Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Small cytoplasmic Ro RNA pseudogene and an Alu repeat in the human α-1 globin gene

Small cytoplasmic Ro RNA pseudogene and an Alu repeat in the human α-1 globin gene Downloaded from https://academic.oup.com/nar/article/16/2/766/1083262 by DeepDyve user on 14 August 2020 Volume 16 Number 2 1988 Nucleic Acid s Research Small cytoplasnuc Ro RNA pseudogene and a n Alu repeat in the human a-1 globin gene Jerzy Jurka, Temple F.Smith1 and Damian Labuda2 Bionet, 700 East Q Camino Real, Mountain View, CA 94040, 'Dana-Farber Cancer Institute, Harvard University, 44 Binney Street, Boston, MA 02115, USA and 'Medical Genetka, Hopital Sainte-Justine, 3175 Cote Saime-Catherine, Montreal, Quebec H3T 1C5, Canada Submitted November 6, 1987 The 5'-end of the previously studied Alu repeat from the al-globin gene (1) is flanked by a sequence 80% similar to one of the full length human small cytoplasmic Ro RNAs (Fig. la), denoted as HY3 (2). This is the first known example of a pseudogene for the Ro scRNA. Only a few such pseudogenes arc expected to exist in the human genome (2). The pseudogene location next to the Alu sequence may suggest physical interactions between HY3-like RNA and the Alu RNA prior to the reverse transcription. The 3'-flanking region of the previously studied full size Alu repeat is another unreported Alu sequence truncated at the Eco RI restriction site (Fig. lb). In vitro transcription of the region analysed (1) gave four RNA fragments. One of them, 86 nt long, is synthesized from the short class III transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAATTGATCACAACCAGTTA 50 *******! ********) * * *******|********** ********* 3' -al GGCTGGTTGGAGTGCAGCGCTTTTTACAATTAATTGATCAGAACCAGTTA 52 (a) HY3 CAGATTTCTTTGTTCCTTCTCCACTCCCACTGCTTCACTTGACT-AGCCTTT 101 1*1**** *, ***************||******** ****** ***** 3'-al TAAATTTATCATTTCCTTCTCCACTCCTGCTGCTTCAGTTGACTAAGCCTAA 104 promoter GTGGCNNAGTGG Alu GGCCGGGCGCGGTGG-CTCACGCCTGTAATCCCAGCACTTTGGGAGGCCG 49 **| ****|*|**** *****************************|***| 3'-al GGTTGGGCACAGTGGCCTCACGCCTGTAATCCCAGCACTTTGGGAAGCCA 471 (b) promoter GGGTTCGANNCC Alu AGGCGGGCGGATCACCTGAGGTCAGGAGTTC 80 ***,****!****** |*********|*** 3'-al AGGTGGGCAGATCAC—AAGGTCAGGAATTC 500 Fig. 1. (a) Sequence alignment between HY3 (2) and the corresponding 3'-al-globin region (1). Putative polymerse i n promoter is indicated, (b) Genomic Alu consensus (4), aligned to the 3'-al-globin sequence at positions 423-500. Promoter boxes (5) are indicated. Sequences and numbering of the 3'-al-globin region are identical to those in (1). Exact matches (*), purine-purine/pyrimidine-pyrimidine replacements (I), and gaps (-) are indicated in both alignments. REFERENCES (1) Shen, C.-KJ. and Maniatis, T. (1982) J. Mol. Appl. Gen. 1, 343-360. (2) Wolin, S.L. and Steitz, J.A. (1983) Cell 32, 735-744. (3) Hess, J., et al. (1985) J. Mol. Biol. 184, 7-21. (4) Schmid, C.W. and Shen, C.-K.J. (1985) in Molecular Evolutionary Genetics (Mclntyre, R.J. ed.), pp. 323-358. Plenum Publishing. New York. (5) Fowlkes, D.M. and Shenk, T. (1980) Cell 22, 405-413. 766 © IRLPre» Limited, Oxford, England. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Small cytoplasmic Ro RNA pseudogene and an Alu repeat in the human α-1 globin gene

Download PDF
1 page

Loading next page...
 
/lp/oxford-university-press/small-cytoplasmic-ro-rna-pseudogene-and-an-alu-repeat-in-the-human-1-8IucG3qVEg

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Oxford University Press
Copyright
© IRL Press Limited, Oxford, England
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/16.2.766
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article/16/2/766/1083262 by DeepDyve user on 14 August 2020 Volume 16 Number 2 1988 Nucleic Acid s Research Small cytoplasnuc Ro RNA pseudogene and a n Alu repeat in the human a-1 globin gene Jerzy Jurka, Temple F.Smith1 and Damian Labuda2 Bionet, 700 East Q Camino Real, Mountain View, CA 94040, 'Dana-Farber Cancer Institute, Harvard University, 44 Binney Street, Boston, MA 02115, USA and 'Medical Genetka, Hopital Sainte-Justine, 3175 Cote Saime-Catherine, Montreal, Quebec H3T 1C5, Canada Submitted November 6, 1987 The 5'-end of the previously studied Alu repeat from the al-globin gene (1) is flanked by a sequence 80% similar to one of the full length human small cytoplasmic Ro RNAs (Fig. la), denoted as HY3 (2). This is the first known example of a pseudogene for the Ro scRNA. Only a few such pseudogenes arc expected to exist in the human genome (2). The pseudogene location next to the Alu sequence may suggest physical interactions between HY3-like RNA and the Alu RNA prior to the reverse transcription. The 3'-flanking region of the previously studied full size Alu repeat is another unreported Alu sequence truncated at the Eco RI restriction site (Fig. lb). In vitro transcription of the region analysed (1) gave four RNA fragments. One of them, 86 nt long, is synthesized from the short class III transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAATTGATCACAACCAGTTA 50 *******! ********) * * *******|********** ********* 3' -al GGCTGGTTGGAGTGCAGCGCTTTTTACAATTAATTGATCAGAACCAGTTA 52 (a) HY3 CAGATTTCTTTGTTCCTTCTCCACTCCCACTGCTTCACTTGACT-AGCCTTT 101 1*1**** *, ***************||******** ****** ***** 3'-al TAAATTTATCATTTCCTTCTCCACTCCTGCTGCTTCAGTTGACTAAGCCTAA 104 promoter GTGGCNNAGTGG Alu GGCCGGGCGCGGTGG-CTCACGCCTGTAATCCCAGCACTTTGGGAGGCCG 49 **| ****|*|**** *****************************|***| 3'-al GGTTGGGCACAGTGGCCTCACGCCTGTAATCCCAGCACTTTGGGAAGCCA 471 (b) promoter GGGTTCGANNCC Alu AGGCGGGCGGATCACCTGAGGTCAGGAGTTC 80 ***,****!****** |*********|*** 3'-al AGGTGGGCAGATCAC—AAGGTCAGGAATTC 500 Fig. 1. (a) Sequence alignment between HY3 (2) and the corresponding 3'-al-globin region (1). Putative polymerse i n promoter is indicated, (b) Genomic Alu consensus (4), aligned to the 3'-al-globin sequence at positions 423-500. Promoter boxes (5) are indicated. Sequences and numbering of the 3'-al-globin region are identical to those in (1). Exact matches (*), purine-purine/pyrimidine-pyrimidine replacements (I), and gaps (-) are indicated in both alignments. REFERENCES (1) Shen, C.-KJ. and Maniatis, T. (1982) J. Mol. Appl. Gen. 1, 343-360. (2) Wolin, S.L. and Steitz, J.A. (1983) Cell 32, 735-744. (3) Hess, J., et al. (1985) J. Mol. Biol. 184, 7-21. (4) Schmid, C.W. and Shen, C.-K.J. (1985) in Molecular Evolutionary Genetics (Mclntyre, R.J. ed.), pp. 323-358. Plenum Publishing. New York. (5) Fowlkes, D.M. and Shenk, T. (1980) Cell 22, 405-413. 766 © IRLPre» Limited, Oxford, England.

Journal

Nucleic Acids Research – Oxford University Press

Published: Jan 25, 1988

There are no references for this article.