Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The meiotic recombination checkpoint is regulated by checkpoint rad+ genes in fission yeast

The meiotic recombination checkpoint is regulated by checkpoint rad+ genes in fission yeast The EMBO Journal Vol. 21 No. 11 pp. 2807-2818, 2002 The meiotic recombination checkpoint is regulated by checkpoint rad genes in fission yeast as to prevent aneuploidy and cell lethality (Hartwell Midori Shimada, Kentaro Nabeshima, and Weinert, 1989). This arrest or delay in cell cycle Takahiro Tougan and Hiroshi Nojima progression occurs in eukaryotic cells when they are Department of Molecular Genetics, Research Institute for Microbial exposed to DNA-damaging agents or when DNA synthesis Diseases, Osaka University, 3-1 Yamadaoka, Suita City, is blocked. The checkpoints require the function of the Osaka 565-0871, Japan + + + + + checkpoint rad genes (rad] , radJ , rad9 , radl7, Corresponding author + + + + + + rad26 and husJ ), crb2 /rhp9 , eds] and chkJ e-mail: [email protected] (Caspari and Carr, 1999) and also inhibit Tyr15 dephos­ phorylation of Cdc2 (Rhind et al., 1997; Rhind and During the course of meiotic prophase, intrinsic Russell, 1998). It has been found that a pre-meiotic double-strand breaks (DSBs) must be repaired before replication checkpoint also operates in both budding and the cell can engage in meiotic nuclear division. Here fission yeasts (Stuart and Wittenberg, 1998; Murakami we investigate the mechanism that controls the meiotic and Nurse, 1999). progression in Schizosaccharomyces pombe that have There are several meiotic mutants such as hop2,1 accumulated excess meiotic DSBs. A meiotic recom­ (Saccharomyces cerevisiae homolog of meu13), dmclLJ. bination-defective mutant, meul3.d, shows a delay in and ziplLJ. that exhibit an arrest at the pachytene stage of meiotic progression. This delay is dependent on + meiotic prophase in S.cerevisiae (Roeder and Bailis, recJ2 , namely on DSB formation. Pulsed-field gel 2000). Mammalian germ cells exhibit meiotic arrest and electrophoresis analysis revealed that meiotic DSB apoptosis in response to the defects of recombination and/ repair in meul3LJ. was retarded. We also found that or synapsis, suggesting the conservation throughout evo­ the delay in entering nuclear division was dependent + + + lution of a checkpoint that prevents entry into meiosis I on the checkpoint rad , cdsJ and mekJ (the meiotic (Roeder and Bailis, 2000). Thus, to ensure the generation paralog of Cdsl/Chk2). This implies that these genes of viable meiotic products, the progression through are involved in a checkpoint that provides time to meiosis must be tightly regulated by mechanisms that repair DSBs. Consistently, the induction of an excess monitor the status of recombination repair, synaptonemal of extrinsic DSBs by ionizing radiation delayed complex (SC) formation and proper chromosome segre­ meiotic progression in a radJ7 -dependent manner. gation. dmclLJ. also shows meiotic delay, however, this delay is In S.cerevisiae, several proteins (Mecl, Rad24 and + + independent of recJ2 and checkpoint rad . We Radl 7) involved in the DNA damage checkpoint also propose that checkpoint monitoring of the status of participate in the pachytene checkpoint (Lydall et al., meiotic DSB repair exists in fission yeast and that 1996). In mammals, Atrn, Atr, Radl and Chkl proteins, defects other than DSB accumulation can cause delays which are involved in the damage checkpoint, also localize in meiotic progression. to the meiotic chromosomal cores and are thought to play Keywords: DNA damage checkpoint/double-strand important roles in meiotic recombination, meiotic arrest break/homologous recombination/meiosis/pachytene and apoptosis (Roeder and Bailis, 2000). In S.cerevisiae checkpoint and probably also in mammals, all mutants that arrest at the pachytene stage exhibit defects in SC formation as well as in recombination. For this reason, it is not yet clear Introduction whether the defects in recombination or synapsis are responsible for the arrest in cell cycle progression that is Meiosis is a special type of cell division that produces haploid gametes from diploid parental cells. During mediated by the pachytene checkpoint. As Schiw­ meiosis, homologous recombination occurs at a high saccharomyces pombe does not form an SC, meiotic frequency and can generate new allelic combinations in recombination in S.pombe is a good model for studying the the resulting gametes, thereby increasing the genetic meiotic checkpoint during prophase. diversity of the offspring and promoting the survival of In fission yeast, no meiotic recombination-deficient the species during critical environmental changes. mutants show meiotic arrest and the precise meiotic Homologous recombination is also essential for ensuring progression in meiotic recombination-deficient mutants that chromosome segregation occurs correctly during has not been fully investigated so far. To examine these meiosis. In the absence of recombination, homologs mis­ aspects, we previously isolated and analyzed meul J segregate and the resulting anneuploid gametes produce (Nabeshima et al., 2001), a homolog to budding yeast defective or inviable progeny. Thus, homologous recom­ HOP2, and dmcJ (Fukushima et al., 2000), a meiotic bination is vital for the generation of viable gametes RecA homolog that is conserved among a variety of (Kleckner, 1996; Roeder, 1997). organisms. Here, we report that meul 3 ,1 cells show a delay When there are defects in critical cell cycle events, in entering into meiosis I. The checkpoint Rad proteins checkpoint mechanisms delay the cell cycle progression so (Rad17, Rad3, Radl and Rad9), Cdsl and the meiotic- © European Molecular Biology Organization 2807 M.Shimada et al. specific Cds 1 paralog, Mekl, are required for this control. The delay in meiotic progression of meu13.t1 but These regulatory genes, which are found to be required for not dmcM is dependent on Rec12/Spo11 normal levels of recombination, delay the onset into The observations above suggest that the deficiency in meiosis I in meu13,1 because they recognize the presence meiotic homologous recombination in the meu13,1 and of unrepaired double-strand breaks (DSBs). Introducing dmcl ,1 mutants is responsible for the delay in meiotic excess DSBs in normal cells by y-ray irradiation similarly progression. If so, this delay should be dependent on the delayed the onset of meiosis. Furthermore, rad,1 meuJ3,1, initiation of recombination. It is known that the formation edsJ,1 meu13,1 and mekJ,1 meu13,1 double mutants of DSBs is required for the initiation of meiotic recom­ exhibited decreased recombination frequencies and redu­ bination and that reeJ2 of S.pombe, which encodes a + + + ced spore viability, indicating that rad , eds] and mekJ protein homologous to Spoll of S.eerevisiae, is essential act to delay the cell's progression into meiosis I until the for the generation of DSBs (Cervantes et al., 2000). Thus, DSBs are repaired. Thus, we propose that a meiotic we examined whether the delay in the meiotic progression recombination checkpoint exists in S.pombe to ensure the of the meul 3 ,1 and dme J ,1 mutants is dependent on reel 2 . production of viable spores and recombination at the The average percentages of cells in meiosis I at 5 and 6 h proper frequencies. are shown in Figure lC. Deletion of reeJ2 eliminated the delay that was observed in pat] meul 3,1 cells and allowed these cells to enter into meiosis I with the same kinetics as seen in patl. Thus, the delay in meiotic progression Results observed in meu13,1 is dependent on rec12 , namely on the Meiotic progression is delayed in the meu13.t1 and initiation of recombination. This suggests that recombin­ dmcM mutants ation intermediates in meu13,1 trigger a meiotic delay. In budding yeast, nematodes (Caenorhabditis elegans), Interestingly, the deletion of reeJ2 did not eliminate flies (Drosophila melanogaster) and mice, some of the the dmcl,1 delay but caused more delay than patl dmcJ,1 mutant cells that are defective in recombination and/or (Figure 1 C), suggesting that the meiotic delay in these synapsis will arrest at the pachytene stage (Roeder and cells is independent of the initiation of recombination and Bailis, 2000). In fission yeast, however, so far it has that it may be triggered by a signal other than recombin­ not been determined whether a failure to complete ation intermediates (see Discussion). meiotic recombination will affect the meiotic progression. To investigate whether meiotic recombination-deficient rad1J+, rad3'", rad1 and rad!I'" genes participate in mutants show any defect in meiotic progression, we delaying meiotic progression in meu13.t1 but checked the meiotic progression of two meiotic recombin­ not in dmcM + + + + + + ation-deficient mutants, meu13,1 and dmcJ,1. meuJJ and Checkpoint rad genes (rad] , rad3 , rad9 , rad17 , + + + + + + + dmcJ have both been identified as meiosis-specific genes rad26 and husJ ), crb2 /rhp9 , eds] and ehkJ act in (Watanabe et al., 2001). meuJ3 is a budding yeast HOP2 the DNA damage and/or DNA replication checkpoint homolog and is required for proper homologous pairing controls (Caspari and Carr, 1999). Unrepaired DNA or a and recombination (Nabeshima et al., 2001). dmcl , a block in replication are sensed by these genes, which then meiotic RecA homolog conserved among a variety of act to stop or delay the cell cycle progression by organisms, also participates in fission yeast meiotic transmitting the checkpoint signals to Cdc2 kinase, a recombination (Fukushima et al., 2000). To synchronize major regulator of the G /M transition. In S.cerevisiae, it meiosis effectively, we used the pat] -114 temperature­ has been reported that some of the homologs of fission sensitive strain, which enters meiosis in a highly syn­ yeast checkpoint genes also control meiotic progression chronous manner when it is shifted to its restrictive (Lydall et al., 1996). Thus, we investigated if these fission temperature (Iino and Yamamoto, 1985). Homozygous yeast checkpoint genes could be participating in the delay diploid patl, patl meu13,1 and pat] dmcl,1 cells were of meiotic progression observed in the meul J and dmcl + arrested at the G stage by nitrogen starvation and then mutants. As shown in Figure 1 C, the deletion of radJ7 shifted to the restrictive temperature to induce synchron­ abolished the delay observed in patl meu13,1 cells and ous meiosis (Figure lA). Meiotic recombination occurs at allowed these cells to enter meiosis I with a timing similar + + the horsetail stage (orange line in Figure lA), where the to that observed in patl. Deletion of rad] , radJ and nucleus repeatedly moves backwards and forwards several rad9 also eliminated the delay of patl meu13,1 (data not + + + + times. The time at which the horsetail stage developed was shown). Thus, rad17 , rad3 , rad] and rad9 genes similar for all three strains (~2 h after temperature shift, participate in the delay of meiotic progression in meu13L1. peaking at ~3 h).Thus, neither meu13,1 nor dmcJ,1 appear In the damage checkpoint, checkpoint rad genes are to affect the entry into meiotic prophase in pat] cells. thought to monitor DNA damage such as DSBs and However, in the patl meu13,1 and patl dmcJ,1 double respond to this damage by delaying cell cycle progression mutants, meiosis I peaked 6 h after the temperature shift, (Caspari and Carr, 1999). Thus, these data, together with 30 min later than for pat] . Cumulative curves (Hunter and the observation in the previous section that lack of the Kleckner, 2001) clearly showed that in patl meu13,1 and ability to produce DSBs normalizes meu13,1 meiosis, patl dmcl ,1 mutants, entry into the horsetail stage was suggest that meu13,1 cells may accumulate DSBs that are similar to that in pat] , but both exit from the horsetail monitored by these checkpoint genes. stage and entry into meiotic division were delayed Saeeharomyees eerevisiae dmcJ,1 cells are known to (Figure lB). This delay in meiosis I initiation was accumulate DSBs during recombination intermediate observed in more than four independent experiments stages (Bishop et al., 1992). Given that this mutant, like performed identically. the dmcl,1 mutant of S.pombe (Fukushima et al., 2000), 2808 Meiotic recombination checkpoint in S.pambe also exhibits a decreased frequency of meiotic recombina­ genomic DNA of S.pombe as a substrate (T.Tougan, tion, we expected that S.pombe dmcl ,1 cells would also M.Shimada and H.Nojima, unpublished data). We found accumulate DSBs and that these might trigger the meiotic that the Ade frequencies of edsJ,1 and mekl,1 were only delay in dmcJ,1 cells. However, the deletion of rad17 , 48 and 33% that of the wild-type strain, respectively, + + + rad] , rad3 and rad9 did not eliminate the delay in suggesting that Cdsl and the fission yeast Mekl homolog meiotic progression of the pat] dmcl ,1 mutant but caused are also required to maintain normal levels of meiotic a much greater delay than pat] dmel ,1 (Figure 1 C and data recombination in wild-type cells (Figure 2B). However, not shown). This again indicates that the regulation of the the viabilities of edsJ,1 and mekJ,1 spores were 91 and meiotic delay observed in dmcJ,1 is differen t from that in 94% that of the wild-type st rain, respectively. Thus, spore meu13,1 cells. viability was not affected by these muta tions as by the rad3.t1 and radl7.t1 muta tions (Figure 2A). Both edsJ,1 meu13,1 and mekl,1 meul3f:. double mutants, however, rad3" and rad1J+ increase the viability of the exhibited reduced levels of spore viabili ty and meiotic meiotic product and the recombination frequency recombination. Thus, when there is already a partial defect in recombination mutants + in meiotic recombina tion, the eds] and mekJ genes are Because checkpoin t rad genes participate in controlling also required to generate enough meiotic recombination to meiotic progression in meul3.t1 and dmcliJ., checkpoin t + ensure spore viability (Figure 2A and B). Furthermore, rad deletion in meu13,1 and dmcJ,1 would affect their + + deletion of eds] and mekJ genes also eliminated the production of viable meiotic products. As shown in delay of pat] meu13,1 cells, indicating that both eds] and Figure 2A, the spore viabili ty of rad3,1 and radl7,1 was mekl genes have a function in controlling meiotic similar to that of wild-type cells, whereas rad3,1 meul3.t1, progression in patl meu13,1 cells like checkpoin t rad radl7 ,1 meul3 ,1 and radl7 ,1 dmc I ,1 double mutants genes. showed a reduced spore viability when compared with their corresponding single mutant. The number of spores with more than four 4',6-diamidino-2-phenylindole Meiotic DSB repair is delayed in meu13.tJ. (DAPl)-stained masses was greater in the radl7.t1 Considering that the meiotic delay of meul 3 ,1 is dependent meu13,1 and rad17,1 dmcJ,1 double mutants than in the + + on reeJ2 as well as on checkpoin t rad genes, which single mutants (Figure 2C), suggesting more frequent monitor such damage, we surmised that the meiotic delay fragmen tation in double mutants. Thus, spore viabilities is triggered by the accumulation of recombination + + were reduced by the disruption of rad3 and rad] 7 in intermediates such as DSBs. To test this possibility meiotic recombination mutants, al though the mechanism directly, we examined the formation of DSBs during operating in meul3.t1 is different from that in dmcliJ.. + meiosis in the meul3.t1 st rain by pulsed-field gel electro­ Next we examined whether the disruption of rad3 and + phoresis (PFGE). In fission yeas t, meiotic DSBs can be rad] 7 decreases the frequency of recombination in the detected as smeared bands by PFGE because they produce meul3,1 and dmel,1 mutants by measuring the frequency broken chromosomes with variable length (Cervantes of allelic gene conversion between two differen t mutant et al., 2000). In the pat] meu13,1 and pat] dmcl ,1 double alleles of ade6, namely ade6-M26 and ade6-469, in these mutants, as well as in the pat] single mutant st rain, double mutants (Figure 2B). We found that the rad3.t1 and smeared bands appeared 3 h after the temperature shift radJ7,1 single mutants already had a reduced recombin­ (Figure 3). This resul t is consis tent with that shown in at ion frequency, as shown by a decrease in the percentage + Figure lA, which suggests that the double mutant cells of Ade recombinant spores relative to the wild-type + + enter the meiotic prophase at approximately the same time st rain. Thus, the rad3 and rad] 7 genes are required to after shifting the temperature as pat] cells. Smeared bands maintain a normal level of meiotic recombination even in were no longer observed in pat] cells 4.5 h after the normal cells. The double mutants also exhibited a decrease temperature shift but they continued to be observed in in recombination. For example, recombination in rad3,1 pat] meuJ3,1 cells. Thus, meiotic DSB repair is delayed in meu13,1 and rad17,1 meu13,1 was decreased to 44 and patl meul3.t1. 34% of that of meul3.t1. The radl7,1 dmcJ,1 mutant also Unexpectedly, the smeared bands in pat] dmcl,1 cells showed a reduced recombination frequency as compared were diminished 4.5 h after the temperature shift, as in the with the single mutants. Thus, Rad3 and Radl 7 are needed patl st rain (Figure 3). This suggests that defects other than in the meul3.t1 and dmcJ,1 mutants to allow sufficien t a delay in DSB repair may be triggering the delay in levels of recombination to occur so that viable spores can meiosis in dmcl iJ., which is consis tent with the fact that the be produced. checkpoin t rad genes also do not appear to be involved. pat] rad17,1 meu13,1 cells had smeared bands at the + + cds1 and mek1 participate in maintaining time point when they would be entering meiosis I spore viability and recombination frequency (Figures 3 and 1), suggesting that patl radl7.t1 meu13,1 and delaying meiotic progression in the cells probably enter meiosis I without completing DSB meu13.tJ. mutant repair, which would cause chromosome fragmentation. In The MEKJ gene of S.eerevisiae encodes a meiosis-specific line with this is that this st rain produced abnormal spores protein kinase that participates in the pachytene check­ with an irregular number of DAPI-stained bodies, as poin t (Rockmill and Roeder, 1991). We isolated a fission shown in Figure 2C. To assess whether the smeared bands yeast homolog (mekJ ) of MEKJ by computer-assisted observed here are specific to meiotic recombination, we + + homologous searching in GenBank. The mekJ gene was examined the effect of disrupting reeJ2 on the presence then isolated by PCR using appropriate primers and the of smeared bands, as reeJ2 is responsible for in troducing 2809 M.Shimada et al. DSBs during meiosis. The rec12LJ. meu13LJ. double mutant 'J"'ray irradiation of wild-type cells during the horsetail period delays their entry into never shows smeared bands at any time (Figure 3). These meiosis I in a rad17 -dependent manner results st rongly support the idea that the broken chromo­ If the delay in entering meiosis I in meul 3,:1 cells is caused somes, which were observed in radl 7 LJ. meu13LJ. meiosis I, by the persis tent presence of DSBs, one would expect that were caused by meiotic DSBs, and that radl 7 acts to delay meul 3LJ. from entering meiosis I to allow the DSBs an increased number of DSBs formed during the meiotic prophase would cause even wild-type cells to experience a to be repaired. --- I nud e1.a bcJnoolall l n111!lci _,._ l nudci patl dmcl6. pat! paO meu13A 1 00 100 15 75 ;; � di 50 50 u u 25 25 0 2 3 -l 5 7 ii hot 1 11, •fl •rs hi ft 1KM111, •flcr •hi fl hQurs nftcr ahi r, patl paLl meu]3 B plltl dmcl/J. JOO JOO -; .; � ( 25 25 6 !.I I 2 j 4 5 6 7 8 0 l l 3 4 5 7 -1 6 0 2 3 5 7 8 b oun, d ter slti.fl boors after shifl hom , J1er s hi r, horstail -- 2n uclei life span (h r) e)(it lime (Ju) I i fc span (hr) e ntry lime (hr) cnu-lime (hr) ei-it lime (hr) pail 1.56 8 4.9 2.29 3. 5 0.76 5.66 pa.11 meul31!i. 2.13 2.42 4.55 1.15 5.48 6.63 parl dmcll!. 2.23 4. 1 5 0.76 5.39 6.15 1.92 Fig. 1. Meiotic recombination-deficient mutants, meul JLI and dmcl LI, are delayed in entering meiosis I. (A) Homozygous diploid pat] cells were ° ° cultured to mid log phase, transferred to EMM-N medium for 16 h at 25 C and then shifted to 34 C to inactivate Patl and synchronize meiosis. Progression of meiosis was monitored by DAPI staining of samples that were collected every 30 min or 1 h after temperature shift. At least 150 cells were scored by fluorescence microscopy for each time point. (B) Cumulative curves and the time indicating the life span, entry into and ex.it from each DNA stage of patl, patl meul JLI and patl dmcl LI. Cumulative curves are expressed as a percentage of maximum values against time after tem­ perature shift (Hunter and Kleckner, 2001). (C) Meiotic delay of meul3LI is dependent on the recJZ gene and checkpoint rad• genes but this is not the case for dmcJLI. Cells were induced to enter meiosis and the progression of meiosis was monitored by DAPI staining. Shown are the average ratios of cells in meiosis I at 5 and 6 h in three or four independent experiments. (D) y-ray-irradiated cells are delayed in entering meiosis I and this delay is also dependent on radJ7 . Cells were induced to enter meiosis and irradiated with y-rays 3 h after temperature shift, when the cells were in the horse­ tail period. Shown are the average ratios of cells in meiosis I at 5.5 h in three independent experiments. Strains: patl (JZ670), patl meul3LI (KN8), patl dmclLI (MS276-l), patl recl2LI (MS123-5), patl recl2LI meu13LI (MSll0-2), patl recl2LI dmclLI (MS189-1), patl rad17LI (MSlOl-4), patl rad17 LI meul JLI (MS107-1), patl rad17 LI dmcl LI (MS190-7), patl cdsl LI meul3LI (MS231-1) and patl mekl LI meul3LI (MS217-l). 2810 Meiotic recombination checkpoint in S.pombe delay in en tering meiosis I. To examine this possibili ty, we the onset of meiosis I was delayed in irradiated patl cells irradiated meiotic patl cells during the horsetail period relative to non-irradiated cells. However, when radJ7 with y-rays (3 h after temperature shift) and de termined was deleted from patl cells, y-ray irradiation no longer when these cells entered meiosis I. As shown in Figure 1D, affected the timing with which meiosis I was initiated. pall meuJJA pat.I dmc/ 5hr 5hr 6hr 5hr 6hr 6hr pat/ rec12A pal recl1A. nU!ul3A go 80 so U 40 tit 20 20 5hr 6hr 5hr 5hr 6hr pall radl7t:,. dmclt:. pat/ radl7t11tie1t/JA pall radl7t:,. <,O <,O u 40 u •10 � # 20 20 6hr 6hr Shi- 5hr 6hr pat/ cdsJt:,. meu/3 patJ mek.JA. /tU!ltfJt:,. .; u 40 U 40 tl! '20 2.0 5hr 5hr 6br 6hr D pall pall radl7A u 40 'i:i t§1 gamma-ray gamma-ray 2811 M.Shi mada et al. 89.5 81.. !IJ.S J /10 tie Ml !'""1 �= .,: "° ·;;: JI> WT ... 71,i 7 Q 'TOCMf �- ;,., "' 51AI O ;., :I 400U O" Q,j JOOO <: 11•10 wr H f 4 � 'iiitlth dli'tlfltl t.N tlliil!l -lbod iai □ 4bedia.w •h liitnll..,. (7"] daDl'ltfll!lt .._• l� ■ 111 VA.PI sl.u■ lq !N11r 11111 UAl' I ;st■kilnfi: [..{) In DArl � ;; r,(l tf. • M l , :ro WI' .,,. /J/J. md/ 7A roill7A d""'lf " md/ 70 m-eul JA dmc:I It. Fig. 2. Spore viability and gene conversion frequencies of meiosis-defective mutants. The spore viabilities (A) and allelic gene conversion frequencies (B) between ade6-469 and ade6-M26 of double mutants (rad3/J. meu13/J., radl7/J. meu13/J., cdsl/J. meu13/J., mekl!J. meu13/J. and rad1 7/J. dmcl/J.) and single mutants were measured. The various strains were generated by crossing wild-type (MSll I- WI X MS105- IB ), rad3/J. (MS126-4 X MS162-1), rad17/J. (MS! 11-1 X MS105-22D), cdsl/J. (MS233-4 X MS245-3), mekl/J. (MS203-2 X MS202-11), meul3/J. (MSll l-ml3 X MS105-22C), dmcl/J. (MS133-l X MS114-3), rad3/J. meu13/J. (MS128-15 X MS163-10), radl 7/J. meu13/J. (MS! 11-6 X MS105-25C), cdsl/J. meul3/J. (MS233-3 X MS245-7), mekl/J. meul3/J. (MS203-2 X MS202-10) and rad17/J. dmcl/J. (MS133-1 X MS! 14-3). All data presented above are the average of three independent experiments with standard errors. (C) The phenotype of wild-type, meu13/J., radl 7/J., radl7/J. meu13/J., dmcl/J. and radl7/J. dmcl/J. cells. Typical microscopic images of the asci stained by DAPI are shown in the right panels. The scale bar represents 5 µm. Thus, DSBs appear to be monitored by a checkpoin t and Russell, 1998). To investigate whether this phos­ pathway involving radl7, and their presence delays the phorylation participates in delaying meiosis in meul3L1 cell' s entry into meiosis I. cells, we monitored Cdc2 Tyr15 phosphorylation in patl and patl meul3L1 cells during meiosis and sporulation (Figure 4). The level of the phosphorylated form of Cdc2 Phosphory/ation of Tyr15 in Cdc2 is maintained for increased du ring the pre-meiotic S phase and decreased a longer period in pat1 meu13L1 than in pat1 during meiotic division in pat] cells. In pat] meul 311 cells, Phosphorylation of Tyr15 in Cdc2 plays a key role in blocking the onset of mitosis when DNA replication is however, Cdc2 was phosphorylated for 1 h longer than in inhibited or DNA is damaged (Rhind et al., 199 7; Rhind patl cells, cons istent with the length of the delay in 2812 Meiotic recombi nation checkpoint in S.pombe Chr l + CbrD + Chr m + DSB [ hours after shift 0 2 33 .544.5 5 0 2 33.5 44 .5 S 6 02 33.54 4. 5 s, paJl patl meu13A. pa Jl dmclA Chr l � CbrD � Cbr ffl + DSB [ hours aftu shift O 2 3 3.5 4 4.5 5 0 2 33 .S 44 .S 5 0 2 33 . .S 44.5 5 6 patl rec12A. me ul3A patl recl 2A. dmclA pall rad17A meu13A Chr l � Cbr ll � Chr m + �B [ bolll5 afler shifl O 2 3 3.S 4 4.5 5 patl rad1 7A Fig. 3. DSB repair is retarded in meul3L1. Cells were induced to enter meiosis as shown in Figure 2. Samples were taken after the temperature shift at the indicated time points, analyzed by PFGE and stained with ethidium bromide to detect DNA. Chr I, Chr II and Chr ill indicate the position of chromosomes 1, 2 and 3, respectively. The smear bands represent the DSBs that appear during meiosis. meiosis I onset in patl meu13,1 cells. Furthermore, we Three protein kinases , Cds1, Chk1 and Mek1, are found that this extended period of phosphorylation was not expressed and phosphorylated during meiosis Cdsl and Chkl play impor tant roles in checkpoint controls presen t in pat] rad] 7 ,1 meul 3,1 and pat] reel 2,1 meul 3,1 and are phosphorylated when the checkpoints are activ­ cells, which do not experience a delay in meiosis, as shown ated. Thus, we examined the expression of Cdsl, Chkl and in Figure lC. Thus, the regulatory pathway delaying the onset of meiosis I in meul 3,1 employs the phosphorylation Mekl (the meiotic paralog of Cdsl) during meiosis and of Tyr15 in Cdc2. sporulation in patl and patl meu13L1 cells (F igure 5). In 2813 4567 M.Shimada et al. patl meul3d pall hon"' allu sbill O 2 3 45 67 8 0 2 34 56 7 8 Cdcl TyrlSP Cdc2 pall radl7 A meu lJA patl recl2'1. meul3A bournflcnbin 0 23 0 23 45 8 6 78 Cdc2 TyrlSP Cdcl pall radl 7'1. patl rec12.d 0 23 4 56 78 0 2 34 5 67 8 Cdc2 Tyr15P Cdcl Fig. 4. Phosphorylation of the Tyrl5 in Cdc2 is extended in patl meul3A. patl (JZ670), patl meul3A (KN8), patl recl2A meul3A (MSll0-2), patl rad17A meul3A (MS107-1), pat] recl2A (MS123-5) and patl rad17A (MSI Ol-4) cells were induced to enter meiosis as shown in Figure I. Samples were taken after the temperature shift at the indicated time points and western blot analysis was performed to detect the amount of Cdc2 and phos­ phorylated Cdc2. both patl and patl meul3A cells, Cdsl was phosphoryl­before their entry into meiosis I. Consis tent with this ated from 2 h after the temperature shift, which continued hypothesis, deletion of radJ7 allowed meul3A cells to to the end of sporula tion . In both cell types, Chkl was not progress into meiosis I without completing DSB repair. phosphorylated during early meiosis but was phosphoryl­Th ese results st rongly suggest that, when meiotic DSB ated slightly in the later stage. However, Mekl was repair is delayed in S.pombe, DSBs are detected by DNA expressed only during pre-meiotic replication and meiotic damage and replication checkpoin t genes, which retards recombination and showed a mobility shift during these meiotic progression. To test this hypothesis directly, we periods, suggesting that phosphorylation occurred. artificially in troduced an unusually large amount of DSBs Furthermore, the extent of Mekl mobility shif t in patl into meiotic cells. Th is triggered a delay in meiotic meul3A is greater than that in patl, whereas the expres­ progression, which was dependen t on radJ7 (Figure lD). sion pat terns of Cdsl and Chkl are similar in these cells at Ta ken together, we propose that a meiotic recombination the time point just before the onset of meiosis I (Figure 5; checkpoin t exists in S.pombe to monitor meiotic DSB 4 h). Th ese results suggest that Cdsl, Chkl and Mekl have repair and regulate entry into meiosis I (Figure 6). Th is differen t functions during meiosis. regulation seems to be responsible for the maintenance of the optimal level of spore viability and meiotic recombin­ ation frequency in cells that experience a delay in DSB Discussion repair (Figure 2). The meiotic recombination checkpoint exists in In budding yeas t, S.eerevisiae, it has been reported that fission yeast the pachytene checkpoin t operates to arrest cells at the In this st udy, we found that meul3A cells harboring a pachytene st age in response to a defect in recombination defec t in meiotic recombination had a delay in the entry and /o r synapsis. It has not been shown clearly, however, into meiosis I. Th e delay was dependen t on reeJ2 /SPOl l, whether meiotic delay is triggered by a defect in DSB which is required for initia tion of meiotic recombination, repair or synaptonemal complex formation, or by defects + + + + rad] 7, rad] , rad] and rad9 , which are required for in both of them together (Roeder and Bailis, 2000). Of note damage and replication checkpoints in mitosis, eds] , and is that in st riking contrast to S.eerevisiae, S. pombe does + + mekl , a meiosis-specific eds] paralog. Furthermore, we not form any SC (Bahler et al., 1993). Considering that found that there is a delay in meiotic DSB repair in many genes required for the meiotic recombination meul3A. From these resul ts, we surmised that a delay, checkpoin t in S.pombe have homologs that are required elicited by DNA damage and replication checkpoin t genes, for the pachytene checkpoin t in S.eerevisiae, and the was required in meul3A cells to repair meiotic DSBs st rong analogy between the observations in these two 28 14 45 6 Meiotic recombination checkpoint in S.pombe a- T u b a- HA houn aller shiJI 0 23 4 56 78 0 23 pall Cds lHA meul3A a -Tub a-HA 0 2 3 4 5 6 7 8 boor,; rs bilt 0 23 4567 8 ChklHA meu 13L1 �--------------..._ _____________ ___.J pat1 I a-HA a-Tub 0 2 3 4 5 6 7 8 0 2345 678 pat] MeklHA pat] ,ne u13Li Fig. 5. Three protein kinases, Cds l, Chkl and Me kl, are expressed and phosphorylated during meiosis and sporulation in fission yeast. pat] Cds lH A (MS19 7-6), patl meul3L1 Cds lH A (MS198-l), patl ChklHA (MS108- l), patl meul3L1 ChklHA (MS1 96-2), patl MeklHA (MS1 99-4) and patl meul 311 MeklHA (MS200-5) cells were induced to enter meiosis as shown in Figure l. Samples were taken after the temperature shift at the indicated time points and proteins were prepared and detected with anti-HA and anti a-tubulin anti bodies. yeasts, our results strongly suggest that the checkpoint actually monitors defects in meiotic recombination. The role of the checkpoint rad" genes, cds1 and mek1 in meiotic recombination Delay of meiotic DSB repair + + + We report here that S. pombe rad17, rad3 , eds] and mekl + genes are required for maintaining a normal level of meiotic recombination, although they are not required for the maintenance of viable spores (Figure 2 and Murakami and Nurse, 1999). This is consistent with the notion that many DNA damage checkpoint genes may play a direct role in meiotic recombination in other species. In S. cerevisiae, genes homologous to S.pombe radl7, + + rad3 and mekJ are required for meiotic recombination (Kato and Ogawa, 1994; Lydall et al. , 1996; Xu et al. , 1997). Mammalian Radl, ATR, ATM and Chkl (S.pombe + + + + radl , rad3 , telJ and chkJ homologs, respectively) have been found to localize to synapsed and/or unsynapsed meiotic chromosomes (Roeder and Bailis, 2000) and are Yl5 suggested to play a direct role in meiotic recombination. ( ) cdc2 Schiwsaccharomyces pombe Mekl, which is expressed only during meiosis, is required for efficient meiotic recombination. Mekl is also required for the meiotic Prophase I � Meiosi s I recombination checkpoint (Figure IC). In S. cerevisiae, Mekl is considered to be the meiotic counterpart of Rad53 Fig. 6. A model of the meiotic recombination checkpoint in fission (S.pombe Cdsl homolog). However, the meiotic function + + yeast. When repair of meiotic DSBs is retarded, checkpoint rad, eds] of Rad53 is not fully understood. Schiwsaccharomyces and mekJ genes delay cells to enter into meiosis I through phosphoryl­ pombe Cdsl is required for a normal level of meiotic ation of Cdc2 Tyr 15 to provide enough time to repair DSBs. pail I· afl<! M.Shimada et al. recombina tion. Cdsl is also required for maintaining spore the duration of pre-meiotic replication (Cha et al., 2000), viability and recombination effi ciency in meul 3LI dmcJ could have a function in unexpected cell cycle (Figure 2). Therefore, we conclude that both Mekl and progression which is unr elated to recombina tion. Cdsl are required for the meiotic recombination check­ The meiotic delay observed in dmcl LI cells is not + + + poin t in S.pombe . dependent on checkpoin t rad genes (rad17, radJ , rad] + + Phosphorylation of Cdsl is observed from the initia tion and rad9 ); however, radJ7 is required for maintenance of pre-meiotic replication (2 h after temperature shift) of viable spores and meiotic recombination frequency in through to the end of sporula tion. Chkl expression dmclLI cells (Figure 2). On e possible explanation of this + + strongly increases aft er the first meiotic division, but phenotype is that dmcJ and radJ7 might have a function Chkl only becomes phosphorylated at the sporulation in recombination between homologous chromosomes in st age (Figure 5). Mekl expression begins at the start of an independen t way. Thus, when both genes are defective, pre-meiotic replication and continues until about the time meiotic recombination between homologous chromo­ of meiosis I. Mekl displays a mobility shif t during these somes would st rongly decrease, resulting in reduced periods, which is probably due to its phosphoryla tion, as spore viabili ty. Further examination of Dmcl function was shown previously in S.cerevisiae (Rockmill and should provide new insights into the regulatory mechan­ Roeder, 1991). Thus, the meiotic regulation of each of ism of meiotic progression. these three protein kinases, Cdsl, Chkl and Mekl, is possibly differen t in terms of expression and phosphoryl­ ation, suggesting that each has a distinct role to play in Materials and methods meiosis. From these results, we speculate that Rad1 7, Rad3, Cdsl and Mekl may be involved in some part of the Yeast strains, media and genetic methods DNA recombination process as well as in the meiotic The S.pombe strains used in this study are listed in Table I. Standard S.pombe genetic procedures were followed (Moreno et al., 1991). recombination monitoring system. Complete media YPD or YE containing adenine sulfate (75 µg/ml), In addition to the homology to the above-mentioned synthetic minimal medium EMM2, sporulation medium ME or EMM2-N genes, the targets of these checkpoints seem to be the and germination media YEAde or EMMG were used. The homozygous same. In S.cerevisiae, entry into meiosis I is inhibited by diploid strains were constructed by cell fusion. maintaining the Tyr19-phosphoryla ted state of Cdc28 (S .pombe Cdc2 homolog) in response to activation of the Spore viability and recombination assays Haploid parental strains were grown on YPD plates at 33 C, cultured in pachytene checkpoin t because the Tyr19-non-phosphoryl­ YE-Ade and harvested at the stationary phase. Cells were mated and ated form mutants cannot arrest properly in such a sporulated on ME plates at 28 C (zygotic meiosis). After 3-4 days of situa tion (L eu and Roeder, 1999; Tung et al., 2000). We incubation, spores were treated with 0.5% glusulase (NEN Life Science confirmed that similar regulation of Cdc2 operates in Products, Inc.) for 16 h at 36C and checked microscopically for the complete digestion of contaminating vegetative cells. The glusulase­ S.pombe; the timing of Tyr15 phosphoryla tion of Cdc2 is treated spores were washed with water and then used for the spore retarded when entry into meiosis I is delayed in the viability assay and the intragenic recombination assay. meu13LI mutant (Figure 4). Sp ore viability assays. A total of 160 spores were spotted with a micro­ manipulator (MS series 200; Singer Instrument, UK) on EMMG What is the defect that triggers a meiotic delay in containing supplements and germinated at 30 C for 4 days. Colonies dmc M cells? were counted and the spore viability was expressed as a percentage We showed here that S.pombe dmclLI cells display the relative to the 160 spores. We repeated this assay three times for each following unexpected phenotypes as compared with those strain. of S.cerevisiae . Firs t, dmclLI cells show a delay in meiotic Intr agenic recombination assays. We determined recombination fre­ progression but do not arrest at prophase as seen in quencies as described previously (Nabeshima et al., 2001). To examine S. cerevisiae (Figure 1). Second, they do not exhibit the frequency of intragenic recombination, we used two ade6 alleles (ade6-M26 and ade6-469) as the intragenic recombination between these accumulation of DSBs (Figure 3). Third, the level of alleles produces the ade6 allele. reduction in recombination or spore viability is much less than those of the dmcl mutant of S.cerevisiae (Figure 2). Synchronous meiosis Meiotic delay in dmcl LI cells is not alleviated by Fresh homozygous pat l-114 diploid strains were grown in EMM with elimination either of DSBs by deletion of recJ2 or of the supplements at 25 C for >24 h. Cells at the mid-log phase were collected, washed and then transferred at a density of 3-4 X 10 cells/ml to EMM2 checkp oin t genes involved in the delay in meu13LI cells containing supplements Leu (60 µg/ml) and Ura (40 µg/ml) but lacking (Figure lC). These results imply that Dmcl plays a role in NJLiCI. After 16 h of incubation at 25 C, NJLiCl (5 mg/ml) and S. pombe meiosis that is independent of DSB formation. supplements Leu (250 µg/ml) and Ura (75 µg/ml) were added to the They also mean that the absence of this DSB-independen t culture medium and then the temperature was raised to 34 C to induce role triggers a delay in meiotic progression which is meiosis. The progression of meiosis was monitored by staining the methanol-fixed cells with DAPI (Wako). Fory-ray analysis, horsetail cells distinc t from that mediated by the functions of the DNA (3 h after temperature shift) were irradiated from a oCo source at a dose damage checkpoin t. rate of 468 Gy/h for ~20 min (170 Gy). We surmise the following possibilities to explain why dmcJLI shows meiotic delay. Firs t, S. pombe dmcJ may Meiotic DSB assays play a role in recombination independen t of DSB form­ The procedures for PFGE have been described previously (Cervantes et al., 2000). Meiosis was induced in pat] diploid cells by shifting the ation, which might be single-strand break-induced recom­ temperature, and 14 ml of cultured cells were collected at the indicated bination. Second, the defec t of dmcl + function may alter times. PFGE was conducted in a 0.8% chromosomal grade agarose gel chromatin structure to inhibi t proper division of the (Bio-Rad) in a Bio-Rad CHEF-Mapper system at 14 C for 48 h with nucleus, which requires time to be repaired. Third, like 2 V/cm, 100 C-induced angle in lX TAE buffer (40 mM Tris-acetate S. cerevisiae SPOJ J and RECB, muta tions of which affect pH 8.0, 1 mM EDTA), with a switch time of 30 min. 2816 Meiotic recombi nation checkpoint in S.pombe Table I. Strains used in this study Strain Genotype MS lll wl h ura4-D18 leul-32 ade6-469 his2 MS 10 5- 1B h- ura4-D18 ade6-M26 + + MS 12 6-4 h ura4-D18 leul-32 ade6-469 his2 rad3 :: ura4 MS 16 2- 1 h- ura4-D18 ade6-M26 rad 3::ur a4 + + MS lll -1 h ura4-D18 leul-32 ade6-469 his2 rad1 7::ura4 MS lO S-220 h- ura4-D18 ade6-M26 rad1 7: :ur a4 + + MS203-2 h ura4-D18 leul-32 ade6-469 his2 mekl ::u ra4 MS202- 11 h-ura4-D18 ade6-M26 mekl :: ura4 + + MS233-4 h ura4-D18 leul-32 ade6-469 his2 cd sl::ur a4 MS245 -3 h- ura4-D18 ade6-M26 cdsl:: ura4 + + MS 11 1m13 h ura4-D18 leul-32 ade6-469 his2 meu1 3:: ura4 MS 10 5-22C h- ura4-D18 ade6-M26 meu1 3:: ura4 + + MS 133-1 h ura4-D18 leul-32 ade6-469 his2 dmcl ::ur a4 MS 1 14-3 h- ura4-D18 ade6-M26 dmcl :: ura4 + + + MS 128- 15 h ura4-D18 leul-32 ade6-469 his2 rad3 :: ura4 me u13:: ura4 + + MS 16 3-10 h- ura4-D18 ade6-M26 rad 3::ur a4 meu1 3::ura4 + + + MS ll l-6 h ura4-D18 leul-32 ade6-469 his2 rad1 7::ura4 meu1 3:: ura4 + + MS 10 5-25C h-ura4-D18 ade6-M26 rad1 7: :ur a4 me u13:: ura4 + + + MS203-2 h ura4-D18 leul-32 ade6-469 his2 mekl ::u ra4 meu1 3:: ura4 + + MS202- 10 h- ura4-D18 ade6-M26 mekl ::ur a4 meu1 3::ura4 + + + MS23 3-3 h ura4-D18 leul-32 ade6-469 his2 cd sl:: ura4 meu1 3:: ura4 + + MS245-7 h- ura4-D18 ade6-M26 cd sl:: ura4 meu1 3:: ura4 + + + MS 133-1 h ura4-D18 leul-32 ade6-469 his2 radl 7::ura4 dmcl :: ura4 + + MS 1 14-3 h- ura4-D18 ade6-M26 rad1 7: :ur a4 dmcl::ur a4 JZ670" h-llr patl -114/patl -114 leul -32/ leul-32 ade6-M21 0/ ade6-M2 16 KN8 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 meu1 3::ura4+J me u13:: ura4 + + MS276- 1 h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 dmcl :: ura4 /d mcl :: ura4 MS 12 3-5 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/ re c12::LEU 2 MS ll 0-2 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/re c12: :LEU2 + + me u13:: ura4 /meu13:: ura4 MS 18 9-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/re c12: :LEU2 + + dmcl::ur a4 /dmc l:: ura4 MS lOl- 4 h--/Jr patl -114/patl -114 ura4-D18/ ura4-D18 leul -32/ leul-32 ade6-M21 0/ ade6-M2 16 rad1 7: :ur a4+Jrad1 7::ura4 + + MS 10 7-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 rad1 7::ura4 /radl 7::ura4 + + meul 3: : ura4 /meul 3: : ura4 + + h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 rad1 7::ura4 MS 19 0-7 /rad1 7::ura4 + + dmcl::ur a4 /dmc l:: ura4 + + MS23 1-1 h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 cdsl ::ur a4 fcdsl::ur a4 + + meul 3: : ura4 /meul 3: : ura4 + + MS217-1 h-llr patl -114/patl -114 ura4-Dl 8/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 mekl: :ur a4 /mekl :: ura4 + + me u13:: ura4 /meu13:: ura4 MS 19 7-6 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M21 0/ ade6-M2 16 Cd sl:2 HA: ura4 ,Cds l MS 198-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 meu1 3::ura4+J me u13:: ura4 Cd sl:2 HA: ura4 /Cds l MS 108- 1 h-!h-patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 Ch kl:3 HA/Chkl + + MS 19 6-2 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M21 0/ ade6-M2 16 meu1 3::ura4 /meu13:: ura4 Chkl :3HA/Chkl MS 19 9-4 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 Me kl: 3HA:L EU2/Mekl + + MS200-5 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M21 0/ ade6-M2 16 meu 13:: ura4 /me u1 3:: ura4 Me kl: 3HA:L EU2/Mek l TP4- 1D h ura4-D18 leul-32 ade6-M 216 his2 TP4-5A h-ura4-D18 leul-32 ade6-M 210 •Provided by M.Ya mamoto. Protein extra ction and western blotting upstream region and 3' downstream region of the mekJ gene. For this Protein extracts were prepared as described previously (Caspari et al., purpose, we synthesized the following four oligonucleotides and used 2000) and western blots were performed as published (Shimada et al., them as primers: me kl -SF, 5'-C GGGGTACCTGCAGAATTGAAAA­ 19 99). For the detection of Cds lH A, ChklHA and MeklHA, the blots TACGTCAAACCGAAC -3; mek l- SR, 5'-C CGCTCGAGCACTTTG­ were probed with mouse monoclonal antibodies 12CA5 (Boehringer CAAAACGGTGATGCGCGTAA GC- 3'; me kl -3F, 5'-AAAACTG­ Mannheim for ChklHA and MeklHA) and 16 B 12 (COY ANCE Inc. for CAGCTCGAGCCAC GTAAGAAAATATTCCGATAAA CTTG- 3'; and Cds lH A), then stripped and reprobed with anti-tubulin antibody (Sigma me kl -3R, 5'-CCC GAGCTCTAATTTAATATATCTTTGCTTGAAT­ T5 16 8) as a loading control. For the detection of Cdc2 Tyr 15 TATCG- 3'. The underlined sequences denote the artificially introduced phosphorylation, the blots were probed with an anti-phospho-Cdc2 restriction enzyme sites for Kp nl, Xhol, PstI-XhoI and Sad, respectively. (Ty rl5) rabbit polyclonal antibody (NEB 911 1), then stripped and + These PCR products and the 1.8 kb HindIII fragment containing the ura4 reprobed with the anti-Cdc2 antibody (S anta Cruz Biotechnology, Santa gene (Grimm et al. , 1988 ) were inserted into the pBluesc riptII KS(+) Cruz, CA) . vector via the Kp nI-X hoI, PstI-SacI and HindIII sites, respectively. This plasmid construct was digested with Kp nl and Sad and the resulting construct was introduced into the diploid strain TP4-5A/TP 4-1D. The Mek1 disruption + + + The mekJ gene was disrupted by replacing it with the ura4 gene. To do Ura transformants were then screened by Southern blot analysis to this, we performed PCR and obtained a DNA fragment carrying the 5' identify the disrupted strain. 2817 M.Shi mada et al. Construction of Mek1-3HA strain Leu,J.Y. and Roeder,G.S. (1999) The pachytene checkpoint in To prepare the Mekl-3HA construct, we performed PCR and obtained a S. cer evisiae depends on Swel-mediated phosphorylation of the DNA fragment carrying the open reading frame (ORF) region and the 3' cyclin-dependent kinase Cdc28. Mol. Cell, 4, 805-814. downstream region of the mekJ gene. For this purpose, we synthe­ Lydall,D., Nikolsky,Y., Bishop,D.K. and Weinert,T. (1996) A meiotic sized the following four oligonucleotides and used them as primers: recombination checkpoint controlled by mitotic checkpoint genes. mekl-ORF-F, 5'-ATAGG CGCGCCGTCGACTATGGACTTTTTATCAC­ Nature, 383, 840-843. ATGCCATGC-3'; and mekl-ORF-R, 5'-TATTCTTAGCGGCCGCCG­ Moreno,S., Klar,A. and Nurse,P. (1991) Molecular genetic analysis of TAGCCGGGAATGTTTAAGAGG-3'. The underlined sequences denote fission yeast Schizosaccharomyces pombe. Methods Enzymol. , 194, the artificially introduced restriction enzyme sites for Asel-Sall and Notl, 795-823. respectively. To obtain the 3' downstream region, we used the same Murakami,H. and Nurse,P. (1999) Meiotic DNA replication checkpoint primers as described above. These PCR products were inserted into the control in fission yeast. Genes Dev. , 13, 2581-2593. pIL(m vector (T.Nakamura, unpublished), which is designed to allow Nabeshima,K., Kakihara,Y., Hiraoka,Y. and Nojima,H. (2001) A novel one-step integration via Sall-Not! and Xhol-Sacl sites, respectively. This meiosis-specific protein of fission yeast, Meu13p, promotes plasmid construct was digested with Mlul. The resulting construct was homologous pairing independently of homologous recombination. introduced into the haploid strains TP4-5A and TP4-1D. We then screened EMB O J. , 20, 3871-3881. the Leu transformants by Southern blot analysis to identify the Mekl- Rhind,N. and Russell,P. (1998) Tyrosine phosphorylation of cdc2 is 3HA tagged strain. required for the replication checkpoint in Schizosaccharomyces pombe. Mol. Cell. Biol. , 18, 3782-3787. Rhind,N., Fumari,B. and Russell,P. (1997) Cdc2 tyrosine phosphoryl­ ation is required for the DNA damage checkpoint in fission yeast. Acknowledgements Genes Dev. , 11, 504-511. We are grateful to Dr Tony Carr for strains and critical discussions, and Rockmill,B. and Roeder,G.S. (1991) A meiosis-specific protein kinase Dr Gerry Smith for strains and technical suggestions. We also thank Dr homolog required for chromosome synapsis and recombination. Genes T.J.Kim for general support and encouragement, Drs T.Nakamura, Dev. , 5, 2392-2404. Y.Watanabe and E.Hartsuiker for critical discussions, Drs P.Russell, Roeder,G.S. (1997) Meiotic chromosomes: it takes two to tango. Genes F.lshikawa, M.Yamamoto and C.Shimoda for strains, Dr P.Nurse for the Dev. , 11, 2600-2621. Cdc2 antibody, Dr V.Wood for cosmid clones of the S.pombe genome, Roeder,G.S. and Bailis,J.M. (2000) The pachytene checkpoint. Trends and Dr P.Hughes for critically reading the manuscript. This work was Genet. , 16, 395-403. supported by a Grant-in-aid for Scientific Research on Priority Areas Shimada,M., Okuzaki,D., Tanaka,S., Tougan,T., Tamai,K.K., from the Ministry of Education, Science, Sports and Culture of Japan and Shimoda,C. and Nojima,H. (1999) Replication factor C3 of grants from The Uehara Memorial Foundation to H.N. M.S. is a Research Schizosaccharomyces pombe, a small subunit of replication factor C Fellow of the Japan Society for the Promotion of Science. complex, plays a role in both replication and damage checkpoints. Mol. Biol. Cell, 10, 3991-4003. Stuart,D. and Wittenberg,C. (1998) CLB5 and CLB6 are required for References premeiotic DNA replication and activation of the meiotic SIM checkpoint. Genes Dev. , 12, 2698-2710. Bahler,J., Wyler,T., Loidl,J. and Kohli,J. (1993) Unusual nuclear Tung,K.S., Hong,E.J. and Roeder,G.S. (2000) The pachytene checkpoint structures in meiotic prophase of fission yeast: a cytological prevents accumulation and phosphorylation of the meiosis-specific analysis. J. Cell Biol. , 121, 241-256. transcription factor Ndt80. Proc. Natl Acad. Sci. USA , 97, Bishop,D.K., Park,D., Xu,L. and Kleckner,N. (1992) DMCl: a meiosis­ 12187-12192. specific yeast homolog of recA required for recombination, Watanabe,T., Miyashita,K., Saito,T.T., Yoneki,T., Kakihara,Y., synaptonemal complex formation and cell cycle progression. Cell, Nabeshima,K., Kishi,Y.A., Shimoda,C. and Nojima,H. (2001) 69, 439-456. Comprehensive isolation of meiosis-specific genes identifies novel Caspari,T. and Carr,A.M. (1999) DNA structure checkpoint pathways in proteins and unusual non-coding transcripts in Schizosaccharomyces Schizosaccharomyces pombe. Biochimie, 81, 173-181. pombe. Nucleic Acids Res. , 29, 2327-2337. Caspari,T., Dahlen,M., Kanter,S.G., Lindsay, HD., Hofmann,K., Xu,L., Weiner,B.M. and Kleckner,N. (1997) Meiotic cells monitor the Papadimitriou,K., Sunnerhagen,P. and Carr,A.M. (2000) Characteriz­ status of the interhomolog recombination complex. Genes Dev. , 11, ation of Schizosaccharomyces pombe Husl; a PCNA-related protein 106-118. that associates with Rad ! and Rad9. Mol. Cell. Biol. , 20, 1254-1262. Cervantes,M.D., Farah,J.A. and Smith,G.R. (2000) Meiotic DNA breaks Received January 22, 2002; revised April 8, 2002; associated with recombination in S.pombe. Mol. Cell, 5, 883-888. accepted April 11, 2002 Cha,R.S., Weiner,B.M., Keeney,S., Dekker,J. and Kleckner,N. (2000) Progression of meiotic DNA replication is modulated by interchromosomal interaction proteins, negatively by SPOllp and positively by Rec8p. Genes Dev. , 14, 493-503. Fukushima,K., Tanaka,Y., Nabeshima,K., Yoneki,T., Tougan,T., Tanaka,S. and Nojima,H. (2000) Dmcl of Schizosaccharomyces pombe plays a role in meiotic recombination. Nucleic Acids Res. , 28, 2709-2716. Grimm,C., Kohli,J., Murray,J. and Maundrell,K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet. , 215, 81-86. Hartwell,L.H. and Weinert,T.A. (1989) Checkpoints: controls that ensure the order of cell cycle events. Science, 246, 629---634. Hunter,N. and Kleckner,N. (2001) The single-end invasion: an asymmetric intermediate at the double-strand break to double­ Holliday junction transition of meiotic recombination. Cell, 106, 59-70. Iino,Y. and Yamamoto,M. (1985) Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. , 198, 416-421. Kato,R. and Ogawa,H. (1994) An essential gene, ES RJ, is required for mitotic cell growth, DNA repair and meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res. , 22, 3104-3112. Kleckner,N. (1996) Meiosis: how could it work? Proc. Natl Acad. Sci. USA , 93, 8167-8174. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

The meiotic recombination checkpoint is regulated by checkpoint rad+ genes in fission yeast

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/the-meiotic-recombination-checkpoint-is-regulated-by-checkpoint-rad-GKA0z0n7Dp

References (30)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 2002
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1093/emboj/21.11.2807
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal Vol. 21 No. 11 pp. 2807-2818, 2002 The meiotic recombination checkpoint is regulated by checkpoint rad genes in fission yeast as to prevent aneuploidy and cell lethality (Hartwell Midori Shimada, Kentaro Nabeshima, and Weinert, 1989). This arrest or delay in cell cycle Takahiro Tougan and Hiroshi Nojima progression occurs in eukaryotic cells when they are Department of Molecular Genetics, Research Institute for Microbial exposed to DNA-damaging agents or when DNA synthesis Diseases, Osaka University, 3-1 Yamadaoka, Suita City, is blocked. The checkpoints require the function of the Osaka 565-0871, Japan + + + + + checkpoint rad genes (rad] , radJ , rad9 , radl7, Corresponding author + + + + + + rad26 and husJ ), crb2 /rhp9 , eds] and chkJ e-mail: [email protected] (Caspari and Carr, 1999) and also inhibit Tyr15 dephos­ phorylation of Cdc2 (Rhind et al., 1997; Rhind and During the course of meiotic prophase, intrinsic Russell, 1998). It has been found that a pre-meiotic double-strand breaks (DSBs) must be repaired before replication checkpoint also operates in both budding and the cell can engage in meiotic nuclear division. Here fission yeasts (Stuart and Wittenberg, 1998; Murakami we investigate the mechanism that controls the meiotic and Nurse, 1999). progression in Schizosaccharomyces pombe that have There are several meiotic mutants such as hop2,1 accumulated excess meiotic DSBs. A meiotic recom­ (Saccharomyces cerevisiae homolog of meu13), dmclLJ. bination-defective mutant, meul3.d, shows a delay in and ziplLJ. that exhibit an arrest at the pachytene stage of meiotic progression. This delay is dependent on + meiotic prophase in S.cerevisiae (Roeder and Bailis, recJ2 , namely on DSB formation. Pulsed-field gel 2000). Mammalian germ cells exhibit meiotic arrest and electrophoresis analysis revealed that meiotic DSB apoptosis in response to the defects of recombination and/ repair in meul3LJ. was retarded. We also found that or synapsis, suggesting the conservation throughout evo­ the delay in entering nuclear division was dependent + + + lution of a checkpoint that prevents entry into meiosis I on the checkpoint rad , cdsJ and mekJ (the meiotic (Roeder and Bailis, 2000). Thus, to ensure the generation paralog of Cdsl/Chk2). This implies that these genes of viable meiotic products, the progression through are involved in a checkpoint that provides time to meiosis must be tightly regulated by mechanisms that repair DSBs. Consistently, the induction of an excess monitor the status of recombination repair, synaptonemal of extrinsic DSBs by ionizing radiation delayed complex (SC) formation and proper chromosome segre­ meiotic progression in a radJ7 -dependent manner. gation. dmclLJ. also shows meiotic delay, however, this delay is In S.cerevisiae, several proteins (Mecl, Rad24 and + + independent of recJ2 and checkpoint rad . We Radl 7) involved in the DNA damage checkpoint also propose that checkpoint monitoring of the status of participate in the pachytene checkpoint (Lydall et al., meiotic DSB repair exists in fission yeast and that 1996). In mammals, Atrn, Atr, Radl and Chkl proteins, defects other than DSB accumulation can cause delays which are involved in the damage checkpoint, also localize in meiotic progression. to the meiotic chromosomal cores and are thought to play Keywords: DNA damage checkpoint/double-strand important roles in meiotic recombination, meiotic arrest break/homologous recombination/meiosis/pachytene and apoptosis (Roeder and Bailis, 2000). In S.cerevisiae checkpoint and probably also in mammals, all mutants that arrest at the pachytene stage exhibit defects in SC formation as well as in recombination. For this reason, it is not yet clear Introduction whether the defects in recombination or synapsis are responsible for the arrest in cell cycle progression that is Meiosis is a special type of cell division that produces haploid gametes from diploid parental cells. During mediated by the pachytene checkpoint. As Schiw­ meiosis, homologous recombination occurs at a high saccharomyces pombe does not form an SC, meiotic frequency and can generate new allelic combinations in recombination in S.pombe is a good model for studying the the resulting gametes, thereby increasing the genetic meiotic checkpoint during prophase. diversity of the offspring and promoting the survival of In fission yeast, no meiotic recombination-deficient the species during critical environmental changes. mutants show meiotic arrest and the precise meiotic Homologous recombination is also essential for ensuring progression in meiotic recombination-deficient mutants that chromosome segregation occurs correctly during has not been fully investigated so far. To examine these meiosis. In the absence of recombination, homologs mis­ aspects, we previously isolated and analyzed meul J segregate and the resulting anneuploid gametes produce (Nabeshima et al., 2001), a homolog to budding yeast defective or inviable progeny. Thus, homologous recom­ HOP2, and dmcJ (Fukushima et al., 2000), a meiotic bination is vital for the generation of viable gametes RecA homolog that is conserved among a variety of (Kleckner, 1996; Roeder, 1997). organisms. Here, we report that meul 3 ,1 cells show a delay When there are defects in critical cell cycle events, in entering into meiosis I. The checkpoint Rad proteins checkpoint mechanisms delay the cell cycle progression so (Rad17, Rad3, Radl and Rad9), Cdsl and the meiotic- © European Molecular Biology Organization 2807 M.Shimada et al. specific Cds 1 paralog, Mekl, are required for this control. The delay in meiotic progression of meu13.t1 but These regulatory genes, which are found to be required for not dmcM is dependent on Rec12/Spo11 normal levels of recombination, delay the onset into The observations above suggest that the deficiency in meiosis I in meu13,1 because they recognize the presence meiotic homologous recombination in the meu13,1 and of unrepaired double-strand breaks (DSBs). Introducing dmcl ,1 mutants is responsible for the delay in meiotic excess DSBs in normal cells by y-ray irradiation similarly progression. If so, this delay should be dependent on the delayed the onset of meiosis. Furthermore, rad,1 meuJ3,1, initiation of recombination. It is known that the formation edsJ,1 meu13,1 and mekJ,1 meu13,1 double mutants of DSBs is required for the initiation of meiotic recom­ exhibited decreased recombination frequencies and redu­ bination and that reeJ2 of S.pombe, which encodes a + + + ced spore viability, indicating that rad , eds] and mekJ protein homologous to Spoll of S.eerevisiae, is essential act to delay the cell's progression into meiosis I until the for the generation of DSBs (Cervantes et al., 2000). Thus, DSBs are repaired. Thus, we propose that a meiotic we examined whether the delay in the meiotic progression recombination checkpoint exists in S.pombe to ensure the of the meul 3 ,1 and dme J ,1 mutants is dependent on reel 2 . production of viable spores and recombination at the The average percentages of cells in meiosis I at 5 and 6 h proper frequencies. are shown in Figure lC. Deletion of reeJ2 eliminated the delay that was observed in pat] meul 3,1 cells and allowed these cells to enter into meiosis I with the same kinetics as seen in patl. Thus, the delay in meiotic progression Results observed in meu13,1 is dependent on rec12 , namely on the Meiotic progression is delayed in the meu13.t1 and initiation of recombination. This suggests that recombin­ dmcM mutants ation intermediates in meu13,1 trigger a meiotic delay. In budding yeast, nematodes (Caenorhabditis elegans), Interestingly, the deletion of reeJ2 did not eliminate flies (Drosophila melanogaster) and mice, some of the the dmcl,1 delay but caused more delay than patl dmcJ,1 mutant cells that are defective in recombination and/or (Figure 1 C), suggesting that the meiotic delay in these synapsis will arrest at the pachytene stage (Roeder and cells is independent of the initiation of recombination and Bailis, 2000). In fission yeast, however, so far it has that it may be triggered by a signal other than recombin­ not been determined whether a failure to complete ation intermediates (see Discussion). meiotic recombination will affect the meiotic progression. To investigate whether meiotic recombination-deficient rad1J+, rad3'", rad1 and rad!I'" genes participate in mutants show any defect in meiotic progression, we delaying meiotic progression in meu13.t1 but checked the meiotic progression of two meiotic recombin­ not in dmcM + + + + + + ation-deficient mutants, meu13,1 and dmcJ,1. meuJJ and Checkpoint rad genes (rad] , rad3 , rad9 , rad17 , + + + + + + + dmcJ have both been identified as meiosis-specific genes rad26 and husJ ), crb2 /rhp9 , eds] and ehkJ act in (Watanabe et al., 2001). meuJ3 is a budding yeast HOP2 the DNA damage and/or DNA replication checkpoint homolog and is required for proper homologous pairing controls (Caspari and Carr, 1999). Unrepaired DNA or a and recombination (Nabeshima et al., 2001). dmcl , a block in replication are sensed by these genes, which then meiotic RecA homolog conserved among a variety of act to stop or delay the cell cycle progression by organisms, also participates in fission yeast meiotic transmitting the checkpoint signals to Cdc2 kinase, a recombination (Fukushima et al., 2000). To synchronize major regulator of the G /M transition. In S.cerevisiae, it meiosis effectively, we used the pat] -114 temperature­ has been reported that some of the homologs of fission sensitive strain, which enters meiosis in a highly syn­ yeast checkpoint genes also control meiotic progression chronous manner when it is shifted to its restrictive (Lydall et al., 1996). Thus, we investigated if these fission temperature (Iino and Yamamoto, 1985). Homozygous yeast checkpoint genes could be participating in the delay diploid patl, patl meu13,1 and pat] dmcl,1 cells were of meiotic progression observed in the meul J and dmcl + arrested at the G stage by nitrogen starvation and then mutants. As shown in Figure 1 C, the deletion of radJ7 shifted to the restrictive temperature to induce synchron­ abolished the delay observed in patl meu13,1 cells and ous meiosis (Figure lA). Meiotic recombination occurs at allowed these cells to enter meiosis I with a timing similar + + the horsetail stage (orange line in Figure lA), where the to that observed in patl. Deletion of rad] , radJ and nucleus repeatedly moves backwards and forwards several rad9 also eliminated the delay of patl meu13,1 (data not + + + + times. The time at which the horsetail stage developed was shown). Thus, rad17 , rad3 , rad] and rad9 genes similar for all three strains (~2 h after temperature shift, participate in the delay of meiotic progression in meu13L1. peaking at ~3 h).Thus, neither meu13,1 nor dmcJ,1 appear In the damage checkpoint, checkpoint rad genes are to affect the entry into meiotic prophase in pat] cells. thought to monitor DNA damage such as DSBs and However, in the patl meu13,1 and patl dmcJ,1 double respond to this damage by delaying cell cycle progression mutants, meiosis I peaked 6 h after the temperature shift, (Caspari and Carr, 1999). Thus, these data, together with 30 min later than for pat] . Cumulative curves (Hunter and the observation in the previous section that lack of the Kleckner, 2001) clearly showed that in patl meu13,1 and ability to produce DSBs normalizes meu13,1 meiosis, patl dmcl ,1 mutants, entry into the horsetail stage was suggest that meu13,1 cells may accumulate DSBs that are similar to that in pat] , but both exit from the horsetail monitored by these checkpoint genes. stage and entry into meiotic division were delayed Saeeharomyees eerevisiae dmcJ,1 cells are known to (Figure lB). This delay in meiosis I initiation was accumulate DSBs during recombination intermediate observed in more than four independent experiments stages (Bishop et al., 1992). Given that this mutant, like performed identically. the dmcl,1 mutant of S.pombe (Fukushima et al., 2000), 2808 Meiotic recombination checkpoint in S.pambe also exhibits a decreased frequency of meiotic recombina­ genomic DNA of S.pombe as a substrate (T.Tougan, tion, we expected that S.pombe dmcl ,1 cells would also M.Shimada and H.Nojima, unpublished data). We found accumulate DSBs and that these might trigger the meiotic that the Ade frequencies of edsJ,1 and mekl,1 were only delay in dmcJ,1 cells. However, the deletion of rad17 , 48 and 33% that of the wild-type strain, respectively, + + + rad] , rad3 and rad9 did not eliminate the delay in suggesting that Cdsl and the fission yeast Mekl homolog meiotic progression of the pat] dmcl ,1 mutant but caused are also required to maintain normal levels of meiotic a much greater delay than pat] dmel ,1 (Figure 1 C and data recombination in wild-type cells (Figure 2B). However, not shown). This again indicates that the regulation of the the viabilities of edsJ,1 and mekJ,1 spores were 91 and meiotic delay observed in dmcJ,1 is differen t from that in 94% that of the wild-type st rain, respectively. Thus, spore meu13,1 cells. viability was not affected by these muta tions as by the rad3.t1 and radl7.t1 muta tions (Figure 2A). Both edsJ,1 meu13,1 and mekl,1 meul3f:. double mutants, however, rad3" and rad1J+ increase the viability of the exhibited reduced levels of spore viabili ty and meiotic meiotic product and the recombination frequency recombination. Thus, when there is already a partial defect in recombination mutants + in meiotic recombina tion, the eds] and mekJ genes are Because checkpoin t rad genes participate in controlling also required to generate enough meiotic recombination to meiotic progression in meul3.t1 and dmcliJ., checkpoin t + ensure spore viability (Figure 2A and B). Furthermore, rad deletion in meu13,1 and dmcJ,1 would affect their + + deletion of eds] and mekJ genes also eliminated the production of viable meiotic products. As shown in delay of pat] meu13,1 cells, indicating that both eds] and Figure 2A, the spore viabili ty of rad3,1 and radl7,1 was mekl genes have a function in controlling meiotic similar to that of wild-type cells, whereas rad3,1 meul3.t1, progression in patl meu13,1 cells like checkpoin t rad radl7 ,1 meul3 ,1 and radl7 ,1 dmc I ,1 double mutants genes. showed a reduced spore viability when compared with their corresponding single mutant. The number of spores with more than four 4',6-diamidino-2-phenylindole Meiotic DSB repair is delayed in meu13.tJ. (DAPl)-stained masses was greater in the radl7.t1 Considering that the meiotic delay of meul 3 ,1 is dependent meu13,1 and rad17,1 dmcJ,1 double mutants than in the + + on reeJ2 as well as on checkpoin t rad genes, which single mutants (Figure 2C), suggesting more frequent monitor such damage, we surmised that the meiotic delay fragmen tation in double mutants. Thus, spore viabilities is triggered by the accumulation of recombination + + were reduced by the disruption of rad3 and rad] 7 in intermediates such as DSBs. To test this possibility meiotic recombination mutants, al though the mechanism directly, we examined the formation of DSBs during operating in meul3.t1 is different from that in dmcliJ.. + meiosis in the meul3.t1 st rain by pulsed-field gel electro­ Next we examined whether the disruption of rad3 and + phoresis (PFGE). In fission yeas t, meiotic DSBs can be rad] 7 decreases the frequency of recombination in the detected as smeared bands by PFGE because they produce meul3,1 and dmel,1 mutants by measuring the frequency broken chromosomes with variable length (Cervantes of allelic gene conversion between two differen t mutant et al., 2000). In the pat] meu13,1 and pat] dmcl ,1 double alleles of ade6, namely ade6-M26 and ade6-469, in these mutants, as well as in the pat] single mutant st rain, double mutants (Figure 2B). We found that the rad3.t1 and smeared bands appeared 3 h after the temperature shift radJ7,1 single mutants already had a reduced recombin­ (Figure 3). This resul t is consis tent with that shown in at ion frequency, as shown by a decrease in the percentage + Figure lA, which suggests that the double mutant cells of Ade recombinant spores relative to the wild-type + + enter the meiotic prophase at approximately the same time st rain. Thus, the rad3 and rad] 7 genes are required to after shifting the temperature as pat] cells. Smeared bands maintain a normal level of meiotic recombination even in were no longer observed in pat] cells 4.5 h after the normal cells. The double mutants also exhibited a decrease temperature shift but they continued to be observed in in recombination. For example, recombination in rad3,1 pat] meuJ3,1 cells. Thus, meiotic DSB repair is delayed in meu13,1 and rad17,1 meu13,1 was decreased to 44 and patl meul3.t1. 34% of that of meul3.t1. The radl7,1 dmcJ,1 mutant also Unexpectedly, the smeared bands in pat] dmcl,1 cells showed a reduced recombination frequency as compared were diminished 4.5 h after the temperature shift, as in the with the single mutants. Thus, Rad3 and Radl 7 are needed patl st rain (Figure 3). This suggests that defects other than in the meul3.t1 and dmcJ,1 mutants to allow sufficien t a delay in DSB repair may be triggering the delay in levels of recombination to occur so that viable spores can meiosis in dmcl iJ., which is consis tent with the fact that the be produced. checkpoin t rad genes also do not appear to be involved. pat] rad17,1 meu13,1 cells had smeared bands at the + + cds1 and mek1 participate in maintaining time point when they would be entering meiosis I spore viability and recombination frequency (Figures 3 and 1), suggesting that patl radl7.t1 meu13,1 and delaying meiotic progression in the cells probably enter meiosis I without completing DSB meu13.tJ. mutant repair, which would cause chromosome fragmentation. In The MEKJ gene of S.eerevisiae encodes a meiosis-specific line with this is that this st rain produced abnormal spores protein kinase that participates in the pachytene check­ with an irregular number of DAPI-stained bodies, as poin t (Rockmill and Roeder, 1991). We isolated a fission shown in Figure 2C. To assess whether the smeared bands yeast homolog (mekJ ) of MEKJ by computer-assisted observed here are specific to meiotic recombination, we + + homologous searching in GenBank. The mekJ gene was examined the effect of disrupting reeJ2 on the presence then isolated by PCR using appropriate primers and the of smeared bands, as reeJ2 is responsible for in troducing 2809 M.Shimada et al. DSBs during meiosis. The rec12LJ. meu13LJ. double mutant 'J"'ray irradiation of wild-type cells during the horsetail period delays their entry into never shows smeared bands at any time (Figure 3). These meiosis I in a rad17 -dependent manner results st rongly support the idea that the broken chromo­ If the delay in entering meiosis I in meul 3,:1 cells is caused somes, which were observed in radl 7 LJ. meu13LJ. meiosis I, by the persis tent presence of DSBs, one would expect that were caused by meiotic DSBs, and that radl 7 acts to delay meul 3LJ. from entering meiosis I to allow the DSBs an increased number of DSBs formed during the meiotic prophase would cause even wild-type cells to experience a to be repaired. --- I nud e1.a bcJnoolall l n111!lci _,._ l nudci patl dmcl6. pat! paO meu13A 1 00 100 15 75 ;; � di 50 50 u u 25 25 0 2 3 -l 5 7 ii hot 1 11, •fl •rs hi ft 1KM111, •flcr •hi fl hQurs nftcr ahi r, patl paLl meu]3 B plltl dmcl/J. JOO JOO -; .; � ( 25 25 6 !.I I 2 j 4 5 6 7 8 0 l l 3 4 5 7 -1 6 0 2 3 5 7 8 b oun, d ter slti.fl boors after shifl hom , J1er s hi r, horstail -- 2n uclei life span (h r) e)(it lime (Ju) I i fc span (hr) e ntry lime (hr) cnu-lime (hr) ei-it lime (hr) pail 1.56 8 4.9 2.29 3. 5 0.76 5.66 pa.11 meul31!i. 2.13 2.42 4.55 1.15 5.48 6.63 parl dmcll!. 2.23 4. 1 5 0.76 5.39 6.15 1.92 Fig. 1. Meiotic recombination-deficient mutants, meul JLI and dmcl LI, are delayed in entering meiosis I. (A) Homozygous diploid pat] cells were ° ° cultured to mid log phase, transferred to EMM-N medium for 16 h at 25 C and then shifted to 34 C to inactivate Patl and synchronize meiosis. Progression of meiosis was monitored by DAPI staining of samples that were collected every 30 min or 1 h after temperature shift. At least 150 cells were scored by fluorescence microscopy for each time point. (B) Cumulative curves and the time indicating the life span, entry into and ex.it from each DNA stage of patl, patl meul JLI and patl dmcl LI. Cumulative curves are expressed as a percentage of maximum values against time after tem­ perature shift (Hunter and Kleckner, 2001). (C) Meiotic delay of meul3LI is dependent on the recJZ gene and checkpoint rad• genes but this is not the case for dmcJLI. Cells were induced to enter meiosis and the progression of meiosis was monitored by DAPI staining. Shown are the average ratios of cells in meiosis I at 5 and 6 h in three or four independent experiments. (D) y-ray-irradiated cells are delayed in entering meiosis I and this delay is also dependent on radJ7 . Cells were induced to enter meiosis and irradiated with y-rays 3 h after temperature shift, when the cells were in the horse­ tail period. Shown are the average ratios of cells in meiosis I at 5.5 h in three independent experiments. Strains: patl (JZ670), patl meul3LI (KN8), patl dmclLI (MS276-l), patl recl2LI (MS123-5), patl recl2LI meu13LI (MSll0-2), patl recl2LI dmclLI (MS189-1), patl rad17LI (MSlOl-4), patl rad17 LI meul JLI (MS107-1), patl rad17 LI dmcl LI (MS190-7), patl cdsl LI meul3LI (MS231-1) and patl mekl LI meul3LI (MS217-l). 2810 Meiotic recombination checkpoint in S.pombe delay in en tering meiosis I. To examine this possibili ty, we the onset of meiosis I was delayed in irradiated patl cells irradiated meiotic patl cells during the horsetail period relative to non-irradiated cells. However, when radJ7 with y-rays (3 h after temperature shift) and de termined was deleted from patl cells, y-ray irradiation no longer when these cells entered meiosis I. As shown in Figure 1D, affected the timing with which meiosis I was initiated. pall meuJJA pat.I dmc/ 5hr 5hr 6hr 5hr 6hr 6hr pat/ rec12A pal recl1A. nU!ul3A go 80 so U 40 tit 20 20 5hr 6hr 5hr 5hr 6hr pall radl7t:,. dmclt:. pat/ radl7t11tie1t/JA pall radl7t:,. <,O <,O u 40 u •10 � # 20 20 6hr 6hr Shi- 5hr 6hr pat/ cdsJt:,. meu/3 patJ mek.JA. /tU!ltfJt:,. .; u 40 U 40 tl! '20 2.0 5hr 5hr 6br 6hr D pall pall radl7A u 40 'i:i t§1 gamma-ray gamma-ray 2811 M.Shi mada et al. 89.5 81.. !IJ.S J /10 tie Ml !'""1 �= .,: "° ·;;: JI> WT ... 71,i 7 Q 'TOCMf �- ;,., "' 51AI O ;., :I 400U O" Q,j JOOO <: 11•10 wr H f 4 � 'iiitlth dli'tlfltl t.N tlliil!l -lbod iai □ 4bedia.w •h liitnll..,. (7"] daDl'ltfll!lt .._• l� ■ 111 VA.PI sl.u■ lq !N11r 11111 UAl' I ;st■kilnfi: [..{) In DArl � ;; r,(l tf. • M l , :ro WI' .,,. /J/J. md/ 7A roill7A d""'lf " md/ 70 m-eul JA dmc:I It. Fig. 2. Spore viability and gene conversion frequencies of meiosis-defective mutants. The spore viabilities (A) and allelic gene conversion frequencies (B) between ade6-469 and ade6-M26 of double mutants (rad3/J. meu13/J., radl7/J. meu13/J., cdsl/J. meu13/J., mekl!J. meu13/J. and rad1 7/J. dmcl/J.) and single mutants were measured. The various strains were generated by crossing wild-type (MSll I- WI X MS105- IB ), rad3/J. (MS126-4 X MS162-1), rad17/J. (MS! 11-1 X MS105-22D), cdsl/J. (MS233-4 X MS245-3), mekl/J. (MS203-2 X MS202-11), meul3/J. (MSll l-ml3 X MS105-22C), dmcl/J. (MS133-l X MS114-3), rad3/J. meu13/J. (MS128-15 X MS163-10), radl 7/J. meu13/J. (MS! 11-6 X MS105-25C), cdsl/J. meul3/J. (MS233-3 X MS245-7), mekl/J. meul3/J. (MS203-2 X MS202-10) and rad17/J. dmcl/J. (MS133-1 X MS! 14-3). All data presented above are the average of three independent experiments with standard errors. (C) The phenotype of wild-type, meu13/J., radl 7/J., radl7/J. meu13/J., dmcl/J. and radl7/J. dmcl/J. cells. Typical microscopic images of the asci stained by DAPI are shown in the right panels. The scale bar represents 5 µm. Thus, DSBs appear to be monitored by a checkpoin t and Russell, 1998). To investigate whether this phos­ pathway involving radl7, and their presence delays the phorylation participates in delaying meiosis in meul3L1 cell' s entry into meiosis I. cells, we monitored Cdc2 Tyr15 phosphorylation in patl and patl meul3L1 cells during meiosis and sporulation (Figure 4). The level of the phosphorylated form of Cdc2 Phosphory/ation of Tyr15 in Cdc2 is maintained for increased du ring the pre-meiotic S phase and decreased a longer period in pat1 meu13L1 than in pat1 during meiotic division in pat] cells. In pat] meul 311 cells, Phosphorylation of Tyr15 in Cdc2 plays a key role in blocking the onset of mitosis when DNA replication is however, Cdc2 was phosphorylated for 1 h longer than in inhibited or DNA is damaged (Rhind et al., 199 7; Rhind patl cells, cons istent with the length of the delay in 2812 Meiotic recombi nation checkpoint in S.pombe Chr l + CbrD + Chr m + DSB [ hours after shift 0 2 33 .544.5 5 0 2 33.5 44 .5 S 6 02 33.54 4. 5 s, paJl patl meu13A. pa Jl dmclA Chr l � CbrD � Cbr ffl + DSB [ hours aftu shift O 2 3 3.5 4 4.5 5 0 2 33 .S 44 .S 5 0 2 33 . .S 44.5 5 6 patl rec12A. me ul3A patl recl 2A. dmclA pall rad17A meu13A Chr l � Cbr ll � Chr m + �B [ bolll5 afler shifl O 2 3 3.S 4 4.5 5 patl rad1 7A Fig. 3. DSB repair is retarded in meul3L1. Cells were induced to enter meiosis as shown in Figure 2. Samples were taken after the temperature shift at the indicated time points, analyzed by PFGE and stained with ethidium bromide to detect DNA. Chr I, Chr II and Chr ill indicate the position of chromosomes 1, 2 and 3, respectively. The smear bands represent the DSBs that appear during meiosis. meiosis I onset in patl meu13,1 cells. Furthermore, we Three protein kinases , Cds1, Chk1 and Mek1, are found that this extended period of phosphorylation was not expressed and phosphorylated during meiosis Cdsl and Chkl play impor tant roles in checkpoint controls presen t in pat] rad] 7 ,1 meul 3,1 and pat] reel 2,1 meul 3,1 and are phosphorylated when the checkpoints are activ­ cells, which do not experience a delay in meiosis, as shown ated. Thus, we examined the expression of Cdsl, Chkl and in Figure lC. Thus, the regulatory pathway delaying the onset of meiosis I in meul 3,1 employs the phosphorylation Mekl (the meiotic paralog of Cdsl) during meiosis and of Tyr15 in Cdc2. sporulation in patl and patl meu13L1 cells (F igure 5). In 2813 4567 M.Shimada et al. patl meul3d pall hon"' allu sbill O 2 3 45 67 8 0 2 34 56 7 8 Cdcl TyrlSP Cdc2 pall radl7 A meu lJA patl recl2'1. meul3A bournflcnbin 0 23 0 23 45 8 6 78 Cdc2 TyrlSP Cdcl pall radl 7'1. patl rec12.d 0 23 4 56 78 0 2 34 5 67 8 Cdc2 Tyr15P Cdcl Fig. 4. Phosphorylation of the Tyrl5 in Cdc2 is extended in patl meul3A. patl (JZ670), patl meul3A (KN8), patl recl2A meul3A (MSll0-2), patl rad17A meul3A (MS107-1), pat] recl2A (MS123-5) and patl rad17A (MSI Ol-4) cells were induced to enter meiosis as shown in Figure I. Samples were taken after the temperature shift at the indicated time points and western blot analysis was performed to detect the amount of Cdc2 and phos­ phorylated Cdc2. both patl and patl meul3A cells, Cdsl was phosphoryl­before their entry into meiosis I. Consis tent with this ated from 2 h after the temperature shift, which continued hypothesis, deletion of radJ7 allowed meul3A cells to to the end of sporula tion . In both cell types, Chkl was not progress into meiosis I without completing DSB repair. phosphorylated during early meiosis but was phosphoryl­Th ese results st rongly suggest that, when meiotic DSB ated slightly in the later stage. However, Mekl was repair is delayed in S.pombe, DSBs are detected by DNA expressed only during pre-meiotic replication and meiotic damage and replication checkpoin t genes, which retards recombination and showed a mobility shift during these meiotic progression. To test this hypothesis directly, we periods, suggesting that phosphorylation occurred. artificially in troduced an unusually large amount of DSBs Furthermore, the extent of Mekl mobility shif t in patl into meiotic cells. Th is triggered a delay in meiotic meul3A is greater than that in patl, whereas the expres­ progression, which was dependen t on radJ7 (Figure lD). sion pat terns of Cdsl and Chkl are similar in these cells at Ta ken together, we propose that a meiotic recombination the time point just before the onset of meiosis I (Figure 5; checkpoin t exists in S.pombe to monitor meiotic DSB 4 h). Th ese results suggest that Cdsl, Chkl and Mekl have repair and regulate entry into meiosis I (Figure 6). Th is differen t functions during meiosis. regulation seems to be responsible for the maintenance of the optimal level of spore viability and meiotic recombin­ ation frequency in cells that experience a delay in DSB Discussion repair (Figure 2). The meiotic recombination checkpoint exists in In budding yeas t, S.eerevisiae, it has been reported that fission yeast the pachytene checkpoin t operates to arrest cells at the In this st udy, we found that meul3A cells harboring a pachytene st age in response to a defect in recombination defec t in meiotic recombination had a delay in the entry and /o r synapsis. It has not been shown clearly, however, into meiosis I. Th e delay was dependen t on reeJ2 /SPOl l, whether meiotic delay is triggered by a defect in DSB which is required for initia tion of meiotic recombination, repair or synaptonemal complex formation, or by defects + + + + rad] 7, rad] , rad] and rad9 , which are required for in both of them together (Roeder and Bailis, 2000). Of note damage and replication checkpoints in mitosis, eds] , and is that in st riking contrast to S.eerevisiae, S. pombe does + + mekl , a meiosis-specific eds] paralog. Furthermore, we not form any SC (Bahler et al., 1993). Considering that found that there is a delay in meiotic DSB repair in many genes required for the meiotic recombination meul3A. From these resul ts, we surmised that a delay, checkpoin t in S.pombe have homologs that are required elicited by DNA damage and replication checkpoin t genes, for the pachytene checkpoin t in S.eerevisiae, and the was required in meul3A cells to repair meiotic DSBs st rong analogy between the observations in these two 28 14 45 6 Meiotic recombination checkpoint in S.pombe a- T u b a- HA houn aller shiJI 0 23 4 56 78 0 23 pall Cds lHA meul3A a -Tub a-HA 0 2 3 4 5 6 7 8 boor,; rs bilt 0 23 4567 8 ChklHA meu 13L1 �--------------..._ _____________ ___.J pat1 I a-HA a-Tub 0 2 3 4 5 6 7 8 0 2345 678 pat] MeklHA pat] ,ne u13Li Fig. 5. Three protein kinases, Cds l, Chkl and Me kl, are expressed and phosphorylated during meiosis and sporulation in fission yeast. pat] Cds lH A (MS19 7-6), patl meul3L1 Cds lH A (MS198-l), patl ChklHA (MS108- l), patl meul3L1 ChklHA (MS1 96-2), patl MeklHA (MS1 99-4) and patl meul 311 MeklHA (MS200-5) cells were induced to enter meiosis as shown in Figure l. Samples were taken after the temperature shift at the indicated time points and proteins were prepared and detected with anti-HA and anti a-tubulin anti bodies. yeasts, our results strongly suggest that the checkpoint actually monitors defects in meiotic recombination. The role of the checkpoint rad" genes, cds1 and mek1 in meiotic recombination Delay of meiotic DSB repair + + + We report here that S. pombe rad17, rad3 , eds] and mekl + genes are required for maintaining a normal level of meiotic recombination, although they are not required for the maintenance of viable spores (Figure 2 and Murakami and Nurse, 1999). This is consistent with the notion that many DNA damage checkpoint genes may play a direct role in meiotic recombination in other species. In S. cerevisiae, genes homologous to S.pombe radl7, + + rad3 and mekJ are required for meiotic recombination (Kato and Ogawa, 1994; Lydall et al. , 1996; Xu et al. , 1997). Mammalian Radl, ATR, ATM and Chkl (S.pombe + + + + radl , rad3 , telJ and chkJ homologs, respectively) have been found to localize to synapsed and/or unsynapsed meiotic chromosomes (Roeder and Bailis, 2000) and are Yl5 suggested to play a direct role in meiotic recombination. ( ) cdc2 Schiwsaccharomyces pombe Mekl, which is expressed only during meiosis, is required for efficient meiotic recombination. Mekl is also required for the meiotic Prophase I � Meiosi s I recombination checkpoint (Figure IC). In S. cerevisiae, Mekl is considered to be the meiotic counterpart of Rad53 Fig. 6. A model of the meiotic recombination checkpoint in fission (S.pombe Cdsl homolog). However, the meiotic function + + yeast. When repair of meiotic DSBs is retarded, checkpoint rad, eds] of Rad53 is not fully understood. Schiwsaccharomyces and mekJ genes delay cells to enter into meiosis I through phosphoryl­ pombe Cdsl is required for a normal level of meiotic ation of Cdc2 Tyr 15 to provide enough time to repair DSBs. pail I· afl<! M.Shimada et al. recombina tion. Cdsl is also required for maintaining spore the duration of pre-meiotic replication (Cha et al., 2000), viability and recombination effi ciency in meul 3LI dmcJ could have a function in unexpected cell cycle (Figure 2). Therefore, we conclude that both Mekl and progression which is unr elated to recombina tion. Cdsl are required for the meiotic recombination check­ The meiotic delay observed in dmcl LI cells is not + + + poin t in S.pombe . dependent on checkpoin t rad genes (rad17, radJ , rad] + + Phosphorylation of Cdsl is observed from the initia tion and rad9 ); however, radJ7 is required for maintenance of pre-meiotic replication (2 h after temperature shift) of viable spores and meiotic recombination frequency in through to the end of sporula tion. Chkl expression dmclLI cells (Figure 2). On e possible explanation of this + + strongly increases aft er the first meiotic division, but phenotype is that dmcJ and radJ7 might have a function Chkl only becomes phosphorylated at the sporulation in recombination between homologous chromosomes in st age (Figure 5). Mekl expression begins at the start of an independen t way. Thus, when both genes are defective, pre-meiotic replication and continues until about the time meiotic recombination between homologous chromo­ of meiosis I. Mekl displays a mobility shif t during these somes would st rongly decrease, resulting in reduced periods, which is probably due to its phosphoryla tion, as spore viabili ty. Further examination of Dmcl function was shown previously in S.cerevisiae (Rockmill and should provide new insights into the regulatory mechan­ Roeder, 1991). Thus, the meiotic regulation of each of ism of meiotic progression. these three protein kinases, Cdsl, Chkl and Mekl, is possibly differen t in terms of expression and phosphoryl­ ation, suggesting that each has a distinct role to play in Materials and methods meiosis. From these results, we speculate that Rad1 7, Rad3, Cdsl and Mekl may be involved in some part of the Yeast strains, media and genetic methods DNA recombination process as well as in the meiotic The S.pombe strains used in this study are listed in Table I. Standard S.pombe genetic procedures were followed (Moreno et al., 1991). recombination monitoring system. Complete media YPD or YE containing adenine sulfate (75 µg/ml), In addition to the homology to the above-mentioned synthetic minimal medium EMM2, sporulation medium ME or EMM2-N genes, the targets of these checkpoints seem to be the and germination media YEAde or EMMG were used. The homozygous same. In S.cerevisiae, entry into meiosis I is inhibited by diploid strains were constructed by cell fusion. maintaining the Tyr19-phosphoryla ted state of Cdc28 (S .pombe Cdc2 homolog) in response to activation of the Spore viability and recombination assays Haploid parental strains were grown on YPD plates at 33 C, cultured in pachytene checkpoin t because the Tyr19-non-phosphoryl­ YE-Ade and harvested at the stationary phase. Cells were mated and ated form mutants cannot arrest properly in such a sporulated on ME plates at 28 C (zygotic meiosis). After 3-4 days of situa tion (L eu and Roeder, 1999; Tung et al., 2000). We incubation, spores were treated with 0.5% glusulase (NEN Life Science confirmed that similar regulation of Cdc2 operates in Products, Inc.) for 16 h at 36C and checked microscopically for the complete digestion of contaminating vegetative cells. The glusulase­ S.pombe; the timing of Tyr15 phosphoryla tion of Cdc2 is treated spores were washed with water and then used for the spore retarded when entry into meiosis I is delayed in the viability assay and the intragenic recombination assay. meu13LI mutant (Figure 4). Sp ore viability assays. A total of 160 spores were spotted with a micro­ manipulator (MS series 200; Singer Instrument, UK) on EMMG What is the defect that triggers a meiotic delay in containing supplements and germinated at 30 C for 4 days. Colonies dmc M cells? were counted and the spore viability was expressed as a percentage We showed here that S.pombe dmclLI cells display the relative to the 160 spores. We repeated this assay three times for each following unexpected phenotypes as compared with those strain. of S.cerevisiae . Firs t, dmclLI cells show a delay in meiotic Intr agenic recombination assays. We determined recombination fre­ progression but do not arrest at prophase as seen in quencies as described previously (Nabeshima et al., 2001). To examine S. cerevisiae (Figure 1). Second, they do not exhibit the frequency of intragenic recombination, we used two ade6 alleles (ade6-M26 and ade6-469) as the intragenic recombination between these accumulation of DSBs (Figure 3). Third, the level of alleles produces the ade6 allele. reduction in recombination or spore viability is much less than those of the dmcl mutant of S.cerevisiae (Figure 2). Synchronous meiosis Meiotic delay in dmcl LI cells is not alleviated by Fresh homozygous pat l-114 diploid strains were grown in EMM with elimination either of DSBs by deletion of recJ2 or of the supplements at 25 C for >24 h. Cells at the mid-log phase were collected, washed and then transferred at a density of 3-4 X 10 cells/ml to EMM2 checkp oin t genes involved in the delay in meu13LI cells containing supplements Leu (60 µg/ml) and Ura (40 µg/ml) but lacking (Figure lC). These results imply that Dmcl plays a role in NJLiCI. After 16 h of incubation at 25 C, NJLiCl (5 mg/ml) and S. pombe meiosis that is independent of DSB formation. supplements Leu (250 µg/ml) and Ura (75 µg/ml) were added to the They also mean that the absence of this DSB-independen t culture medium and then the temperature was raised to 34 C to induce role triggers a delay in meiotic progression which is meiosis. The progression of meiosis was monitored by staining the methanol-fixed cells with DAPI (Wako). Fory-ray analysis, horsetail cells distinc t from that mediated by the functions of the DNA (3 h after temperature shift) were irradiated from a oCo source at a dose damage checkpoin t. rate of 468 Gy/h for ~20 min (170 Gy). We surmise the following possibilities to explain why dmcJLI shows meiotic delay. Firs t, S. pombe dmcJ may Meiotic DSB assays play a role in recombination independen t of DSB form­ The procedures for PFGE have been described previously (Cervantes et al., 2000). Meiosis was induced in pat] diploid cells by shifting the ation, which might be single-strand break-induced recom­ temperature, and 14 ml of cultured cells were collected at the indicated bination. Second, the defec t of dmcl + function may alter times. PFGE was conducted in a 0.8% chromosomal grade agarose gel chromatin structure to inhibi t proper division of the (Bio-Rad) in a Bio-Rad CHEF-Mapper system at 14 C for 48 h with nucleus, which requires time to be repaired. Third, like 2 V/cm, 100 C-induced angle in lX TAE buffer (40 mM Tris-acetate S. cerevisiae SPOJ J and RECB, muta tions of which affect pH 8.0, 1 mM EDTA), with a switch time of 30 min. 2816 Meiotic recombi nation checkpoint in S.pombe Table I. Strains used in this study Strain Genotype MS lll wl h ura4-D18 leul-32 ade6-469 his2 MS 10 5- 1B h- ura4-D18 ade6-M26 + + MS 12 6-4 h ura4-D18 leul-32 ade6-469 his2 rad3 :: ura4 MS 16 2- 1 h- ura4-D18 ade6-M26 rad 3::ur a4 + + MS lll -1 h ura4-D18 leul-32 ade6-469 his2 rad1 7::ura4 MS lO S-220 h- ura4-D18 ade6-M26 rad1 7: :ur a4 + + MS203-2 h ura4-D18 leul-32 ade6-469 his2 mekl ::u ra4 MS202- 11 h-ura4-D18 ade6-M26 mekl :: ura4 + + MS233-4 h ura4-D18 leul-32 ade6-469 his2 cd sl::ur a4 MS245 -3 h- ura4-D18 ade6-M26 cdsl:: ura4 + + MS 11 1m13 h ura4-D18 leul-32 ade6-469 his2 meu1 3:: ura4 MS 10 5-22C h- ura4-D18 ade6-M26 meu1 3:: ura4 + + MS 133-1 h ura4-D18 leul-32 ade6-469 his2 dmcl ::ur a4 MS 1 14-3 h- ura4-D18 ade6-M26 dmcl :: ura4 + + + MS 128- 15 h ura4-D18 leul-32 ade6-469 his2 rad3 :: ura4 me u13:: ura4 + + MS 16 3-10 h- ura4-D18 ade6-M26 rad 3::ur a4 meu1 3::ura4 + + + MS ll l-6 h ura4-D18 leul-32 ade6-469 his2 rad1 7::ura4 meu1 3:: ura4 + + MS 10 5-25C h-ura4-D18 ade6-M26 rad1 7: :ur a4 me u13:: ura4 + + + MS203-2 h ura4-D18 leul-32 ade6-469 his2 mekl ::u ra4 meu1 3:: ura4 + + MS202- 10 h- ura4-D18 ade6-M26 mekl ::ur a4 meu1 3::ura4 + + + MS23 3-3 h ura4-D18 leul-32 ade6-469 his2 cd sl:: ura4 meu1 3:: ura4 + + MS245-7 h- ura4-D18 ade6-M26 cd sl:: ura4 meu1 3:: ura4 + + + MS 133-1 h ura4-D18 leul-32 ade6-469 his2 radl 7::ura4 dmcl :: ura4 + + MS 1 14-3 h- ura4-D18 ade6-M26 rad1 7: :ur a4 dmcl::ur a4 JZ670" h-llr patl -114/patl -114 leul -32/ leul-32 ade6-M21 0/ ade6-M2 16 KN8 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 meu1 3::ura4+J me u13:: ura4 + + MS276- 1 h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 dmcl :: ura4 /d mcl :: ura4 MS 12 3-5 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/ re c12::LEU 2 MS ll 0-2 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/re c12: :LEU2 + + me u13:: ura4 /meu13:: ura4 MS 18 9-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 re c12::LEU 2/re c12: :LEU2 + + dmcl::ur a4 /dmc l:: ura4 MS lOl- 4 h--/Jr patl -114/patl -114 ura4-D18/ ura4-D18 leul -32/ leul-32 ade6-M21 0/ ade6-M2 16 rad1 7: :ur a4+Jrad1 7::ura4 + + MS 10 7-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 rad1 7::ura4 /radl 7::ura4 + + meul 3: : ura4 /meul 3: : ura4 + + h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 rad1 7::ura4 MS 19 0-7 /rad1 7::ura4 + + dmcl::ur a4 /dmc l:: ura4 + + MS23 1-1 h-lh-patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M 210 /a de6-M2 16 cdsl ::ur a4 fcdsl::ur a4 + + meul 3: : ura4 /meul 3: : ura4 + + MS217-1 h-llr patl -114/patl -114 ura4-Dl 8/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 mekl: :ur a4 /mekl :: ura4 + + me u13:: ura4 /meu13:: ura4 MS 19 7-6 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M21 0/ ade6-M2 16 Cd sl:2 HA: ura4 ,Cds l MS 198-1 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 21 leul-32 ade6-M 210 /a de6-M2 16 meu1 3::ura4+J me u13:: ura4 Cd sl:2 HA: ura4 /Cds l MS 108- 1 h-!h-patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 Ch kl:3 HA/Chkl + + MS 19 6-2 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M21 0/ ade6-M2 16 meu1 3::ura4 /meu13:: ura4 Chkl :3HA/Chkl MS 19 9-4 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 le ul-3 2/ leul-32 ade6-M 210 /a de6-M2 16 Me kl: 3HA:L EU2/Mekl + + MS200-5 h-llr patl -114/patl -114 ura4-D18/ ura4-D18 leul-321 leul-32 ade6-M21 0/ ade6-M2 16 meu 13:: ura4 /me u1 3:: ura4 Me kl: 3HA:L EU2/Mek l TP4- 1D h ura4-D18 leul-32 ade6-M 216 his2 TP4-5A h-ura4-D18 leul-32 ade6-M 210 •Provided by M.Ya mamoto. Protein extra ction and western blotting upstream region and 3' downstream region of the mekJ gene. For this Protein extracts were prepared as described previously (Caspari et al., purpose, we synthesized the following four oligonucleotides and used 2000) and western blots were performed as published (Shimada et al., them as primers: me kl -SF, 5'-C GGGGTACCTGCAGAATTGAAAA­ 19 99). For the detection of Cds lH A, ChklHA and MeklHA, the blots TACGTCAAACCGAAC -3; mek l- SR, 5'-C CGCTCGAGCACTTTG­ were probed with mouse monoclonal antibodies 12CA5 (Boehringer CAAAACGGTGATGCGCGTAA GC- 3'; me kl -3F, 5'-AAAACTG­ Mannheim for ChklHA and MeklHA) and 16 B 12 (COY ANCE Inc. for CAGCTCGAGCCAC GTAAGAAAATATTCCGATAAA CTTG- 3'; and Cds lH A), then stripped and reprobed with anti-tubulin antibody (Sigma me kl -3R, 5'-CCC GAGCTCTAATTTAATATATCTTTGCTTGAAT­ T5 16 8) as a loading control. For the detection of Cdc2 Tyr 15 TATCG- 3'. The underlined sequences denote the artificially introduced phosphorylation, the blots were probed with an anti-phospho-Cdc2 restriction enzyme sites for Kp nl, Xhol, PstI-XhoI and Sad, respectively. (Ty rl5) rabbit polyclonal antibody (NEB 911 1), then stripped and + These PCR products and the 1.8 kb HindIII fragment containing the ura4 reprobed with the anti-Cdc2 antibody (S anta Cruz Biotechnology, Santa gene (Grimm et al. , 1988 ) were inserted into the pBluesc riptII KS(+) Cruz, CA) . vector via the Kp nI-X hoI, PstI-SacI and HindIII sites, respectively. This plasmid construct was digested with Kp nl and Sad and the resulting construct was introduced into the diploid strain TP4-5A/TP 4-1D. The Mek1 disruption + + + The mekJ gene was disrupted by replacing it with the ura4 gene. To do Ura transformants were then screened by Southern blot analysis to this, we performed PCR and obtained a DNA fragment carrying the 5' identify the disrupted strain. 2817 M.Shi mada et al. Construction of Mek1-3HA strain Leu,J.Y. and Roeder,G.S. (1999) The pachytene checkpoint in To prepare the Mekl-3HA construct, we performed PCR and obtained a S. cer evisiae depends on Swel-mediated phosphorylation of the DNA fragment carrying the open reading frame (ORF) region and the 3' cyclin-dependent kinase Cdc28. Mol. Cell, 4, 805-814. downstream region of the mekJ gene. For this purpose, we synthe­ Lydall,D., Nikolsky,Y., Bishop,D.K. and Weinert,T. (1996) A meiotic sized the following four oligonucleotides and used them as primers: recombination checkpoint controlled by mitotic checkpoint genes. mekl-ORF-F, 5'-ATAGG CGCGCCGTCGACTATGGACTTTTTATCAC­ Nature, 383, 840-843. ATGCCATGC-3'; and mekl-ORF-R, 5'-TATTCTTAGCGGCCGCCG­ Moreno,S., Klar,A. and Nurse,P. (1991) Molecular genetic analysis of TAGCCGGGAATGTTTAAGAGG-3'. The underlined sequences denote fission yeast Schizosaccharomyces pombe. Methods Enzymol. , 194, the artificially introduced restriction enzyme sites for Asel-Sall and Notl, 795-823. respectively. To obtain the 3' downstream region, we used the same Murakami,H. and Nurse,P. (1999) Meiotic DNA replication checkpoint primers as described above. These PCR products were inserted into the control in fission yeast. Genes Dev. , 13, 2581-2593. pIL(m vector (T.Nakamura, unpublished), which is designed to allow Nabeshima,K., Kakihara,Y., Hiraoka,Y. and Nojima,H. (2001) A novel one-step integration via Sall-Not! and Xhol-Sacl sites, respectively. This meiosis-specific protein of fission yeast, Meu13p, promotes plasmid construct was digested with Mlul. The resulting construct was homologous pairing independently of homologous recombination. introduced into the haploid strains TP4-5A and TP4-1D. We then screened EMB O J. , 20, 3871-3881. the Leu transformants by Southern blot analysis to identify the Mekl- Rhind,N. and Russell,P. (1998) Tyrosine phosphorylation of cdc2 is 3HA tagged strain. required for the replication checkpoint in Schizosaccharomyces pombe. Mol. Cell. Biol. , 18, 3782-3787. Rhind,N., Fumari,B. and Russell,P. (1997) Cdc2 tyrosine phosphoryl­ ation is required for the DNA damage checkpoint in fission yeast. Acknowledgements Genes Dev. , 11, 504-511. We are grateful to Dr Tony Carr for strains and critical discussions, and Rockmill,B. and Roeder,G.S. (1991) A meiosis-specific protein kinase Dr Gerry Smith for strains and technical suggestions. We also thank Dr homolog required for chromosome synapsis and recombination. Genes T.J.Kim for general support and encouragement, Drs T.Nakamura, Dev. , 5, 2392-2404. Y.Watanabe and E.Hartsuiker for critical discussions, Drs P.Russell, Roeder,G.S. (1997) Meiotic chromosomes: it takes two to tango. Genes F.lshikawa, M.Yamamoto and C.Shimoda for strains, Dr P.Nurse for the Dev. , 11, 2600-2621. Cdc2 antibody, Dr V.Wood for cosmid clones of the S.pombe genome, Roeder,G.S. and Bailis,J.M. (2000) The pachytene checkpoint. Trends and Dr P.Hughes for critically reading the manuscript. This work was Genet. , 16, 395-403. supported by a Grant-in-aid for Scientific Research on Priority Areas Shimada,M., Okuzaki,D., Tanaka,S., Tougan,T., Tamai,K.K., from the Ministry of Education, Science, Sports and Culture of Japan and Shimoda,C. and Nojima,H. (1999) Replication factor C3 of grants from The Uehara Memorial Foundation to H.N. M.S. is a Research Schizosaccharomyces pombe, a small subunit of replication factor C Fellow of the Japan Society for the Promotion of Science. complex, plays a role in both replication and damage checkpoints. Mol. Biol. Cell, 10, 3991-4003. Stuart,D. and Wittenberg,C. (1998) CLB5 and CLB6 are required for References premeiotic DNA replication and activation of the meiotic SIM checkpoint. Genes Dev. , 12, 2698-2710. Bahler,J., Wyler,T., Loidl,J. and Kohli,J. (1993) Unusual nuclear Tung,K.S., Hong,E.J. and Roeder,G.S. (2000) The pachytene checkpoint structures in meiotic prophase of fission yeast: a cytological prevents accumulation and phosphorylation of the meiosis-specific analysis. J. Cell Biol. , 121, 241-256. transcription factor Ndt80. Proc. Natl Acad. Sci. USA , 97, Bishop,D.K., Park,D., Xu,L. and Kleckner,N. (1992) DMCl: a meiosis­ 12187-12192. specific yeast homolog of recA required for recombination, Watanabe,T., Miyashita,K., Saito,T.T., Yoneki,T., Kakihara,Y., synaptonemal complex formation and cell cycle progression. Cell, Nabeshima,K., Kishi,Y.A., Shimoda,C. and Nojima,H. (2001) 69, 439-456. Comprehensive isolation of meiosis-specific genes identifies novel Caspari,T. and Carr,A.M. (1999) DNA structure checkpoint pathways in proteins and unusual non-coding transcripts in Schizosaccharomyces Schizosaccharomyces pombe. Biochimie, 81, 173-181. pombe. Nucleic Acids Res. , 29, 2327-2337. Caspari,T., Dahlen,M., Kanter,S.G., Lindsay, HD., Hofmann,K., Xu,L., Weiner,B.M. and Kleckner,N. (1997) Meiotic cells monitor the Papadimitriou,K., Sunnerhagen,P. and Carr,A.M. (2000) Characteriz­ status of the interhomolog recombination complex. Genes Dev. , 11, ation of Schizosaccharomyces pombe Husl; a PCNA-related protein 106-118. that associates with Rad ! and Rad9. Mol. Cell. Biol. , 20, 1254-1262. Cervantes,M.D., Farah,J.A. and Smith,G.R. (2000) Meiotic DNA breaks Received January 22, 2002; revised April 8, 2002; associated with recombination in S.pombe. Mol. Cell, 5, 883-888. accepted April 11, 2002 Cha,R.S., Weiner,B.M., Keeney,S., Dekker,J. and Kleckner,N. (2000) Progression of meiotic DNA replication is modulated by interchromosomal interaction proteins, negatively by SPOllp and positively by Rec8p. Genes Dev. , 14, 493-503. Fukushima,K., Tanaka,Y., Nabeshima,K., Yoneki,T., Tougan,T., Tanaka,S. and Nojima,H. (2000) Dmcl of Schizosaccharomyces pombe plays a role in meiotic recombination. Nucleic Acids Res. , 28, 2709-2716. Grimm,C., Kohli,J., Murray,J. and Maundrell,K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet. , 215, 81-86. Hartwell,L.H. and Weinert,T.A. (1989) Checkpoints: controls that ensure the order of cell cycle events. Science, 246, 629---634. Hunter,N. and Kleckner,N. (2001) The single-end invasion: an asymmetric intermediate at the double-strand break to double­ Holliday junction transition of meiotic recombination. Cell, 106, 59-70. Iino,Y. and Yamamoto,M. (1985) Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. , 198, 416-421. Kato,R. and Ogawa,H. (1994) An essential gene, ES RJ, is required for mitotic cell growth, DNA repair and meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res. , 22, 3104-3112. Kleckner,N. (1996) Meiosis: how could it work? Proc. Natl Acad. Sci. USA , 93, 8167-8174.

Journal

The EMBO Journal – Springer Journals

Published: Jun 3, 2002

Keywords: DNA damage checkpoint; double‐strand break; homologous recombination; meiosis; pachytene checkpoint

There are no references for this article.