Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/unpaywall/reciprocal-effects-of-stat5-and-stat3-in-breast-cancer-7dOm916jF0
References (50)
-
M. Nevalainen, Jianwu Xie, J. Torhorst, L. Bubendorf, Philippe Haas, J. Kononen, G. Sauter, H. Rui (2004)
Signal transducer and activator of transcription-5 activation and breast cancer prognosis.Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 22 11
-
J. Bromberg (2000)
Signal transducers and activators of transcription as regulators of growth, apoptosis and breast developmentBreast Cancer Research : BCR, 2
-
James Alvarez, P. Febbo, Sridhar Ramaswamy, M. Loda, A. Richardson, D. Frank (2005)
Identification of a genetic signature of activated signal transducer and activator of transcription 3 in human tumors.Cancer research, 65 12
-
S. Tworoger, P. Sluss, S. Hankinson (2006)
Association between plasma prolactin concentrations and risk of breast cancer among predominately premenopausal women.Cancer research, 66 4
-
T. Battle, D. Frank (2003)
STAT1 mediates differentiation of chronic lymphocytic leukemia cells in response to Bryostatin 1.Blood, 102 8
-
T. Matsuda, Takanori Nakamura, K. Nakao, T. Arai, M. Katsuki, Toshio Heike, T. Yokota (1999)
STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cellsThe EMBO Journal, 18
-
Cheng Li, W. Wong (2003)
DNA-Chip Analyzer (dChip) -
Xiaoyang Ling, R. Arlinghaus (2005)
Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice.Cancer research, 65 7
-
Suresh Logarajah, Patricia Hunter, Matthew Kraman, D. Steele, S. Lakhani, L. Bobrow, A. Venkitaraman, S. Wagner (2003)
BCL-6 is expressed in breast cancer and prevents mammary epithelial differentiationOncogene, 22
-
O. Margalit, Hila Amram, N. Amariglio, A. Simon, S. Shaklai, G. Granot, Neri Minsky, A. Shimoni, A. Harmelin, D. Givol, M. Shohat, M. Oren, G. Rechavi (2005)
BCL6 is regulated by p53 through a response element frequently disrupted in B-cell non-Hodgkin lymphoma.Blood, 107 4
-
J. Darnell (1997)
STATs and gene regulation.Science, 277 5332
-
R. Lynch, J. Etchin, T. Battle, D. Frank (2007)
A small-molecule enhancer of signal transducer and activator of transcription 1 transcriptional activity accentuates the antiproliferative effects of IFN-gamma in human cancer cells.Cancer research, 67 3
-
H. Niwa, T. Burdon, I. Chambers, Austin Smith (1998)
Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3.Genes & development, 12 13
-
A. Richardson, Z. Wang, Arcangela Nicolo, Xin Lu, Myles Brown, A. Miron, Xiaodong Liao, J. Iglehart, D. Livingston, Shridar Ganesan (2006)
X chromosomal abnormalities in basal-like human breast cancer.Cancer cell, 9 2
-
Xiuwen Liu, G. Robinson, Fabrice Gouilleux, Bernd Groner, Lothar Hennighausen (1995)
Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue.Proceedings of the National Academy of Sciences of the United States of America, 92 19
-
S. Teglund, C. Mckay, E. Schuetz, J. Deursen, D. Stravopodis, Demin Wang, Michael Brown, S. Bodner, G. Grosveld, J. Ihle (1998)
Stat5a and Stat5b Proteins Have Essential and Nonessential, or Redundant, Roles in Cytokine ResponsesCell, 93
-
M. Saito, Jie Gao, K. Basso, Y. Kitagawa, P. Smith, G. Bhagat, A. Pernis, L. Pasqualucci, R. Dalla-Favera (2007)
A signaling pathway mediating downregulation of BCL6 in germinal center B cells is blocked by BCL6 gene alterations in B cell lymphoma.Cancer cell, 12 3
-
S. Desrivières, C. Kunz, I. Barash, V. Vafaizadeh, C. Borghouts, B. Groner (2006)
The Biological Functions of the Versatile Transcription Factors STAT3 and STAT5 and New Strategies for their Targeted InhibitionJournal of Mammary Gland Biology and Neoplasia, 11
-
J. Richer, Carol Lange, A. Wierman, K. Brooks, L. Tung, G. Takimoto, K. Horwitz (1998)
Progesterone receptor variants found in breast cells repress transcription by wild-type receptorsBreast Cancer Research and Treatment, 48
-
R. Chapman, P. Lourenço, E. Tonner, D. Flint, S. Selbert, K. Takeda, S. Akira, A. Clarke, C. Watson (1999)
Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3.Genes & development, 13 19
-
F. Gouilleux, Hiroshi Wakaol, M. Mundt, B. Groner (1994)
Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription.The EMBO Journal, 13
-
E. Nelson, Sarah Walker, A. Kepich, Laurie Gashin, T. Hideshima, H. Ikeda, D. Chauhan, K. Anderson, D. Frank (2008)
Nifuroxazide inhibits survival of multiple myeloma cells by directly inhibiting STAT3.Blood, 112 13
-
J. Visvader, G. Lindeman (2003)
Transcriptional regulators in mammary gland development and cancer.The international journal of biochemistry & cell biology, 35 7
-
Yongzhi Cui, G. Riedlinger, Keiko Miyoshi, Wei-Yu Tang, Cuiling Li, C. Deng, G. Robinson, L. Hennighausen (2004)
Inactivation of Stat5 in Mouse Mammary Epithelium during Pregnancy Reveals Distinct Functions in Cell Proliferation, Survival, and DifferentiationMolecular and Cellular Biology, 24
-
Ekat Kritikou, A. Sharkey, K. Abell, P. Came, Elizabeth Anderson, R. Clarkson, C. Watson (2003)
A dual, non-redundant, role for LIF as a regulator of development and STAT3-mediated cell death in mammary gland, 130
-
Tanya Gritsko, Ann Williams, J. Turkson, S. Kaneko, Tammy Bowman, Meijuan Huang, Sangkil Nam, Ibrahim Eweis, Nils Diaz, D. Sullivan, S. Yoder, S. Enkemann, S. Eschrich, J. Lee, C. Beam, Jin Cheng, S. Minton, C. Muro-Cacho, R. Jove (2006)
Persistent Activation of Stat3 Signaling Induces Survivin Gene Expression and Confers Resistance to Apoptosis in Human Breast Cancer CellsClinical Cancer Research, 12
-
Fu-Chuan Hsieh, G. Cheng, Jiayuh Lin (2005)
Evaluation of potential Stat3-regulated genes in human breast cancer.Biochemical and biophysical research communications, 335 2
-
Elena Iavnilovitch, B. Groner, I. Barash (2002)
Overexpression and forced activation of stat5 in mammary gland of transgenic mice promotes cellular proliferation, enhances differentiation, and delays postlactational apoptosis.Molecular cancer research : MCR, 1 1
-
David Frank (1999)
STAT Signaling in the Pathogenesis and Treatment of CancerMolecular Medicine, 5
-
Xuesong Lu, Xin Lu, Z. Wang, J. Iglehart, Xuegong Zhang, A. Richardson (2008)
Predicting features of breast cancer with gene expression patternsBreast Cancer Research and Treatment, 108
-
Z. Duan, R. Foster, D. Bell, J. Mahoney, Kathryn Wolak, A. Vaidya, C. Hampel, Hang Lee, M. Seiden (2006)
Signal Transducers and Activators of Transcription 3 Pathway Activation in Drug-Resistant Ovarian CancerClinical Cancer Research, 12
-
J. Turkson, Joon Kim, Shumin Zhang, Jing Yuan, Meijuan Huang, M. Glenn, E. Haura, S. Sebti, A. Hamilton, R. Jove (2004)
Novel peptidomimetic inhibitors of signal transducer and activator of transcription 3 dimerization and biological activity.Molecular cancer therapeutics, 3 3
-
R. Clarkson, M. Boland, Ekat Kritikou, J. Lee, T. Freeman, Paul Tiffen, C. Watson (2006)
The genes induced by signal transducer and activators of transcription (STAT)3 and STAT5 in mammary epithelial cells define the roles of these STATs in mammary development.Molecular endocrinology, 20 3
-
E. Matros, Z. Wang, Gabriela Lodeiro, A. Miron, J. Iglehart, A. Richardson (2005)
BRCA1 promoter methylation in sporadic breast tumors: relationship to gene expression profilesBreast Cancer Research and Treatment, 91
-
Shi Li, Jeffrey Rosen (1995)
Nuclear factor I and mammary gland factor (STAT5) play a critical role in regulating rat whey acidic protein gene expression in transgenic miceMolecular and Cellular Biology, 15
-
S. Ren, Hong Cai, Minglin Li, P. Furth (2002)
Loss of Stat5a delays mammary cancer progression in a mouse modelOncogene, 21
-
I. Cotarla, S. Ren, Ying Zhang, E. Gehan, Baljit Singh, P. Furth (2004)
Stat5a is tyrosine phosphorylated and nuclear localized in a high proportion of human breast cancersInternational Journal of Cancer, 108
-
B. Happ, B. Groner (1993)
The activated mammary gland specific nuclear factor (MGF) enhances in vitro transcription of the β-casein gene promoterThe Journal of Steroid Biochemistry and Molecular Biology, 47
-
R. Humphreys, Brian Bierie, Ling Zhao, R. Raz, D. Levy, L. Hennighausen (2002)
Deletion of Stat3 blocks mammary gland involution and extends functional competence of the secretory epithelium in the absence of lactogenic stimuli.Endocrinology, 143 9
-
R. Chapman, Paula Lourenço, E. Tonner, David Flint, Stefan Selbert, Kyoshi Takeda, Shizuo Akira, Alan Clarke, Christine Watson (2000)
The role of Stat3 in apoptosis and mammary gland involution. Conditional deletion of Stat3.Advances in experimental medicine and biology, 480
-
Xiuwen Liu, G. Robinson, L. Hennighausen (1996)
Activation of Stat5a and Stat5b by tyrosine phosphorylation is tightly linked to mammary gland differentiation.Molecular endocrinology, 10 12
-
D. Frank (2007)
STAT3 as a central mediator of neoplastic cellular transformation.Cancer letters, 251 2
-
T. Fukuda, Takehiko Yoshida, S. Okada, M. Hatano, T. Miki, K. Ishibashi, S. Okabe, H. Koseki, S. Hirosawa, M. Taniguchi, N. Miyasaka, T. Tokuhisa (1997)
Disruption of the Bcl6 Gene Results in an Impaired Germinal Center FormationThe Journal of Experimental Medicine, 186
-
R. Bos, P. Diest, P. Groep, A. Greijer, M. Hermsen, I. Heijnen, G. Meijer, J. Baak, H. Pinedo, E. Wall, A. Shvarts (2003)
Protein expression of B-cell lymphoma gene 6 (BCL-6) in invasive breast cancer is associated with cyclin D1 and hypoxia-inducible factor-1α (HIF-1α)Oncogene, 22
-
Hui Song, Renxiao Wang, Shaomeng Wang, Jiayuh Lin (2005)
A low-molecular-weight compound discovered through virtual database screening inhibits Stat3 function in breast cancer cells.Proceedings of the National Academy of Sciences of the United States of America, 102 13
-
Elena Iavnilovitch, R. Cardiff, B. Groner, I. Barash (2004)
Deregulation of Stat5 expression and activation causes mammary tumors in transgenic miceInternational Journal of Cancer, 112
-
Sarah Walker, E. Nelson, D. Frank (2007)
STAT5 represses BCL6 expression by binding to a regulatory region frequently mutated in lymphomasOncogene, 26
-
C. Schere-Levy, V. Buggiano, A. Quaglino, A. Gattelli, M. Cirio, I. Piazzón, S. Vanzulli, E. Kordon (2003)
Leukemia inhibitory factor induces apoptosis of the mammary epithelial cells and participates in mouse mammary gland involution.Experimental cell research, 282 1
-
E. Ratovitski, B. Trink, D. Sidransky (2006)
p63 and p73: teammates or adversaries?Cancer cell, 9 1
-
V. Ivanov, A. Bhoumik, M. Krasilnikov, R. Raz, L. Owen-Schaub, D. Levy, C. Horvath, Z. Ronai (2001)
Cooperation between STAT3 and c-jun suppresses Fas transcription.Molecular cell, 7 3
- Publisher
- Unpaywall
- ISSN
- 1541-7786
- DOI
- 10.1158/1541-7786.mcr-08-0238
- Publisher site
- See Article on Publisher Site
Abstract
Supplemental table 1. Genes upregulated in tumors containing phosphorylated STAT3 and phosphorylated STAT5 compared to tumors with only phosphorylated STAT3. gene name Gene ID fold t statistic P value change Amphiregulin (schwannoma-derived growth factor) 374 5.49 4.272 0.000631 Spectrin repeat containing, nuclear envelope 2 23224 4.35 2.148 0.045754 SMAD specific E3 ubiquitin protein ligase 1 57154 4.35 2.168 0.041519 Ras suppressor protein 1 62514.012.291 0.032122 amphiregulin (schwannoma-derived growth factor) 374 3.79 3.601 0.002142 chemokine (C-X-C motif) ligand 2 2920 3.17 2.201 0.044089 laminin, gamma 2 3918 3.11 2.623 0.020121 interferon, alpha-inducible protein (clone IFI-6-16) 2537 2.96 2.153 0.048022 transmembrane 4 L six family member 1 4071 2.9 2.396 0.025563 2'-5'-oligoadenylate synthetase 2, 69/71kDa 4939 2.78 2.143 0.047492 guanylate cyclase 1, soluble, beta 2 2974 2.72 2.469 0.021815 phorbol-12-myristate-13-acetate-induced protein 1 5366 2.64 2.494 0.022427 Mesenchymal stem cell protein DSC43 51333 2.64 2.311 0.031991 PARK2 co-regulated 135138 2.62 2.464 0.023734 myxovirus (influenza virus) resistance 1, interferon- 4599 2.61 2.172 0.046523 inducible protein p78 (mouse) /// myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) solute carrier family 16 (monocarboxylic acid 6566 2.48 2.341 0.030719 transporters), member 1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 2591 2.47 2.216 0.039053 acetylgalactosaminyltransferase 3 (GalNAc-T3) deoxynucleotidyltransferase, terminal 1791 2.42 2.252 0.035746 toll-like receptor 3 7098 2.36 3.503 0.002153 glycosyltransferase 28 domain containing 1 55849 2.32 3.846 0.001546 G protein-coupled receptor, family C, group 5, member A 9052 2.27 2.129 0.048845 early growth response 3 1960 2.27 2.819 0.010601 phospholipase A2, group X 8399 2.21 2.104 0.04992 coagulation factor II (thrombin) receptor-like 1 2150 2.21 2.5 0.023593 tumor necrosis factor receptor superfamily, member 11b 4982 2.18 2.31 0.030837 (osteoprotegerin) ets variant gene 7 (TEL2 oncogene) 51513 2.18 2.849 0.009355 pannexin 1 24145 2.17 4.544 0.000188 zinc finger protein 154 (pHZ-92) 7710 2.13 2.637 0.015235 G1 to S phase transition 2 /// G1 to S phase transition 2 23708 2.13 2.408 0.025982 tripartite motif-containing 58 25893 2.12 2.449 0.022811 S100 calcium binding protein A2 6273 2.1 2.64 0.016791 hypothetical protein LOC284837 2848372.082.407 0.025377 antigen p97 (melanoma associated) identified by 4241 2.08 2.196 0.040537 monoclonal antibodies 133.2 and 96.5 stomatin 20402.072.655 0.01482 Tumor necrosis factor (ligand) superfamily, member 10 /// 8743 2.06 2.342 0.029792 Tumor necrosis factor (ligand) superfamily, member 10 fibronectin leucine rich transmembrane protein 3 23767 2.02 2.297 0.032343 sterile alpha motif and leucine zipper containing kinase 51776 1.99 3.12 0.004986 AZK dual specificity phosphatase 10 11221 1.97 2.831 0.009954 sterile alpha motif domain containing 9 54809 1.96 3.614 0.001929 arylsulfatase D 414 1.94 2.598 0.016876 Adaptor-related protein complex 1, sigma 2 subunit 8905 1.94 2.519 0.023887 KIAA0701 protein 23074 1.93 2.391 0.026618 annexin A3 306 1.92 2.32 0.030282 chromosome 7 open reading frame 6 219285 1.91 2.95 0.008886 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, 2683 1.9 2.395 0.027939 polypeptide 1 hypothetical gene supported by BC007071 91687 1.9 2.273 0.033786 elongation factor, RNA polymerase II, 2 22936 1.9 2.85 0.011154 membrane targeting (tandem) C2 domain containing 1 123036 1.89 2.464 0.022009 follistatin 104681.892.409 0.026879 SLIT and NTRK-like family, member 2 84631 1.88 2.542 0.018604 gastrin-releasing peptide 2922 1.88 2.587 0.017343 zinc finger and BTB domain containing 1 22890 1.87 2.54 0.018734 catenin (cadherin-associated protein), alpha 3 29119 1.87 2.587 0.017231 v-jun sarcoma virus 17 oncogene homolog (avian) 3725 1.85 3.541 0.002074 Kruppel-like factor 4 (gut) 9314 1.85 3.287 0.003364 COMM domain containing 5 /// COMM domain containing 28991 1.85 3.229 0.00408 basic leucine zipper nuclear factor 1 (JEM-1) 8548 1.84 2.754 0.012031 zinc finger protein 554 115196 1.81 2.758 0.011728 GULP, engulfment adaptor PTB domain containing 1 51454 1.81 2.536 0.018834 zinc finger protein 639 51193 1.8 3.27 0.003526 MRE11 meiotic recombination 11 homolog A (S. 4361 1.8 2.397 0.029186 cerevisiae) Interferon-induced protein 44 10561 1.8 2.266 0.036778 dual specificity phosphatase 10 11221 1.8 2.441 0.02345 deoxyribonuclease I 1773 1.8 2.36 0.029046 solute carrier family 19 (thiamine transporter), member 2 10560 1.79 3.649 0.001417 nudix (nucleoside diphosphate linked moiety X)-type 83594 1.78 2.626 0.016353 motif 12 tetraspanin 15 23555 1.77 4.566 0.000158 hypothetical protein MGC52057 1305741.772.671 0.014235 hypothetical protein FLJ20035 55601 1.77 2.844 0.012057 COBW domain containing 1 /// COBW domain containing 150472 /// 1.77 2.438 0.02557 2 /// dopamine responsive protein 220869 /// ubiquitously transcribed tetratricopeptide repeat, X 7403 1.76 2.635 0.015912 chromosome Similar to Zinc finger protein 492 388760 1.76 2.748 0.012339 claspin homolog (Xenopus laevis) 63967 1.76 2.351 0.030435 AF464140 1635901.763.181 0.004502 hemochromatosis 30771.742.634 0.015552 GTPase, IMAP family member 2 26157 1.73 2.405 0.027051 coiled-coil domain containing 2 80173 1.72 2.531 0.020341 hypothetical protein MGC19764 1623941.712.456 0.022875 chromosome 14 open reading frame 105 55195 1.71 2.716 0.012682 Rho GTPase activating protein 26 23092 1.7 2.631 0.016031 homer homolog 2 (Drosophila) 9455 1.7 2.482 0.02381 KIAA0701 protein 23074 1.69 3.096 0.005993 Histamine N-methyltransferase 3176 1.69 2.741 0.012914 melanocortin 4 receptor 4160 1.68 2.583 0.016986 KIAA1333 556321.683.119 0.005114 solute carrier family 4, sodium bicarbonate cotransporter, 8671 1.67 2.587 0.016897 member 4 v-jun sarcoma virus 17 oncogene homolog (avian) 3725 1.66 4.697 0.000111 retinol dehydrogenase 10 (all-trans) 1575061.662.644 0.016941 mitogen-activated protein kinase associated protein 1 79109 1.65 2.565 0.020635 histamine N-methyltransferase 3176 1.65 2.83 0.009752 etoposide induced 2.4 mRNA 95381.642.646 0.015223 solute carrier family 35, member F5 80255 1.63 3.177 0.005208 chromosome 7 open reading frame 6 219285 1.63 2.567 0.018428 amyloid beta (A4) precursor protein (protease nexin-II, 351 1.63 2.726 0.012651 Alzheimer disease) tropomyosin 1 (alpha) 7168 1.62 2.726 0.013365 hypothetical protein LOC116068 1160681.612.759 0.012049 Potassium inwardly-rectifying channel, subfamily J, 3763 1.6 2.789 0.010706 member 6 KIAA0433 protein 23262 1.6 2.766 0.013009 Decay accelerating factor for complement (CD55, 1604 1.6 2.671 0.014251 Cromer blood group system) endosulfine alpha 2029 1.58 2.814 0.010801 x 009 protein 56986 1.57 2.729 0.012411 RAB43, member RAS oncogene family 339122 1.57 2.898 0.00839 Kruppel-like factor 3 (basic) 51274 1.57 3.231 0.004905 salvador homolog 1 (Drosophila) 60485 1.56 3.072 0.006495 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol 6646 1.55 2.999 0.007079 acyltransferase) 1 poly (ADP-ribose) polymerase family, member 10 84875 1.55 2.919 0.008234 chromosome 9 open reading frame 64 84267 1.55 3.236 0.003801 zinc finger protein 639 51193 1.54 2.908 0.008231 interferon induced with helicase C domain 1 64135 1.54 2.996 0.006998 CCR4-NOT transcription complex, subunit 6-like 246175 1.54 3.053 0.006269 nuclear receptor binding factor 2 29982 1.53 3.391 0.002628 DKFZP564J0863 protein 25923 1.53 2.943 0.007591 numb homolog (Drosophila) 8650 1.52 3.257 0.003616 nucleoporin 160kDa 23279 1.52 2.784 0.012851 Ku70-binding protein 3 91419 1.52 3.09 0.005398 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 2590 1.5 3.113 0.006841 acetylgalactosaminyltransferase 2 (GalNAc-T2) Chromosome 14 open reading frame 126 112487 1.46 3.452 0.002286 poly(A) polymerase alpha 10914 1.45 3.397 0.002947 tight junction protein 1 (zona occludens 1) 7082 1.42 3.707 0.001491 cornichon homolog (Drosophila) 10175 1.42 3.916 0.000744 dipeptidylpeptidase 8 54878 1.41 3.548 0.002131 Supplemental table 2. Genes downregulated in tumors containing phosphorylated STAT3 and phosphorylated STAT5 compared to tumors with only phosphorylated STAT3. gene name Gene ID fold t statistic P value change Hypothetical protein MGC15396 91369-18.12-2.692 0.01344 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 374291 -5.13 -2.156 0.042457 20kDa (NADH-coenzyme Q reductase) hypothetical protein MGC34732 220047 -5.07-2.273 0.034003 FERM, RhoGEF (ARHGEF) and pleckstrin domain 10160 -4.42 -2.141 0.043622 protein 1 (chondrocyte-derived) Hypothetical protein LOC284412 284412 -4.05 -2.115 0.047995 leucine rich repeat containing 2 79442 -3.74 -2.201 0.041801 protein kinase C binding protein 1 23613 -3.38 -2.404 0.029583 EMI domain containing 2 136227 -3.23 -2.448 0.022817 Tripartite motif-containing 5 85363 -2.42 -2.143 0.048969 enolase 2 (gamma, neuronal) 2026 -2.19 -2.599 0.02232 serine arginine-rich pre-mRNA splicing factor SR- 58506 -2.18 -3.363 0.003889 A1 regulatory factor X, 2 (influences HLA class II 5990 -2.05 -2.299 0.03555 expression) homeo box D9 3235 -2.02 -2.187 0.043673 DNA segment on chromosome X (unique) 9879 8270 -2.02 -2.45 0.033725 expressed sequence Nedd4 binding protein 1 9683 -2 -2.26 0.048235 Leucine-rich repeat LGI family, member 4 163175 -1.99 -2.239 0.044569 adaptor-related protein complex 2, alpha 1 subunit 160 -1.98 -3.236 0.004649 collagen, type XXV, alpha 1 /// collagen, type XXV, 84570 -1.96 -2.393 0.03222 alpha 1 protein kinase C binding protein 1 23613 -1.89 -2.714 0.019042 Tubby like protein 4 56995 -1.88 -2.289 0.039825 tripartite motif-containing 55 84675 -1.86 -3.038 0.00694 glycophorin E 2996 -1.86 -2.448 0.02352 sterile alpha and TIR motif containing 1 23098 -1.83 -2.843 0.011391 protein kinase C binding protein 1 23613 -1.82 -2.53 0.027141 G protein-coupled receptor 24 2847 -1.82 -2.512 0.024749 casein kinase 1, gamma 1 53944 -1.81 -2.834 0.01019 KIAA0703 gene product 9914 -1.8 -2.798 0.013754 RNA binding motif protein 8A 9939 -1.78 -2.716 0.013975 HLA-B associated transcript 5 7920 -1.78 -3.348 0.003356 tubby like protein 4 56995 -1.74 -2.442 0.033991 Microtubule associated monoxygenase, calponin 57553 -1.74 -2.325 0.042592 and LIM domain containing 3 carboxypeptidase X (M14 family), member 2 119587 -1.73 -2.492 0.023129 zinc finger protein 3 (A8-51) 7551 -1.68 -2.655 0.018759 Signal sequence receptor, alpha (translocon- 6745 -1.67 -3.289 0.00462 associated protein alpha) zinc ribbon domain containing, 1 30834 -1.65 -2.837 0.009878 Stereocilin 161497-1.65-3.045 0.007869 protein kinase C binding protein 1 23613 -1.64 -2.744 0.017568 stromal interaction molecule 1 6786 -1.63 -2.849 0.015737 signal transducer and activator of transcription 6, 6778 -1.63 -2.657 0.018722 interleukin-4 induced villin 2 (ezrin) 7430 -1.59 -2.855 0.011415 tubulin-specific chaperone e 6905 -1.59 -3.412 0.00348 LOC440526 440526-1.56-2.889 0.013482 leukocyte receptor cluster (LRC) member 4 79143 -1.56 -2.89 0.012677 villin 2 (ezrin) 7430 -1.45 -3.486 0.002757 Supplemental table 3. Normalized mRNA expression of CIS, SOCS3, and BCL6 in the breast cancers stained for STAT3 and STAT5 phosphorylation, grouped by phosphorylation pattern. Expression data are derived from microarray-based quantitation. Tumor CIS SOCS3 BCL6 STAT activation B10 93.36 545.59 71.54 No STAT 3 or 5 B28 172.4 405.05 28.58 No STAT 3 or 5 B30 183.34 537.88 64.25 No STAT 3 or 5 B37 103.94 121.78 175.25 No STAT 3 or 5 B39 167.64 421.52 138.98 No STAT 3 or 5 B41 124.71 200.42 59.54 No STAT 3 or 5 B52 14.69 418.47 101.83 No STAT 3 or 5 B53 45.23 283.6 67.43 No STAT 3 or 5 B63 70.97 399.02 79.43 No STAT 3 or 5 B78 150.31 684.52 144.76 No STAT 3 or 5 B8 232.24 177.17 84.03 No STAT 3 or 5 B89 238.86 801.69 92.99 No STAT 3 or 5 B90 116.06 440.75 157.08 No STAT 3 or 5 B92 44.66 463.57 160.28 No STAT 3 or 5 B94 171.56 1316.78 90.05 No STAT 3 or 5 B96 54.11 294.75 97.09 No STAT 3 or 5 B14 96.72 1126.17 23.95 STAT 3 only B16 70.47 891.78 48.29 STAT 3 only B17 271.85 369.31 23.44 STAT 3 only B18 183.96 681.13 135.09 STAT 3 only B21 55.67 488.92 54.75 STAT 3 only B24 277.93 641.06 369.22 STAT 3 only B25 85.34 312.27 19.8 STAT 3 only B33 1.24 451.44 73.45 STAT 3 only B34 248.23 482.01 52.37 STAT 3 only B35 41.72 1031.74 30.59 STAT 3 only B38 40.76 755.23 70.92 STAT 3 only B4 103.42 336.53 76.96 STAT 3 only B43 328.52 590.1 303.72 STAT 3 only B47 86.13 391.21 107.43 STAT 3 only B50 275.86 82.81 34.6 STAT 3 only B55 28.37 228.05 98.48 STAT 3 only B57 70.3 324.89 81.03 STAT 3 only B61 238.25 124.85 41.41 STAT 3 only B68 137.56 449.43 36.38 STAT 3 only B70 125.86 651.36 49.11 STAT 3 only B71 291.14 493.59 86.57 STAT 3 only B74 83.22 652.27 64.12 STAT 3 only B77 244 237 39.73 STAT 3 only B82 497.59 422.48 109.66 STAT 3 only B84 44.89 163.19 113.57 STAT 3 only B95 36.6 182.11 219.52 STAT 3 only B98 164.11 407.6 103.53 STAT 3 only B13 199.15 274.46 64.46 STAT 5 only B22 294.24 907.77 47.45 STAT 5 only B76 241.57 178.39 90.39 STAT 5 only B81 96.63 67.39 42.54 STAT 5 only B97 263.94 1714.86 763.04 STAT 5 only B1 149.44 342.53 821.45 STAT 3 and 5 B11 96.91 1236.54 108.13 STAT 3 and 5 B12 47.22 510.58 152.81 STAT 3 and 5 B15 191.24 1231.31 280.29 STAT 3 and 5 B2 43.24 393.69 132.51 STAT 3 and 5 B29 371.35 256.83 58.92 STAT 3 and 5 B3 74.42 551.08 460.11 STAT 3 and 5 B31 139.86 387.73 313.86 STAT 3 and 5 B36 244.3 461.74 69.2 STAT 3 and 5 B40 182.62 326.76 166.06 STAT 3 and 5 B45 152.9 375.57 58.9 STAT 3 and 5 B5 184.92 354.37 99.11 STAT 3 and 5 B65 66.13 862.13 47.56 STAT 3 and 5 B66 106.53 230.16 112.06 STAT 3 and 5 B67 299.07 809.43 47.79 STAT 3 and 5 B7 98.98 548.74 434.43 STAT 3 and 5 B79 86.45 365.6 111.95 STAT 3 and 5 B80 89.73 175.43 80.24 STAT 3 and 5 B85 169.98 1366.87 113.27 STAT 3 and 5 B86 305.64 613.44 235.44 STAT 3 and 5 Mean expression: CIS SOCS3 BCL6 124.01 ± 67.91 469.54 ± 287.95 100.82 ± 42.26 No STAT 3 or 5 152.95 ± 119.55 480.32 ± 263.40 91.40 ± 83.12 STAT 3 only 219.11 ± 76.74 628.57 ± 689.38 201.58 ± 314.43 STAT 5 only 155.05 ± 91.19 570.03 ± 351.52 195.20 ± 191.43 STAT 3 and 5 Supplemental table 4. Primers used for real-time RT-PCR Gene Forward primer Reverse primer BCL6 CTGCAGATGGAGCATGTTGT TCTTCACGAGGAGGCTTGAT CIS CTGCTGTGCATAGCCAAGAC GTGCCTTCTGGCATCTTCTG GAPDH AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA SOCS3 TCAAGACCTTCAGCTCCAAG TGACGCTGAGCGTGAAGAAG KLF4 GTTCCCATCTCAAGGCACAC ACGGTAGTGCCTGGTCAGTT ANKRD40 AGGTGCAGAAACTGGTGGAG TGGACTGGCATTTCTCCTTT AREG TGGTGCTGTCGCTCTTGATA TCACGCTTCCCAGAGTAGGT BAT5 TCAACCGGGTTAAGAAGCTG CACAGAGCCTGGATACAGCA CSNK1G1 TATAATGCCATGGTGCTGGA TGCACGTATTCCATTCGAGA ETV7 GGAGCGCTCAAGACAGAAAG TGCCACAGGGCTTATAGGAG NBRF2 GTCGAGCTCCCTTGCAGTC GCTCGTCTGCTCTGTTGATG PANX1 CAGAGCGAGTCTGGAAACCT GGTACAGGAGGATCGCAAAG PRKCBP1 CCCTCCACATTCTTCCAATG TCAACAGGGTCTGTGGTGAG RAB43 ACCATGAAGACGCTGGAGAT GCTCCTCTTGGTGATGTCGT SAMD9 GGTTGCAGTGGGTGAATAGG AAGTTGCTTTGCCATTCTGA TLR3 AACTGGATATCTTTGCCAATTCA TTGTTCAGAAAGAGGCCAAA TSPAN15 GCGCTTCTCCTACCTCTGG TATTTCTGCCGCTCAACCTC VIL2 GAACAGACCTTTGGCTTGGA CACTCCAAGGAAAGCCAATC Supplemental figure 1 P-STAT5 P-STAT5 STAT5 STAT5 Prolactin: - + EGF: - + BCL6 BCL6 1.2 1.2 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 untreated prolactin untx EGF P-ST P-STA AT T3 3 P- P-S ST TA AT T3 3 ST STA AT T3 3 ST STA AT T3 3 LIF: LIF: - - + + OSM OSM: : - - + + BCL6 BCL6 2.5 1.5 1.5 0.5 0.5 untreated LIF untreated OSM Relative mRNA expression Relative mRNA expression Relative mRNA expression Relative mRNA expression Supplemental figure 1. STAT5 and STAT3 oppositely regulate BCL6. SK-BR-3 cells were stimulated with prolactin (a), EGF (b), LIF (c), or OSM (d) for 15 minutes. STAT5 or STAT3 phosphorylation was analyzed by immunoblot with the indicated antibodies (top panels). SK-BR-3 cells were stimulated with prolactin (a), EGF (b), LIF (c), or OSM (d) for 90 minutes. BCL6 mRNA expression was analyzed by quantitative RT-PCR (bottom panels). Supplemental figure 2. V 3i STAT3 ST STA AT T5 5 STAT5 ST STA AT T3 3 tubulin ac acti tin n si siC C s sii5 5a a//5 5b b BCL6 BCL6 untreated 1.2 untreated LIF 2.5 prolactin 0.8 0.6 1.5 0.4 0.2 0.5 siC si5a/5b pRS pRS-STAT3i Supplemental figure 2. STAT5 and STAT3 are necessary for prolactin and LIF modulation of BCL6 expression. A. SK-BR-3 cells transfected with siRNA to STAT5a and STAT5b (si5a/5b) or control siRNA (siC) were analyzed by immunoblot with the indicated antibodies (top panel), or were stimulated with prolactin for 90 minutes and BCL6 mRNA expression was analyzed by qPCR (bottom panel). B. SK-BR-3 cells were infected with pRetroSuper-STAT3i (pRS-STAT3i) or control vector (pRS) and analyzed by immunoblot for the indicated antibodies (top panel), or were stimulated with LIF for 90 minutes and BCL6 mRNA expression was analyzed by qPCR (bottom panel). Relative mRNA expression Relative mRNA expression Supplemental figure 3 a b P-ST P-STA AT T5 5 1.2 P-ST P-STA AT T3 3 0.8 0.6 STA STAT T5 5 0.4 0.2 STA STAT T3 3 untreated prolactin LIF prolactin/LIF Pr Prol olacti actin: - n: - + + - - + + LIF LIF:: - - - - + + + + Supplemental figure 3. STAT5 is dominant over constititive and induced STAT3 activation. MDA-MB-468 cells were stimulated with prolactin and LIF, separately and simultaneously for 15 minutes and analyzed by immunoblot (a) or 90 minutes and BCL6 mRNA expression was analyzed by qPCR (b). Relative BCL6 expression Supplemental figure 4. SOCS3 vector STAT5a1*6 vector STAT5a1*6 Pool A Pool B Supplemental figure 4. Activated STAT5 upregulates SOCS3 expression. MDA-MB- 468 cells stably expressing STAT5a1*6 (pool A and pool B) were analyzed for SOCS3 expression by quantitative RT-PCR normalized to GAPDH. Relative mRNA expression Supplemental figure 5. 120 120 vector vector 100 100 STAT5a1* STAT5a1*6 6 80 80 60 60 40 40 20 20 0 0 DMSO DMSO 1 1 2 2 3 3 4 4 5 5 6 6 7 7 uM paclitaxel uM paclitaxel vector STAT5a1*6 0 0.25 1 5 uM vinorelbine Supplemental figure 5. Cells containing activation of both STAT5 and STAT3 are more sensitive to chemotherapy then cells with only STAT3 activation. MDA-MB-468 cells stably expressing STAT5a1*6 were treated with vehicle or the indicated concentrations of paclitaxel (a) or vinorelbine (b) for 48 hours. Viable cells were quantitated and normalized to each vehicle treated control. Similar results were obtained using two independent stable pools of cells. % v % viia ab biilliit ty y % viability
Journal
Molecular Cancer Research – Unpaywall
Published: Jun 1, 2009