Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Further insight into BRUTUS domain composition and functionality

Further insight into BRUTUS domain composition and functionality PLANT SIGNALING & BEHAVIOR 2016, VOL. 11, NO. 8, e1204508 (6 pages) http://dx.doi.org/10.1080/15592324.2016.1204508 SHORT COMMUNICATION Anna Matthiadis and Terri A. Long Department of Plant and Microbial Biology, North Carolina State University, Raleigh, NC, USA ABSTRACT ARTICLE HISTORY Received 3 June 2016 BRUTUS (BTS) is a hemerythrin (HHE) domain containing E3 ligase that facilitates the degradation of Accepted 17 June 2016 POPEYE-like (PYEL) proteins in a proteasomal-dependent manner. Deletion of BTS HHE domains enhances BTS stability in the presence of iron and also complements loss of BTS function, suggesting that the HHE KEYWORDS domains are critical for protein stability but not for enzymatic function. The RING E3 domain plays an Arabidopsis thaliana; BRUTUS essential role in BTS’ capacity to both interact with PYEL proteins and to act as an E3 ligase. Here we show (BTS); hemerythrin (HHE); that removal of the RING domain does not complement loss of BTS function. We conclude that enzymatic iron homeostasis; activity of BTS via the RING domain is essential for response to iron deficiency in plants. Further, we multidomain protein; Pirh2; RING E3 analyze possible BTS domain structure evolution and predict that the combination of domains found in BTS is specific to photosynthetic organisms, potentially indicative of a role for BTS and its orthologs in mitigating the iron-related challenges presented by photosynthesis. Iron (Fe) is an essential micronutrient for many key processes BTS encodes a multi-domain protein with 3 hemerythrin in plants. In response to iron deprivation, plants activate a (HHE) domains and a RING domain flanked by a CHY- well-known series of responses that mediate iron uptake from type zinc finger and a zinc ribbon domain. The HHE the surrounding rhizosphere. In most dicots these responses domains are left-twisted 4-a-helical bundles that, in marine include acidification of the rhizosphere, reduction of ferric iron invertebrates and the mammalian iron homeostasis protein to ferrous iron, and subsequent uptake of ferrous iron into root FBXL5, provide a hydrophobic pocket wherein diiron binds 8-10 epidermal cells. Following uptake, iron is bound to various che- oxygen. Correspondingly, we found that the BTS HHE lators, transported through the vasculature, and translocated domains also bind both iron and zinc. We expressed from the root to shoot and sink tissues. Two regulatory path- recombinant GFP tagged BTS lacking all 3 of the HHE ways controlled by bHLH transcription factors have been domains (BTS ) and driven by the native BTS promoter DHHE shown to mediate these responses in Arabidopsis thaliana. The (BBDHG) in bts-1 mutants and found that removal of the bHLH transcription factor FIT controls the initialization of the HHE domains does not affect the ability of the truncated iron deficiency response by directly and indirectly controlling protein to complement bts-1 phenotypes including root the expression of genes involved in rhizosphere acidification, length and iron reductase activity. Moreover, while full- 1,2 ferric reduction, and ferrous iron uptake. The bHLH tran- length recombinant BTS synthesized by in vitro translation scription factor POPEYE (PYE) mediates control by directly using a wheat germ system exhibits decreased stability in regulating the expression of genes involved in intercellular the presence of increasing concentrations of soluble iron, transport, mitochondrial ferric reduction, and other processes. recombinant BTS protein maintains stability regardless DHHE PYE physically interacts with PYE-like (PYEL) proteins includ- of iron concentration. We also observed enhanced accumu- ing bHLH104, ILR3, and bHLH115; and several PYEL proteins lation of BTS protein in planta by analyzing transgenic DHHE 4-6 directly target PYE transcriptionally. Similar to PYE, loss of bts-1 mutants transformed with either BBG (pBTS::BTS- PYEL expression leads to decreased tolerance to iron defi- GFP) or BBDHG (pBTS:: BTS -GFP) constructs. These DHHE 5,6 ciency, suggesting that PYE and PYEL proteins may have findings suggest that the presence of the HHE domains con- somewhat redundant functions. While PYE and PYEL proteins fers protein instability upon binding of iron. physically interact, only PYEL proteins have been shown to The presence of an E3 RING-H2 domain near the C- interact with a third protein, BRUTUS (BTS). BTS, similar to terminus of BTS suggested that BTS may act as an E3 ligase. PYE and PYELs, is induced transcriptionally in response to E3 ligases catalyze the final step in the ubiquitination of an 3,4 iron deprivation. Unlike pye and pyel loss of function interacting E3 substrate. Ubiquitination targets proteins for mutants, bts mutants that exhibit decreased induction of BTS degradation via the 26S proteasome. Initially, ubiquitin is acti- expression under iron deficiency show increased tolerance to vated by ATP and transferred via a ubiquitin-activating enzyme 3,4 iron deprivation. Thus, BTS and PYE/PYEL proteins act in (E1) to a ubiquitin-conjugating enzyme (E2), generating E2 11,12 opposing manners to control the iron deficiency response. thioesterified with ubiquitin (E2-Ub). Ubiquitin-ligating CONTACT Terri A. Long [email protected], [email protected] North Carolina State University, Department of Plant and Microbial Biology, Raleigh, NC, USA Published with license by Taylor & Francis Group, LLC © Anna Matthiadis and Terri A. Long This is an Open Access article distributed under the terms of the Creative Commons Attribution-Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The moral rights of the named author(s) have been asserted. e1204508-2 A. MATTHIADIS AND T. A. LONG enzymes (E3), including members of the RING H2 family, bind both a targeting substrate and E2-Ub and facilitate the transfer of the ubiquitin from the E2-Ub to the substrate. RING domains alone purified from diverse enzymes have been shown to demonstrate intrinsic E3 ligase activity in the presence of a 12,13 conjugating E1, E2, ubiquitin, and ATP. We have shown that full length in vitro translated and purified BTS protein exhibits E3 ligase capacity. We also showed that this E3 capacity is able to affect the stability of 2 BTS targets – the PYEL proteins ILR3 and bHLH115. Strikingly, deletion of the BTS HHE region confers apparent increased E3 ligase functional- ity in vitro and enhanced ability to facilitate the degradation of PYEL proteins in cell free degradation assays due to increased pro- tein stability. These findings indicate that the BTS HHE domains play a critical role in the stability of the protein, which increases the accumulation of BTS and therefore E3 activity in vitro.How- ever, the role of the E3 domain alone in mediating iron deficiency responses and protein stability has not yet been explored. Here, to further explore the role of the BTS E3 domain, we expressed recombinant GFP tagged BTS lacking the E3 domain (BTS ) and driven by the native BTS promoter DE3 (BBDEG) in bts-1 mutants. We first identified several bts-1 mutant lines expressing BBDEG and chose to focus on line 6-1 with expression at levels most comparable to previously published lines expressing full length BTS (BBG 1-2) and BTS lacking the HHE domains (BBDHG 3-3) (Fig. 1A). We used confocal analysis to confirm that structurally via- ble protein is produced and to identify any effects on stabil- ity. Accumulation of the BTS protein is similar to that of DE3 full length BTS; both proteins accumulate minimally even under iron deficiency in contrast to the previously pub- lished more stable BTS protein (Fig. 1B). These find- DHHE ings indicate that while the HHE domains facilitate degradation of BTS protein, the E3 domain does not appear to play a critical role in BTS stability. Next, we examined the capacity of the BBDEG construct to complement bts-1 mutant phenotypes. We found that, unlike full length BTS and BBDHG, expression of BBDEG in a bts-1 mutant background results in root length (Fig. 2A, C)and iron reductase activity (Fig. 2B)not significantly different from that of the bts-1 mutant under iron deficiency, indicating that the BTS protein DE3 is not functional in fulfilling BTS’ typical iron homeostasis roles. The presence of the BTS E3 RING domain is therefore critical for BTS’ ability to repress several classical responses to iron deficiency. Figure 1. Expression and stability of BTS and BTS deletion constructs. (A) Relative Since loss of the E3 domain inhibits the ability of BTS to facilitate BTS expression in root tissue of 7 day old seedlings (4 d CFe, 3 d -Fe). Error bars ubiquitin formation in vitro and to interact with the target proteins indicate §SE (n D 3) and columns with different letters are significantly different ILR3 and bHLH115, the primary role of the BTS E3 domain is from each other (ANOVA followed by Tukey-Kramer, p < 0.05). (B) Confocal microscopy images of roots of 7 day old bts-1 seedlings (4 d CFe, 3 d -Fe) express- likely to facilitate the ubiquitination and subsequent degradation ing pBTS::BTS-GFP (BBG), pBTS::BTSDHHE-GFP (BBDHG), and pBTS::BTSDE3-GFP of target substrates independent of the function of the HHE stained with propidium iodide (red). Scale bars D 50 mm. Results shown represent domains. This provides further evidence that the overall physio- at least 3 independent assays. logical differences seen in the bts-1 mutant are indicative of its nor- mal role in finely tuning the iron deficiency response, dependent on a functioning E3 ligase domain.Thoughsomedirecttargets of evolutionary descent. We were therefore interested in exploring BTS E3 ligase activity have been identified, the link between these the taxonomic distribution of other proteins similar to BTS in an targets and the phenotypic outputs of the bts-1 mutant is yet to be effort to infer both further functionality of the individual illuminated. domains and potential evolutionary implications of their compo- The BTS ortholog HRZ1 in Oryza sativa has been shown to sition. For a broad overview, the Simple Modular Architecture play a similar role to BTS in iron deficiency. Conserved domain Research Tool (SMART) was used to determine that the specific architecture is likely to indicate both common functionality and domain structure of BTS (3 HHE, one zinc finger CHY, one E3 PLANT SIGNALING & BEHAVIOR e1204508-3 RING, and one zinc ribbon domain) is present only in proteins 16,17 from plant species. In order to confirm and expand on this observation, sequences with significant similarity to the full BTS amino acid sequence were analyzed based on domain structure (Fig. 3A). All BTS orthologs in species ranging from protozoa to animals contain RING, CHY, and zinc ribbon domains, or derivative sequences thereof. Indeed, the C-termi- nus of BTS aligns closely to the key cell cycle regulator Pirh2 (RCHY1) in Homo sapiens and its animal homologs 18,19 (Fig. 3B). The combination of one or more HHE domains with the CHY-RING structure, however, only appears in pho- tosynthetic organisms – mainly green algae and land plants but also in 3 species of red algae (Fig. 3A). It is clear that this combination is of evolutionary importance for plant species since it has appeared early and persisted throughout the evolu- tion of plants. In fact, transcript coding for the BTS ortholog in Chlamydomonas reinhardtii (Cre05.g248550) is induced under iron deficiency, indicating a conserved role for BTS’ plant orthologs in iron deficiency. Iron deficiency is a signifi- cant issue for photosynthetic organisms in particular because of the requirement for iron in chlorophyll biosynthesis and the photosynthetic electron transport chain. BTS orthologs may have evolved as a multifunctional mechanism both to detect and respond to changes in iron availability through regulating the degradation of target proteins. The evolutionary origin of plant HHE domains is difficult to trace beyond photosynthetic organisms. Other examples of HHE domains are found primarily in prokaryotes and invertebrates and in the mammalian F-box and leucine-rich repeat protein5 16,17,21 (FBXL5) family of proteins. BTS is commonly compared to FBXL5 due to key conserved amino acids and some functional 4,14,22,23 similarity in iron regulation. FBXL5 acts with the E3 ligase RBXI as a part of an SCF complex to degrade the iron reg- 9,10,24 ulatory protein IRP2. BTS therefore effectively combines the activity of 2 mammalian proteins as domains in one protein. Despite these similarities, the HHE domains of BTS differ signifi- cantly from the FBXL5 HHE domain, sharing at most 20% iden- tity. The iron-dependent regulation of FBXL5 and BTS is also different – FBXL5 is degraded in the absence of iron and BTS is 4,9 degraded in the presence of iron. Additionally, the RING E3 domain of BTS is more similar to that of Pirh2 (44% identity) than to that of the SCF E3 ligase RBX1 (27%). The CHY domain of Pirh2 and BTS orthologs are also remarkably similar (46%), suggesting some unidentified but important functionality. In ani- mals, the CHY domain is not required for binding or ubiquiti- nating the Pirh2 substrate p53, but may contribute to optimal activity. Interestingly, the Pirh2 amino acids that are predicted to interact with its target p53 (249-256) are almost completely different in BTS (Fig. 3B), indicating that BTS may interact with a different set of target proteins (including the known PYEL pro- teins ). The high similarity of the C-terminus of BTS to the full amino acid sequence of Pirh2 grants more explanation to the Figure 2. Complementation of bts-1 mutant phenotypes with BTS and BTS dele- tion constructs. (A) Root length of 11 day old seedlings (4 d CFe, 7 d C/-Fe). Error unexpected complementation of bts-1 by BTS , a truncated DHHE bars indicate §SE (n D 32) and columns with different letters are significantly dif- protein lacking the entire HHE region of BTS. This BTS DHHE ferent from each other (ANOVA followed by Tukey-Kramer, p < 0.05). (B) Iron protein resembles full Pirh2 in sequence and appears fully func- reductase activity of 10 day old seedlings (7 d CFe, 3 d C/-Fe). Error bars indicate §SE (n D 4) and columns with different letters are significantly different from tional. Based on these analyses, BTS seems more structurally and each other (ANOVA followed by Tukey-Kramer, p<0.05). (C) Image of root length perhaps functionally similar to Pirh2 than to FBXL5. The HHE of 14 day old seedlings (4 d CFe, 10 d -Fe). domains are likely an evolutionary addition that grant more pre- cise and adaptable control of a conserved regulatory mechanism. e1204508-4 A. MATTHIADIS AND T. A. LONG Figure 3. The complete BTS protein domain architecture is observed only in photosynthetic organisms. (A) Phylogenetic tree is composed of species containing protein sequences that align significantly to BTS. Color indicates photosynthetic (green) and non-photosynthetic (gray) species. Symbols beside species name indicate domain composition of the BTS ortholog(s) in that species. The square(s) indicate presence of HHE domain(s) and the triangle indicates presence of CHY, RING, and zinc ribbon domains. Nodes are collapsed (e.g. Fungi) if the majority of contained species have the same protein structure. Domains were predicted using Pfam7 and SMART16,17 domain analysis; derivative structures not fitting algorithm criteria may be present. (B) Alignment of the C-terminus of BTS to full Pirh2 amino acid sequence. Conserved amino acids are colored black and domain regions are indicated with black labels. Zinc coordinating amino acids (all conserved) are colored red and Pirh2 amino acids that interact with p53 are underlined in red. Further examination of the BTS CHY, RING, and zinc ribbon Expression analysis regions in relation to the well-studied Pirh2 protein may help to Total RNA was extracted from the root tissue of 7 day old highlight commonalities and divergent functionality between seedlings (4 d CFe, 3 d -Fe) using the GeneJET Plant RNA Pirh2 and the BTS family of plant proteins. Purification Mini Kit (Thermo Scientific). cDNA was syn- thesized using the SuperScript III First-Strand Synthesis Materials and methods System (Life Technologies). Quantitative Real-Time PCR was conducted using iTaq Universal SYBR Green Supermix Plant lines and growth conditions (Bio-Rad) and the StepOnePlus Real-Time PCR System Mutant bts-1 plants and BBG, BBDHG, and BBDEG lines as (Applied Biosystems). Relative expression was calculated well as growth conditions, experimental setup, and statistics using the comparitive C method normalized to b-tubulin 3,4 for all phenotypic assays were as previously described. using the primers: PLANT SIGNALING & BEHAVIOR e1204508-5 BTS_RT_F (GGACTCAACACTTGATCCGAGGAG) 8. Stenkamp RE. Dioxygen and hemerythrin. Chem Rev 1994;94(3):715– 726; PMID:11539597; http://dx.doi.org/10.1021/cr00027a008 BTS_RT_R (CGGGGAACATCCAAGTTCAACATCACC) 9. Salahudeen AA, Thompson JW, Ruiz JC, Ma HW, Kinch LN, Li bTUB_RT_F (CGACAATGAAGCTCTCTACGA) Q, Grishin NV, Bruick RK. An E3 ligase possessing an iron- bTUB_RT_R (AAGTCACACCGCTCATTGTT) responsive hemerythrin domain is a regulator of iron homeostasis. Science 2009; 326:722-6; PMID:19762597; http://dx.doi.org/ 10.1126/science.1176326 Confocal microscopy 10. Vashisht AA, Zumbrennen KB, Huang X, Powers DN, Durazo A, Sun D, Bhaskaran N, Persson A, Uhlen M, Sangfelt O, et al. Con- Seven day old seedlings (4 d CFe, 3 d -Fe) were imaged with a trol of iron homeostasis by an iron-regulated ubiquitin ligase. Sci- Zeiss LSM 710 microscope using 10 mM propidium iodide to ence 2009; 326:718-21; PMID:19762596; http://dx.doi.org/10.1126/ visualize cell walls. science.1176333 11. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteo- lytic pathway: destruction for the sake of construction. Physiol Phylogenetic tree Rev 2002; 82:373-428; PMID:11917093; http://dx.doi.org/10.1152/ physrev.00027.2001 Sequences were selected using NCBI BLASTP 2.3.1C with all 12. Stone SL, Hauksdottir H, Troy A, Herschleb J, Kraft E, Callis J. Func- non-redundant GenBank CDS translationsCPDBCSwis- tional analysis of the RING-type ubiquitin ligase family of Arabidop- sProtCPIRCPRF excluding environmental samples from WGS sis. Plant Physiol 2005; 137:13-30; PMID:15644464; http://dx.doi.org/ 10.1104/pp.104.052423 projects as of May 2016, using the BTS amino acid sequence and E 7 13. Hardtke CS, Okamoto H, Stoop-Myer C, Deng XW. Biochemical evi- value of less than 1e-20. Domains were predicted using Pfam and dence for ubiquitin ligase activity of the Arabidopsis COP1 interacting 16,17 SMART. Domain classification for the closest BTS ortholog protein 8 (CIP8). Plant J 2002; 30:385-94; PMID:12028569; http://dx. per species was used to color the phylogenetic tree, assembled using doi.org/10.1046/j.1365-313X.2002.01298.x 27,28 29 14. Kobayashi T, Nagasaka S, Senoura T, Itai RN, Nakanishi H, Nish- NCBI Common Tree and visualized using EvolView. izawa NK. Iron-binding haemerythrin RING ubiquitin ligases reg- ulate plant iron responses and accumulation. Nat Commun 2013; 4:1-12. PMID:24253678; http://dx.doi.org/10.1038/ncomms3792 Disclosure of potential confllicts of interest 15. Vogel C, Bashton M, Kerrison ND, Chothia C, Teichmann SA. Struc- No potential conflicts of interest were disclosed. ture, function and evolution of multidomain proteins. Curr Opin Structural Biol 2004; 14:208-16; PMID:15093836; http://dx.doi.org/ 10.1016/j.sbi.2004.03.011 Funding 16. Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc This work was supported by the U.S. National Science Foundation (grant Natl Acad Sci USA 1998; 95:5857-64; PMID:9600884; http://dx.doi. no. MCB1120937). org/10.1073/pnas.95.11.5857 17. Letunic I, Doerks T, Bork P. SMART: recent updates, new develop- ments and status in 2015. Nucleic Acids Res 2015; 43:D257-60; References PMID:25300481; http://dx.doi.org/10.1093/nar/gku949 18. Leng RP, Lin Y, Ma W, Wu H, Lemmers B, Chung S, Parant JM, Loz- 1. Colangelo EP, Guerinot ML. The essential basic helix-loop-helix ano G, Hakem R, Benchimol S. Pirh2, a p53-induced ubiquitin-pro- protein FIT1 is required for the iron deficiency response. Plant tein ligase, promotes p53 degradation. Cell 2003; 112:779-91; Cell 2004; 16:3400-12; PMID:15539473; http://dx.doi.org/10.1105/ PMID:12654245; http://dx.doi.org/10.1016/S0092-8674(03)00193-4 tpc.104.024315 19. Halaby MJ, Hakem R, Hakem A. Pirh2: an E3 ligase with central roles 2. Yuan Y, Wu H, Wang N, Li J, Zhao W, Du J, Wang D, Ling H-Q. in the regulation of cell cycle, DNA damage response, and differentia- FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake gene expression for iron homeostasis in Arabidopsis. Cell tion. Cell Cycle 2013; 12:2733-7; PMID:23966173; http://dx.doi.org/ Res 2008; 18:385-97; PMID:18268542; http://dx.doi.org/10.1038/ 10.4161/cc.25785 cr.2008.26 20. Urzica EI, Casero D, Yamasaki H, Hsieh SI, Adler LN, Karpowicz SJ, Blaby-Haas CE, Clarke SG, Loo JA, Pellegrini M, et al. Systems and 3. Long TA, Tsukagoshi H, Busch W, Lahner B, Salt DE, Benfey PN. The Trans-System Level Analysis Identifies Conserved Iron Deficiency bHLH transcription factor POPEYE regulates response to iron defi- Responses in the Plant Lineage. Plant Cell 2012; 24(10):3921-48; ciency in Arabidopsis roots. Plant Cell 2010; 22:2219-36; PMID:23043051; http://dx.doi.org/10.1105/tpc.112.102491 PMID:20675571; http://dx.doi.org/10.1105/tpc.110.074096 21. French CE, Bell JM, Ward FB. Diversity and distribution of hemery- 4. Selote D, Samira R, Matthiadis A, Gillikin JW, Long TA. Iron- thrin-like proteins in prokaryotes. FEMS Microbiol Lett 2008; binding E3 ligase mediates iron response in plants by targeting basic 279:131-45; PMID:18081840; http://dx.doi.org/10.1111/j.1574- helix-loop-helix transcription factors. Plant Physiol 2015; 167:273-86; 6968.2007.01011.x PMID:25452667; http://dx.doi.org/10.1104/pp.114.250837 22. Hindt MN, Guerinot ML. Getting a sense for signals: regulation of the 5. Zhang J, Liu B, Li M, Feng D, Jin H, Wang P, Liu J, Xiong F, Wang J, plant iron deficiency response. Biochim Biophys Acta 2012; Wang HB. The bHLH transcription factor bHLH104 interacts with 1823:1521-30; PMID:22483849; http://dx.doi.org/10.1016/j.bbamcr. IAA-LEUCINE RESISTANT3 and modulates iron homeostasis in 2012.03.010 Arabidopsis. Plant Cell 2015; 27(3):787-805; PMID:25794933; http:// 23. Kobayashi T, Nishizawa NK. Iron sensors and signals in response to dx.doi.org/10.1105/tpc.114.132704 iron deficiency. Plant Science 2014; 224:36-43; PMID:24908504; 6. Li XL, Zhang HM, Ai Q, Liang G, Yu D. Two bHLH transcription fac- http://dx.doi.org/10.1016/j.plantsci.2014.04.002 tors, bHLH34 and bHLH104, regulate iron homeostasis in arabidopsis 24. Thompson JW, Salahudeen AA, Chollangi S, Ruiz JC, Brautigam CA, thaliana. Plant Physiol 2016; 170(4):2478-93; PMID:26921305; http:// Makris TM, Lipscomb JD, Tomchick DR, Bruick RK. Structural and dx.doi.org/10.1104/pp.15.01827 molecular characterization of iron-sensing hemerythrin-like domain 7. Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter within F-box and leucine-rich repeat protein 5 (FBXL5). J Biol Chem SC, Punta M, Qureshi M, Sangrador-Vegas A, et al. The Pfam protein fam- 2012; 287:7357-65; PMID:22253436; http://dx.doi.org/10.1074/jbc. ilies database: towards a more sustainable future. Nucleic Acids Res 2016; M111.308684 44:D279-85; PMID:26673716; http://dx.doi.org/10.1093/nar/gkv1344 e1204508-6 A. MATTHIADIS AND T. A. LONG 25. Sheng Y, Laister RC, Lemak A, Wu B, Tai E, Duan S, Lukin J, resources of the national center for biotechnology information. Sunnerhagen M, Srisailam S, Karra M, et al. Molecular basis of Pirh2- Nucleic Acids Res 2009; 37:D5-15; PMID:18940862; http://dx.doi.org/ mediated p53 ubiquitylation. Nat Struct Mol Biol 2008; 15:1334-42; 10.1093/nar/gkn741 PMID:19043414; http://dx.doi.org/ http://dx.doi.org/10.1038/nsmb.1521 28. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. Gen- 26. Altschul SF, Madden TL, Sch€afferAA, ZhangJ,Zhang Z, MillerW, Lip- Bank. Nucleic Acids Res 2009; 37:D26-31; PMID:18940867; http://dx. man DJ. Gapped BLAST and PSI-BLAST: a new generation of protein doi.org/10.1093/nar/gkn723 database search programs. Nucleic Acids Res 1997; 25:3389-402; 29. Zhang H, Gao S, Lercher MJ, Hu S, Chen WH. EvolView, an online PMID:9254694; http://dx.doi.org/10.1093/nar/25.17.3389 tool for visualizing, annotating and managing phylogenetic trees. 27. Sayers EW, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin Nucleic Acids Res 2012; 40:W569-72; PMID:22695796; http://dx.doi. V, Church DM, DiCuccio M, Edgar R, Federhen S, et al. Database org/10.1093/nar/gks576 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Signaling & Behavior Taylor & Francis

Further insight into BRUTUS domain composition and functionality

Matthiadis, Anna; Long, Terri A.
Plant Signaling & Behavior , Volume 11 (8): 1 – Aug 2, 2016
Download PDF
6 pages

Loading next page...
 
/lp/taylor-francis/further-insight-into-brutus-domain-composition-and-functionality-DsnofIpF9v

References (34)

Publisher
Taylor & Francis
Copyright
© 2016 The Author(s). Published with license by Taylor & Francis Group, LLC
ISSN
1559-2324
DOI
10.1080/15592324.2016.1204508
Publisher site
See Article on Publisher Site

Abstract

PLANT SIGNALING & BEHAVIOR 2016, VOL. 11, NO. 8, e1204508 (6 pages) http://dx.doi.org/10.1080/15592324.2016.1204508 SHORT COMMUNICATION Anna Matthiadis and Terri A. Long Department of Plant and Microbial Biology, North Carolina State University, Raleigh, NC, USA ABSTRACT ARTICLE HISTORY Received 3 June 2016 BRUTUS (BTS) is a hemerythrin (HHE) domain containing E3 ligase that facilitates the degradation of Accepted 17 June 2016 POPEYE-like (PYEL) proteins in a proteasomal-dependent manner. Deletion of BTS HHE domains enhances BTS stability in the presence of iron and also complements loss of BTS function, suggesting that the HHE KEYWORDS domains are critical for protein stability but not for enzymatic function. The RING E3 domain plays an Arabidopsis thaliana; BRUTUS essential role in BTS’ capacity to both interact with PYEL proteins and to act as an E3 ligase. Here we show (BTS); hemerythrin (HHE); that removal of the RING domain does not complement loss of BTS function. We conclude that enzymatic iron homeostasis; activity of BTS via the RING domain is essential for response to iron deficiency in plants. Further, we multidomain protein; Pirh2; RING E3 analyze possible BTS domain structure evolution and predict that the combination of domains found in BTS is specific to photosynthetic organisms, potentially indicative of a role for BTS and its orthologs in mitigating the iron-related challenges presented by photosynthesis. Iron (Fe) is an essential micronutrient for many key processes BTS encodes a multi-domain protein with 3 hemerythrin in plants. In response to iron deprivation, plants activate a (HHE) domains and a RING domain flanked by a CHY- well-known series of responses that mediate iron uptake from type zinc finger and a zinc ribbon domain. The HHE the surrounding rhizosphere. In most dicots these responses domains are left-twisted 4-a-helical bundles that, in marine include acidification of the rhizosphere, reduction of ferric iron invertebrates and the mammalian iron homeostasis protein to ferrous iron, and subsequent uptake of ferrous iron into root FBXL5, provide a hydrophobic pocket wherein diiron binds 8-10 epidermal cells. Following uptake, iron is bound to various che- oxygen. Correspondingly, we found that the BTS HHE lators, transported through the vasculature, and translocated domains also bind both iron and zinc. We expressed from the root to shoot and sink tissues. Two regulatory path- recombinant GFP tagged BTS lacking all 3 of the HHE ways controlled by bHLH transcription factors have been domains (BTS ) and driven by the native BTS promoter DHHE shown to mediate these responses in Arabidopsis thaliana. The (BBDHG) in bts-1 mutants and found that removal of the bHLH transcription factor FIT controls the initialization of the HHE domains does not affect the ability of the truncated iron deficiency response by directly and indirectly controlling protein to complement bts-1 phenotypes including root the expression of genes involved in rhizosphere acidification, length and iron reductase activity. Moreover, while full- 1,2 ferric reduction, and ferrous iron uptake. The bHLH tran- length recombinant BTS synthesized by in vitro translation scription factor POPEYE (PYE) mediates control by directly using a wheat germ system exhibits decreased stability in regulating the expression of genes involved in intercellular the presence of increasing concentrations of soluble iron, transport, mitochondrial ferric reduction, and other processes. recombinant BTS protein maintains stability regardless DHHE PYE physically interacts with PYE-like (PYEL) proteins includ- of iron concentration. We also observed enhanced accumu- ing bHLH104, ILR3, and bHLH115; and several PYEL proteins lation of BTS protein in planta by analyzing transgenic DHHE 4-6 directly target PYE transcriptionally. Similar to PYE, loss of bts-1 mutants transformed with either BBG (pBTS::BTS- PYEL expression leads to decreased tolerance to iron defi- GFP) or BBDHG (pBTS:: BTS -GFP) constructs. These DHHE 5,6 ciency, suggesting that PYE and PYEL proteins may have findings suggest that the presence of the HHE domains con- somewhat redundant functions. While PYE and PYEL proteins fers protein instability upon binding of iron. physically interact, only PYEL proteins have been shown to The presence of an E3 RING-H2 domain near the C- interact with a third protein, BRUTUS (BTS). BTS, similar to terminus of BTS suggested that BTS may act as an E3 ligase. PYE and PYELs, is induced transcriptionally in response to E3 ligases catalyze the final step in the ubiquitination of an 3,4 iron deprivation. Unlike pye and pyel loss of function interacting E3 substrate. Ubiquitination targets proteins for mutants, bts mutants that exhibit decreased induction of BTS degradation via the 26S proteasome. Initially, ubiquitin is acti- expression under iron deficiency show increased tolerance to vated by ATP and transferred via a ubiquitin-activating enzyme 3,4 iron deprivation. Thus, BTS and PYE/PYEL proteins act in (E1) to a ubiquitin-conjugating enzyme (E2), generating E2 11,12 opposing manners to control the iron deficiency response. thioesterified with ubiquitin (E2-Ub). Ubiquitin-ligating CONTACT Terri A. Long [email protected], [email protected] North Carolina State University, Department of Plant and Microbial Biology, Raleigh, NC, USA Published with license by Taylor & Francis Group, LLC © Anna Matthiadis and Terri A. Long This is an Open Access article distributed under the terms of the Creative Commons Attribution-Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The moral rights of the named author(s) have been asserted. e1204508-2 A. MATTHIADIS AND T. A. LONG enzymes (E3), including members of the RING H2 family, bind both a targeting substrate and E2-Ub and facilitate the transfer of the ubiquitin from the E2-Ub to the substrate. RING domains alone purified from diverse enzymes have been shown to demonstrate intrinsic E3 ligase activity in the presence of a 12,13 conjugating E1, E2, ubiquitin, and ATP. We have shown that full length in vitro translated and purified BTS protein exhibits E3 ligase capacity. We also showed that this E3 capacity is able to affect the stability of 2 BTS targets – the PYEL proteins ILR3 and bHLH115. Strikingly, deletion of the BTS HHE region confers apparent increased E3 ligase functional- ity in vitro and enhanced ability to facilitate the degradation of PYEL proteins in cell free degradation assays due to increased pro- tein stability. These findings indicate that the BTS HHE domains play a critical role in the stability of the protein, which increases the accumulation of BTS and therefore E3 activity in vitro.How- ever, the role of the E3 domain alone in mediating iron deficiency responses and protein stability has not yet been explored. Here, to further explore the role of the BTS E3 domain, we expressed recombinant GFP tagged BTS lacking the E3 domain (BTS ) and driven by the native BTS promoter DE3 (BBDEG) in bts-1 mutants. We first identified several bts-1 mutant lines expressing BBDEG and chose to focus on line 6-1 with expression at levels most comparable to previously published lines expressing full length BTS (BBG 1-2) and BTS lacking the HHE domains (BBDHG 3-3) (Fig. 1A). We used confocal analysis to confirm that structurally via- ble protein is produced and to identify any effects on stabil- ity. Accumulation of the BTS protein is similar to that of DE3 full length BTS; both proteins accumulate minimally even under iron deficiency in contrast to the previously pub- lished more stable BTS protein (Fig. 1B). These find- DHHE ings indicate that while the HHE domains facilitate degradation of BTS protein, the E3 domain does not appear to play a critical role in BTS stability. Next, we examined the capacity of the BBDEG construct to complement bts-1 mutant phenotypes. We found that, unlike full length BTS and BBDHG, expression of BBDEG in a bts-1 mutant background results in root length (Fig. 2A, C)and iron reductase activity (Fig. 2B)not significantly different from that of the bts-1 mutant under iron deficiency, indicating that the BTS protein DE3 is not functional in fulfilling BTS’ typical iron homeostasis roles. The presence of the BTS E3 RING domain is therefore critical for BTS’ ability to repress several classical responses to iron deficiency. Figure 1. Expression and stability of BTS and BTS deletion constructs. (A) Relative Since loss of the E3 domain inhibits the ability of BTS to facilitate BTS expression in root tissue of 7 day old seedlings (4 d CFe, 3 d -Fe). Error bars ubiquitin formation in vitro and to interact with the target proteins indicate §SE (n D 3) and columns with different letters are significantly different ILR3 and bHLH115, the primary role of the BTS E3 domain is from each other (ANOVA followed by Tukey-Kramer, p < 0.05). (B) Confocal microscopy images of roots of 7 day old bts-1 seedlings (4 d CFe, 3 d -Fe) express- likely to facilitate the ubiquitination and subsequent degradation ing pBTS::BTS-GFP (BBG), pBTS::BTSDHHE-GFP (BBDHG), and pBTS::BTSDE3-GFP of target substrates independent of the function of the HHE stained with propidium iodide (red). Scale bars D 50 mm. Results shown represent domains. This provides further evidence that the overall physio- at least 3 independent assays. logical differences seen in the bts-1 mutant are indicative of its nor- mal role in finely tuning the iron deficiency response, dependent on a functioning E3 ligase domain.Thoughsomedirecttargets of evolutionary descent. We were therefore interested in exploring BTS E3 ligase activity have been identified, the link between these the taxonomic distribution of other proteins similar to BTS in an targets and the phenotypic outputs of the bts-1 mutant is yet to be effort to infer both further functionality of the individual illuminated. domains and potential evolutionary implications of their compo- The BTS ortholog HRZ1 in Oryza sativa has been shown to sition. For a broad overview, the Simple Modular Architecture play a similar role to BTS in iron deficiency. Conserved domain Research Tool (SMART) was used to determine that the specific architecture is likely to indicate both common functionality and domain structure of BTS (3 HHE, one zinc finger CHY, one E3 PLANT SIGNALING & BEHAVIOR e1204508-3 RING, and one zinc ribbon domain) is present only in proteins 16,17 from plant species. In order to confirm and expand on this observation, sequences with significant similarity to the full BTS amino acid sequence were analyzed based on domain structure (Fig. 3A). All BTS orthologs in species ranging from protozoa to animals contain RING, CHY, and zinc ribbon domains, or derivative sequences thereof. Indeed, the C-termi- nus of BTS aligns closely to the key cell cycle regulator Pirh2 (RCHY1) in Homo sapiens and its animal homologs 18,19 (Fig. 3B). The combination of one or more HHE domains with the CHY-RING structure, however, only appears in pho- tosynthetic organisms – mainly green algae and land plants but also in 3 species of red algae (Fig. 3A). It is clear that this combination is of evolutionary importance for plant species since it has appeared early and persisted throughout the evolu- tion of plants. In fact, transcript coding for the BTS ortholog in Chlamydomonas reinhardtii (Cre05.g248550) is induced under iron deficiency, indicating a conserved role for BTS’ plant orthologs in iron deficiency. Iron deficiency is a signifi- cant issue for photosynthetic organisms in particular because of the requirement for iron in chlorophyll biosynthesis and the photosynthetic electron transport chain. BTS orthologs may have evolved as a multifunctional mechanism both to detect and respond to changes in iron availability through regulating the degradation of target proteins. The evolutionary origin of plant HHE domains is difficult to trace beyond photosynthetic organisms. Other examples of HHE domains are found primarily in prokaryotes and invertebrates and in the mammalian F-box and leucine-rich repeat protein5 16,17,21 (FBXL5) family of proteins. BTS is commonly compared to FBXL5 due to key conserved amino acids and some functional 4,14,22,23 similarity in iron regulation. FBXL5 acts with the E3 ligase RBXI as a part of an SCF complex to degrade the iron reg- 9,10,24 ulatory protein IRP2. BTS therefore effectively combines the activity of 2 mammalian proteins as domains in one protein. Despite these similarities, the HHE domains of BTS differ signifi- cantly from the FBXL5 HHE domain, sharing at most 20% iden- tity. The iron-dependent regulation of FBXL5 and BTS is also different – FBXL5 is degraded in the absence of iron and BTS is 4,9 degraded in the presence of iron. Additionally, the RING E3 domain of BTS is more similar to that of Pirh2 (44% identity) than to that of the SCF E3 ligase RBX1 (27%). The CHY domain of Pirh2 and BTS orthologs are also remarkably similar (46%), suggesting some unidentified but important functionality. In ani- mals, the CHY domain is not required for binding or ubiquiti- nating the Pirh2 substrate p53, but may contribute to optimal activity. Interestingly, the Pirh2 amino acids that are predicted to interact with its target p53 (249-256) are almost completely different in BTS (Fig. 3B), indicating that BTS may interact with a different set of target proteins (including the known PYEL pro- teins ). The high similarity of the C-terminus of BTS to the full amino acid sequence of Pirh2 grants more explanation to the Figure 2. Complementation of bts-1 mutant phenotypes with BTS and BTS dele- tion constructs. (A) Root length of 11 day old seedlings (4 d CFe, 7 d C/-Fe). Error unexpected complementation of bts-1 by BTS , a truncated DHHE bars indicate §SE (n D 32) and columns with different letters are significantly dif- protein lacking the entire HHE region of BTS. This BTS DHHE ferent from each other (ANOVA followed by Tukey-Kramer, p < 0.05). (B) Iron protein resembles full Pirh2 in sequence and appears fully func- reductase activity of 10 day old seedlings (7 d CFe, 3 d C/-Fe). Error bars indicate §SE (n D 4) and columns with different letters are significantly different from tional. Based on these analyses, BTS seems more structurally and each other (ANOVA followed by Tukey-Kramer, p<0.05). (C) Image of root length perhaps functionally similar to Pirh2 than to FBXL5. The HHE of 14 day old seedlings (4 d CFe, 10 d -Fe). domains are likely an evolutionary addition that grant more pre- cise and adaptable control of a conserved regulatory mechanism. e1204508-4 A. MATTHIADIS AND T. A. LONG Figure 3. The complete BTS protein domain architecture is observed only in photosynthetic organisms. (A) Phylogenetic tree is composed of species containing protein sequences that align significantly to BTS. Color indicates photosynthetic (green) and non-photosynthetic (gray) species. Symbols beside species name indicate domain composition of the BTS ortholog(s) in that species. The square(s) indicate presence of HHE domain(s) and the triangle indicates presence of CHY, RING, and zinc ribbon domains. Nodes are collapsed (e.g. Fungi) if the majority of contained species have the same protein structure. Domains were predicted using Pfam7 and SMART16,17 domain analysis; derivative structures not fitting algorithm criteria may be present. (B) Alignment of the C-terminus of BTS to full Pirh2 amino acid sequence. Conserved amino acids are colored black and domain regions are indicated with black labels. Zinc coordinating amino acids (all conserved) are colored red and Pirh2 amino acids that interact with p53 are underlined in red. Further examination of the BTS CHY, RING, and zinc ribbon Expression analysis regions in relation to the well-studied Pirh2 protein may help to Total RNA was extracted from the root tissue of 7 day old highlight commonalities and divergent functionality between seedlings (4 d CFe, 3 d -Fe) using the GeneJET Plant RNA Pirh2 and the BTS family of plant proteins. Purification Mini Kit (Thermo Scientific). cDNA was syn- thesized using the SuperScript III First-Strand Synthesis Materials and methods System (Life Technologies). Quantitative Real-Time PCR was conducted using iTaq Universal SYBR Green Supermix Plant lines and growth conditions (Bio-Rad) and the StepOnePlus Real-Time PCR System Mutant bts-1 plants and BBG, BBDHG, and BBDEG lines as (Applied Biosystems). Relative expression was calculated well as growth conditions, experimental setup, and statistics using the comparitive C method normalized to b-tubulin 3,4 for all phenotypic assays were as previously described. using the primers: PLANT SIGNALING & BEHAVIOR e1204508-5 BTS_RT_F (GGACTCAACACTTGATCCGAGGAG) 8. Stenkamp RE. Dioxygen and hemerythrin. Chem Rev 1994;94(3):715– 726; PMID:11539597; http://dx.doi.org/10.1021/cr00027a008 BTS_RT_R (CGGGGAACATCCAAGTTCAACATCACC) 9. Salahudeen AA, Thompson JW, Ruiz JC, Ma HW, Kinch LN, Li bTUB_RT_F (CGACAATGAAGCTCTCTACGA) Q, Grishin NV, Bruick RK. An E3 ligase possessing an iron- bTUB_RT_R (AAGTCACACCGCTCATTGTT) responsive hemerythrin domain is a regulator of iron homeostasis. Science 2009; 326:722-6; PMID:19762597; http://dx.doi.org/ 10.1126/science.1176326 Confocal microscopy 10. Vashisht AA, Zumbrennen KB, Huang X, Powers DN, Durazo A, Sun D, Bhaskaran N, Persson A, Uhlen M, Sangfelt O, et al. Con- Seven day old seedlings (4 d CFe, 3 d -Fe) were imaged with a trol of iron homeostasis by an iron-regulated ubiquitin ligase. Sci- Zeiss LSM 710 microscope using 10 mM propidium iodide to ence 2009; 326:718-21; PMID:19762596; http://dx.doi.org/10.1126/ visualize cell walls. science.1176333 11. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteo- lytic pathway: destruction for the sake of construction. Physiol Phylogenetic tree Rev 2002; 82:373-428; PMID:11917093; http://dx.doi.org/10.1152/ physrev.00027.2001 Sequences were selected using NCBI BLASTP 2.3.1C with all 12. Stone SL, Hauksdottir H, Troy A, Herschleb J, Kraft E, Callis J. Func- non-redundant GenBank CDS translationsCPDBCSwis- tional analysis of the RING-type ubiquitin ligase family of Arabidop- sProtCPIRCPRF excluding environmental samples from WGS sis. Plant Physiol 2005; 137:13-30; PMID:15644464; http://dx.doi.org/ 10.1104/pp.104.052423 projects as of May 2016, using the BTS amino acid sequence and E 7 13. Hardtke CS, Okamoto H, Stoop-Myer C, Deng XW. Biochemical evi- value of less than 1e-20. Domains were predicted using Pfam and dence for ubiquitin ligase activity of the Arabidopsis COP1 interacting 16,17 SMART. Domain classification for the closest BTS ortholog protein 8 (CIP8). Plant J 2002; 30:385-94; PMID:12028569; http://dx. per species was used to color the phylogenetic tree, assembled using doi.org/10.1046/j.1365-313X.2002.01298.x 27,28 29 14. Kobayashi T, Nagasaka S, Senoura T, Itai RN, Nakanishi H, Nish- NCBI Common Tree and visualized using EvolView. izawa NK. Iron-binding haemerythrin RING ubiquitin ligases reg- ulate plant iron responses and accumulation. Nat Commun 2013; 4:1-12. PMID:24253678; http://dx.doi.org/10.1038/ncomms3792 Disclosure of potential confllicts of interest 15. Vogel C, Bashton M, Kerrison ND, Chothia C, Teichmann SA. Struc- No potential conflicts of interest were disclosed. ture, function and evolution of multidomain proteins. Curr Opin Structural Biol 2004; 14:208-16; PMID:15093836; http://dx.doi.org/ 10.1016/j.sbi.2004.03.011 Funding 16. Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc This work was supported by the U.S. National Science Foundation (grant Natl Acad Sci USA 1998; 95:5857-64; PMID:9600884; http://dx.doi. no. MCB1120937). org/10.1073/pnas.95.11.5857 17. Letunic I, Doerks T, Bork P. SMART: recent updates, new develop- ments and status in 2015. Nucleic Acids Res 2015; 43:D257-60; References PMID:25300481; http://dx.doi.org/10.1093/nar/gku949 18. Leng RP, Lin Y, Ma W, Wu H, Lemmers B, Chung S, Parant JM, Loz- 1. Colangelo EP, Guerinot ML. The essential basic helix-loop-helix ano G, Hakem R, Benchimol S. Pirh2, a p53-induced ubiquitin-pro- protein FIT1 is required for the iron deficiency response. Plant tein ligase, promotes p53 degradation. Cell 2003; 112:779-91; Cell 2004; 16:3400-12; PMID:15539473; http://dx.doi.org/10.1105/ PMID:12654245; http://dx.doi.org/10.1016/S0092-8674(03)00193-4 tpc.104.024315 19. Halaby MJ, Hakem R, Hakem A. Pirh2: an E3 ligase with central roles 2. Yuan Y, Wu H, Wang N, Li J, Zhao W, Du J, Wang D, Ling H-Q. in the regulation of cell cycle, DNA damage response, and differentia- FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake gene expression for iron homeostasis in Arabidopsis. Cell tion. Cell Cycle 2013; 12:2733-7; PMID:23966173; http://dx.doi.org/ Res 2008; 18:385-97; PMID:18268542; http://dx.doi.org/10.1038/ 10.4161/cc.25785 cr.2008.26 20. Urzica EI, Casero D, Yamasaki H, Hsieh SI, Adler LN, Karpowicz SJ, Blaby-Haas CE, Clarke SG, Loo JA, Pellegrini M, et al. Systems and 3. Long TA, Tsukagoshi H, Busch W, Lahner B, Salt DE, Benfey PN. The Trans-System Level Analysis Identifies Conserved Iron Deficiency bHLH transcription factor POPEYE regulates response to iron defi- Responses in the Plant Lineage. Plant Cell 2012; 24(10):3921-48; ciency in Arabidopsis roots. Plant Cell 2010; 22:2219-36; PMID:23043051; http://dx.doi.org/10.1105/tpc.112.102491 PMID:20675571; http://dx.doi.org/10.1105/tpc.110.074096 21. French CE, Bell JM, Ward FB. Diversity and distribution of hemery- 4. Selote D, Samira R, Matthiadis A, Gillikin JW, Long TA. Iron- thrin-like proteins in prokaryotes. FEMS Microbiol Lett 2008; binding E3 ligase mediates iron response in plants by targeting basic 279:131-45; PMID:18081840; http://dx.doi.org/10.1111/j.1574- helix-loop-helix transcription factors. Plant Physiol 2015; 167:273-86; 6968.2007.01011.x PMID:25452667; http://dx.doi.org/10.1104/pp.114.250837 22. Hindt MN, Guerinot ML. Getting a sense for signals: regulation of the 5. Zhang J, Liu B, Li M, Feng D, Jin H, Wang P, Liu J, Xiong F, Wang J, plant iron deficiency response. Biochim Biophys Acta 2012; Wang HB. The bHLH transcription factor bHLH104 interacts with 1823:1521-30; PMID:22483849; http://dx.doi.org/10.1016/j.bbamcr. IAA-LEUCINE RESISTANT3 and modulates iron homeostasis in 2012.03.010 Arabidopsis. Plant Cell 2015; 27(3):787-805; PMID:25794933; http:// 23. Kobayashi T, Nishizawa NK. Iron sensors and signals in response to dx.doi.org/10.1105/tpc.114.132704 iron deficiency. Plant Science 2014; 224:36-43; PMID:24908504; 6. Li XL, Zhang HM, Ai Q, Liang G, Yu D. Two bHLH transcription fac- http://dx.doi.org/10.1016/j.plantsci.2014.04.002 tors, bHLH34 and bHLH104, regulate iron homeostasis in arabidopsis 24. Thompson JW, Salahudeen AA, Chollangi S, Ruiz JC, Brautigam CA, thaliana. Plant Physiol 2016; 170(4):2478-93; PMID:26921305; http:// Makris TM, Lipscomb JD, Tomchick DR, Bruick RK. Structural and dx.doi.org/10.1104/pp.15.01827 molecular characterization of iron-sensing hemerythrin-like domain 7. Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter within F-box and leucine-rich repeat protein 5 (FBXL5). J Biol Chem SC, Punta M, Qureshi M, Sangrador-Vegas A, et al. The Pfam protein fam- 2012; 287:7357-65; PMID:22253436; http://dx.doi.org/10.1074/jbc. ilies database: towards a more sustainable future. Nucleic Acids Res 2016; M111.308684 44:D279-85; PMID:26673716; http://dx.doi.org/10.1093/nar/gkv1344 e1204508-6 A. MATTHIADIS AND T. A. LONG 25. Sheng Y, Laister RC, Lemak A, Wu B, Tai E, Duan S, Lukin J, resources of the national center for biotechnology information. Sunnerhagen M, Srisailam S, Karra M, et al. Molecular basis of Pirh2- Nucleic Acids Res 2009; 37:D5-15; PMID:18940862; http://dx.doi.org/ mediated p53 ubiquitylation. Nat Struct Mol Biol 2008; 15:1334-42; 10.1093/nar/gkn741 PMID:19043414; http://dx.doi.org/ http://dx.doi.org/10.1038/nsmb.1521 28. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. Gen- 26. Altschul SF, Madden TL, Sch€afferAA, ZhangJ,Zhang Z, MillerW, Lip- Bank. Nucleic Acids Res 2009; 37:D26-31; PMID:18940867; http://dx. man DJ. Gapped BLAST and PSI-BLAST: a new generation of protein doi.org/10.1093/nar/gkn723 database search programs. Nucleic Acids Res 1997; 25:3389-402; 29. Zhang H, Gao S, Lercher MJ, Hu S, Chen WH. EvolView, an online PMID:9254694; http://dx.doi.org/10.1093/nar/25.17.3389 tool for visualizing, annotating and managing phylogenetic trees. 27. Sayers EW, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin Nucleic Acids Res 2012; 40:W569-72; PMID:22695796; http://dx.doi. V, Church DM, DiCuccio M, Edgar R, Federhen S, et al. Database org/10.1093/nar/gks576

Journal

Plant Signaling & Behavior – Taylor & Francis

Published: Aug 2, 2016

Keywords: Arabidopsis thaliana; BRUTUS (BTS); hemerythrin (HHE); iron homeostasis; multidomain protein; Pirh2; RING E3

There are no references for this article.