (14, 15), and share an ability to bind copper ions in a selective manner in vitro (16–18). Whereas PrP mRNA is expressed in the central nervous system and many peripheral tissues, the * This work was supported by the Canadian Institutes of Health most notable site of Dpl expression is the testis. Although Dpl Research Grants MOP363377 and MSC46763, Natural Sciences and Engineering Research Council of Canada Grant PGSA266137-2004, the is not thought to convert to a protease-resistant isoform anal- Sc Premier’s Research Excellence Award from the Government of Ontario, ogous to PrP or to support the process of prion replication (19, and the Alzheimer Society of Ontario. The costs of publication of this 20), expression in the central nervous system causes apoptotic article were defrayed in part by the payment of page charges. This death of both granule and Purkinje cells, determining a severe article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. To whom correspondence should be addressed: Centre for Research in Neurodegenerative Diseases, Tanz Neuroscience Bldg., 6 Queen’s mouse Doppel gene; Tg, transgenic; GFP, green fluorescent protein; Park Crescent West, Toronto, Ontario M5S 3H2, Canada. Tel.: 416-978- CGN, cerebellar granule neurons; Ac-DEVD-CHO, N-Acetyl-Asp-Glu- 1556; Fax: 416-978-1878; E-mail: [email protected]. Val-Asp-al; GPI, glycosylphosphatidylinositol; ORF, open reading 1 C The abbreviations used are: PrP , cellular prion protein; Dpl, Dop- frame; wt, wild type; ANOVA, analysis of variance; PBS, phosphate- Sc pel protein; PrP , scrapie prion protein; Prnp, mouse prion gene; Prnd, buffered saline. This paper is available on line at http://www.jbc.org 55443 This is an Open Access article under the CC BY license. 55444 Genetic Assay of PrP and Doppel nadino Ghetti. These mice on a hybrid 129/B6 background were used in ataxic phenotype in Dpl-expressing transgenic mice (10, 20– their 13th backcross to the B6 strain, with B6 mice from the same 22). Of note, the toxic effect of Dpl upon both granule and supplier (Charles River) comprising a source of Prnp cells. For some Purkinje neurons is counteracted by wt PrP , and interactions experiments Tg(SHaPrP)7 mice maintained in a B6 congenic back- between PrP and Dpl have been equated with antagonistic ground (35) (a gift from G. Carlson) or non-Tg littermates were also activities of the two mature proteins enacted at the cell surface used as a source of donor cells. Primary cultures of cerebellar granule (10, 23, 24). Furthermore, internally deleted forms of PrP re- cells were prepared from P6–7-day animals as described previously (7, 36). After 4 days in vitro, granule cells were transfected in minimum sembling Dpl are also cytotoxic (25). essential medium with 2 g of pBud-GFP vectors using Lipofectamine The many biochemical similarities between Dpl and PrP 2000 (Invitrogen) for 30 min before replacing the media with K25S. and recurring connections between PrP itself and apoptosis 24 h post-transfection, cells were fixed in 4% paraformaldehyde for 30 (9, 26–28) have suggested that analysis of Dpl-induced neuro- min. N2a neuroblastoma cells were transfected as described previously degeneration might provide insights into the biology and (10). Where described, 20 M of Ac-DEVD-CHO (Sigma) was added to pathobiology of prion proteins (23, 24, 29). To distinguish be- the cultures after transfection. Measurement of Cell Death—Cell death was quantified by staining tween theories to account for the neurotoxicity of Dpl and the C the cells with the blue fluorescent dye Hoechst 33342, which stains counteracting effect of PrP (29–31) and yet avoid the logistics chromatin. Transfected neurons (GFP-positive) were scored as healthy of assessing many alleles in transgenic mice, we have estab- or apoptotic by morphological criteria (i.e. chromatin condensation, lished a cell culture assay compatible with saturation mutagen- nuclear fragmentation, cytoplasm blebbing, and neuritic degeneration) esis. This assay reveals close concordance with analyses of (37, 38). Each graph represents at least three independent experiments Prnp alleles performed in transgenic mice and has yielded performed in triplicate in which about 150–200 neurons were individ- ually examined using a fluorescent Zeiss Axiovert inverted microscope. insights into some attributes required for bioactivity of these Immunofluorescence—Immunofluorescence experiments were per- two proteins. formed 24 h after transfection with pBud-GFP vectors. Cells were fixed in 4% paraformaldehyde and washed three times with PBS. For inter- EXPERIMENTAL PROCEDURES nal staining cells were incubated for 1 min at room temperature in PBS Plasmid Construction—Dpl point mutants and deletions were gen- containing 0.5% Triton X-100. Cells were then incubated for 30 min in erated via site-directed mutagenesis performed on the wild type Dpl blocking solution (PBS, 2% goat serum) and then overnight in primary ORF (10) (in pcDNA3.0; Invitrogen) using a Pfu DNA polymerase- antibody (-Dpl E6977, a gift from S. Prusiner) diluted 1:300 in blocking mediated mutagenesis system (Quickchange, Stratagene). Mutagenic solution. Cells were washed three times with PBS, incubated in block- PCRs were digested with restriction enzyme DpnI (target sequence, ing solution for 15 min, and then incubated with the secondary antibody m6 5-G ATC-3), specific for methylated and hemi-methylated DNA, in (Cy-3 1:300, Jackson ImmunoResearch) for1hat room temperature. order to eliminate parental DNA template. Products were then trans- Monoclonal antibody 7A12 binding between residues 90 and 145 was formed into Escherichia coli and verified by sequence analysis using used (1:300) for immunodetection of PrP (39), in conjunction with an two coding strand and two anti-coding strand sequencing primers. AlexaFluor594-conjugated anti-mouse secondary antibody (Invitrogen) Authenticated mutants were subsequently transferred into pBud.GFP and a block solution of Hanks’ buffered salt solution containing mag- (pBud.CE4 vector, Invitrogen) by standard restriction enzyme cloning nesium and calcium, 10% goat serum, 1 mM HEPES, pH 7.4, and 2% for transfection experiments. Mutagenic oligonucleotide primer used to horse serum. Cells were washed three times with PBS and viewed at generate the Dpl mutants (5 to 3, with reverse complement oligo- room temperature with a Zeiss Axiovert inverted microscope using an nucleotides omitted for the sake of brevity) were as follows: Dpl- Achrostigmat 40/0.55 LD objective. Pictures were taken with a Kodak (G155Ter), CGATTTCTGGCTGGAAAGGTGATCAGCGCTTCGGGT- Digital camera (DC290) using the Kodak Microscopy Documentation CGC; Dpl(29–49), ACGGTCAAGGCAAGGGGCGCCCGGGTAGCTG- System MDS2900 software for the image acquisition. AGAACCGC; Dpl(50–90), GCGGCGGCCAGATCACCGAATACTAC- Immunoblotting—Cells were harvested in 50 mM Tris-HCl, pH 7.5, GAAGGCTGCTCTGA; Dpl(91–149), GGCAGTTCCCTGATGGGATC- containing 0.5% SDS and assayed for total protein using the BCA assay TTCTGGCTGGAAAGGGGAGC; Dpl(91–125), GGCAGTTCCCTGAT- (Pierce). 50 g protein samples were loaded on Tris-glycine SDS-poly- GGGATCCAGGATAGCAAGCTCCACCAGCG; Dpl(126–149), GCTG- acrylamide gels and then blotted to nitrocellulose membranes. For AGTTCTCCCGGGAGAAGTTCTGGCTGGAAAGGGGAGC; Dpl- immunoblotting, membrane was incubated with the polyclonal anti- (91–100), CTATTGGCAGTTCCCTGATGGGATCACCAAGGAGATG- body E6977 at 1:4000 overnight, and antibody binding was revealed by CTGGTGACCAGC; Dpl(101–125), CGAAGGCTGCTCTGAAGCCAA- using an ECL detection system (Amersham Biosciences). A Dpl N- CGTGCAGGATAGCAAGCTCCACCAGCG; Dpl(91–125), GGCAGTT- terminal peptide antigen corresponding to residues 27–39 was synthe- CCCTGATGGGATCCAGGATAGCAAGCTCCACCAGCG-3; Dpl- sized by solid phase techniques and purified by reverse phase high (91,92TerTer), GGCAGTTCCCTGATGGGATCTAGTAGGAAGGCTGC- pressure liquid chromatography. This peptide was covalently linked to TCTGAAGCCAACG; PrP51–90, CCTGGAGGCAACCGTTACCCAG- keyhole limpet hemocyanin via a disulfide linkage made possible by the GAGGGGGTACCCATAATCAG; PrP(23–28), GACTATGTGGACTGA- addition of a cysteine residue at the peptide C terminus. A total of three TGTCGGCCTCTGC2GGAGGGTGGAACACCGGTGGAAGCCGG; PrP- rabbits were immunized with peptide-keyhole limpet hemocyanin com- (32–121), AAGCGGCCAAAGCCTGGAGGGTGGGGGGGCCTTGGT- plexes for each peptide antigen and were then subsequently given GGCTACATGC; and PrPS232ter, GACGGGAGAAGATCCAGCTAGG- booster injections at 7-day intervals. Antisera collected for each peptide ACCGTGCTTTTCTCCTCC. To mobilize the Prnp “H/G” allele from a were pooled, and IgG was precipitated with ammonium sulfate. Anti- heterologous cloning vector, we used the seamless cloning technique bodies were then affinity-purified with Sulfo-link-agarose (Pierce) cou- (Stratagene) and primers located in flanking regions of the Prnp coding pled with the appropriate peptide. This final purification is required to region (AGTTACTCTTCGGACTGATGTCGGCCTCTGC and AGTTAC- remove nonspecific interactions of other antibodies present in either in TCTTCTGCCCCAGCTGCCGCAGCCC). To create the Dpl-GPS1-1 allele, the pre- or post-immune serum. a Doppel cDNA was mutagenized with the transposon-based “GPS” RESULTS mutagenesis system (New England Biolabs), digested with Pme1 to excise the transposon, and re-ligated to create a 15-bp insert. The A Transgene-based Assay for Dpl Toxicity—Based upon sus- position of the resulting 5-amino acid insertion was established by ceptibility to toxicity engendered by Dpl and mutant PrP trans- sequencing. The wt Prnp allele used as a basis for mutagenesis was genes in vivo (as well as the results presented below), we first derived from a Prnp cDNA (32). This was modified to include a NotI investigated primary cerebellar granule cell cultures to evalu- site in the 5 leader sequence encoded by exon 2 (33) adjacent to a ate the toxic action of recombinant proteins. However, a failure naturally occurring KpnI site and a second NotI site 80 bp downstream of the termination codon. The PrpS232ter and PrP51–90 alleles were to recapitulate the protective effect of endogenous PrP , as well made using the QuikChange system. These alleles were excised with as the high (micromolar) concentrations of recombinant Dpl NotI and inserted into the NotI site of the pcDNA3.0 polylinker region. required to induce apoptotic cell death (not shown), suggested All mutant alleles were sequenced on both strands to exclude the an exploration of alternative paradigms. The availability of Dpl presence of extraneous lesions introduced during in vitro mutagenesis and PrP alleles assessed previously in Tg mice provided the procedures. impetus to develop a gene-based bioassay. Cell Culture and Transfection—Breeding pairs from a re-derived 0/0 colony of Zrch1 Prnp mice (34) were a generous gift from Dr. Ber- To obviate biohazard issues arising from the use of viral Genetic Assay of PrP and Doppel 55445 0/0 FIG.1. Doppel transgene expression in Prnp cerebellar granule cells induces neurodegeneration. A, fluorescence micrographs of 0/0 cerebellar granule cells derived from Prnp mice, transfected with pBud-GFP-empty vector (e.v.) and pBud-GFP-Dpl. GFP-positive neurons (a, c, e, and g) were identified, and nuclear morphology was analyzed for signs of neurodegeneration, after staining with Hoechst 44333 (b, d, f, and g). A higher number of GFP-positive cells showing nuclear fragmentation, neuritic degeneration, and pyknotic nuclei were found in Dpl-transfected neurons (white arrows, d and h) compared with empty vector-transfected cells (b and f). (Scale bar in this and subsequent figures  20 m.) B, neurons transfected by GFP-wtDpl show twice the rate of death compared with neurons transfected with GFP empty vector. 21 h after transfection there is a statistically significant difference in the death induced by wt Dpl versus empty vector. Data are mean  S.E. of 12 independent experiments (Student’s t test, *, p  0.0001). vectors to express mammalian prion and prion-like genes, we days after culturing in vitro (“DIV 4”). Cerebellar neuronal developed a protocol based upon delivery of naked DNA. In this cultures were fixed with 4% paraformaldehyde and stained transient transfection system, primary cultures of granule neu- with the DNA dye Hoechst 44333 to visualize nuclear morphol- rons were transfected with bigenic expression plasmids by a ogy 24 h following transfection. Transfected neurons were ob- liposome-based method. In this way it was possible to obtain tained at a frequency between 1 and 2%, as analyzed by fluo- simultaneous expression of green fluorescent protein (GFP) to rescence microscopy for GFP expression, and were scored denote the subset of cells successfully transfected (and thereby without knowledge of plasmid genotype for signs of cellular expressing the Prnd alleles under study), without recourse to death. We found that a population of granule cells transfected use the GFP-prion protein fusions of undefined biological ac- with wt Doppel showed a 2-fold elevated level of apoptotic tivity. Accordingly, pBud-CE4 bigenic vectors were used to death above empty vector controls, as indicated by nuclear clone a variety of Prnd alleles (all with identical 5- and 3- morphology visualized with Hoechst stain (Fig. 1A) (37, 38, 40). untranslated sequences) and GFP genes under the control of This 2-fold increase was similar to that observed in other two different promoters (cytomegalovirus and EF-1, respec- culture paradigms of neurodegenerative disease (37, 38) and tively). These plasmids were then used to transfect post-mitotic was observed in more than 12 independent transfection exper- primary cerebellar granule cells at postnatal day 10 or 11, 4 iments, each performed in triplicate (p  0.0001, Fig. 1B). To be 55446 Genetic Assay of PrP and Doppel FIG.2. A high percentage of GFP-positive neurons also express Doppel after transfection with bigenic vectors. A, immunofluores- cence analysis of GFP-positive neurons after transfection with both pBud-GFP vector and derivatives also harboring Dpl or PrP coding regions. Cells were fixed and stained with antibody -Doppel (E6977) followed by Cy 3-red-conjugated secondary antibody or -PrP 7A12 and Alexa- Fluor594-conjugated secondary antibody. Top row, GFP-expressing neurons; bottom row, Dpl or PrP immunostaining, as noted. B, 94% of the GFP-expressing cells in pBUD-GFP-Dpl bigenic plasmids were also positive for Doppel cell-surface immunofluorescence. certain that each neuron expressing the GFP marker gene also ing that PrP expression was capable of rescuing the toxic expressed Dpl, transfected neurons were analyzed by immuno- phenotype induced by Dpl expression. In a further experiment, 0/0 fluorescence using the polyclonal Doppel antibody E6977 (20) we tested the effect of co-transfecting Prnp granule cells with and visualized by using a secondary antibody conjugated with both a GFP/Dpl plasmid and a wt PrP transgene encoded by a Cy-3. Over 94% of the green fluorescent neurons also exhibited second expression vector. Here co-transfection of a PrP -ex- cell-surface immunofluorescence with the anti-Doppel antibody pressing plasmid with the Dpl-expressing plasmid (3:1 ratio by (Fig. 2). Taken together, these data suggest that Doppel trans- mass) completely blocked toxicity produced by the Dpl trans- gene expression in cerebellar granule cells induces cell death. gene (Fig. 3B). In other experiments we confirmed the ability of C C PrP Expression Blocks Dpl-induced Toxicity—A key crite- bigenic pBUD-GFPPrP plasmids to support PrP expression, rion to assess the accuracy of the in vitro model described above as assessed by immunostaining with the monoclonal antibody is the protective effect of PrP expression, as this has been 7A12 (Fig. 2). Further control experiments, where plasmids documented in all transgenic paradigms examined to date (20, encoding GFP or a red fluorescent protein were mixed, revealed 22, 41, 42). Because cerebellar cells overexpressing hamster a high frequency of co-transfection, with 93% of cells expressing PrP derived from Tg(SHaPrP)7 mice (35) were resistant to the GFP also expressing red fluorescent protein (Fig. 3C). In sum- toxic effect of Dpl (not shown), as in Tg mice (20, 43), we mary, these results establish a protective effect of PrP ,asis investigated whether this was also the case for PrP expressed the case in vivo in transgenic mice. at endogenous levels. For this purpose, cerebellar granule cells Doppel Induces Neurodegeneration by an Apoptotic Mecha- were cultured from C57/B6 wt PrP-expressing mice (i.e. nism—As noted above, morphological studies on Dpl-trans- Prnp cells) and transfected with both Doppel-GFP and fected cells were consistent with apoptotic cell death, in accord empty vector-GFP constructs. The percentage of cellular death with studies performed on TgDpl mice, where features of apo- (Fig. 3A) did not increase in Dpl-transfected neurons, confirm- ptosis were apparent within degenerating granule neurons Genetic Assay of PrP and Doppel 55447 FIG.3. Doppel is not toxic in wt PrP-expressing cells. A, cerebellar granule cells from Prnp mice express- ing endogenous wt PrP are resistant to the neurotoxic effect of Dpl expression. Data are from three independent experi- ments each done in triplicate. Student’s t test revealed no significant difference be- tween cells transfected with Dpl and 0/0 empty vector (e.v.; p 0.92). B, Prnp granule cells were co-transfected with pBud-GFP-e.v.  pBud-GFP-wt PrP and pBud-GFP-Dpl pBud-GFP-wtPrP (ratio 1:3). PrP expression is able to rescue the Dpl-induced toxic phenotype. ANOVA, *, p  0.007. C, Prnp granule neurons were co-transfected with pBud-GFP-e.v. and pCX-dsRed (molar ratio 1:3). Al- though most fluorescing neurons (88%) (bar 1) showed the simultaneous expres- sion of both GFP (green) and red fluores- cent proteins (red), few cells showed sin- gle color fluorescence (red, bar 2; green, bar 3), indicating a high efficiency of co- transfection of the two independent plasmids. (20). To extend these findings, immunocytochemical staining (PHGG(G/S)WGQ 3 PGGG(G/S)WGQ ). Plasmids encoding a 4 4 was performed with an antibody specific for the cleaved form of PrP allele deleted for the basically charged region (PrP23–28) caspase-3 (44). Cells with nuclear apoptotic morphology were implicated in cell-trafficking events and interactions with pro- also found to be positive for a neo-epitope generated by tein X (47, 48) or with a stop codon prior to the GPI signal caspase-3 proteolytic activation (Fig. 4A). In a further experi- peptide (PrPS232ter) were also investigated in the same man- ment, granule cells were transfected with Dpl and control con- ner (Fig. 5, A and B). None of these Prnp alleles exhibited structs in the presence or absence of 20 M of Ac-DEVD-CHO, toxicity above background levels, but with the exception of the a synthetic peptide inhibitor of caspases 3, 6, 7, 8, and 10 (44). S232ter allele, neither did they protect against the pro-apo- Survival of Dpl-transfected neurons was markedly increased ptotic action of Dpl. “Nonprotective” PrP alleles (PrP23–28 by Ac-DEVD-CHO (Fig. 4B), suggesting that caspase activity is and PrP51–90 shown, Fig. 2A) were nonetheless associated required for Doppel-induced cell death. Taken together, the with immunostaining, arguing against the trivial effects of data from Figs. 1–4 demonstrate the utility of the transgene- these internal deletions upon gene expression. based approach over delivery of recombinant proteins, and this To investigate further the accuracy of our cellular model for methodology was used for subsequent studies. Doppel neurotoxicity, we also tested the effect of pathogenic Mutational Analysis of Neuroprotective Activity of PrP — “octarepeat insertion” PrP alleles found in diseases classified Because (i) copper binding is a potential mechanism whereby as either familial Creuzfeldt-Jakob disease or Gerstmann- PrP and Dpl might compete (18), (ii) the major Cu(II) binding Stra¨ussler Scheinker disease. These alleles behave as domi- domain maps within the octarepeat region of PrP (16, 45), and nant traits and, unlike the situation for Dpl, do not behave (iii) internal N-terminal deletions of PrP are stably expressed differently when expressed in the presence or absence of en- but nontoxic (46) (whereas larger deletions such as PrP32– dogenous mouse Prnp alleles (49). The mutant PRNP allele 121 and PrP32–134 are toxic (25)), we hypothesized that one (encoding an additional eight octarepeats above the five pres- neuroprotective region within PrP might lie within the octare- ent in wt PRNP alleles) used for this experiment was derived peat sequences. Accordingly, we tested the activity of a co- from a Gerstmann-Stra¨ussler Scheinker patient (50). A result- transfected PrP51–90 allele lacking all five octarepeats, as ing “octa13” Prnp allele was cloned into the pBud bigenic vector 0/0 / well as an allele where each histidine residue within the copper and analyzed in Prnp and Prnp cerebellar granule cell 0/0 / binding octarepeats was converted to a glycine residue cultures. Both Prnp and Prnp cultures proved susceptible 55448 Genetic Assay of PrP and Doppel nal region, followed by a globular C-terminal structured do- main comprised of helices A, B/B, and C as well as two short -strands. Two disulfide bonds (between residues 93 and 148 and between residues 103 and 143) cross-link helices B/B and C (13, 15). A series of three large deletion mutant alleles (29–49, 50–90, and 91–149) were created to encompass these structural elements. In addition, smaller deletions (91– 125, 91–100, 101–125, and 126–149) were created within the boundaries of the most C-terminal large deletion (Fig. 6A). These mutant alleles were transferred to the bigenic expres- sion vector and assessed as per the previous assays. The results of these assays indicated that toxicity mapped to the central region of the protein, as the 91–149 allele reduced toxicity to base-line levels. Smaller deletions of this region were inform- ative and further mapped the toxic activity to sequences lying between codons 101 and 125. Conversely, alleles affecting helix C (a reciprocal Dpl-(126–149) sub-deletion and an allele cre- ated by linker insertion at codon 135) retained full toxic activ- ity. All other deletion alleles retained both their toxic activity and their sensitivity to the presence of PrP expression (Fig. 6B and Table II). In parallel experiments, we also assessed the expression of the corresponding mutant proteins in transient transfections of N2a neuroblastoma cells (Fig. 7). C-terminal deletion mutants were immunodetected by using an N-terminal Dpl antibody (in the case of the Dpl29–49, mutant protein expression was visualized with the E6977 antibody raised against a C-terminal epitope). Each of these deletion alleles lacking pro-apoptotic activity was nonetheless capable of encoding a stable protein, although, depending upon the particular deletion interval, ap- propriately smaller than the wt allele and/or devoid of the electrophoretic heterogeneity deriving from glycosylation of Asn-99 and Asn-111. DISCUSSION A Cellular Assay for Prnp/Prnd Interactions We have adopted a gene-based approach to dissect the an- tagonistic activities of PrP and Dpl, a methodology that is not necessarily dependent upon a priori assumptions concerning either biochemical mechanism or cellular site of action. Our assay for activities encoded by the Prnd and Prnp genes is based upon transfection of cerebellar granule cell neurons, one FIG.4. Doppel-induced neuronal death is apoptotic. A, fluores- of the target cells for Dpl toxicity observed in vivo, and also a 0/0 cence micrographs of Prnp cerebellar granule cells transfected with target population for an apparently similar syndrome produced pBud-GFP-empty vector (e.v.) and pBud-GFP-Dpl. Although neurons by expression of N-terminally truncated forms of PrP (20, 25, transfected with the empty vector appeared nonapoptotic (1st row), a higher percentage of Dpl-expressing neurons (2nd and 3rd rows) 51, 52). This assay for Dpl toxicity measures apoptosis, as showed an apoptotic phenotype characterized by nuclear condensation defined by nuclear morphology, the action of a pan-caspase and fragmentation (Hoechst staining: middle column, 2nd and 3rd C inhibitor and activation of caspase 3, and is blocked by PrP rows) and simultaneous expression of the active caspase-3 form (immu- expression from an endogenous Prnp gene or supplied from a nofluorescence with polyclonal active-caspase-3 antibody, right-hand 0/0 column, 2nd and 3rd rows). B, Prnp granule cells were transfected co-transfected transgene. It is important to stress that some with both pBud-GFP-empty-vector and pBud-GFP-Dpl constructs in Prnp alleles tested here in CGNs have close equivalents that the presence of 20 M of Ac-DEVD-CHO, an inhibitor of caspases 3, 6, have recently been assessed in Tg mice (43), and results ob- 7, 8, and 10. The inhibitor could rescue Doppel-induced neurotoxicity. tained in the two systems are remarkably similar (Table I). In ANOVA, *, p  0.0055. our assay, N-terminal PrP deletions to remove the octarepeats are nontoxic, as is the case in Tg mice (53). Furthermore, Dpl to the toxic effect (Fig. 5C), providing a close parallel to the toxicity in granule cells is not blocked by PrP alleles deleted for behavior of a pathogenic PrP transgene encoding 14 octare- all five octarepeats (PrP51–90), offering a parallel to an N- peats (49) and thus comprising a control for the fidelity of the granule cell transfection assay. Finally, the PrP32–121 allele terminally deleted Prnp allele (PrP23–88) tested in Tg mice. A second Prnp allele with a larger deletion (PrP32–121) is was sensitive to Prnp genotype, as is also the case in mice (25). Similarities in the performance of Prnp alleles in Tg mice and toxic, yet sensitive to co-expression of wt Prnp,as in vivo (25). Finally, an octarepeat expansion familial prion disease allele cultured cells are summarized in Table I. Prior analyses have indicated these Prnp mutations have little effect upon the (octa13) comprised a third internal control. This was pro-apo- ptotic to an equal or greater extent as Dpl but insensitive to the ability to produce robust levels of PrP expression, although in some instances they influence trafficking (as discussed below). presence of wt Prnp alleles, as is indeed the case for expression Pro-apoptotic Properties of Dpl Deletion Mutants—The NMR of an octa14 allele (“PG14”) assayed in Tg mice (49). A practical structure of Dpl is characterized by an unstructured N-termi- consequence of these findings is that it may be possible to Genetic Assay of PrP and Doppel 55449 FIG.5. Prnp alleles analyzed in the CGN assay. A, panel of PrP mutants that have been tested in co-transfection exper- iments to detect the protective domain of PrP in Dpl-mediated neurodegeneration. Helices A–C are represented as rectan- gles, and the two short -strands are rep- resented by rectangles with horizontal shading. Mutants represent an N-termi- nal deletion protein (PrP23–28), an octa- repeat deletion protein (PrP51–90), a molecule where each histidine residue within the copper-binding octarepeats was converted to a glycine residue (PHGG(G/S)WGQ 3 PGGG(G/S)WGQ ), 4 4 “H/G”), and a PrP molecule lacking the GPI anchor (PrPS232ter). B, co-transfec- 0/0 tion experiments in Prnp cerebellar granule cells were performed to analyze the protective domain of PrP (upper graph). pBud-GFP-wtPrP, pBud-GFP- PrP51–90, pBud-GFP-PrPS232ter, pBud-GFP-PrP23–28, and pBud-GFP- PrP-H/G constructs were transfected alone (data not shown) and in the pres- ence of pBud-GFP-empty vector (e.v.)or pBud-GFP-Dpl. None of the PrP mutants showed intrinsic toxicity when trans- fected alone (data not shown). Whereas PrP23–28, PrP51–90, and PrP-H/G are incapable of rescuing Dpl-induced neuro- toxicity, PrPS232ter is fully protective. ANOVA (#, p  0.0001 versus empty vec- tor; **, p  0.0051 versus evwtPrP; *, p  0.0004 versus evwtPrP; ***, p 0.0211 versus evwtPrP). C, as a fur- ther control for the reliability of the cel- 0/0 / lular model, both Prnp and Prnp cerebellar granule cells were transfected with pBud-GFP-PrPOcta13, an octare- peat insertion PrP mutant bearing eight additional octarepeats and with pBud- GFP-PrP32–121 (“Shmerling syndrome” allele). The PrPOcta13 allele was neuro- toxic in both PrP knock-out and PrP - expressing cells, behaving unlike Doppel and PrP32–121 as a dominant trait, and thus further confirming the accuracy of our cellular system. ANOVA (*, p 0.0001; **, p  0.0001; #, p 0.44). 55450 Genetic Assay of PrP and Doppel TABLE I Similar actions of Prnp alleles in granule cell neurons and transgenic mice Pro-apoptotic activity Pro-apoptotic activity in Offsets pro-apoptotic 0/0 / in Prnp neurons? Prnp neurons? effect of Dpl? a Prnp allele Ref. for Tg mice CGN Tg mice CGN Tg mice CGN Tg mice wt No No No No Yes Yes 20, 22, 42, 43, Deleted for all 5 octarepeats No No No No No No 53 c d Altered octarepeat histidines No No No Not done No Not done This paper Deletion of residues 32–121 Yes Yes No No NA NA 25 f g f g Octarepeat expansion Yes Yes Yes Yes NA NA 49, 85 For all data regarding apoptosis in CGNs, see this paper. Prnp allele with a 51–90 deletion was assayed in CGNs, and Prnp alleles with 23–88 or 32–93 deletions were assayed in Tg mice. Each octarepeat histidine was converted to a glycine residue; see main text. d C 0/0 No overt pathologic abnormalities in Tg mice with 1 endogenous PrP expression were assessed in a Prnp genetic background at 15 months of age (O. Windl and H. Kretzschmar, manuscript in preparation). NA indicates not applicable. This result is from an assay of Prnp alleles with a total of 13 octarepeat units. This result is from an assay of Prnp alleles with a total of 14 octarepeat units. predict neurotoxic properties of novel Prnp alleles by analyses With regard to the known properties and functions of the PrP in CGN cells prior to the creation of Tg mice. domains defined by genetic mapping, the charged region While results of our genetic assays are in close accord with in KKRPKP removed by the PrP23–28 deletion contributes to vivo paradigms, we failed to establish a parallel assay based the action of dominant negative PrP alleles that inhibit con- C Sc upon treatment of cerebellar cells with natively folded recom- version of wt PrP to PrP (48). This region is also implicated binant Dpl and PrP (prepared as described previously (13, 54)). in targeting, in the form of a weak nuclear localization signal 0/0 Although Cui et al. (55) have described toxicity for Prnp cells (perhaps only germane to the pathogenesis of PRNP alleles produced by a Dpl-(127–151) peptide at a concentration of 10 encoding truncated forms of PrP (63)), in controlling a tran- M or more, the significance of these treatments and their sition from raft-like domains to clathrin-coated pits (47), and in pharmacological sequelae is unclear, because toxicity was dynein-mediated retrograde axonal transport (64). Features of blocked by PrP-(106–126), an aggregating peptide widely used the octarepeat sequences include selective Cu(II) binding in as a model for PrP-related neurotoxicity (56). Residues 127– vitro (65, 66) and again a relationship to trafficking signals. 151 in the vicinity of helix C were excluded (by three different Thus octarepeat sequences serve to facilitate basal and/or alleles) from an obligatory role in toxicity in our genetic exper- Cu(II)-stimulated endocytosis (67–70) and kinesin-mediated iments (Table II). anterograde axonal transport (64). Although there has been recent interest in “cytoplasmic” PrP (5), such species are Activity Determinants in PrP and Dpl thought to be neurotoxic rather than neuroprotective in cere- C C bellar neurons. We are currently aware of no data from the PrP —Our data thus far reveal two determinants in PrP granule cell assay that supports action of PrP outside of the that, when deleted or otherwise mutated, result in an inability compartments of the secretory and endocytic pathways (8, 9). to protect against Dpl-mediated toxicity. The first is defined by PrP regions scrutinized to date do not lie in the globular the charged motif KKRPKP at the N terminus of mature PrP portion of the molecule, and prior studies have indicated they (PrP23–28), and the second corresponds to the octarepeat have no overt effect upon stability either in cultured cells region (PrP51–90). Of note, a similar octarepeat deletion al- and/or the central nervous system (47, 53, 71). Although the lele failed to protect against Bax-mediated cell death of human effects of these mutations upon PrP half-life in CGNs cannot neurons (26) and cell death induced by serum deprivation of a 0/0 be excluded, we suggest an influence upon trafficking and Prnp neuronal cell line (57, 58). Missense mutations substi- delivery is more plausible. In addition to the effect of N-termi- tuting octarepeat histidine residues for glycine (PHGG(G/ nal sequences described here, it is likely that yet other deter- S)WGQ 3 PGGG(G/S)WGQ ) also inactivated the protective 4 4 minants of neuroprotective activity map elsewhere within effect of PrP (Fig. 5). Not all mutant PrP alleles scrutinized PrP. here lead to loss of protective activity, however, arguing that Doppel—In contrast to Prnp, deletion analysis of a Prnd PrP is not indiscriminately sensitive to perturbation. For ex- cDNA has revealed only major determinants necessary for ample, a Prnp allele impaired in its ability to undergo GPI pro-apoptotic activity. This maps within nucleotides 303–375 of anchor addition exhibited protective activity comparable with a the ORF, corresponding to residues 101–125 encompassing wt allele, as was also the case for a similar allele tested in the helix B/B. Landmark features within this interval include context Bax-initiated apoptosis (26). Although the high fre- cysteine 109 and asparagine 111 (contributing to the N-termi- quency at which granule cells are co-transfected when exposed nal linkage of the “inner” disulfide bond and an N-linked gly- to mixtures of two plasmids indicates that transgene-encoded cosylation site, respectively), but both Cys-109 and Asn-111 Dpl and PrP proteins likely co-exist within the same cells in have close equivalents in PrP . Therefore, these particular our paradigm, it is of interest to note that effects in trans (in a determinants seem unlikely to contribute to the neurotoxic cellular sense) have been noted in other paradigms. In these activity of Dpl. More broadly, the panel of mutant Dpl alleles experiments, wt PrP expressed in cerebellar granule cells was described here, as well as data deriving from other point mu- able to abrogate death of Purkinje cells determined by a tations, suggests that complete folding and maturation of PrP32–134 transgene expressed from a Purkinje cell-specific globular -helical domain of Dpl is not required for toxic “L7” promoter (52). Whether cell-surface shed or donated PrP activity. (59–61), or other GPI anchor-less forms of PrP (which may Although antagonistic actions of Prnp and Prnd (or deleted nonetheless retain membrane association) (62) similar to the protein encoded by the S232ter and PrPGPI alleles (this pa- per and Ref. 26), contribute to neuroprotective effects discerned in Tg mice remains to be established. B. Drisaldi, manuscript in preparation. Genetic Assay of PrP and Doppel 55451 FIG.6. Neurotoxic properties of Doppel mutants. A, representation of wt Dpl and Dpl mutants representing 7 deletions along the entire coding region of the molecule (Dpl29–49, Dpl50–90, Dpl91–149, Dpl91–125, Dpl126–149, Dpl91–100, and Dpl101–125), one 5-bp insertion mutant in the middle of C helix (Dpl-GPS1-1), a stop codon mutant at GPI anchor site 155, and a double termination truncation mutant at site 92. Helices A–C are represented as rectangles, and the two short -strands are represented by rectangles with horizontal shading. B, Dpl 0/0 deletion mutants were transfected into Prnp granule neurons. Although deletions in both the N-terminal and middle regions of Dpl protein did not change Dpl neurotoxic activity, both deletion of helices B/B C and subsequently the sub-deletion of the kinked helix B/B only abolished Dpl toxicity (upper graph). ANOVA, *, p  0.0001 versus empty vector; #, p 0.36. Of note, Dpl GPI anchor is not required to induce toxicity. C, / C C all deletion mutants were transfected in Prnp granule cells in order to confirm the Dpl/PrP paradigm (bottom graph). PrP expression protected neurons from the pro-apoptotic activity associated with wt and mutant Dpl. ANOVA, p 0.22. 55452 Genetic Assay of PrP and Doppel TABLE II Pro-apoptotic properties of Prnd alleles Prnd alleles encode a 0/0 a / Prnd alleles Pro-apoptotic activity in Prnp cells Pro-apoptotic activity in Prnp cells b stable proteins Dpl wt Yes (p  0.0001) No Yes Dpl29–49 Yes (p  0.0001) No Yes Dpl50–90 Yes (p  0.0001) No Yes Dpl91–149 No No Yes Dpl91–125 No No Yes Dpl126–149 Yes (p  0.0001) No Yes Dpl91–100 Yes (p  0 .0002) No Yes Dpl101–125 No No Yes Dpl-G155ter Yes (p  0.0001) No Low expression Dpl-GPS 1–1 Yes (p  0.0001) No Yes Dpl-91,92terter No Not done Not done Pro-apoptotic effect was assessed in CGNs when expressed in the context of pBud-GFP plasmids and using empty vector transfected cells as negative controls. Data were derived from acute transfections of mouse neuroblastoma N2a cells; see Fig. 7. ptotic (Fig. 6). Thus it would appear that the pro-apoptotic activity of Dpl is dependent upon translation of ORF nucleo- tides 303–375 and hence upon a biochemical property of the central region of the Doppel molecule. Distinct from the analogous region of PrP, the NMR struc- ture of this region of Dpl reveals a kink, dividing it into B and B helices of 16 (residues 101–116) and 9 (residues 117–125) residues, respectively (14, 15, 78, 79). In our genetic analyses, the region including residues 101–125 can exert a pro-apoptotic effect in the absence of Aor C (Fig. 6), but it is unclear whether residues 101–125 in solution adopt an interrupted helical conformation in the absence of other portions of the protein; for example, in the NMR structure the kinked region involves a hydrogen bond between Asn-117 and Phe-60 in the first -strand (15), and a synthetic peptide corresponding to the helix B region assessed in phosphate buffer was characterized by a random coil signature (55). The interval defined by the 101–125-residue deletion has also attracted prior interest as overlapping a Cu(II)-binding site defined by fluorescence quenching, equilibrium dialysis binding, and mass spectromet- ric analysis of a Dpl-(101–145) peptide (18). Whether competi- tive binding of copper contributes to the antagonistic actions of these proteins is uncertain, however, because the Dpl-(101– 145) peptide used to define Cu binding also includes sequences from helix C. Further analysis of this active region by satura- tion mutagenesis would appear to be in order. FIG.7. Expression of mutant Doppel proteins in N2a cells. A, expression of Dpl alleles in N2a cells. Neuroblastoma cells were Understanding and Manipulating PrP transiently transfected with plasmids used in cerebellar granule cells in Health and Disease for toxicity assays. Samples were immunoblotted from a 10 to 20% Tris-glycine gradient gel. Lanes 1 and 8, empty vector; lanes 2 and 9, What are the implications of our findings with respect to wt Dpl; lanes 3 and 10, Dpl29–49; lane 4, Dpl50–90; lane 5, prion replication in infectious diseases such as scrapie and DplG155ter; lane 6, DplGPS1-1. Protein expression was tested using bovine spongiform encephalopathy? Dominant negative alleles Dpl antibody raised against N-terminal residues 27–39 (lanes 1–6)or E6977 against full-length Dpl- (27–154) (lanes 8–10). Mature wt Dpl of PrP comprise an important avenue with regard to targeted is highly glycosylated and visible as a heterodisperse signal centered therapy, but it is unclear whether trans-dominant Prnp muta- near an apparent molecular mass of 28 kDa (lanes 2 and 9). Dpl tions lying within a putative protein X-binding site (3, 80) G155ter (lane 5) is expressed at a low level, and the GPS1-1 insertion confer resistance equally to all prion strains. On the other allele is not associated with the heterodisperse signal typically indic- hand, prior experiments strongly suggest that wt Dpl is intrin- ative of glycosylation (lane 6). B, protein expression tested using N-terminal Dpl antibody. Lane 11, empty vector; lane 12, wt Dpl; lane sically incapable of conversion to a -sheet pathogenic confor- 13, Dpl91–149; lane 14, Dpl91–125; lane 15, Dpl126–149; lane mation in the presence of infectious prions (15, 20, 81). By 16, Dpl91–100; lane 17, Dpl101–125. defining a Prnd101–125 allele as non-neurotoxic, our studies now provide a basis for the design of hybrid Dpl-PrP molecules Sc forms of Prnp,“PrP”) have traditionally been equated with resistant to pathologic refolding initiated by PrP . Such hybrid protein activities (24, 25, 72), because unusual secondary struc- molecules might form the basis for new strategies to interfere tures have been proposed for Prnp mRNA (73–75) and conver- with prion replication in trans or to create PrP-related proteins C C sion of PrP to protease-resistant forms is facilitated by cellu- that retain important physiological properties of PrP (82–84), lar RNAs (76, 77), we also considered RNA-based mechanisms. yet are innately resistant to prion infections. To exclude biological properties of this ribonucleotide sequence With regard to discerning the active sites and physiological as a basis for pro-apoptotic activity, we created a Prnd allele attributes of cellular prion proteins, there has been much in- C Sc with tandem stop codons inserted just upstream of this position terest in the requirements of PrP for conversion to PrP in (Dpl91,92terter). Unlike wt Dpl, this allele was not pro-apo- transformed cells, but comparatively few studies focusing upon Genetic Assay of PrP and Doppel 55453 Masliah, E., Gilden, D., Oldstone, M. B., Conti, B., and Williamson, R. A. other biological readouts of activity, and few using primary (2004) Science 303, 1514–1516 cultures of adult neurons. To the best of our knowledge, the 28. Diarra-Mehrpour, M., Arrabal, S., Jalil, A., Pinson, X., Gaudin, C., Pietu, G., Pitaval, A., Ripoche, H., Eloit, M., Dormont, D., and Chouaib, S. (2004) system described is the first to be calibrated in vivo via the Cancer Res. 64, 719–727 performance of benchmark Prnp alleles tested in Tg mice, and 29. Aguzzi, A., and Polymenidou, M. (2004) Cell 116, 313–327 is also compatible with saturation mutagenesis. Our studies 30. Wong, B. S., Liu, T., Paisley, D., Li, R., Pan, T., Chen, S. G., Perry, G., Petersen, R. B., Smith, M. A., Melton, D. W., Gambetti, P., Brown, D. R., thus far have defined a contribution of N-terminal PrP se- and Sy, M. S. (2001) Mol. Cell. Neurosci. 17, 768–775 quences in neuroprotection, and it is of interest to note a close 31. Westaway, D., Hood, L. E., and Prusiner, S. B. (2004) in Prion Biology and Diseases (Prusiner, S. B., ed) 2nd Ed., pp. 283–304, Cold Spring Harbor concordance between deletion intervals and features required Laboratory Press, Cold Spring Harbor, NY for anterograde and retrograde axonal transport (64). It is 32. Locht, C., Chesebro, B., Race, R., and Keith, J. M. (1986) Proc. Natl. Acad. Sci. possible that these determinants would have been overlooked U. S. A. 83, 6372–6376 33. Westaway, D., Cooper, C., Turner, S., Da Costa, M., Carlson, G. A., and in cellular paradigms that do not use differentiated neurons, Prusiner, S. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6418–6422 and that further iterations of the granule cell transfection 34. Bu¨ eler, H., Fischer, M., Lang, Y., Bluethmann, H., Lipp, H.-P., DeArmond, assay will lead to a genetic definition of structures and subcel- S. J., Prusiner, S. B., Aguet, M., and Weissmann, C. (1992) Nature 356, 577–582 lular localizations required for the bioactivity of PrP . Whether 35. Prusiner, S., Scott, M., Foster, D., Westaway, D., and DeArmond, S. (1990) Cell these bioactive forms coincide with the abundant cell-surface 63, 673–686 36. Miller, T. M., and Johnson, E. M., Jr. (1996) J. Neurosci. 16, 7487–7495 displayed molecules detected by routine biochemical and cyto- 37. Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M. E. (1998) Cell 95, logical analysis remains to be established. 55–66 38. Sanchez, I., Xu, C. J., Juo, P., Kakizaka, A., Blenis, J., and Yuan, J. (1999) Acknowledgments—We thank Kefeng Qin for help in the early Neuron 22, 623–633 phases of this work; S. Prusiner for E6977 antibody; J.-L. Laplanche 39. Li, R., Liu, T., Wong, B. S., Pan, T., Morillas, M., Swietnicki, W., O’Rourke, K., and J.-F. Foncin for DNA from the “octa13” kindred; E. Flechsig and Gambetti, P., Surewicz, W. K., and Sy, M. S. (2000) J. Mol. Biol. 301, 0/0 567–573 Umberto DeBoni for plasmids; B. Ghetti for a stock of Prnp mice; and 40. Levkovitz, Y., and Baraban, J. M. (2001) J. Neurosci. 21, 5893–5901 George Carlson, Janice Robertson, David Williams, and Gerold 41. Nishida, N., Tremblay, P., Sugimoto, T., Shigematsu, K., Shirabe, S., Petrom- Schmitt-Ulms for discussions. illi, C., Pilkuhn, S., Nakaoke, R., Atarashi, R., Houtani, T., Torchia, M., Sakaguchi, S., DeArmond, S. J., Prusiner, S. B., and Katamine, S. (1999) REFERENCES Lab. Investig. 79, 689–697 42. Anderson, L., Rossi, D., Linehan, J., Brandner, S., and Weissmann, C. (2004) 1. Prusiner, S. B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13363–13383 Proc. Natl. Acad. Sci. U. S. A. 101, 3644–3649 2. Telling, G. C., Scott, M., Mastrianni, J., Gabizon, R., Torchia, M., Cohen, F. E., 43. Atarashi, R., Nishida, N., Shigematsu, K., Goto, S., Kondo, T., Sakaguchi, S., DeArmond, S. J., and Prusiner, S. B. (1995) Cell 83, 79–90 and Katamine, S. (2003) J. Biol. Chem. 278, 28944–28949 3. Kaneko, K., Zulianello, L., Scott, M., Cooper, C. M., Wallace, A. C., James, 44. Nicholson, D. W., Ali, A., Thornberry, N. A., Vaillancourt, J. P., Ding, C. K., T. L., Cohen, F. E., and Prusiner, S. B. (1997) Proc. Natl. Acad. Sci. U. S. A. Gallant, M., Gareau, Y., Griffin, P. R., Labelle, M., Lazebnik, Y. A., Mun- 94, 10069–10074 day, N., Sayyaparaju, M., Smulson, M. E., Yamin, T.-T., Yu, V. L., and 4. Ma, J., and Lindquist, S. (1999) Nat. Cell Biol. 1, 358–361 Miller, D. K. (1995) Nature 376, 37–43 5. Ma, J., Wollmann, R., and Lindquist, S. (2002) Science 298, 1781–1785 45. Viles, J. H., Cohen, F. E., Prusiner, S. B., Goodin, D. B., Wright, P. E., and 6. Yedidia, Y., Horonchik, L., Tzaban, S., Yanai, A., and Taraboulos, A. (2001) Dyson, H. J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2042–2047 EMBO J. 20, 5383–5391 46. Fischer, M., Rulicke, T., Raeber, A., Sailer, A., Moser, M., Oesch, B., Brandner, 7. Drisaldi, B., Stewart, R. S., Adles, C., Stewart, L. R., Quaglio, E., Biasini, E., S., Aguzzi, A., and Weissmann, C. (1996) EMBO J. 15, 1255–1264 Fioriti, L., Chiesa, R., and Harris, D. A. (2003) J. Biol. Chem. 278, 47. Sunyach, C., Jen, A., Deng, J., Fitzgerald, K. T., Frobert, Y., Grassi, J., 21732–21743 McCaffrey, M. W., and Morris, R. (2003) EMBO J. 22, 3591–3601 8. Mironov, A., Jr., Latawiec, D., Wille, H., Bouzamondo-Bernstein, E., Legname, 48. Zulianello, L., Kaneko, K., Scott, M., Erpel, S., Han, D., Cohen, F. E., and G., Williamson, R. A., Burton, D., DeArmond, S. J., Prusiner, S. B., and Prusiner, S. B. (2000) J. Virol. 74, 4351–4360 Peters, P. J. (2003) J. Neurosci. 23, 7183–7193 49. Chiesa, R., Drisaldi, B., Quaglio, E., Migheli, A., Piccardo, P., Ghetti, B., and 9. Roucou, X., Guo, Q., Zhang, Y., Goodyer, C. G., and LeBlanc, A. C. (2003) Harris, D. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5574–5579 J. Biol. Chem. 278, 40877–40881 50. Foncin, J.-F., Cardot, J.-L., Martinet, Y., and Arnott, G. (1982) Rev. Neurol. 10. Moore, R., Lee, I., Silverman, G. S., Harrison, P., Strome, R., Heinrich, C., (Paris) 138, 123–135 Karunaratne, A., Pasternak, S. H., Chishti, M. A., Liang, Y., Mastrangelo, 51. Chesebro, B. (2002) EMBO Rep. 3, 1123–1126 P., Wang, K., Smit, A. F. A., Katamine, S., Carlson, G. A., Cohen, F. E., 52. Flechsig, E., Hegyi, I., Leimeroth, R., Zuniga, A., Rossi, D., Cozzio, A., Prusiner, S. B., Melton, D. W., Tremblay, P., Hood, L. E., and Westaway, D. Schwarz, P., Rulicke, T., Gotz, J., Aguzzi, A., and Weissmann, C. (2003) (1999) J. Mol. Biol. 293, 797–817 EMBO J. 22, 3095–3101 11. Westaway, D., and Carlson, G. A. (2002) Trends Biochem. Sci. 27, 301–307 53. Flechsig, E., Shmerling, D., Hegyi, I., Raeber, A. J., Fischer, M., Cozzio, A., von 12. Stahl, N., Borchelt, D. R., Hsiao, K., and Prusiner, S. B. (1987) Cell 51, Mering, C., Aguzzi, A., and Weissmann, C. (2000) Neuron 27, 399–408 229–240 54. Qin, K., Yang, D. S., Yang, Y., Chishti, M. A., Meng, L. J., Kretzschmar, H. A., 13. Silverman, G. L., Qin, K., Moore, R. C., Yang, Y., Mastrangelo, P., Tremblay, Yip, C. M., Fraser, P. E., and Westaway, D. (2000) J. Biol. Chem. 275, P., Prusiner, S. B., Cohen, F. E., and Westaway, D. (2000) J. Biol. Chem. 19121–19131 275, 26834–26841 55. Cui, T., Holme, A., Sassoon, J., and Brown, D. R. (2003) Mol. Cell. Neurosci. 23, 14. Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R., and Wuth- 144–155 rich, K. (1996) Nature 382, 180–183 56. Forloni, G., Angeretti, N., Chiesa, R., Monzani, E., Salmona, M., Bugiani, O., 15. Mo, H., Moore, R. C., Cohen, F. E., Westaway, D., Prusiner, S. B., Wright, P. E., and Tagliavini, F. (1993) Nature 362, 543–546 and Dyson, H. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 2352–2357 57. Kuwahara, C., Takeuchi, A. M., Nishimura, T., Haraguchi, K., Kubosaki, A., 16. Hornshaw, M. P., McDermott, J. R., and Candy, J. M. (1995) Biochem. Biophys. Matsumoto, Y., Saeki, K., Yokoyama, T., Itohara, S., and Onodera, T. (1999) Res. Commun. 207, 621–629 Nature 400, 225–226 17. Sto¨ckel, J., Safar, J., Wallace, A. C., Cohen, F. E., and Prusiner, S. B. (1998) 58. Sakudo, A., Lee, D. C., Saeki, K., Nakamura, Y., Inoue, K., Matsumoto, Y., Biochemistry 37, 7185–7193 Itohara, S., and Onodera, T. (2003) Biochem. Biophys. Res. Commun. 308, 18. Qin, K., Coomaraswamy, J., Mastrangelo, P., Yang, Y., Lugowski, S., Petrom- 660–667 illi, C., Prusiner, S. B., Fraser, P. E., Goldberg, J. M., Chakrabartty, A., and 59. Stahl, N., Baldwin, M. A., Burlingame, A. L., and Prusiner, S. B. (1990) Westaway, D. (2003) J. Biol. Chem. 278, 8888–8896 Biochemistry 29, 8879–8884 19. Behrens, A., Brandner, S., Genoud, N., and Aguzzi, A. (2001) EMBO Rep. 2, 60. Borchelt, D. R., Rogers, M., Stahl, N., Telling, G., and Prusiner, S. B. (1993) 347–352 20. Moore, R., Mastrangelo, P., Bouzamondo, E., Heinrich, C., Legname, G., Glycobiology 3, 319–329 61. Liu, T., Li, R., Pan, T., Liu, D., Petersen, R. B., Wong, B. S., Gambetti, P., and Prusiner, S. B., Hood, L., Westaway, D., DeArmond, S., and Tremblay, P. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 15288–15293 Sy, M. S. (2002) J. Biol. Chem. 277, 47671–47678 62. Walmsley, A. R., Zeng, F., and Hooper, N. M. (2003) J. Biol. Chem. 278, 21. Sakaguchi, S., Katamine, S., Nishida, N., Moriuchi, R., Shigematsu, K., Sugi- moto, T., Nakatani, A., Kataoka, Y., Houtani, T., Shirabe, S., Okada, H., 37241–37248 63. Gu, Y., Hinnerwisch, J., Fredricks, R., Kalepu, S., Mishra, R. S., and Singh, N. Hasegawa, S., Miyamoto, T., and Noda, T. (1996) Nature 380, 528–531 22. Rossi, D., Cozzio, A., Flechsig, E., Klein, M. A., Rulicke, T., Aguzzi, A., and (2003) Neurobiol. Dis. 12, 133–149 64. Hachiya, N. S., Watanabe, K., Yamada, M., Sakasegawa, Y., and Kaneko, K. Weissmann, C. (2001) EMBO J. 20, 694–702 23. Mastrangelo, P., and Westaway, D. (2001) Gene (Amst.) 275, 1–18 (2004) Biochem. Biophys. Res. Commun. 315, 802–807 65. Qin, K., Yang, Y., Mastrangelo, P., and Westaway, D. (2002) J. Biol. Chem. 24. Behrens, A., and Aguzzi, A. (2002) Trends Neurosci. 25, 150–154 25. Shmerling, D., Hegyi, I., Fischer, M., Blattler, T., Brandner, S., Gotz, J., 277, 1981–1990, and references therein Rulicke, T., Flechsig, E., Cozzio, A., C., von Mering, C., Hangartner, C., 66. Lehmann, S. (2002) Curr. Opin. Chem. Biol. 6, 187–192, and references Aguzzi, A., and Weissmann, C. (1998) Cell 93, 203–214 therein 26. Bounhar, Y., Zhang, Y., Goodyer, C. G., and LeBlanc, A. (2001) J. Biol. Chem. 67. Shyng, S.-L., Moulder, K. L., Lesko, A., and Harris, D. A. (1995) J. Biol. Chem. 276, 39145–39149 270, 14793–14800 27. Solforosi, L., Criado, J. R., McGavern, D. B., Wirz, S., Sanchez-Alavez, M., 68. Pauly, P. C., and Harris, D. A. (1998) J. Biol. Chem. 273, 33107–33110 Sugama, S., DeGiorgio, L. A., Volpe, B. T., Wiseman, E., Abalos, G., 69. Sumudhu, W., Perera, W. S., and Hooper, N. M. (2001) Curr. Biol. 11, 519–523 55454 Genetic Assay of PrP and Doppel 70. Nunziante, M., Gilch, S., and Schatzl, H. M. (2003) J. Biol. Chem. 278, 79. Luhrs, T., Riek, R., Guntert, P., and Wuthrich, K. (2003) J. Mol. Biol. 326, 3726–3734 1549–1557 71. Suppattapone, S., and Rees, J. (2004) in Prions and Prion Diseases (Telling, G., 80. Perrier, V., Kaneko, K., Safar, J., Vergara, J., Tremblay, P., DeArmond, S. J., ed) pp. 83–102, Horizon Scientific Press, Wymondham, UK Cohen, F. E., Prusiner, S. B., and Wallace, A. C. (2002) Proc. Natl. Acad. 72. Legname, G., Nelken, P., Guan, Z., Kanyo, Z. F., DeArmond, S. J., and Sci. U. S. A. 97, 6073–6078 Prusiner, S. B. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 16285–16290 81. Nicholson, E. M., Mo, H., Prusiner, S. B., Cohen, F. E., and Marqusee, S. (2002) 73. Wills, P. R., and Hughes, A. J. (1990) J. Acquired Immune Defic. Syndr. 3, J. Mol. Biol. 316, 807–815 95–97 82. Collinge, J., Whittington, M. A., Sidle, K. C., Smith, C. J., Palmer, M. S., 74. Wills, P. R. (1992) J. Theor. Biol. 159, 523–527 Clarke, A. R., and Jefferys, J. G. R. (1994) Nature 370, 295–297 75. Luck, R., Steger, G., and Riesner, D. (1996) J. Mol. Biol. 258, 813–826 83. Lledo, P.-M., Tremblay, P., DeArmond, S. J., Prusiner, S. B., and Nicoll, R. A. 76. Deleault, N. R., Lucassen, R. W., and Supattapone, S. (2003) Nature 425, (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2403–2407 717–720 84. Tobler, I., Gaus, S. E., DeBoer, T., Achermann, P., Fischer, M., Rulicke, T., 77. Adler, V., Zeiler, B., Kryukov, V., Kascsak, R., Rubenstein, R., and Grossman, Moser, M., Oesch, B., McBride, P. A., and Manson, J. C. (1996) Nature 380, A. (2003) J. Mol. Biol. 332, 47–57 639–642 78. James, T. L., Liu, H., Ulyanov, N. B., Farr-Jones, S., Zhang, H., Donne, D. G., Kaneko, K., Groth, D., Mehlhorn, I., Prusiner, S. B., and Cohen, F. E. (1997) 85. Chiesa, R., Piccardo, P., Ghetti, B., and Harris, D. A. (1998) Neuron 21, Proc. Natl. Acad. Sci. U. S. A. 94, 10086–10091 1339–1351

Journal

Journal of Biological Chemistry – Unpaywall

Published: Dec 1, 2004

There are no references for this article.