Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

DNA structure-specific priming of ATR activation by DNA-PKcs

DNA structure-specific priming of ATR activation by DNA-PKcs JCB: Report DNA structure-specific priming of ATR activation by DNA-PKcs 1 2 1 1 Sophie Vidal-Eychenié, Chantal Décaillet, Jihane Basbous, and Angelos Constantinou Institute of Human Genetics, Unité Propre de Recherche 1142, Centre National de la Recherche Scientifique, 34396 Montpellier, France Department of Biochemistry, University of Lausanne, 1066 Epalinges s/Lausanne, Switzerland hree phosphatidylinositol-3-kinase–related protein In this paper, we show that the juxtaposition of a double- kinases implement cellular responses to DNA damage. stranded DNA end and a short ssDNA gap triggered ro- TDNA-dependent protein kinase catalytic subunit bust activation of endogenous ATR and Chk1 in human (DNA-PKcs) and ataxia-telangiectasia mutated respond cell-free extracts. This DNA damage signal depended on primarily to DNA double-strand breaks (DSBs). Ataxia- DNA-PKcs and ATR, which congregated onto gapped lin- telangiectasia and RAD3-related (ATR) signals the ac- ear duplex DNA. DNA-PKcs primed ATR/Chk1 activation cumulation of replication protein A (RPA)–covered through DNA structure-specific phosphorylation of RPA32 single-stranded DNA (ssDNA), which is caused by repli- and TopBP1. The synergistic activation of DNA-PKcs and cation obstacles. Stalled replication intermediates can fur- ATR suggests that the two kinases combine to mount a ther degenerate and yield replication-associated DSBs. prompt and specific response to replication-born DSBs. Introduction From the early stages of carcinogenesis, replication-associated accumulate (Byun et al., 2005; MacDougall et al., 2007; Van lesions trigger DNA damage responses (Bartkova et al., 2005; et al., 2010). The recruitment of ATR to stalled replication forks Gorgoulis et al., 2005), which are mediated by the phosphatidy- is mediated by ATRIP, which binds human replication protein linositol-3-kinase–like protein kinases (PI3KKs) ataxia-telangiectasia A (RPA) bound to ssDNA (Zou and Elledge, 2003). ATRIP also mutated (ATM), ataxia-telangiectasia and RAD3-related (ATR), facilitates the recruitment of TopBP1 (Choi et al., 2010), a direct and DNA-dependent protein kinase (DNA-PK) catalytic subunit activator of the ATR–ATRIP complex (Kumagai et al., 2006). (DNA-PKcs). ATM signals DNA double-strand breaks (DSBs), DNA-PKcs is recruited to DNA ends by Ku70–Ku80 and whereas ATR responds to a variety of obstacles that block the activated upon binding to DNA (Dvir et al., 1992; Gottlieb and progression of replication forks (Jackson and Bartek, 2009). Jackson, 1993). DNA-PKcs is a central component of the machin- Activated ATM and ATR phosphorylate hundreds of substrate ery that repairs DSBs by nonhomologous end joining (NHEJ; proteins to activate DNA repair mechanisms and adjust ongoing Smith and Jackson, 1999). DNA-PKcs has additional functions, physiological processes (Matsuoka et al., 2007). Two important notably in telomere maintenance and in the response to DNA targets of ATR and ATM are Chk1 and Chk2, which implement replication stress (Smith and Jackson, 1999; Allen et al., 2011). cell cycle checkpoints (Abraham, 2001). DNA-PKcs and ATR phosphorylate the 32-kD subunit of ATR activation depends on the nucleation of multiple human RPA (RPA32) on multiple sites and these modifications factors that bind single-stranded DNA (ssDNA) and 5 double- promote DNA repair (Shao et al., 1999; Block et al., 2004; stranded DNA to single-stranded DNA (ds/ssDNA) junctions Sakasai et al., 2006; Anantha et al., 2007; Shi et al., 2010; Liaw (MacDougall et al., 2007; Van et al., 2010). The ATR sig- et al., 2011). The underlying mechanism of functional cross talk nal is amplified when either ssDNA or ds/ssDNA junctions between DNA-PKcs and ATR, however, remains elusive, and intriguing, as DNA-PKcs and ATR are recruited to and activated S. Vidal-Eychenié, C. Décaillet, and J. Basbous contributed equally to this paper. by distinct DNA structural elements, respectively, by DSBs and Correspondence to Angelos Constantinou: [email protected] by RPA-covered ssDNA. Abbreviations used in this paper: ATM, ataxia-telangiectasia mutated; ATR, ataxia-telangiectasia and RAD3 related; CPT, camptothecin; DNA-PK, DNA- © 2013 Vidal-Eychenié et al. This article is distributed under the terms of an Attribution– dependent protein kinase; DNA-PKcs, DNA-PK catalytic subunit; DSB, double- Noncommercial–Share Alike–No Mirror Sites license for the r fi st six months after the publication strand break; dsDNA, double-stranded DNA; gDNA, gapped DNA; NHEJ, date (see http://www.rupress.org/terms). After six months it is available under a Creative nonhomologous end joining; PI3KK, phosphatidylinositol-3-kinase–like protein Commons License (Attribution–Noncommercial–Share Alike 3.0 Unported license, as described kinase; RPA, replication protein A; ssDNA, single-stranded DNA. at http://creativecommons.org/licenses/by-nc-sa/3.0/). The Rockefeller University Press $30.00 J. Cell Biol. Vol. 202 No. 3 421–429 www.jcb.org/cgi/doi/10.1083/jcb.201304139 JCB 421 THE JOURNAL OF CELL BIOLOGY Figure 1. DNA damage signal activation in human cell-free extracts. (A) The duplex DNA substrates are blunt ended and 573 bp long. The gDNA contains a 68-nt single-stranded gap. (B) The gDNA is refractory to digestion with SpeI. (C) gDNA-specific phosphorylation of RPA32 and Chk1. Nuclear extracts were incubated without DNA (lane 1), with duplex DNA (lane 2), or with gDNA (lane 3). The indicated proteins were analyzed by Western blotting. (D) Proteins bound to biotinylated DNA were pulled down with streptavidin- coated beads and detected by Western blotting. The dsDNA and gDNA substrates are represented schematically. Biotin (black circles) and streptavidin-coated beads (dented gray circles) are shown. To gain insights into the mechanisms of replication check- in the presence of gDNA (Fig. 1 C). In contrast, markers of ATR point signaling, we designed a DNA substrate that contains activation were not visible when extracts were incubated with- dsDNA ends and a short ssDNA gap. In human cell-free extracts, out DNA or in the presence of dsDNA (Fig. 1 C). To verify that linear gapped DNA (gDNA) promotes the assembly of a potent DNA damage signals emanated from the defined gDNA mole - ATR signaling complex that includes DNA-PKcs, ATR, RPA, cules, we labeled DNA substrates with biotin and then iso- and TopBP1. We propose a novel mechanism for the coopera- lated biotin DNA substrates from the reaction mixtures using tion of DNA-PKcs and ATR at collapsed replication forks. streptavidin-coated beads. Ser345 pChk1 and Ser33 pRPA32 were pulled down exclusively with gDNA (Fig. 1 D). RPA32 also bound the DNA duplex (Fig. 1 D), most likely as a result of Results and discussion helix destabilization and binding to ssDNA (Lao et al., 1999). Induction of RPA and Chk1 phosphorylation Ser33 pRPA32, however, was detected principally in associa- in human cell-free extracts tion with the gDNA substrate (Fig. 1 D). During DNA replication, oncogenes and chemotherapeutic agents Presumably, DNA damage signaling does not depend on induce the accumulation of ssDNA gaps in newly replicated DNA DNA end resection because the DNA ends of duplex DNA and and four-way junctions at replication forks (Fig. S1; Lopes et al., gDNA molecules would be equally susceptible to nucleases, 2006; Ray Chaudhuri et al., 2012; Neelsen et al., 2013). Whereas and yet phosphorylation reactions were prompt and gDNA spe- ssDNA gaps are fragile and prone to breaking (Lopes et al., cific (Fig. 1). Consistent with this, we did not detect significant 2006), overwhelming DNA replication stress or checkpoint de- DNA degradation during a 1-h incubation in nuclear extracts fects can lead to the precocious processing of regressed forks by (Fig. S2 A). In addition, linear DNA duplexes containing either Mus81-Eme1 (Hanada et al., 2007; Neelsen et al., 2013; Szakal a 68- or a 160-nt ssDNA gap equally induced Chk1 phosphory- and Branzei, 2013). The collapse of these unusual replication lation (Fig. S2 B), suggesting that nucleolytic enlargement of intermediates is expected to yield DSBs that can activate DNA- the ssDNA gap is not essential to trigger Chk1 activation. These PKcs and ATM in DNA molecules containing ssDNA gaps that data indicate that linear duplex DNA with a short ssDNA gap can trigger ATR activation (Fig. S1). To study how DNA mole- can promote the formation of a singularly active DNA damage cules that mimic broken replication intermediates are detected signaling complex that phosphorylates endogenous protein sub- and signaled, we designed a linear duplex DNA molecule that strates in human cell-free extracts. contains one defined ssDNA gap (gDNA). The 573-bp DNA duplex was generated by PCR amplification of a DNA template Juxtaposed DNA gap and DNA ends induce (pG68) that comprises closely spaced recognition sites for a robust phosphorylation of RPA and Chk1 nicking endonuclease (Ralf et al., 2006). The nicks yield short To dissect the structural determinants of DNA that activate oligonucleotides eliminated by heat denaturation. This treatment DNA damage signaling, we supplemented the human nuclear creates a 68-nt ssDNA gap in the DNA duplex and removes a extract with different forms of plasmid pG68 (Ralf et al., 2006). SpeI restriction site (Fig. 1, A and B). In addition to Ser33 pRPA32 and Ser345 pChk1, we probed To monitor DNA damage signaling in vitro, we used human the extracts for DNA-PKcs autophosphorylation on Ser2056, a cell-free extracts and probed by Western blotting the phosphory- marker of DNA-PKcs activation that occurs upon binding of lation of RPA32 at Ser33 (Olson et al., 2006) and of Chk1 at DNA-PKcs to DNA ends. In an open circular form, the plasmid Ser345 (Guo et al., 2000; Liu et al., 2000). These phosphosig- induced background phosphorylation of RPA32 on Ser33 and nals were induced in cell-free extracts after incubation for 15 min of DNA-PKcs on Ser2056, after 1 h of incubation in cell-free 422 JCB • VOLUME 202 • NUMBER 3 • 2013 Figure 2. The juxtaposition of DNA ends and an ssDNA gap triggers activation of the DNA damage signal. (A) Nuclear extracts were incubated for the indicated time periods with open circular plasmid DNA (lanes 1–5), linear duplex DNA (lanes 6–10), gap circular DNA (lanes 11–15), or gapped lin- ear duplex DNA (lanes 16–20). The indicated proteins were analyzed by Western blotting. (B) ATR activation depends on accessible DNA ends. (lanes 1–3) dsDNA and gDNA were biotinylated at both ends and incubated with nuclear extracts. (lanes 4–6) Biotinylated DNA substrates (5 nM) were prein- cubated with 30 nM streptavidin for 15 min at 37°C before addition of nuclear extracts. (lanes 7–9) Unmodified DNA sub - strates were preincubated with streptavidin before addition of nuclear extracts. The DNA substrates are represented sche- matically. Biotin (black circles) and streptavidin (gray circles) are shown. extracts (Fig. 2 A). As expected, linearized pG68 promptly trig- efficient than in a reaction mixture supplemented with gapped gered DNA-PKcs autophosphorylation on Ser2056, whereas linear duplex DNA (Fig. S2 C). In contrast, the induction of Chk1 and RPA32 remained unmodified (Fig. 2 A). The gapped DNA-PKcs autophosphorylation was equivalent in both reactions circular plasmid DNA did not induce phosphosignals above (Fig. S2 C). Hence, the close juxtaposition of a dsDNA end and an background levels (Fig. 2 A). In contrast, Ser345 pChk1 and ssDNA gap promotes DNA damage signaling. Although the dis- Ser33 pRPA32 were detected already after a 5-min incuba- tance between the DNA ends and the ssDNA gap was increased tion with gapped linear duplex DNA (Fig. 2 A). In a reaction by more than fivefold in plasmid-based gDNA (Fig. 2 A) com - mixture containing a combination of linear duplex DNA and pared with PCR-based gDNA (Fig. 1 A), both DNA substrates gapped circular DNA molecules, Chk1 phosphorylation was less were potent inducers of DNA damage signaling. This indicates Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 423 Figure 3. Concerted activation of DNA damage signaling by DNA-PKcs, ATM, and ATR. (A) DNA-PKcs, ATM, and ATR bind to the biotinylated DNA substrates. DNA structures biotinylated at one DNA end were coupled to streptavidin-coated beads and then incubated with nuclear extracts for 10 min at 20°C, in the absence or presence of the DNA-PKcs inhibitor IC86621 (100 µM), the ATM inhibitor KU-55933 (10 µM), or the ATR inhibitor ETP-46464 (1 µM), as indicated. DNA-bound DNA-PKcs, ATM, and ATR were pulled down with streptavidin-coated beads, resolved by SDS-PAGE, and detected by Western blotting. (B) DNA-bound TopBP1 and Chk1 were isolated and detected as described in A. (C) Nuclear extracts prepared from cells treated with control shRNA or ATR shRNA were incubated with the indicated biotinylated DNA substrates, as described in A. ATR, DNA-PKcs, and Chk1 proteins were pulled down with streptavidin-coated beads, resolved by SDS-PAGE, and detected by Western blotting. (D) Nuclear extracts from cells treated with control shRNA or RPA shRNA were incubated for the indicated time periods with gDNA and probed for the indicated proteins by Western blotting. iDNA-PKcs, inhibitor of DNA-PKcs; iATM, inhibitor of ATM; iATR, inhibitor of ATR. that DNA damage signaling reactions are permissive to variations at collapsed replication forks, we coupled the DNA fragments of the distance between the DNA ends and the ssDNA region. labeled with biotin at only one end with streptavidin-coated beads To confirm that DNA ends were necessary to potentiate and then incubated the beads in nuclear extracts. The beads were signals emanating from ssDNA, we labeled both 5 ends of the isolated, and proteins associated with gDNA were analyzed by PCR-amplified gDNA product with biotin. 5 -biotin labels did Western blotting. ATM, ATR, and DNA-PKcs were all pulled not impinge on gDNA-induced phosphorylation of DNA-PKcs down with biotinylated DNA substrates (Fig. 3 A). and RPA32 (Fig. 2 B). When streptavidin was added to the re- We then sought evidence of regulatory interplay between action mixture, however, phosphorylation reactions induced by PIKKs using ATR-, ATM-, and DNA-PKcs–specific inhibitors. biotin-labeled gDNA were inhibited (Fig. 2 B), most likely as a Two major clusters of phosphorylation sites in DNA-PKcs reg- consequence of steric hindrance caused by streptavidin–biotin ulate the processing of DNA ends (Meek et al., 2008). DNA-PKcs complexes at DNA ends. Consistent with this, streptavidin had autophosphorylation within the PQR cluster (Ser2056 cluster), no impact on phosphorylation reactions induced by gDNA in the protects DNA ends from nucleolytic resection while allowing absence of 5-biotin labels (Fig. 2 B). In conclusion, the juxta- access to components of the NHEJ machinery (Meek et al., 2008). position of an ssDNA gap and DNA ends triggers the phos- In contrast, phosphorylation of DNA-PKcs within the ABCDE phorylation of RPA32 and Chk1 in human cell-free extracts. cluster (Thr2609 cluster) allows access to enzymes that trim DNA ends to promote homologous recombination (Meek et al., Linear gDNA promotes the assembly of a 2008). This modification can be mediated by ATR in response potent ATR signaling complex to UV-induced DNA replication stress (Yajima et al., 2006). The To characterize the composition of the DNA damage signaling ATM-specific inhibitor KU-55933 had no major impact on the complex and mimic single-ended DNA molecules that may arise phosphorylation of DNA-PKcs and ATR (Fig. 3 A). In contrast, 424 JCB • VOLUME 202 • NUMBER 3 • 2013 Figure 4. DNA-PKcs is essential for DNA damage signal activation. (A) Nuclear extracts prepared from cells treated with control shRNA (shControl) or DNA-PKcs shRNA were incubated without DNA, with dsDNA, or with gDNA, and the indicated proteins were detected by Western blotting. (B) Nuclear / / extracts from HCT116 and HCT116 DNA-PKcs cells were incubated with gDNA, and HCT116 DNA-PKcs nuclear extracts were complemented with increasing amounts of DNA-PK purified from HeLa cells (0.025, 0.05, 0.1, 0.2, and 1 U/µl). (C) Nuclear extracts from cells treated with control shRNA or Ku70 shRNA were incubated for the indicated time periods with gDNA and probed for the indicated proteins by Western blotting. (D) Biotinylated DNA substrates were incubated with nuclear extracts in the absence or presence of IC86621 and pulled down, and the indicated DNA-bound proteins were analyzed by Western blotting. (E) Biotinylated DNA substrates were incubated with nuclear extracts from cells treated with control shRNA or ATR shRNA, isolated, and probed for the indicated proteins. the DNA-PKcs inhibitor IC86621 blocked the phosphorylation beads were incubated with extracts from shRNA-treated cells, of DNA-PKcs on Ser2056 and partially interfered with DNA- and then, protein–DNA complexes were purified and analyzed PKcs phosphorylation on Thr2609 (Fig. 3 A). Surprisingly, the by Western blotting. Fig. 3 C shows that partial depletion of ATR inhibitor ETP-46464 inhibited the phosphorylation of ATR was sufficient to completely abolish the phosphorylation DNA-PKcs on Thr2609, specic fi ally, along with phosphorylation of Chk1 on Ser345 and of DNA-PKcs on Thr2609. of ATR on Thr1989 (Fig. 3 A). Thus, gDNA-induced signaling Because the recruitment of ATR–ATRIP to ssDNA in vitro in cell-free extracts recapitulates a critical step in the regulation is stimulated by RPA (Zou and Elledge, 2003), we knocked down of DNA-PKcs by ATR. The phosphorylation of Xenopus laevis RPA to evaluate its role in gDNA-induced signaling (Fig. 3 D). TopBP1 on Ser1131 augments the capacity of TopBP1 to acti- The amount of total Chk1 protein was significantly reduced in vate the ATR–ATRIP complex (Yoo et al., 2009). TopBP1 was extract prepared from RPA-depleted cells, most likely as a con- also retrieved with biotinylated DNA substrates (Fig. 3 B). sequence of Chk1 activation and degradation in response to stress TopBP1 associated indiscriminately with dsDNA and gDNA, induced by RPA depletion. Chk1, however, was more readily but Ser1138 pTopBP1 was detected preferentially on the gDNA phosphorylated in RPA-depleted nuclear extracts than in con- substrate (Fig. 3 B). Hence, gDNA-specific phosphorylation of trol nuclear extracts (Fig. 3 D). Thus, RPA is not essential for TopBP1 may account for gDNA-induced ATR activation and Chk1 phosphorylation in this experimental setting. Chk1 phosphorylation. Addition of any one of the three PIKKs In response to DNA replication stress, DNA-PKcs and ATR inhibitors to the reaction mixtures interfered with gDNA-induced phosphorylate RPA32 on multiple sites, and these modic fi ations phosphorylation of TopBP1 on Ser1138 and of Chk1 on Ser345 promote DNA repair (Shao et al., 1999; Block et al., 2004; Sakasai (Fig. 3 B). Compared with reaction mixtures containing DNA- et al., 2006; Anantha et al., 2007; Shi et al., 2010; Liaw et al., PKcs or ATR inhibitors, however, ATM inhibition had a lesser 2011). To determine whether DNA-PKcs was necessary for impact on RPA32 phosphorylation (Fig. 3 B). This suggests gDNA-induced ATR signaling, we knocked down DNA-PKcs that ATR and DNA-PKcs can function synergistically to acti- in HeLa cells and then prepared nuclear extracts from these vate DNA damage signaling, in the presence of limited amount cells. The knockdown of DNA-PKcs fully compromised the of ssDNA. phosphorylation of RPA32 and Chk1 induced by linear gDNA To verify the involvement of ATR in gDNA-induced phos- (Fig. 4 A). Consistent with this, gDNA-induced Ser33 pRPA32 phorylation events, we prepared nuclear extracts from HeLa cells and Ser345 pChk1 signals were detected in HCT116 cell-free treated either with a control shRNA or with an shRNA against extracts, absent in extracts prepared from isogenic HCT116 ATR. Biotinylated DNA substrates coupled to streptavidin-coated homozygous knockout of DNA-PKcs, and detected again in Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 425 Figure 5. ATP-dependent assembly of a DNA damage signaling complex. (A) Nuclear extracts were incubated for 10 min at 20°C with gDNA with or without 1 mM AMP-PNP or 1 mM ATP as indicated. Next, the reaction mixture was incubated overnight with an anti-ATR anti- body, and ATR-associated proteins were pulled down with protein G–coupled magnetic beads, resolved by SDS-PAGE, and revealed by Western blotting with the indicated antibodies. (B) ATR immunoprecipitations were conducted as described in A and probed for ATM by Western blotting. (C) Reactions mixtures were assembled as described in A in the presence of 1 mM ATP, with or without 100 µM IC86621, as indicated. (D) Model for the concerted activation of DNA-PKcs and ATR. RPA binds to the ssDNA gap and promotes the recruitment of ATRIP–ATR. Ku binds the dsDNA end, may translocate up to dsDNA to ssDNA junction, and recruits DNA-PKcs. When amounts of RPA-covered ssDNA are limited, the concerted phosphorylation of RPA32 and TopBP1 by DNA-PKcs and ATR promotes signal amplification and assembly of a potent ATR signaling complex. IP, immuno- precipitation; P, phosphorylated. / phosphorylation and ATR activation but is dispensable for the extracts from HCT116 DNA-PKcs cells complemented with congregation of DNA-PKcs, ATR, TopBP1, and Chk1 onto gDNA. recombinant DNA-PK (Fig. 4 B). In addition, ablation of Ku70 by To verify the contribution of DNA-PKcs to ATR activa- shRNA signic fi antly interfered with gDNA-induced phosphory - tion in a cellular context, we subjected U2OS cells to a high dose lation of Chk1 (Fig. 4 C). These data indicate that DNA-PK is of camptothecin (CPT) that induces replication-born DSBs (Shao necessary to prime ATR activation upon assembly onto gDNA. et al., 1999). We detected reduced levels of Ser345 pChk1 in cells To further investigate the intricate links between PI3KKs, treated with shRNAs against DNA-PKcs (Fig. S3 A) or Ku70 we monitored the activation of ATM/Chk2 signaling. Chemical (Fig. S3 B), as well as in cells treated with a small molecule in- inhibition of DNA-PKcs interfered with ATM activation and hibitor of DNA-PKcs (Fig. S3 C). These results indicate that Chk2 phosphorylation without preventing ATM and Chk2 DNA-PKcs contributes to sustain ATR signaling upon the col- binding to DNA (Fig. 4 D). Consistent with this, we did not ob- lapse of replication intermediates. serve gDNA-induced Chk2 phosphorylation in nuclear extracts Here, we have shown that DNA-PKcs and ATR can com- from DNA-PKcs–depleted cells (Fig. 4 E). These observations bine to form a potent DNA damage signaling complex that acti- indicate that DNA-PKcs also connects with ATM signaling in- vates endogenous mediator and effector proteins in the ATR duced by gDNA in cell-free extracts. signal transduction pathway. A recent study has shown that the To verify that DNA-PKcs and ATR signaling proteins as- phosphorylation of RPA32 on Ser4 and Ser8 plays a significant sociate upon gDNA binding and activation, we immunoprecipi- role in ATR-mediated checkpoint activation and that the phos- tated endogenous ATR from reaction mixtures supplemented phorylation of RPA32 on multiple residues is amplified by a re - with gDNA. The pull-down of DNA-PKcs, TopBP1, and Chk1 ciprocal priming effect (Liu et al., 2012). PI3KKs target a subset with an anti-ATR antibody was strictly dependent on the pres- of amino acids, and each phosphorylated amino acid primes the ence of ATP (Fig. 5 A). DNA-PKcs, TopBP1, and Chk1 did not phosphorylation of a subset of N-terminal residues (Liu et al., associate with ATR when ATP was omitted or replaced by the 2012). Consistent with this, our observation that inhibition of nonhydrolyzable analogue AMP-PNP (Fig. 5 A). This indicates DNA-PKcs or ATR abolishes RPA32, TopBP1, and Chk1 phos- that the assembly of the ATR signaling complex on gDNA is phorylation is best explained by an amplification mechanism regulated by phosphorylation events. In contrast, we did not de- dependent on the synergistic action of DNA-PKcs and ATR. tect ATM in the ATR immune precipitate (Fig. 5 B), suggesting At replication-born DSBs, as in cell-free extracts, DNA-PKcs that ATM is not tightly associated with this ATR signaling com- would amplify ATR signals in the presence of a limited amount plex. Ser1138 pTopBP1 and Ser345 pChk1 signals were notice- of RPA-covered ssDNA, through priming of RPA32 and TopBP1 able in the ATR immune precipitate (Fig. 5 C) but not detected in phosphorylation. Previous studies have shown that RPA is nec- extracts containing the DNA-PKcs inhibitor IC86621 (Fig. 5 C), essary to localize ATR–ATRIP at stalled forks but dispensable for consistent with the data presented in Fig. 3 B. In conclusion, Chk1 phosphorylation per se (Ball et al., 2005; Kim et al., 2005). the enzymatic activity of DNA-PKcs is required for TopBP1 426 JCB • VOLUME 202 • NUMBER 3 • 2013 Here, we observed that removal of RPA stimulated gDNA- antibody raised against the peptide NH -Cys-FPENE(pT)PPEGK-COOH) and Ser1138 pTopBP1 (rabbit polyclonal antibody raised against the pep- induced Chk1 phosphorylation in cell-free extracts. These ob- tide NH -Cys-LNTEP(pS)QNEQI-COOH) were gifts from L. Zou (Massachu- servations suggest that although RPA directs ATR–ATRIP to setts General Hospital and Harvard Medical School, Boston, MA) and stalled forks, the ssDNA binding protein is not required for Chk1 W.G. Dunphy (California Institute of Technology, Pasadena, CA), respec- tively. Secondary antibodies (anti–rabbit-HRP and anti–mouse-HRP) were phosphorylation per se and that the hyperphosphorylation of obtained from Promega. RPA bound to ssDNA may overcome a barrier to Chk1 activation. Our data are reminiscent of the findings by Kumagai and RNA interference shRNA vectors were prepared by cloning dsDNA oligonucleotides into Dunphy (2000) who showed that the DNA substrate poly(dA) - pSUPER-Puro (a gift from J. Lingner, Ecole Polytechnique Fédérale de poly(dT) can trigger the phosphorylation of xChk1 in X. laevis Lausanne, Lausanne, Switzerland) as previously described (Azzalin and egg extracts. In this system, ATR activation occurs indepen- Lingner, 2006). The 19-nt target sequences were as follows: for DNA-PKcs, 5-GATCGCACCTTACTCTGTT-3; for ATR, 5-GGAGATTTCCTGAGCA- dently of RPA, through phosphorylation of TopBP1 by ATM TGT-3; for RPA70, 5-CTGGTTGACGAAAGTGGTG-3; and for KU70, (Kim et al., 2005; Yoo et al., 2007). It would be interesting to 5-GGAAGAGATAGTTTGATTT-3. shRNA transfections were performed define the key molecular features of poly(dA) -poly(dT) that 70 70 using Lipofectamine 2000 reagent (Invitrogen). promote xChk1 phosphorylation and to examine whether xDNA- DNA substrates PKcs is also necessary for xChk1 phosphorylation in X. laevis Plasmid pG68 (Ralf et al., 2006) was generated by cloning an array of BbvCI egg extracts. restriction sites (insert A) into pUC18 using EcoRI and HindIII. Insert A is as follows: Pioneering studies have demonstrated that the Ku70/80 5-GAATTCGCCTCATCTCTGGCTTCCCGGATCCCAGGATGCGCAGGC- AGCCGCCTAGGGTGACAGGCTCATGGATATGCTGAGGAATCGCTGA- heterodimer first binds DNA ends independently of their exact GGCGTAGCTGAGGACTAGTGCTGAGGGATCGCTGAGGTGTAGCTGA- structure (Paillard and Strauss, 1991; Falzon et al., 1993) and GGACGTGCTGAGGTGCGTCAGCTACTTGTGAACTCGAGAGGCTCAGTGA- then translocates along duplex DNA to form a beads-on-a-string GTGAAGCTCCATGGCCTAAGGGCAGCAGACTAAGCTT-3. Plasmid pG160 (Gari et al., 2008) was generated by cloning an array of BbvCI and BsmI structure (de Vries et al., 1989; Paillard and Strauss, 1991; restriction sites (insert B) into pUC18 using EcoRI and HindIII. Insert B is as Zhang and Yaneva, 1992). Ku70/80 also exhibits specific affin - follows: 5-GAATTCGCTCCATCTCTGGCTTCCCGCTAGCCATTATGCGCA- ity for ssDNA to dsDNA transitions, including nicks and small GGCAGCCGCCTAGGGTGACAGGCTCATGGATATGAATGCACTCGAG- GAATGCACGGTAGAATGCAAAGAATGCAGGTTGAATGCATTAGAATGC- ssDNA gaps (Blier et al., 1993; Falzon et al., 1993), and DNA- CCCATGGGAATGCACAGAGAATGCAGTATCGAATGCAAATCGAATG- PKcs interacts directly with RPA (Shao et al., 1999). The biochem- CACGTACCTCAGCGATCCCTCAGCACTAGTCCTCAGCTGTACCTCAG- ical properties of DNA-PK components suggest how DNA-PK CACGTCCTCAGCAAGCTT-3. Biotinylated duplex DNA was generated by PCR amplification of may engage in ATR activation at replication-born DSBs. In the plasmid pG68 or of plasmid pG160 using primer 1 (5-biotin-TGCGGCAT- model presented in Fig. 5 C, we propose that Ku70/80 may first CAGAGCAGATTG-3) and primer 2 (5-GCACCCCAGGCTTTACACTTT- bind DNA ends, translocates up to internal nicks and ssDNA ATG-3). To produce gDNA molecules, the duplex amplified from pG68 (68-nt gap) was nicked with NbBbvC1 (New England Biolabs, Inc.), and gaps, and then recruits DNA-PKcs, which phosphorylates RPA the duplex amplified from pGAP160 (160-nt gap) was nicked with BsmI and primes ATR activation. and NtBbvC1 (New England Biolabs, Inc.), resulting in the formation of DNA-PKcs is extremely abundant. It represents 0.1–1% short oligonucleotides (11–13 nt), which were melted by heat denaturation at 80°C and removed using a gel extraction spin column (QIAquick Gel of soluble nuclear proteins in HeLa cells (Carter et al., 1990) Extraction Kit; QIAGEN) as previously described (Ralf et al., 2006). gDNA and, therefore, is very likely to first bind replication-born DSBs. fragments were control digested with SpeI and purified by 0.8% agarose It is tempting to speculate that upon encountering DNA-bound gel electrophoresis and electroelution using an Elutrap device (Schleicher & Schuell BioScience). Open circular pG68 was generated by treatment of RPA at broken replication intermediates, DNA-PKcs would be supercoiled pG68 with topoisomerase I. pG68 was gapped with NbBbvC1 channeled to the ATR signaling pathway at the expense of as described in this paragraph. Plasmid pG68 was linearized with ScaI. NHEJ, thereby contributing to DNA repair pathway choice (Allen et al., 2011). Nuclear extracts Nuclear extracts were prepared using Dignam’s method as previously de- scribed (Shiotani and Zou, 2009). HeLa S3 or HCT116 cells were grown Materials and methods to ≤80% confluence, collected by scrapping and centrifugation (200 g for 3 min at 4°C), and washed twice in PBS. The cell pellet was suspended in Cells, proteins, and chemicals 5× packed cell volume of hypotonic buffer A (10 mM Hepes-KOH, pH 7.9, U2OS and HeLa S3 cells were grown under standard conditions in DMEM 10 mM KCl, 1.5 mM MgCl , 0.5 mM DTT, and 0.5 mM PMSF) supplemented (Invitrogen) supplemented with 10% FBS and 1% penicillin-streptomycin. with a cocktail of protease inhibitors (cOmplete, EDTA free; Roche) and HCT116 (cell line and genotype: HCT116 Hendrickson’s Parental; Horizon phosphatase inhibitors (Thermo Fisher Scientific) and incubated on ice for / Discovery Ltd.) and HCT116 DNA-PKcs cells (clone: w87; cell line and 5 min. Next, the cells were spun down at 500 g for 5 min, suspended in / genotype: HCT116 DNA-PKcs ; Horizon Discovery Ltd.) were cultured in 2× packed cell volume of buffer A and lysed by dounce homogeniza- McCoy’s 5A modie fi d medium (Sigma-Aldrich) supplemented with 10% FBS tion using a tight-fitting pestle. Nuclei were collected by centrifugation at and 1% penicillin-streptomycin. DNA-PK purified from HeLa cells was pur - 4,000 g for 5 min at 4°C and extracted in one nuclei pellet volume of buf- chased from Promega. Streptavidin and CPT were purchased from Sigma- fer C (20 mM Hepes-KOH, pH 7.9, 600 mM KCl, 1.5 mM MgCl , 0.2 mM Aldrich. KU-55933 was obtained from Tocris Bioscience. IC86621 was obtained EDTA, 25% glycerol, 0.5 mM DTT, and 0.5 mM PMSF) supplemented with from Merck. ETP-46464 was a gift from O. Fernandez-Capetillo (Spanish cocktails of protease and phosphatase inhibitors, and mixed on a rotating National Cancer Research Centre, Madrid, Spain; Toledo et al., 2011). wheel at 4°C for 30 min. Nuclear extracts (supernatants) were recovered by centrifugation (16,000 g for 15 min at 4°C) and dialyzed using Slide- Antibodies A-Lyzer Dialysis Cassettes (3,500-D protein molecular weight cutoff; Thermo Primary antibodies were purchased from Abcam (DNA-PKcs and DNA- Fisher Scientific) against buffer D (20 mM Hepes-KOH, pH 7.9, 100 mM PKcs-S2056), Bethyl Laboratories, Inc. (ATM, ATR, TopBP1, RPA32-Ser33, KCl, 0.2 mM EDTA, 20% glycerol, 0.5 mM DTT, and 0.5 mM PMSF). Dia- and RPA32-Ser4/S8), EMD Millipore (RPA32 and Chk2), Cell Signaling lyzed nuclear extracts were centrifuged (100,000 g for 30 min at 4°C) to Technology (Chk1-Ser345 and Chk2-Thr68), Rockland (ATM-Ser1981), eliminate residual precipitates. The protein concentration of the clear super- Thermo Fisher Scientific (DNA-PKcs-Thr2609), and Santa Cruz Biotech - natant was determined using Bradford’s estimation method, and aliquots nology, Inc. (Chk1). Antibodies against Ser1989 pATR (rabbit polyclonal were snap frozen and stored at 80°C. Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 427 damage-induced phosphorylation of the 32 kDa subunit of replication ATR activation assay protein A at threonine 21. Nucleic Acids Res. 32:997–1005. http://dx.doi.org/ 10 µl reaction mixtures contained 5 µg nuclear extracts, 5 nM of the indi- 10.1093/nar/gkh265 cated DNA substrates, 10 mM Hepes-KOH, pH 7.6, 50 mM KCl, 0.1 mM Byun, T.S., M. Pacek, M.C. Yee, J.C. Walter, and K.A. Cimprich. 2005. MgCl , 1 mM PMSF, 0.5 mM DTT, 1 mM ATP, 10 µg/ml creatine kinase, Functional uncoupling of MCM helicase and DNA polymerase activities and 5 mM phosphocreatine. AMP-PNP, used at 1 mM when indicated, activates the ATR-dependent checkpoint. Genes Dev. 19:1040–1052. was obtained from Roche. Phosphorylation reactions were conducted at http://dx.doi.org/10.1101/gad.1301205 37°C for 15 min, unless otherwise indicated, and stopped with 10 µl of 2× Carter, T., I. Vancurová, I. Sun, W. Lou, and S. DeLeon. 1990. A DNA-activated protein sample buffer (125 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 100 mM protein kinase from HeLa cell nuclei. Mol. Cell. Biol. 10:6460–6471. DTT, 2% -mercaptoethanol, and 0.004% bromophenol blue) for 3 min at Choi, J.H., L.A. Lindsey-Boltz, M. Kemp, A.C. Mason, M.S. Wold, and A. 37°C. For ATR pull-down experiments, reaction mixtures were supple- Sancar. 2010. Reconstitution of RPA-covered single-stranded DNA- mented with 1 µg anti-ATR antibody and incubated overnight on a rotated activated ATR-Chk1 signaling. Proc. Natl. Acad. Sci. USA. 107:13660– wheel at 4°C. Antibody–protein complexes were immunoprecipitated for 13665. http://dx.doi.org/10.1073/pnas.1007856107 1 h at 4°C with Dynabeads coupled to protein G (Invitrogen), washed, and de Vries, E., W. van Driel, W.G. Bergsma, A.C. Arnberg, and P.C. van der Vliet. resuspended in 2× protein sample buffer for Western blot analysis. 1989. HeLa nuclear protein recognizing DNA termini and translocating on DNA forming a regular DNA-multimeric protein complex. J. Mol. DNA pull-down assay Biol. 208:65–78. http://dx.doi.org/10.1016/0022-2836(89)90088-0 Biotinylated DNA duplexes (500 ng) were attached to 5 µl streptavidin- Dvir, A., S.R. Peterson, M.W. Knuth, H. Lu, and W.S. Dynan. 1992. Ku autoan- coated magnetic beads (Bio-Adembeads; ADEMTECH) in binding and tigen is the regulatory component of a template-associated protein kinase washing buffer (100 mM Tris, pH 7.5, and 1 M NaCl) and incubated for that phosphorylates RNA polymerase II. Proc. Natl. Acad. Sci. USA. 15 min at room temperature. Then, the beads were washed with 10 mM 89:11920–11924. http://dx.doi.org/10.1073/pnas.89.24.11920 Hepes, pH 7.6, 100 mM KOAc, and 0.1 mM MgOAc and resuspended in Falzon, M., J.W. Fewell, and E.L. Kuff. 1993. EBP-80, a transcription factor reaction buffer (10 mM Hepes, pH 7.6, 50 mM KOAc, 0.1 mM MgOAC, closely resembling the human autoantigen Ku, recognizes single- to double- 1 mM PMSF, 0.5 mM DTT, 1 mM ATP, pH 7.0, 10 µg/ml creatine phos- strand transitions in DNA. J. Biol. Chem. 268:10546–10552. phate, 5 mM phosphocreatine, and 0.5 mg/ml BSA). 50 µl reaction mix- Gari, K., C. Décaillet, M. Delannoy, L. Wu, and A. Constantinou. 2008. tures containing 20 µg nuclear extracts and 500 ng DNA duplexes coupled Remodeling of DNA replication structures by the branch point translo- to magnetic beads were incubated for 10 min at 37°C in reaction buffer. case FANCM. Proc. Natl. Acad. Sci. USA. 105:16107–16112. http://dx .doi.org/10.1073/pnas.0804777105 Online supplemental material Gorgoulis, V.G., L.V. Vassiliou, P. Karakaidos, P. Zacharatos, A. Kotsinas, T. Fig. S1 summarizes schematically how broken replication intermediates con- Liloglou, M. Venere, R.A. Ditullio Jr., N.G. Kastrinakis, B. Levy, et al. taining DNA ends and ssDNA gaps are generated under stressful con- 2005. Activation of the DNA damage checkpoint and genomic instability ditions of DNA replication. Fig. S2 provides further information on the in human precancerous lesions. Nature. 434:907–913. http://dx.doi.org/ stability of DNA substrates in cell-free extracts and on key DNA structural 10.1038/nature03485 determinants in ATR signaling. Fig. S3 shows that DNA-PKcs contributes Gottlieb, T.M., and S.P. Jackson. 1993. The DNA-dependent protein kinase: re- to ATR signaling in U2OS cells exposed to the topoisomerase I poison quirement for DNA ends and association with Ku antigen. Cell. 72:131– CPT. Online supplemental material is available at http://www.jcb.org/ 142. http://dx.doi.org/10.1016/0092-8674(93)90057-W cgi/content/full/jcb.201304139/DC1. Guo, Z., A. Kumagai, S.X. Wang, and W.G. Dunphy. 2000. Requirement for Atr in phosphorylation of Chk1 and cell cycle regulation in response to DNA We thank William G. Dunphy, Oscar Fernandez-Capetillo, and Joachim Lingner replication blocks and UV-damaged DNA in Xenopus egg extracts. Genes for sharing reagents, Lee Zou for reagents and for helpful comments, and Dev. 14:2745–2756. http://dx.doi.org/10.1101/gad.842500 Philippe Pasero, Kerstin Gari, and all of the laboratory members for critical read- Hanada, K., M. Budzowska, S.L. Davies, E. van Drunen, H. Onizawa, H.B. ing of the manuscript. Beverloo, A. Maas, J. Essers, I.D. Hickson, and R. Kanaar. 2007. The This work was supported by the Fondation ARC pour la recherche sur structure-specific endonuclease Mus81 contributes to replication restart le cancer, by Agence Nationale de la Recherche, and by the Swiss National by generating double-strand DNA breaks. Nat. Struct. Mol. Biol. 14: 1096–1104. http://dx.doi.org/10.1038/nsmb1313 Science Foundation. Jackson, S.P., and J. Bartek. 2009. The DNA-damage response in human bi- Submitted: 22 April 2013 ology and disease. Nature. 461:1071–1078. http://dx.doi.org/10.1038/ nature08467 Accepted: 20 June 2013 Kim, S.M., A. Kumagai, J. Lee, and W.G. Dunphy. 2005. Phosphorylation of Chk1 by ATM- and Rad3-related (ATR) in Xenopus egg extracts requires binding of ATRIP to ATR but not the stable DNA-binding or coiled-coil References domains of ATRIP. J. Biol. Chem. 280:38355–38364. http://dx.doi.org/ 10.1074/jbc.M508673200 Abraham, R.T. 2001. Cell cycle checkpoint signaling through the ATM and Kumagai, A., and W.G. Dunphy. 2000. Claspin, a novel protein required for ATR kinases. Genes Dev. 15:2177–2196. http://dx.doi.org/10.1101/gad the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts. Mol. Cell. 6:839–849. http://dx.doi.org/10.1016/ Allen, C., A.K. Ashley, R. Hromas, and J.A. Nickoloff. 2011. More forks on the S1097-2765(05)00092-4 road to replication stress recovery. J. Mol. Cell Biol. 3:4–12. http://dx.doi Kumagai, A., J. Lee, H.Y. Yoo, and W.G. Dunphy. 2006. TopBP1 activates .org/10.1093/jmcb/mjq049 the ATR-ATRIP complex. Cell. 124:943–955. http://dx.doi.org/10.1016/ Anantha, R.W., V.M. Vassin, and J.A. Borowiec. 2007. Sequential and synergistic j.cell.2005.12.041 modic fi ation of human RPA stimulates chromosomal DNA repair. J. Biol. Lao, Y., C.G. Lee, and M.S. Wold. 1999. Replication protein A interactions Chem. 282:35910–35923. http://dx.doi.org/10.1074/jbc.M704645200 with DNA. 2. Characterization of double-stranded DNA-binding/ Azzalin, C.M., and J. Lingner. 2006. The human RNA surveillance factor UPF1 helix-destabilization activities and the role of the zinc-finger domain in is required for S phase progression and genome stability. Curr. Biol. DNA interactions. Biochemistry. 38:3974–3984. http://dx.doi.org/10.1021/ 16:433–439. http://dx.doi.org/10.1016/j.cub.2006.01.018 bi982371m Ball, H.L., J.S. Myers, and D. Cortez. 2005. ATRIP binding to replication pro- Liaw, H., D. Lee, and K. Myung. 2011. DNA-PK-dependent RPA2 hyper- tein A-single-stranded DNA promotes ATR-ATRIP localization but is phosphorylation facilitates DNA repair and suppresses sister chromatid dispensable for Chk1 phosphorylation. Mol. Biol. Cell. 16:2372–2381. exchange. PLoS ONE. 6:e21424. http://dx.doi.org/10.1371/journal http://dx.doi.org/10.1091/mbc.E04-11-1006 .pone.0021424 Bartkova, J., Z. Horejsí, K. Koed, A. Krämer, F. Tort, K. Zieger, P. Guldberg, M. Liu, Q., S. Guntuku, X.S. Cui, S. Matsuoka, D. Cortez, K. Tamai, G. Luo, S. Carattini- Sehested, J.M. Nesland, C. Lukas, et al. 2005. DNA damage response as Rivera, F. DeMayo, A. Bradley, et al. 2000. Chk1 is an essential kinase that a candidate anti-cancer barrier in early human tumorigenesis. Nature. is regulated by Atr and required for the G(2)/M DNA damage checkpoint. 434:864–870. http://dx.doi.org/10.1038/nature03482 Genes Dev. 14:1448–1459. http://dx.doi.org/10.1101/gad.14.12.1448 Blier, P.R., A.J. Griffith, J. Craft, and J.A. Hardin. 1993. Binding of Ku protein Liu, S., S.O. Opiyo, K. Manthey, J.G. Glanzer, A.K. Ashley, C. Amerin, K. to DNA. Measurement of affinity for ends and demonstration of binding Troksa, M. Shrivastav, J.A. Nickoloff, and G.G. Oakley. 2012. Distinct to nicks. J. Biol. Chem. 268:7594–7601. roles for DNA-PK, ATM and ATR in RPA phosphorylation and check- Block, W.D., Y. Yu, and S.P. Lees-Miller. 2004. Phosphatidyl inositol 3-kinase- point activation in response to replication stress. Nucleic Acids Res. like serine/threonine protein kinases (PIKKs) are required for DNA 40:10780–10794. http://dx.doi.org/10.1093/nar/gks849 428 JCB • VOLUME 202 • NUMBER 3 • 2013 Lopes, M., M. Foiani, and J.M. Sogo. 2006. Multiple mechanisms control chro- mosome integrity after replication fork uncoupling and restart at irrepara- ble UV lesions. Mol. Cell. 21:15–27. http://dx.doi.org/10.1016/j.molcel .2005.11.015 MacDougall, C.A., T.S. Byun, C. Van, M.C. Yee, and K.A. Cimprich. 2007. The structural determinants of checkpoint activation. Genes Dev. 21:898–903. http://dx.doi.org/10.1101/gad.1522607 Matsuoka, S., B.A. Ballif, A. Smogorzewska, E.R. McDonald III, K.E. Hurov, J. Luo, C.E. Bakalarski, Z. Zhao, N. Solimini, Y. Lerenthal, et al. 2007. ATM and ATR substrate analysis reveals extensive protein networks re- sponsive to DNA damage. Science. 316:1160–1166. http://dx.doi.org/10 .1126/science.1140321 Meek, K., V. Dang, and S.P. Lees-Miller. 2008. DNA-PK: the means to justify the ends? Adv. Immunol. 99:33–58. http://dx.doi.org/10.1016/S0065-2776(08)00602-0 Neelsen, K.J., I.M. Zanini, R. Herrador, and M. Lopes. 2013. Oncogenes induce genotoxic stress by mitotic processing of unusual replication intermedi- ates. J. Cell Biol. 200:699–708. http://dx.doi.org/10.1083/jcb.201212058 Olson, E., C.J. Nievera, V. Klimovich, E. Fanning, and X. Wu. 2006. RPA2 is a di- rect downstream target for ATR to regulate the S-phase checkpoint. J. Biol. Chem. 281:39517–39533. http://dx.doi.org/10.1074/jbc.M605121200 Paillard, S., and F. Strauss. 1991. Analysis of the mechanism of interaction of simian Ku protein with DNA. Nucleic Acids Res. 19:5619–5624. http:// dx.doi.org/10.1093/nar/19.20.5619 Ralf, C., I.D. Hickson, and L. Wu. 2006. The Bloom’s syndrome helicase can promote the regression of a model replication fork. J. Biol. Chem. 281:22839–22846. http://dx.doi.org/10.1074/jbc.M604268200 Ray Chaudhuri, A., Y. Hashimoto, R. Herrador, K.J. Neelsen, D. Fachinetti, R. Bermejo, A. Cocito, V. Costanzo, and M. Lopes. 2012. Topoisomerase I poisoning results in PARP-mediated replication fork reversal. Nat. Struct. Mol. Biol. 19:417–423. http://dx.doi.org/10.1038/nsmb.2258 Sakasai, R., K. Shinohe, Y. Ichijima, N. Okita, A. Shibata, K. Asahina, and H. Teraoka. 2006. Differential involvement of phosphatidylinositol 3-kinase- related protein kinases in hyperphosphorylation of replication protein A2 in response to replication-mediated DNA double-strand breaks. Genes Cells. 11:237–246. http://dx.doi.org/10.1111/j.1365-2443.2006.00942.x Shao, R.G., C.X. Cao, H. Zhang, K.W. Kohn, M.S. Wold, and Y. Pommier. 1999. Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissoci- ates RPA:DNA-PK complexes. EMBO J. 18:1397–1406. http://dx.doi .org/10.1093/emboj/18.5.1397 Shi, W., Z. Feng, J. Zhang, I. Gonzalez-Suarez, R.P. Vanderwaal, X. Wu, S.N. Powell, J.L. Roti Roti, S. Gonzalo, and J. Zhang. 2010. The role of RPA2 phos- phorylation in homologous recombination in response to replication ar- rest. Carcinogenesis. 31:994–1002. http://dx.doi.org/10.1093/carcin/bgq035 Shiotani, B., and L. Zou. 2009. Single-stranded DNA orchestrates an ATM- to-ATR switch at DNA breaks. Mol. Cell. 33:547–558. http://dx.doi.org/ 10.1016/j.molcel.2009.01.024 Smith, G.C., and S.P. Jackson. 1999. The DNA-dependent protein kinase. Genes Dev. 13:916–934. http://dx.doi.org/10.1101/gad.13.8.916 Szakal, B., and D. Branzei. 2013. Premature Cdk1/Cdc5/Mus81 pathway activa- tion induces aberrant replication and deleterious crossover. EMBO J. 32:1155–1167. http://dx.doi.org/10.1038/emboj.2013.67 Toledo, L.I., M. Murga, R. Zur, R. Soria, A. Rodriguez, S. Martinez, J. Oyarzabal, J. Pastor, J.R. Bischoff, and O. Fernandez-Capetillo. 2011. A cell-based screen identie fi s ATR inhibitors with synthetic lethal properties for cancer- associated mutations. Nat. Struct. Mol. Biol. 18:721–727. http://dx.doi .org/10.1038/nsmb.2076 Van, C., S. Yan, W.M. Michael, S. Waga, and K.A. Cimprich. 2010. Continued primer synthesis at stalled replication forks contributes to checkpoint activation. J. Cell Biol. 189:233–246. http://dx.doi .org/10.1083/jcb.200909105 Yajima, H., K.J. Lee, and B.P. Chen. 2006. ATR-dependent phosphorylation of DNA-dependent protein kinase catalytic subunit in response to UV-induced replication stress. Mol. Cell. Biol. 26:7520–7528. http://dx.doi.org/10.1128/ MCB.00048-06 Yoo, H.Y., A. Kumagai, A. Shevchenko, A. Shevchenko, and W.G. Dunphy. 2007. Ataxia-telangiectasia mutated (ATM)-dependent activation of ATR occurs through phosphorylation of TopBP1 by ATM. J. Biol. Chem. 282:17501–17506. http://dx.doi.org/10.1074/jbc.M701770200 Yoo, H.Y., A. Kumagai, A. Shevchenko, A. Shevchenko, and W.G. Dunphy. 2009. The Mre11-Rad50-Nbs1 complex mediates activation of TopBP1 by ATM. Mol. Biol. Cell. 20:2351–2360. http://dx.doi.org/10.1091/mbc.E08-12-1190 Zhang, W.W., and M. Yaneva. 1992. On the mechanisms of Ku protein binding to DNA. Biochem. Biophys. Res. Commun. 186:574–579. http://dx.doi .org/10.1016/S0006-291X(05)80847-2 Zou, L., and S.J. Elledge. 2003. Sensing DNA damage through ATRIP recogni- tion of RPA-ssDNA complexes. Science. 300:1542–1548. http://dx.doi.org/ 10.1126/science.1083430 Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 429 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Cell Biology Pubmed Central

DNA structure-specific priming of ATR activation by DNA-PKcs

Vidal-Eychenié, Sophie; Décaillet, Chantal; Basbous, Jihane; Constantinou, Angelos
The Journal of Cell Biology , Volume 202 (3) – Aug 5, 2013
Download PDF
9 pages

Loading next page...
 
/lp/pubmed-central/dna-structure-specific-priming-of-atr-activation-by-dna-pkcs-2qnEB0Ythu

References (53)

Publisher
Pubmed Central
Copyright
© 2013 Vidal-Eychenié et al.
ISSN
0021-9525
eISSN
1540-8140
DOI
10.1083/jcb.201304139
Publisher site
See Article on Publisher Site

Abstract

JCB: Report DNA structure-specific priming of ATR activation by DNA-PKcs 1 2 1 1 Sophie Vidal-Eychenié, Chantal Décaillet, Jihane Basbous, and Angelos Constantinou Institute of Human Genetics, Unité Propre de Recherche 1142, Centre National de la Recherche Scientifique, 34396 Montpellier, France Department of Biochemistry, University of Lausanne, 1066 Epalinges s/Lausanne, Switzerland hree phosphatidylinositol-3-kinase–related protein In this paper, we show that the juxtaposition of a double- kinases implement cellular responses to DNA damage. stranded DNA end and a short ssDNA gap triggered ro- TDNA-dependent protein kinase catalytic subunit bust activation of endogenous ATR and Chk1 in human (DNA-PKcs) and ataxia-telangiectasia mutated respond cell-free extracts. This DNA damage signal depended on primarily to DNA double-strand breaks (DSBs). Ataxia- DNA-PKcs and ATR, which congregated onto gapped lin- telangiectasia and RAD3-related (ATR) signals the ac- ear duplex DNA. DNA-PKcs primed ATR/Chk1 activation cumulation of replication protein A (RPA)–covered through DNA structure-specific phosphorylation of RPA32 single-stranded DNA (ssDNA), which is caused by repli- and TopBP1. The synergistic activation of DNA-PKcs and cation obstacles. Stalled replication intermediates can fur- ATR suggests that the two kinases combine to mount a ther degenerate and yield replication-associated DSBs. prompt and specific response to replication-born DSBs. Introduction From the early stages of carcinogenesis, replication-associated accumulate (Byun et al., 2005; MacDougall et al., 2007; Van lesions trigger DNA damage responses (Bartkova et al., 2005; et al., 2010). The recruitment of ATR to stalled replication forks Gorgoulis et al., 2005), which are mediated by the phosphatidy- is mediated by ATRIP, which binds human replication protein linositol-3-kinase–like protein kinases (PI3KKs) ataxia-telangiectasia A (RPA) bound to ssDNA (Zou and Elledge, 2003). ATRIP also mutated (ATM), ataxia-telangiectasia and RAD3-related (ATR), facilitates the recruitment of TopBP1 (Choi et al., 2010), a direct and DNA-dependent protein kinase (DNA-PK) catalytic subunit activator of the ATR–ATRIP complex (Kumagai et al., 2006). (DNA-PKcs). ATM signals DNA double-strand breaks (DSBs), DNA-PKcs is recruited to DNA ends by Ku70–Ku80 and whereas ATR responds to a variety of obstacles that block the activated upon binding to DNA (Dvir et al., 1992; Gottlieb and progression of replication forks (Jackson and Bartek, 2009). Jackson, 1993). DNA-PKcs is a central component of the machin- Activated ATM and ATR phosphorylate hundreds of substrate ery that repairs DSBs by nonhomologous end joining (NHEJ; proteins to activate DNA repair mechanisms and adjust ongoing Smith and Jackson, 1999). DNA-PKcs has additional functions, physiological processes (Matsuoka et al., 2007). Two important notably in telomere maintenance and in the response to DNA targets of ATR and ATM are Chk1 and Chk2, which implement replication stress (Smith and Jackson, 1999; Allen et al., 2011). cell cycle checkpoints (Abraham, 2001). DNA-PKcs and ATR phosphorylate the 32-kD subunit of ATR activation depends on the nucleation of multiple human RPA (RPA32) on multiple sites and these modifications factors that bind single-stranded DNA (ssDNA) and 5 double- promote DNA repair (Shao et al., 1999; Block et al., 2004; stranded DNA to single-stranded DNA (ds/ssDNA) junctions Sakasai et al., 2006; Anantha et al., 2007; Shi et al., 2010; Liaw (MacDougall et al., 2007; Van et al., 2010). The ATR sig- et al., 2011). The underlying mechanism of functional cross talk nal is amplified when either ssDNA or ds/ssDNA junctions between DNA-PKcs and ATR, however, remains elusive, and intriguing, as DNA-PKcs and ATR are recruited to and activated S. Vidal-Eychenié, C. Décaillet, and J. Basbous contributed equally to this paper. by distinct DNA structural elements, respectively, by DSBs and Correspondence to Angelos Constantinou: [email protected] by RPA-covered ssDNA. Abbreviations used in this paper: ATM, ataxia-telangiectasia mutated; ATR, ataxia-telangiectasia and RAD3 related; CPT, camptothecin; DNA-PK, DNA- © 2013 Vidal-Eychenié et al. This article is distributed under the terms of an Attribution– dependent protein kinase; DNA-PKcs, DNA-PK catalytic subunit; DSB, double- Noncommercial–Share Alike–No Mirror Sites license for the r fi st six months after the publication strand break; dsDNA, double-stranded DNA; gDNA, gapped DNA; NHEJ, date (see http://www.rupress.org/terms). After six months it is available under a Creative nonhomologous end joining; PI3KK, phosphatidylinositol-3-kinase–like protein Commons License (Attribution–Noncommercial–Share Alike 3.0 Unported license, as described kinase; RPA, replication protein A; ssDNA, single-stranded DNA. at http://creativecommons.org/licenses/by-nc-sa/3.0/). The Rockefeller University Press $30.00 J. Cell Biol. Vol. 202 No. 3 421–429 www.jcb.org/cgi/doi/10.1083/jcb.201304139 JCB 421 THE JOURNAL OF CELL BIOLOGY Figure 1. DNA damage signal activation in human cell-free extracts. (A) The duplex DNA substrates are blunt ended and 573 bp long. The gDNA contains a 68-nt single-stranded gap. (B) The gDNA is refractory to digestion with SpeI. (C) gDNA-specific phosphorylation of RPA32 and Chk1. Nuclear extracts were incubated without DNA (lane 1), with duplex DNA (lane 2), or with gDNA (lane 3). The indicated proteins were analyzed by Western blotting. (D) Proteins bound to biotinylated DNA were pulled down with streptavidin- coated beads and detected by Western blotting. The dsDNA and gDNA substrates are represented schematically. Biotin (black circles) and streptavidin-coated beads (dented gray circles) are shown. To gain insights into the mechanisms of replication check- in the presence of gDNA (Fig. 1 C). In contrast, markers of ATR point signaling, we designed a DNA substrate that contains activation were not visible when extracts were incubated with- dsDNA ends and a short ssDNA gap. In human cell-free extracts, out DNA or in the presence of dsDNA (Fig. 1 C). To verify that linear gapped DNA (gDNA) promotes the assembly of a potent DNA damage signals emanated from the defined gDNA mole - ATR signaling complex that includes DNA-PKcs, ATR, RPA, cules, we labeled DNA substrates with biotin and then iso- and TopBP1. We propose a novel mechanism for the coopera- lated biotin DNA substrates from the reaction mixtures using tion of DNA-PKcs and ATR at collapsed replication forks. streptavidin-coated beads. Ser345 pChk1 and Ser33 pRPA32 were pulled down exclusively with gDNA (Fig. 1 D). RPA32 also bound the DNA duplex (Fig. 1 D), most likely as a result of Results and discussion helix destabilization and binding to ssDNA (Lao et al., 1999). Induction of RPA and Chk1 phosphorylation Ser33 pRPA32, however, was detected principally in associa- in human cell-free extracts tion with the gDNA substrate (Fig. 1 D). During DNA replication, oncogenes and chemotherapeutic agents Presumably, DNA damage signaling does not depend on induce the accumulation of ssDNA gaps in newly replicated DNA DNA end resection because the DNA ends of duplex DNA and and four-way junctions at replication forks (Fig. S1; Lopes et al., gDNA molecules would be equally susceptible to nucleases, 2006; Ray Chaudhuri et al., 2012; Neelsen et al., 2013). Whereas and yet phosphorylation reactions were prompt and gDNA spe- ssDNA gaps are fragile and prone to breaking (Lopes et al., cific (Fig. 1). Consistent with this, we did not detect significant 2006), overwhelming DNA replication stress or checkpoint de- DNA degradation during a 1-h incubation in nuclear extracts fects can lead to the precocious processing of regressed forks by (Fig. S2 A). In addition, linear DNA duplexes containing either Mus81-Eme1 (Hanada et al., 2007; Neelsen et al., 2013; Szakal a 68- or a 160-nt ssDNA gap equally induced Chk1 phosphory- and Branzei, 2013). The collapse of these unusual replication lation (Fig. S2 B), suggesting that nucleolytic enlargement of intermediates is expected to yield DSBs that can activate DNA- the ssDNA gap is not essential to trigger Chk1 activation. These PKcs and ATM in DNA molecules containing ssDNA gaps that data indicate that linear duplex DNA with a short ssDNA gap can trigger ATR activation (Fig. S1). To study how DNA mole- can promote the formation of a singularly active DNA damage cules that mimic broken replication intermediates are detected signaling complex that phosphorylates endogenous protein sub- and signaled, we designed a linear duplex DNA molecule that strates in human cell-free extracts. contains one defined ssDNA gap (gDNA). The 573-bp DNA duplex was generated by PCR amplification of a DNA template Juxtaposed DNA gap and DNA ends induce (pG68) that comprises closely spaced recognition sites for a robust phosphorylation of RPA and Chk1 nicking endonuclease (Ralf et al., 2006). The nicks yield short To dissect the structural determinants of DNA that activate oligonucleotides eliminated by heat denaturation. This treatment DNA damage signaling, we supplemented the human nuclear creates a 68-nt ssDNA gap in the DNA duplex and removes a extract with different forms of plasmid pG68 (Ralf et al., 2006). SpeI restriction site (Fig. 1, A and B). In addition to Ser33 pRPA32 and Ser345 pChk1, we probed To monitor DNA damage signaling in vitro, we used human the extracts for DNA-PKcs autophosphorylation on Ser2056, a cell-free extracts and probed by Western blotting the phosphory- marker of DNA-PKcs activation that occurs upon binding of lation of RPA32 at Ser33 (Olson et al., 2006) and of Chk1 at DNA-PKcs to DNA ends. In an open circular form, the plasmid Ser345 (Guo et al., 2000; Liu et al., 2000). These phosphosig- induced background phosphorylation of RPA32 on Ser33 and nals were induced in cell-free extracts after incubation for 15 min of DNA-PKcs on Ser2056, after 1 h of incubation in cell-free 422 JCB • VOLUME 202 • NUMBER 3 • 2013 Figure 2. The juxtaposition of DNA ends and an ssDNA gap triggers activation of the DNA damage signal. (A) Nuclear extracts were incubated for the indicated time periods with open circular plasmid DNA (lanes 1–5), linear duplex DNA (lanes 6–10), gap circular DNA (lanes 11–15), or gapped lin- ear duplex DNA (lanes 16–20). The indicated proteins were analyzed by Western blotting. (B) ATR activation depends on accessible DNA ends. (lanes 1–3) dsDNA and gDNA were biotinylated at both ends and incubated with nuclear extracts. (lanes 4–6) Biotinylated DNA substrates (5 nM) were prein- cubated with 30 nM streptavidin for 15 min at 37°C before addition of nuclear extracts. (lanes 7–9) Unmodified DNA sub - strates were preincubated with streptavidin before addition of nuclear extracts. The DNA substrates are represented sche- matically. Biotin (black circles) and streptavidin (gray circles) are shown. extracts (Fig. 2 A). As expected, linearized pG68 promptly trig- efficient than in a reaction mixture supplemented with gapped gered DNA-PKcs autophosphorylation on Ser2056, whereas linear duplex DNA (Fig. S2 C). In contrast, the induction of Chk1 and RPA32 remained unmodified (Fig. 2 A). The gapped DNA-PKcs autophosphorylation was equivalent in both reactions circular plasmid DNA did not induce phosphosignals above (Fig. S2 C). Hence, the close juxtaposition of a dsDNA end and an background levels (Fig. 2 A). In contrast, Ser345 pChk1 and ssDNA gap promotes DNA damage signaling. Although the dis- Ser33 pRPA32 were detected already after a 5-min incuba- tance between the DNA ends and the ssDNA gap was increased tion with gapped linear duplex DNA (Fig. 2 A). In a reaction by more than fivefold in plasmid-based gDNA (Fig. 2 A) com - mixture containing a combination of linear duplex DNA and pared with PCR-based gDNA (Fig. 1 A), both DNA substrates gapped circular DNA molecules, Chk1 phosphorylation was less were potent inducers of DNA damage signaling. This indicates Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 423 Figure 3. Concerted activation of DNA damage signaling by DNA-PKcs, ATM, and ATR. (A) DNA-PKcs, ATM, and ATR bind to the biotinylated DNA substrates. DNA structures biotinylated at one DNA end were coupled to streptavidin-coated beads and then incubated with nuclear extracts for 10 min at 20°C, in the absence or presence of the DNA-PKcs inhibitor IC86621 (100 µM), the ATM inhibitor KU-55933 (10 µM), or the ATR inhibitor ETP-46464 (1 µM), as indicated. DNA-bound DNA-PKcs, ATM, and ATR were pulled down with streptavidin-coated beads, resolved by SDS-PAGE, and detected by Western blotting. (B) DNA-bound TopBP1 and Chk1 were isolated and detected as described in A. (C) Nuclear extracts prepared from cells treated with control shRNA or ATR shRNA were incubated with the indicated biotinylated DNA substrates, as described in A. ATR, DNA-PKcs, and Chk1 proteins were pulled down with streptavidin-coated beads, resolved by SDS-PAGE, and detected by Western blotting. (D) Nuclear extracts from cells treated with control shRNA or RPA shRNA were incubated for the indicated time periods with gDNA and probed for the indicated proteins by Western blotting. iDNA-PKcs, inhibitor of DNA-PKcs; iATM, inhibitor of ATM; iATR, inhibitor of ATR. that DNA damage signaling reactions are permissive to variations at collapsed replication forks, we coupled the DNA fragments of the distance between the DNA ends and the ssDNA region. labeled with biotin at only one end with streptavidin-coated beads To confirm that DNA ends were necessary to potentiate and then incubated the beads in nuclear extracts. The beads were signals emanating from ssDNA, we labeled both 5 ends of the isolated, and proteins associated with gDNA were analyzed by PCR-amplified gDNA product with biotin. 5 -biotin labels did Western blotting. ATM, ATR, and DNA-PKcs were all pulled not impinge on gDNA-induced phosphorylation of DNA-PKcs down with biotinylated DNA substrates (Fig. 3 A). and RPA32 (Fig. 2 B). When streptavidin was added to the re- We then sought evidence of regulatory interplay between action mixture, however, phosphorylation reactions induced by PIKKs using ATR-, ATM-, and DNA-PKcs–specific inhibitors. biotin-labeled gDNA were inhibited (Fig. 2 B), most likely as a Two major clusters of phosphorylation sites in DNA-PKcs reg- consequence of steric hindrance caused by streptavidin–biotin ulate the processing of DNA ends (Meek et al., 2008). DNA-PKcs complexes at DNA ends. Consistent with this, streptavidin had autophosphorylation within the PQR cluster (Ser2056 cluster), no impact on phosphorylation reactions induced by gDNA in the protects DNA ends from nucleolytic resection while allowing absence of 5-biotin labels (Fig. 2 B). In conclusion, the juxta- access to components of the NHEJ machinery (Meek et al., 2008). position of an ssDNA gap and DNA ends triggers the phos- In contrast, phosphorylation of DNA-PKcs within the ABCDE phorylation of RPA32 and Chk1 in human cell-free extracts. cluster (Thr2609 cluster) allows access to enzymes that trim DNA ends to promote homologous recombination (Meek et al., Linear gDNA promotes the assembly of a 2008). This modification can be mediated by ATR in response potent ATR signaling complex to UV-induced DNA replication stress (Yajima et al., 2006). The To characterize the composition of the DNA damage signaling ATM-specific inhibitor KU-55933 had no major impact on the complex and mimic single-ended DNA molecules that may arise phosphorylation of DNA-PKcs and ATR (Fig. 3 A). In contrast, 424 JCB • VOLUME 202 • NUMBER 3 • 2013 Figure 4. DNA-PKcs is essential for DNA damage signal activation. (A) Nuclear extracts prepared from cells treated with control shRNA (shControl) or DNA-PKcs shRNA were incubated without DNA, with dsDNA, or with gDNA, and the indicated proteins were detected by Western blotting. (B) Nuclear / / extracts from HCT116 and HCT116 DNA-PKcs cells were incubated with gDNA, and HCT116 DNA-PKcs nuclear extracts were complemented with increasing amounts of DNA-PK purified from HeLa cells (0.025, 0.05, 0.1, 0.2, and 1 U/µl). (C) Nuclear extracts from cells treated with control shRNA or Ku70 shRNA were incubated for the indicated time periods with gDNA and probed for the indicated proteins by Western blotting. (D) Biotinylated DNA substrates were incubated with nuclear extracts in the absence or presence of IC86621 and pulled down, and the indicated DNA-bound proteins were analyzed by Western blotting. (E) Biotinylated DNA substrates were incubated with nuclear extracts from cells treated with control shRNA or ATR shRNA, isolated, and probed for the indicated proteins. the DNA-PKcs inhibitor IC86621 blocked the phosphorylation beads were incubated with extracts from shRNA-treated cells, of DNA-PKcs on Ser2056 and partially interfered with DNA- and then, protein–DNA complexes were purified and analyzed PKcs phosphorylation on Thr2609 (Fig. 3 A). Surprisingly, the by Western blotting. Fig. 3 C shows that partial depletion of ATR inhibitor ETP-46464 inhibited the phosphorylation of ATR was sufficient to completely abolish the phosphorylation DNA-PKcs on Thr2609, specic fi ally, along with phosphorylation of Chk1 on Ser345 and of DNA-PKcs on Thr2609. of ATR on Thr1989 (Fig. 3 A). Thus, gDNA-induced signaling Because the recruitment of ATR–ATRIP to ssDNA in vitro in cell-free extracts recapitulates a critical step in the regulation is stimulated by RPA (Zou and Elledge, 2003), we knocked down of DNA-PKcs by ATR. The phosphorylation of Xenopus laevis RPA to evaluate its role in gDNA-induced signaling (Fig. 3 D). TopBP1 on Ser1131 augments the capacity of TopBP1 to acti- The amount of total Chk1 protein was significantly reduced in vate the ATR–ATRIP complex (Yoo et al., 2009). TopBP1 was extract prepared from RPA-depleted cells, most likely as a con- also retrieved with biotinylated DNA substrates (Fig. 3 B). sequence of Chk1 activation and degradation in response to stress TopBP1 associated indiscriminately with dsDNA and gDNA, induced by RPA depletion. Chk1, however, was more readily but Ser1138 pTopBP1 was detected preferentially on the gDNA phosphorylated in RPA-depleted nuclear extracts than in con- substrate (Fig. 3 B). Hence, gDNA-specific phosphorylation of trol nuclear extracts (Fig. 3 D). Thus, RPA is not essential for TopBP1 may account for gDNA-induced ATR activation and Chk1 phosphorylation in this experimental setting. Chk1 phosphorylation. Addition of any one of the three PIKKs In response to DNA replication stress, DNA-PKcs and ATR inhibitors to the reaction mixtures interfered with gDNA-induced phosphorylate RPA32 on multiple sites, and these modic fi ations phosphorylation of TopBP1 on Ser1138 and of Chk1 on Ser345 promote DNA repair (Shao et al., 1999; Block et al., 2004; Sakasai (Fig. 3 B). Compared with reaction mixtures containing DNA- et al., 2006; Anantha et al., 2007; Shi et al., 2010; Liaw et al., PKcs or ATR inhibitors, however, ATM inhibition had a lesser 2011). To determine whether DNA-PKcs was necessary for impact on RPA32 phosphorylation (Fig. 3 B). This suggests gDNA-induced ATR signaling, we knocked down DNA-PKcs that ATR and DNA-PKcs can function synergistically to acti- in HeLa cells and then prepared nuclear extracts from these vate DNA damage signaling, in the presence of limited amount cells. The knockdown of DNA-PKcs fully compromised the of ssDNA. phosphorylation of RPA32 and Chk1 induced by linear gDNA To verify the involvement of ATR in gDNA-induced phos- (Fig. 4 A). Consistent with this, gDNA-induced Ser33 pRPA32 phorylation events, we prepared nuclear extracts from HeLa cells and Ser345 pChk1 signals were detected in HCT116 cell-free treated either with a control shRNA or with an shRNA against extracts, absent in extracts prepared from isogenic HCT116 ATR. Biotinylated DNA substrates coupled to streptavidin-coated homozygous knockout of DNA-PKcs, and detected again in Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 425 Figure 5. ATP-dependent assembly of a DNA damage signaling complex. (A) Nuclear extracts were incubated for 10 min at 20°C with gDNA with or without 1 mM AMP-PNP or 1 mM ATP as indicated. Next, the reaction mixture was incubated overnight with an anti-ATR anti- body, and ATR-associated proteins were pulled down with protein G–coupled magnetic beads, resolved by SDS-PAGE, and revealed by Western blotting with the indicated antibodies. (B) ATR immunoprecipitations were conducted as described in A and probed for ATM by Western blotting. (C) Reactions mixtures were assembled as described in A in the presence of 1 mM ATP, with or without 100 µM IC86621, as indicated. (D) Model for the concerted activation of DNA-PKcs and ATR. RPA binds to the ssDNA gap and promotes the recruitment of ATRIP–ATR. Ku binds the dsDNA end, may translocate up to dsDNA to ssDNA junction, and recruits DNA-PKcs. When amounts of RPA-covered ssDNA are limited, the concerted phosphorylation of RPA32 and TopBP1 by DNA-PKcs and ATR promotes signal amplification and assembly of a potent ATR signaling complex. IP, immuno- precipitation; P, phosphorylated. / phosphorylation and ATR activation but is dispensable for the extracts from HCT116 DNA-PKcs cells complemented with congregation of DNA-PKcs, ATR, TopBP1, and Chk1 onto gDNA. recombinant DNA-PK (Fig. 4 B). In addition, ablation of Ku70 by To verify the contribution of DNA-PKcs to ATR activa- shRNA signic fi antly interfered with gDNA-induced phosphory - tion in a cellular context, we subjected U2OS cells to a high dose lation of Chk1 (Fig. 4 C). These data indicate that DNA-PK is of camptothecin (CPT) that induces replication-born DSBs (Shao necessary to prime ATR activation upon assembly onto gDNA. et al., 1999). We detected reduced levels of Ser345 pChk1 in cells To further investigate the intricate links between PI3KKs, treated with shRNAs against DNA-PKcs (Fig. S3 A) or Ku70 we monitored the activation of ATM/Chk2 signaling. Chemical (Fig. S3 B), as well as in cells treated with a small molecule in- inhibition of DNA-PKcs interfered with ATM activation and hibitor of DNA-PKcs (Fig. S3 C). These results indicate that Chk2 phosphorylation without preventing ATM and Chk2 DNA-PKcs contributes to sustain ATR signaling upon the col- binding to DNA (Fig. 4 D). Consistent with this, we did not ob- lapse of replication intermediates. serve gDNA-induced Chk2 phosphorylation in nuclear extracts Here, we have shown that DNA-PKcs and ATR can com- from DNA-PKcs–depleted cells (Fig. 4 E). These observations bine to form a potent DNA damage signaling complex that acti- indicate that DNA-PKcs also connects with ATM signaling in- vates endogenous mediator and effector proteins in the ATR duced by gDNA in cell-free extracts. signal transduction pathway. A recent study has shown that the To verify that DNA-PKcs and ATR signaling proteins as- phosphorylation of RPA32 on Ser4 and Ser8 plays a significant sociate upon gDNA binding and activation, we immunoprecipi- role in ATR-mediated checkpoint activation and that the phos- tated endogenous ATR from reaction mixtures supplemented phorylation of RPA32 on multiple residues is amplified by a re - with gDNA. The pull-down of DNA-PKcs, TopBP1, and Chk1 ciprocal priming effect (Liu et al., 2012). PI3KKs target a subset with an anti-ATR antibody was strictly dependent on the pres- of amino acids, and each phosphorylated amino acid primes the ence of ATP (Fig. 5 A). DNA-PKcs, TopBP1, and Chk1 did not phosphorylation of a subset of N-terminal residues (Liu et al., associate with ATR when ATP was omitted or replaced by the 2012). Consistent with this, our observation that inhibition of nonhydrolyzable analogue AMP-PNP (Fig. 5 A). This indicates DNA-PKcs or ATR abolishes RPA32, TopBP1, and Chk1 phos- that the assembly of the ATR signaling complex on gDNA is phorylation is best explained by an amplification mechanism regulated by phosphorylation events. In contrast, we did not de- dependent on the synergistic action of DNA-PKcs and ATR. tect ATM in the ATR immune precipitate (Fig. 5 B), suggesting At replication-born DSBs, as in cell-free extracts, DNA-PKcs that ATM is not tightly associated with this ATR signaling com- would amplify ATR signals in the presence of a limited amount plex. Ser1138 pTopBP1 and Ser345 pChk1 signals were notice- of RPA-covered ssDNA, through priming of RPA32 and TopBP1 able in the ATR immune precipitate (Fig. 5 C) but not detected in phosphorylation. Previous studies have shown that RPA is nec- extracts containing the DNA-PKcs inhibitor IC86621 (Fig. 5 C), essary to localize ATR–ATRIP at stalled forks but dispensable for consistent with the data presented in Fig. 3 B. In conclusion, Chk1 phosphorylation per se (Ball et al., 2005; Kim et al., 2005). the enzymatic activity of DNA-PKcs is required for TopBP1 426 JCB • VOLUME 202 • NUMBER 3 • 2013 Here, we observed that removal of RPA stimulated gDNA- antibody raised against the peptide NH -Cys-FPENE(pT)PPEGK-COOH) and Ser1138 pTopBP1 (rabbit polyclonal antibody raised against the pep- induced Chk1 phosphorylation in cell-free extracts. These ob- tide NH -Cys-LNTEP(pS)QNEQI-COOH) were gifts from L. Zou (Massachu- servations suggest that although RPA directs ATR–ATRIP to setts General Hospital and Harvard Medical School, Boston, MA) and stalled forks, the ssDNA binding protein is not required for Chk1 W.G. Dunphy (California Institute of Technology, Pasadena, CA), respec- tively. Secondary antibodies (anti–rabbit-HRP and anti–mouse-HRP) were phosphorylation per se and that the hyperphosphorylation of obtained from Promega. RPA bound to ssDNA may overcome a barrier to Chk1 activation. Our data are reminiscent of the findings by Kumagai and RNA interference shRNA vectors were prepared by cloning dsDNA oligonucleotides into Dunphy (2000) who showed that the DNA substrate poly(dA) - pSUPER-Puro (a gift from J. Lingner, Ecole Polytechnique Fédérale de poly(dT) can trigger the phosphorylation of xChk1 in X. laevis Lausanne, Lausanne, Switzerland) as previously described (Azzalin and egg extracts. In this system, ATR activation occurs indepen- Lingner, 2006). The 19-nt target sequences were as follows: for DNA-PKcs, 5-GATCGCACCTTACTCTGTT-3; for ATR, 5-GGAGATTTCCTGAGCA- dently of RPA, through phosphorylation of TopBP1 by ATM TGT-3; for RPA70, 5-CTGGTTGACGAAAGTGGTG-3; and for KU70, (Kim et al., 2005; Yoo et al., 2007). It would be interesting to 5-GGAAGAGATAGTTTGATTT-3. shRNA transfections were performed define the key molecular features of poly(dA) -poly(dT) that 70 70 using Lipofectamine 2000 reagent (Invitrogen). promote xChk1 phosphorylation and to examine whether xDNA- DNA substrates PKcs is also necessary for xChk1 phosphorylation in X. laevis Plasmid pG68 (Ralf et al., 2006) was generated by cloning an array of BbvCI egg extracts. restriction sites (insert A) into pUC18 using EcoRI and HindIII. Insert A is as follows: Pioneering studies have demonstrated that the Ku70/80 5-GAATTCGCCTCATCTCTGGCTTCCCGGATCCCAGGATGCGCAGGC- AGCCGCCTAGGGTGACAGGCTCATGGATATGCTGAGGAATCGCTGA- heterodimer first binds DNA ends independently of their exact GGCGTAGCTGAGGACTAGTGCTGAGGGATCGCTGAGGTGTAGCTGA- structure (Paillard and Strauss, 1991; Falzon et al., 1993) and GGACGTGCTGAGGTGCGTCAGCTACTTGTGAACTCGAGAGGCTCAGTGA- then translocates along duplex DNA to form a beads-on-a-string GTGAAGCTCCATGGCCTAAGGGCAGCAGACTAAGCTT-3. Plasmid pG160 (Gari et al., 2008) was generated by cloning an array of BbvCI and BsmI structure (de Vries et al., 1989; Paillard and Strauss, 1991; restriction sites (insert B) into pUC18 using EcoRI and HindIII. Insert B is as Zhang and Yaneva, 1992). Ku70/80 also exhibits specific affin - follows: 5-GAATTCGCTCCATCTCTGGCTTCCCGCTAGCCATTATGCGCA- ity for ssDNA to dsDNA transitions, including nicks and small GGCAGCCGCCTAGGGTGACAGGCTCATGGATATGAATGCACTCGAG- GAATGCACGGTAGAATGCAAAGAATGCAGGTTGAATGCATTAGAATGC- ssDNA gaps (Blier et al., 1993; Falzon et al., 1993), and DNA- CCCATGGGAATGCACAGAGAATGCAGTATCGAATGCAAATCGAATG- PKcs interacts directly with RPA (Shao et al., 1999). The biochem- CACGTACCTCAGCGATCCCTCAGCACTAGTCCTCAGCTGTACCTCAG- ical properties of DNA-PK components suggest how DNA-PK CACGTCCTCAGCAAGCTT-3. Biotinylated duplex DNA was generated by PCR amplification of may engage in ATR activation at replication-born DSBs. In the plasmid pG68 or of plasmid pG160 using primer 1 (5-biotin-TGCGGCAT- model presented in Fig. 5 C, we propose that Ku70/80 may first CAGAGCAGATTG-3) and primer 2 (5-GCACCCCAGGCTTTACACTTT- bind DNA ends, translocates up to internal nicks and ssDNA ATG-3). To produce gDNA molecules, the duplex amplified from pG68 (68-nt gap) was nicked with NbBbvC1 (New England Biolabs, Inc.), and gaps, and then recruits DNA-PKcs, which phosphorylates RPA the duplex amplified from pGAP160 (160-nt gap) was nicked with BsmI and primes ATR activation. and NtBbvC1 (New England Biolabs, Inc.), resulting in the formation of DNA-PKcs is extremely abundant. It represents 0.1–1% short oligonucleotides (11–13 nt), which were melted by heat denaturation at 80°C and removed using a gel extraction spin column (QIAquick Gel of soluble nuclear proteins in HeLa cells (Carter et al., 1990) Extraction Kit; QIAGEN) as previously described (Ralf et al., 2006). gDNA and, therefore, is very likely to first bind replication-born DSBs. fragments were control digested with SpeI and purified by 0.8% agarose It is tempting to speculate that upon encountering DNA-bound gel electrophoresis and electroelution using an Elutrap device (Schleicher & Schuell BioScience). Open circular pG68 was generated by treatment of RPA at broken replication intermediates, DNA-PKcs would be supercoiled pG68 with topoisomerase I. pG68 was gapped with NbBbvC1 channeled to the ATR signaling pathway at the expense of as described in this paragraph. Plasmid pG68 was linearized with ScaI. NHEJ, thereby contributing to DNA repair pathway choice (Allen et al., 2011). Nuclear extracts Nuclear extracts were prepared using Dignam’s method as previously de- scribed (Shiotani and Zou, 2009). HeLa S3 or HCT116 cells were grown Materials and methods to ≤80% confluence, collected by scrapping and centrifugation (200 g for 3 min at 4°C), and washed twice in PBS. The cell pellet was suspended in Cells, proteins, and chemicals 5× packed cell volume of hypotonic buffer A (10 mM Hepes-KOH, pH 7.9, U2OS and HeLa S3 cells were grown under standard conditions in DMEM 10 mM KCl, 1.5 mM MgCl , 0.5 mM DTT, and 0.5 mM PMSF) supplemented (Invitrogen) supplemented with 10% FBS and 1% penicillin-streptomycin. with a cocktail of protease inhibitors (cOmplete, EDTA free; Roche) and HCT116 (cell line and genotype: HCT116 Hendrickson’s Parental; Horizon phosphatase inhibitors (Thermo Fisher Scientific) and incubated on ice for / Discovery Ltd.) and HCT116 DNA-PKcs cells (clone: w87; cell line and 5 min. Next, the cells were spun down at 500 g for 5 min, suspended in / genotype: HCT116 DNA-PKcs ; Horizon Discovery Ltd.) were cultured in 2× packed cell volume of buffer A and lysed by dounce homogeniza- McCoy’s 5A modie fi d medium (Sigma-Aldrich) supplemented with 10% FBS tion using a tight-fitting pestle. Nuclei were collected by centrifugation at and 1% penicillin-streptomycin. DNA-PK purified from HeLa cells was pur - 4,000 g for 5 min at 4°C and extracted in one nuclei pellet volume of buf- chased from Promega. Streptavidin and CPT were purchased from Sigma- fer C (20 mM Hepes-KOH, pH 7.9, 600 mM KCl, 1.5 mM MgCl , 0.2 mM Aldrich. KU-55933 was obtained from Tocris Bioscience. IC86621 was obtained EDTA, 25% glycerol, 0.5 mM DTT, and 0.5 mM PMSF) supplemented with from Merck. ETP-46464 was a gift from O. Fernandez-Capetillo (Spanish cocktails of protease and phosphatase inhibitors, and mixed on a rotating National Cancer Research Centre, Madrid, Spain; Toledo et al., 2011). wheel at 4°C for 30 min. Nuclear extracts (supernatants) were recovered by centrifugation (16,000 g for 15 min at 4°C) and dialyzed using Slide- Antibodies A-Lyzer Dialysis Cassettes (3,500-D protein molecular weight cutoff; Thermo Primary antibodies were purchased from Abcam (DNA-PKcs and DNA- Fisher Scientific) against buffer D (20 mM Hepes-KOH, pH 7.9, 100 mM PKcs-S2056), Bethyl Laboratories, Inc. (ATM, ATR, TopBP1, RPA32-Ser33, KCl, 0.2 mM EDTA, 20% glycerol, 0.5 mM DTT, and 0.5 mM PMSF). Dia- and RPA32-Ser4/S8), EMD Millipore (RPA32 and Chk2), Cell Signaling lyzed nuclear extracts were centrifuged (100,000 g for 30 min at 4°C) to Technology (Chk1-Ser345 and Chk2-Thr68), Rockland (ATM-Ser1981), eliminate residual precipitates. The protein concentration of the clear super- Thermo Fisher Scientific (DNA-PKcs-Thr2609), and Santa Cruz Biotech - natant was determined using Bradford’s estimation method, and aliquots nology, Inc. (Chk1). Antibodies against Ser1989 pATR (rabbit polyclonal were snap frozen and stored at 80°C. Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 427 damage-induced phosphorylation of the 32 kDa subunit of replication ATR activation assay protein A at threonine 21. Nucleic Acids Res. 32:997–1005. http://dx.doi.org/ 10 µl reaction mixtures contained 5 µg nuclear extracts, 5 nM of the indi- 10.1093/nar/gkh265 cated DNA substrates, 10 mM Hepes-KOH, pH 7.6, 50 mM KCl, 0.1 mM Byun, T.S., M. Pacek, M.C. Yee, J.C. Walter, and K.A. Cimprich. 2005. MgCl , 1 mM PMSF, 0.5 mM DTT, 1 mM ATP, 10 µg/ml creatine kinase, Functional uncoupling of MCM helicase and DNA polymerase activities and 5 mM phosphocreatine. AMP-PNP, used at 1 mM when indicated, activates the ATR-dependent checkpoint. Genes Dev. 19:1040–1052. was obtained from Roche. Phosphorylation reactions were conducted at http://dx.doi.org/10.1101/gad.1301205 37°C for 15 min, unless otherwise indicated, and stopped with 10 µl of 2× Carter, T., I. Vancurová, I. Sun, W. Lou, and S. DeLeon. 1990. A DNA-activated protein sample buffer (125 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 100 mM protein kinase from HeLa cell nuclei. Mol. Cell. Biol. 10:6460–6471. DTT, 2% -mercaptoethanol, and 0.004% bromophenol blue) for 3 min at Choi, J.H., L.A. Lindsey-Boltz, M. Kemp, A.C. Mason, M.S. Wold, and A. 37°C. For ATR pull-down experiments, reaction mixtures were supple- Sancar. 2010. Reconstitution of RPA-covered single-stranded DNA- mented with 1 µg anti-ATR antibody and incubated overnight on a rotated activated ATR-Chk1 signaling. Proc. Natl. Acad. Sci. USA. 107:13660– wheel at 4°C. Antibody–protein complexes were immunoprecipitated for 13665. http://dx.doi.org/10.1073/pnas.1007856107 1 h at 4°C with Dynabeads coupled to protein G (Invitrogen), washed, and de Vries, E., W. van Driel, W.G. Bergsma, A.C. Arnberg, and P.C. van der Vliet. resuspended in 2× protein sample buffer for Western blot analysis. 1989. HeLa nuclear protein recognizing DNA termini and translocating on DNA forming a regular DNA-multimeric protein complex. J. Mol. DNA pull-down assay Biol. 208:65–78. http://dx.doi.org/10.1016/0022-2836(89)90088-0 Biotinylated DNA duplexes (500 ng) were attached to 5 µl streptavidin- Dvir, A., S.R. Peterson, M.W. Knuth, H. Lu, and W.S. Dynan. 1992. Ku autoan- coated magnetic beads (Bio-Adembeads; ADEMTECH) in binding and tigen is the regulatory component of a template-associated protein kinase washing buffer (100 mM Tris, pH 7.5, and 1 M NaCl) and incubated for that phosphorylates RNA polymerase II. Proc. Natl. Acad. Sci. USA. 15 min at room temperature. Then, the beads were washed with 10 mM 89:11920–11924. http://dx.doi.org/10.1073/pnas.89.24.11920 Hepes, pH 7.6, 100 mM KOAc, and 0.1 mM MgOAc and resuspended in Falzon, M., J.W. Fewell, and E.L. Kuff. 1993. EBP-80, a transcription factor reaction buffer (10 mM Hepes, pH 7.6, 50 mM KOAc, 0.1 mM MgOAC, closely resembling the human autoantigen Ku, recognizes single- to double- 1 mM PMSF, 0.5 mM DTT, 1 mM ATP, pH 7.0, 10 µg/ml creatine phos- strand transitions in DNA. J. Biol. Chem. 268:10546–10552. phate, 5 mM phosphocreatine, and 0.5 mg/ml BSA). 50 µl reaction mix- Gari, K., C. Décaillet, M. Delannoy, L. Wu, and A. Constantinou. 2008. tures containing 20 µg nuclear extracts and 500 ng DNA duplexes coupled Remodeling of DNA replication structures by the branch point translo- to magnetic beads were incubated for 10 min at 37°C in reaction buffer. case FANCM. Proc. Natl. Acad. Sci. USA. 105:16107–16112. http://dx .doi.org/10.1073/pnas.0804777105 Online supplemental material Gorgoulis, V.G., L.V. Vassiliou, P. Karakaidos, P. Zacharatos, A. Kotsinas, T. Fig. S1 summarizes schematically how broken replication intermediates con- Liloglou, M. Venere, R.A. Ditullio Jr., N.G. Kastrinakis, B. Levy, et al. taining DNA ends and ssDNA gaps are generated under stressful con- 2005. Activation of the DNA damage checkpoint and genomic instability ditions of DNA replication. Fig. S2 provides further information on the in human precancerous lesions. Nature. 434:907–913. http://dx.doi.org/ stability of DNA substrates in cell-free extracts and on key DNA structural 10.1038/nature03485 determinants in ATR signaling. Fig. S3 shows that DNA-PKcs contributes Gottlieb, T.M., and S.P. Jackson. 1993. The DNA-dependent protein kinase: re- to ATR signaling in U2OS cells exposed to the topoisomerase I poison quirement for DNA ends and association with Ku antigen. Cell. 72:131– CPT. Online supplemental material is available at http://www.jcb.org/ 142. http://dx.doi.org/10.1016/0092-8674(93)90057-W cgi/content/full/jcb.201304139/DC1. Guo, Z., A. Kumagai, S.X. Wang, and W.G. Dunphy. 2000. Requirement for Atr in phosphorylation of Chk1 and cell cycle regulation in response to DNA We thank William G. Dunphy, Oscar Fernandez-Capetillo, and Joachim Lingner replication blocks and UV-damaged DNA in Xenopus egg extracts. Genes for sharing reagents, Lee Zou for reagents and for helpful comments, and Dev. 14:2745–2756. http://dx.doi.org/10.1101/gad.842500 Philippe Pasero, Kerstin Gari, and all of the laboratory members for critical read- Hanada, K., M. Budzowska, S.L. Davies, E. van Drunen, H. Onizawa, H.B. ing of the manuscript. Beverloo, A. Maas, J. Essers, I.D. Hickson, and R. Kanaar. 2007. The This work was supported by the Fondation ARC pour la recherche sur structure-specific endonuclease Mus81 contributes to replication restart le cancer, by Agence Nationale de la Recherche, and by the Swiss National by generating double-strand DNA breaks. Nat. Struct. Mol. Biol. 14: 1096–1104. http://dx.doi.org/10.1038/nsmb1313 Science Foundation. Jackson, S.P., and J. Bartek. 2009. The DNA-damage response in human bi- Submitted: 22 April 2013 ology and disease. Nature. 461:1071–1078. http://dx.doi.org/10.1038/ nature08467 Accepted: 20 June 2013 Kim, S.M., A. Kumagai, J. Lee, and W.G. Dunphy. 2005. Phosphorylation of Chk1 by ATM- and Rad3-related (ATR) in Xenopus egg extracts requires binding of ATRIP to ATR but not the stable DNA-binding or coiled-coil References domains of ATRIP. J. Biol. Chem. 280:38355–38364. http://dx.doi.org/ 10.1074/jbc.M508673200 Abraham, R.T. 2001. Cell cycle checkpoint signaling through the ATM and Kumagai, A., and W.G. Dunphy. 2000. Claspin, a novel protein required for ATR kinases. Genes Dev. 15:2177–2196. http://dx.doi.org/10.1101/gad the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts. Mol. Cell. 6:839–849. http://dx.doi.org/10.1016/ Allen, C., A.K. Ashley, R. Hromas, and J.A. Nickoloff. 2011. More forks on the S1097-2765(05)00092-4 road to replication stress recovery. J. Mol. Cell Biol. 3:4–12. http://dx.doi Kumagai, A., J. Lee, H.Y. Yoo, and W.G. Dunphy. 2006. TopBP1 activates .org/10.1093/jmcb/mjq049 the ATR-ATRIP complex. Cell. 124:943–955. http://dx.doi.org/10.1016/ Anantha, R.W., V.M. Vassin, and J.A. Borowiec. 2007. Sequential and synergistic j.cell.2005.12.041 modic fi ation of human RPA stimulates chromosomal DNA repair. J. Biol. Lao, Y., C.G. Lee, and M.S. Wold. 1999. Replication protein A interactions Chem. 282:35910–35923. http://dx.doi.org/10.1074/jbc.M704645200 with DNA. 2. Characterization of double-stranded DNA-binding/ Azzalin, C.M., and J. Lingner. 2006. The human RNA surveillance factor UPF1 helix-destabilization activities and the role of the zinc-finger domain in is required for S phase progression and genome stability. Curr. Biol. DNA interactions. Biochemistry. 38:3974–3984. http://dx.doi.org/10.1021/ 16:433–439. http://dx.doi.org/10.1016/j.cub.2006.01.018 bi982371m Ball, H.L., J.S. Myers, and D. Cortez. 2005. ATRIP binding to replication pro- Liaw, H., D. Lee, and K. Myung. 2011. DNA-PK-dependent RPA2 hyper- tein A-single-stranded DNA promotes ATR-ATRIP localization but is phosphorylation facilitates DNA repair and suppresses sister chromatid dispensable for Chk1 phosphorylation. Mol. Biol. Cell. 16:2372–2381. exchange. PLoS ONE. 6:e21424. http://dx.doi.org/10.1371/journal http://dx.doi.org/10.1091/mbc.E04-11-1006 .pone.0021424 Bartkova, J., Z. Horejsí, K. Koed, A. Krämer, F. Tort, K. Zieger, P. Guldberg, M. Liu, Q., S. Guntuku, X.S. Cui, S. Matsuoka, D. Cortez, K. Tamai, G. Luo, S. Carattini- Sehested, J.M. Nesland, C. Lukas, et al. 2005. DNA damage response as Rivera, F. DeMayo, A. Bradley, et al. 2000. Chk1 is an essential kinase that a candidate anti-cancer barrier in early human tumorigenesis. Nature. is regulated by Atr and required for the G(2)/M DNA damage checkpoint. 434:864–870. http://dx.doi.org/10.1038/nature03482 Genes Dev. 14:1448–1459. http://dx.doi.org/10.1101/gad.14.12.1448 Blier, P.R., A.J. Griffith, J. Craft, and J.A. Hardin. 1993. Binding of Ku protein Liu, S., S.O. Opiyo, K. Manthey, J.G. Glanzer, A.K. Ashley, C. Amerin, K. to DNA. Measurement of affinity for ends and demonstration of binding Troksa, M. Shrivastav, J.A. Nickoloff, and G.G. Oakley. 2012. Distinct to nicks. J. Biol. Chem. 268:7594–7601. roles for DNA-PK, ATM and ATR in RPA phosphorylation and check- Block, W.D., Y. Yu, and S.P. Lees-Miller. 2004. Phosphatidyl inositol 3-kinase- point activation in response to replication stress. Nucleic Acids Res. like serine/threonine protein kinases (PIKKs) are required for DNA 40:10780–10794. http://dx.doi.org/10.1093/nar/gks849 428 JCB • VOLUME 202 • NUMBER 3 • 2013 Lopes, M., M. Foiani, and J.M. Sogo. 2006. Multiple mechanisms control chro- mosome integrity after replication fork uncoupling and restart at irrepara- ble UV lesions. Mol. Cell. 21:15–27. http://dx.doi.org/10.1016/j.molcel .2005.11.015 MacDougall, C.A., T.S. Byun, C. Van, M.C. Yee, and K.A. Cimprich. 2007. The structural determinants of checkpoint activation. Genes Dev. 21:898–903. http://dx.doi.org/10.1101/gad.1522607 Matsuoka, S., B.A. Ballif, A. Smogorzewska, E.R. McDonald III, K.E. Hurov, J. Luo, C.E. Bakalarski, Z. Zhao, N. Solimini, Y. Lerenthal, et al. 2007. ATM and ATR substrate analysis reveals extensive protein networks re- sponsive to DNA damage. Science. 316:1160–1166. http://dx.doi.org/10 .1126/science.1140321 Meek, K., V. Dang, and S.P. Lees-Miller. 2008. DNA-PK: the means to justify the ends? Adv. Immunol. 99:33–58. http://dx.doi.org/10.1016/S0065-2776(08)00602-0 Neelsen, K.J., I.M. Zanini, R. Herrador, and M. Lopes. 2013. Oncogenes induce genotoxic stress by mitotic processing of unusual replication intermedi- ates. J. Cell Biol. 200:699–708. http://dx.doi.org/10.1083/jcb.201212058 Olson, E., C.J. Nievera, V. Klimovich, E. Fanning, and X. Wu. 2006. RPA2 is a di- rect downstream target for ATR to regulate the S-phase checkpoint. J. Biol. Chem. 281:39517–39533. http://dx.doi.org/10.1074/jbc.M605121200 Paillard, S., and F. Strauss. 1991. Analysis of the mechanism of interaction of simian Ku protein with DNA. Nucleic Acids Res. 19:5619–5624. http:// dx.doi.org/10.1093/nar/19.20.5619 Ralf, C., I.D. Hickson, and L. Wu. 2006. The Bloom’s syndrome helicase can promote the regression of a model replication fork. J. Biol. Chem. 281:22839–22846. http://dx.doi.org/10.1074/jbc.M604268200 Ray Chaudhuri, A., Y. Hashimoto, R. Herrador, K.J. Neelsen, D. Fachinetti, R. Bermejo, A. Cocito, V. Costanzo, and M. Lopes. 2012. Topoisomerase I poisoning results in PARP-mediated replication fork reversal. Nat. Struct. Mol. Biol. 19:417–423. http://dx.doi.org/10.1038/nsmb.2258 Sakasai, R., K. Shinohe, Y. Ichijima, N. Okita, A. Shibata, K. Asahina, and H. Teraoka. 2006. Differential involvement of phosphatidylinositol 3-kinase- related protein kinases in hyperphosphorylation of replication protein A2 in response to replication-mediated DNA double-strand breaks. Genes Cells. 11:237–246. http://dx.doi.org/10.1111/j.1365-2443.2006.00942.x Shao, R.G., C.X. Cao, H. Zhang, K.W. Kohn, M.S. Wold, and Y. Pommier. 1999. Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissoci- ates RPA:DNA-PK complexes. EMBO J. 18:1397–1406. http://dx.doi .org/10.1093/emboj/18.5.1397 Shi, W., Z. Feng, J. Zhang, I. Gonzalez-Suarez, R.P. Vanderwaal, X. Wu, S.N. Powell, J.L. Roti Roti, S. Gonzalo, and J. Zhang. 2010. The role of RPA2 phos- phorylation in homologous recombination in response to replication ar- rest. Carcinogenesis. 31:994–1002. http://dx.doi.org/10.1093/carcin/bgq035 Shiotani, B., and L. Zou. 2009. Single-stranded DNA orchestrates an ATM- to-ATR switch at DNA breaks. Mol. Cell. 33:547–558. http://dx.doi.org/ 10.1016/j.molcel.2009.01.024 Smith, G.C., and S.P. Jackson. 1999. The DNA-dependent protein kinase. Genes Dev. 13:916–934. http://dx.doi.org/10.1101/gad.13.8.916 Szakal, B., and D. Branzei. 2013. Premature Cdk1/Cdc5/Mus81 pathway activa- tion induces aberrant replication and deleterious crossover. EMBO J. 32:1155–1167. http://dx.doi.org/10.1038/emboj.2013.67 Toledo, L.I., M. Murga, R. Zur, R. Soria, A. Rodriguez, S. Martinez, J. Oyarzabal, J. Pastor, J.R. Bischoff, and O. Fernandez-Capetillo. 2011. A cell-based screen identie fi s ATR inhibitors with synthetic lethal properties for cancer- associated mutations. Nat. Struct. Mol. Biol. 18:721–727. http://dx.doi .org/10.1038/nsmb.2076 Van, C., S. Yan, W.M. Michael, S. Waga, and K.A. Cimprich. 2010. Continued primer synthesis at stalled replication forks contributes to checkpoint activation. J. Cell Biol. 189:233–246. http://dx.doi .org/10.1083/jcb.200909105 Yajima, H., K.J. Lee, and B.P. Chen. 2006. ATR-dependent phosphorylation of DNA-dependent protein kinase catalytic subunit in response to UV-induced replication stress. Mol. Cell. Biol. 26:7520–7528. http://dx.doi.org/10.1128/ MCB.00048-06 Yoo, H.Y., A. Kumagai, A. Shevchenko, A. Shevchenko, and W.G. Dunphy. 2007. Ataxia-telangiectasia mutated (ATM)-dependent activation of ATR occurs through phosphorylation of TopBP1 by ATM. J. Biol. Chem. 282:17501–17506. http://dx.doi.org/10.1074/jbc.M701770200 Yoo, H.Y., A. Kumagai, A. Shevchenko, A. Shevchenko, and W.G. Dunphy. 2009. The Mre11-Rad50-Nbs1 complex mediates activation of TopBP1 by ATM. Mol. Biol. Cell. 20:2351–2360. http://dx.doi.org/10.1091/mbc.E08-12-1190 Zhang, W.W., and M. Yaneva. 1992. On the mechanisms of Ku protein binding to DNA. Biochem. Biophys. Res. Commun. 186:574–579. http://dx.doi .org/10.1016/S0006-291X(05)80847-2 Zou, L., and S.J. Elledge. 2003. Sensing DNA damage through ATRIP recogni- tion of RPA-ssDNA complexes. Science. 300:1542–1548. http://dx.doi.org/ 10.1126/science.1083430 Concerted activation of ATR and DNA-PKcs • Vidal-Eychenié et al. 429

Journal

The Journal of Cell Biology – Pubmed Central

Published: Aug 5, 2013

There are no references for this article.