Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

The structure and transcription start site of major potato tuber protine gene

The structure and transcription start site of major potato tuber protine gene Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Volume 14 Number 11 1986 Nucleic Acids Research The structure and transcription start site of a major potato tuber protein gene M.Bevan*, R.Barker, A.Goldsbrough, M.Jarvis, T.Kavanagh and G.Iturriaga Molecular Genetics Department, Plant Breeding Institute, Marts Lane, Trumpington, Cambridge, UK Received 26 March 1986; Revised and Accepted 6 May 1986 ABSTRACT We have isolated recombinant lambda clones containing intact major tuber protein (patatin) genes and flanking sequences from the commercial tetraploid variety Marls Piper. The gene is composed of seven exons and six Introns, spread over 4 kb of DNA. Nuclease mapping defined the 51 end of the mRNA approximately 45 bp upstream of the Initiation codon. The 5' end of the gene is preceeded by a canonical TATA box sequence. The three known patatin genes encode proteins of nearly identical M but very different isoelectric points. The sequence of the gene does not Indicate a role for patatin as one of the globulin class of plant storage proteins. INTRODUCTION The most abundant protein in potato tubers is a 40 kd glycoprotein called patatin, which represents approximately 40$ of the total protein in mature tubers1. Patatin exists as a complex mixture of differently charged isoforms within a variety2, but protein and cUNA sequencing have shown that there are only two major forms of patatin differing by 17 amino acids3. It is thought the extensive charge heterogeneity of patatin may also be due to glycosylation and other post-translat1onal modifications2. There is strong evidence that patatin is a lipolytic acyl hydrolase (LAH)\ an activity which Is thought to be involved in the response of tubers to pathogens 5 . The putative 23 amino ad d signal sequence Identified by cUNA sequencing is consistent with lipid hydrolase activity, which must be sequestered to avoid cell lysis. However, 1t is difficult to equate this lipid hydrolase activity with the massive quantity of patatin in tubers. Patatin may have a dual role as a somatic storage protein and as an enzyme Involved in host resistance. Patatin is not normally found In stems, leaves or roots of potatoes, but it can be Induced to accumulate in isolated single-node cuttings without differentiation into a stolon and tuber by removing the axillary bud6. Normally the axillary bud develops as a stolon and tuber under short-day treatment and as a shoot under long-day conditions. Tuber formation can also ©IR L Press Limited, Oxford, England. 4625 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research be stimulated by high levels of sucrose and cytokinin In the growth medium'' 8 , and retarded by exogenous gibberel hns 9 . As mKNA for patatin is only found in developing tubers3, i t is likely that factors such as day-length , sucrose and growth regulators act, directly or Indirectly, to stimulat e the transcription of patatin genes. We are interested in the regulatory mechanisms involved in patatin accumulation , and as a prelude to these investigations we report here the Isolatio n and UNA sequence of an intact patatin gene and flanking sequences from Solanum tuberosum. MATERIALS AND METHODS Bacteria l Strains E. col l K803 hsdR- hsdM" supE met" E. coll MC1U22 ara D139 A(ara, leu)7697 AlacZM15 galU galF StrA E. col i TG2 recA" FtraU36, proAB, lacls^, AlacZM15. Material s Restriction enzymes, alkaline phosphatase, T4 kinase and T4 ligase were obtained from BoehMnger, Amersham International or BKL, and were used according to the manufacturer's instructions. Chemicals used in UNA sequencing were obtained from the recommended suppliers10. Radiochemicals were obtained from NEN and Amersham International. UNA Sequencing Chemical UNA sequencing reactions were performed according to Haxam and Gilbert10, with modifications and sequencing gels run according to Barker et aJL u Uideoxy sequencing was conducted according to standard methods12. Templates for sequencing were obtained by direct cloning or by exonuclease III 13delet1ons . Computer analysis of the UNA and protein sequences were performed using the programs of the University of Wisconsin 11* and R. Staden15. RNA Analysis A single stranded radioactive probe was made by priming 16 an ml3jnplU clone of an Hpall - Xbal fragment that extended from nucleotide 1929 (an Xbal site) to nucieotide 2442 (an Hpall site 129 bp 3' of the putative Initiation codon). The radioactive single strands complementary to patatin mRNA were hybridised to 3 pg of polyadenylated tuber RNA, digested with SI nuclease, and electrophoresed on an 81 polyacrylamide 94 urea sequencing gel. Genomic DNA Analysis Ten yg samples of tobacco (N. tabacum var Samsun), tomato (Lycopersicon 4626 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research esculentum UC828), and potato (Solanum tuberosum var. Desiree, Haris Piper and 7322)w UNA were digested with restriction endonucleases, eletrophoresed i n 0.8% agarose gels, and blotted onto Hybond N nylon membranes according to the manufacturer's instructions. Blots were hybridised with nick-translated 1 8 patatin cDNA UM2033, washed in U.2x SSC, 0.1J SUS lmrt EDTA at 65°C, and exposed to X-ray film for 24-48 hours. Kecombinant Library Construction Two hundred pg of Haris Piper DNA was partiall y digested with Sau 3a, and size-fractionated by centrifugation on two 14 ml 1U-40J sucrose gradients in 1M NaCl, 5mM EUTA, 2U mM Tns HC1 pH 8.U for 6 hr at 40.UUO rpm, 20°C. Fractions containing UNA larger than 15 kb were pooled and re-fractionated on a single gradient. Fragments of 15-20 kb were pooled and ethanol precipitated . The lambda vector EMBL319 was digested with BamHl and EcoRl, phenol extracted and precipitated twice with 0.6 vol of isopropanol at 0°C. A large scale ligat ion containing 4 pg of vector DNA and 1 pg of size-fractionate d potato UNA was packaged in vitro to yiel d 1400 pi of solutio n with a titr e of 2.8 x 103 pfu/pl . This represented an efficiency of 2.84 x 105 pfu/pg of EMBL3 DNA. Packaging mix was adsorbed onto K803, plated onto 22 cm2 Nunc plates, and the resulting phage lawn was lifted onto nitrocellulose 1 8 and screened with nick-translated UM203 patatin cUNA probe. Pure plaques were obtained after 2-3 rounds of purification, and DNA was purifie d from large scale liquid lysates18of recombinant phage. RESULTS Isolation of Genomic Clones The hybridisation of nick-translated patatin cDNA probe3 to nitrocellulose lifts of 200,000 recombinant plaques revealed 5 strongly hybridising plaques. Only two of these were stable during subsequent growth on K8O3. UNA was Isolated from both phages and analysed by restriction digestion and Southern hybridisation20. Only one clone, xpat21, contained hybridising DNA fragments of the same size seen in genomic Southern blots hybridised with GM203 (see later). The region of UNA homologous to patatin cDNA was contained within a 4 kb Xbal fragment located approximately 0.3 kb from the left boundary of the phage Insert (see F1g. 1). This 4.0 kb Xbal fragment was subcloned into pUC1921 and sequenced using the Maxam and Gilbert method10. Regions of the clone inaccessible to this method were sequenced using exonuclease III generated deletions of xpat21 DNA cloned 1n M13mpl8 and mpl921. Inspection of the sequence revealed a putative AUG initiation codon 4627 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research P«» r * m *•• u,r * ? • ii till—L_L Fig. 1 Structure of recombinant lambda clones containing patatin genes. The line represents potato DNA inserted into the BamHI site of XEMBL3, with the left arm of EMBL3 on the left. The boxed regions represent the exons encoding patatin, while the direction of transcription 1s shown by an arrow. Abbreviations: B, BamHI; G, Bglll; H, Hindlll, P, PstI; X, Xbal. for patatin precursor polypeptide approximately 20U bp from an Xbal site, which was 300 bp from the left boundary of the plant clone. The 300 bp fragment containing the upstream flanking sequences of patatin was isolated, sequenced, and used to probe another library of 200,000 recombinant plaques. Five stable strongly hybridising plaques were Isolated. Southern analysis showed that they had a similar pattern of Pstl, Hindlll, BamHI, Xbal and Kpnl sites, but only one clone xpatl8, had at least 8 kb of 5' upstream sequence. The restriction map at Xpatl8 1s shown in F1g. 1. Fragments containing the 51 end of Xpatl8 were subcloned into mpl8 and mpl9 and sequenced. The sequences of xpatl8 and xpat21 were Identical over the 700 bp sequenced at their 51 ends and 500 bp sequenced at their 3' untranslated regions. This similarity leads us to conclude that the same patatin gene was Isolated from both libraries. Figure 2 shows the sequence of the coding region of the gene, which spans 2939 bp, 842 bp of 3' non-coding sequence, and 2313 bp of 5' non-coding region. The total sequence was 71.2% AT, while the coding regions were 63.8% AT. This was reflected in a strong bias towards the use of A or T in the third base position, as shown 1n Table 1. The gene contained seven exons all of which were delineated by canonical 5' GT-31 AG splice sites22. The introns were particularly AT rich and varied In size from 86 bp to 726 bp, while the exons varied 1n size from 57 bp to 288 bp, and encoded a polypeptide of M 42504. We refer to the Introns as IVS 1 to IVS 6, 51 to 3'. There were substantial differences 1n the amino ad d sequence of xpat21 and published cONA sequences3. Nearly all of the 25 amino acid changes occurred at the same positions 1n all three genes, and several of the changes Involved the substitution of differently charged amino acids. Consequently the three known patatin proteins encoded by Xpat 21, GM201 and GM203, had an almost identical M.W. but were predicted to have different isoelectric 4628 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research CCCATCTTAL1 11IATTCCC1111.1111ATTATCAII11 11ACACH.H.1U0I ICACTAATTCACCtCACACTAIACCATATAAiaCCTAAICACAlCTT 1 1 , 1 1 1 1 1 , > 100 AblUlUlllllATlllllUllATCTACAACACCAAllUllAAAMTATCAACTTGCTACTAT 1 CTTCA11I IICACTTATAATTTTACTCAATTGCAM 1111ACAATAI1111 lAATACTTACCAOl I H-ATCAATCATCAACTTTAH.11UXATATACAC 201 1 1 < 1 1 1 1 1 1 f 300 TACTTTCTOATtUTATACrrCAAAAACrrTCACTTATCTTAAATTTCTAATMTAAAATTtAATTATATTCTAAAICAAAAATTACrrA 301 1 1 1 1 1 1 1 1 1 • tOO ATTACAACATAIQUA<aCAAATTCT(rrTACAT*TTTTACrrTT(aCrCCAATAIOAATAICrCAATTTAAATCr 40 1 I 1 1 1 1 1 1 (UCCTAIAAAA<CTCjGA>TT&tACCAACATMTTCCAAGCTATCTCTCAOaCArr^^ 11 nCTCTA 50 1 1 1 i 1 1 P 1 1 1 ^ WO TTAJCTrATTTTTATTATATCATCATCCCTCAATTTTCATACAlATAl 11 lH.lUATTAAATAAATTAArrCATCACAACTTCAlTACTTTOC*T&tnAA 701 1 1 1 1 1— 1 1 1 1 • 800 AAAATCTATTATCCTACTtCCCTTTATTCTTAAA«TCAATAUllUAUlUAllU01UACAATTCTAA M l 1 1 1 1 1 1 1 1 1 y WO TTTATirATTTAAiy-AAAAAATA :TA A ATH A A A ArACTr-i-n><rreArr_ATATTATATi-l-ITTr A ArTATr-AAAAr^TA/^t-n T 1001 1 1 1 1 1 —I 1 1 y- f 1100 TTJTt?TTCTnrrrreATTi^ArTAAATAATTA/yf;A™;ATATAi. li rairrA/yTAATAAJ.i 11 I I n 1101 1 1 1 1 1 1 1 1 1 • •- H 1 • 1)00 AITf.l LI ATArTTTY>ACTr»|-ir AreTTTACTC ATT Af-Tri-l-reAITTA . . I I V^IY-tr ATA A A . Tl-m ^ ^p-A/T-A H f A 130 1 1 1 1 1 1 1 1 I 1 • 1400 TCUTTTATACATCAJXLAATTArrTCTCCCTCATAATCTAAl llUUbliCTCATCATTACTCll 11 U 111,111 LAI 1K.11ATCTTACTTCATTAAUA 1401 1 1 1 1 1 1 1 1 1 1 1S00 AAAAATCTCTCTTCTTATCAATTCTCACCTCTTTAATATCATAj^TTAJUAAATATTTTAATA™^ 1501 1 1 1 1 1 1 1 1 1 • 1600 ATATrreAATr.iV-ATTTTAT^ 1601 — 1 1 1 1 1 1 1 1 1 t 1700 tTCTA 1701 1 1 1 1 1 1 I I i =+ 1800 CACTGACCTCCCACCCACACAAIUI.11 lACTATCACACTCCATCATCTCTCAI.il IIATCCATATCACTCTMTTTCAACTCACTTTAACCAATTCICA 1801 I 1 1 1 1 1 I 1 1 • 1900 TAAaX£ICCAAAATU£ACT«rrtMMTCTACAAAAATCTCATACT1?rCA^ 1901 1 1 1 1 1 1 1 1 1 • 2000 CCCCAACCTCACCAAJUU^AAACCTCCIXTCAACAACCAJATrTCCCCTCCTAAACAATTT^^ 200 1 1 1 1 1 1 1 1 1 1 I 210 0 1 1 1 • 22O0 TAtqrCAAACTCAAAATAJUAlTrCTCAACTTOTTTAgrrCCCilATATATAtXATCCrTCTTATATC^ 220 1 1 1 1 1 1 1 1 1 1 • 2M 0 AACATTTCCAAAATCCCAACTACTAAA1L11111 lAATrTTArTTlTTATCATATTACCAAJ^ACTACTTCAACATCTCCTACCTrCCCAClAATCl^aA 230 1 1 1 1 1 1 1 1 1 1 • 2400 Tr^ATftf7^ATrATajAAACCTAATTATTATTCAAATAAATTAiU,llllLliATCTTACA>CTTATTT^rTA, ATTAI I I 11 11 |AATATATA»*TCTAr 270 1 1 I 1 1 1 1 1 1 1 • 2800 4629 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research TATCTCATTAAAAACTCACTTATTATTTATACSACTTAU 111L1111 CCACTCiCCAACTOCACAATAATAAACATCCAAaACTTCCACATTACTTICA 280 1 1 1 1 1 1 1 1 1 1 • 2900 roPbaAlaAlaAlaL7*AapIlaValPr o TTTTACTTCCAACATCCCCCTCATAl 111 lAlTTATACCTACATCTACATATmTAl IU.1111.1111AATTTA11IHUAATTTTAACTTCATACOC 300 1 1 1 1 1 1 1 ( 1 1 • 3100 ACTTTAiaLCa^OU^AAA<aTTTTTl^UrrCTTCACATCTCAAACCTATCAATATrrAAIA 1 TUTU, 11.1UAACATCTCTACTTCAAACTTCAAATCA 310 1 I 1 1 1 1 1 1 1 1 • 3200 1 1 • 3300 CATAAAA ^ 1 1 1 1 • 3400 TCTAAAAMTCTATAAAAAAATTACUTCllAUTAAACmTTTttATCTCUUATTCCAAA^ 340 1 1 1 1 1 1 1 1 1 1 ^ 3500 CTTACATOCACTAAAAAAAATA(XTCAAACAACTCCAAACAAACAA(KAGMTAT(7rTTCeACTAATGAAn^ 350 1 1 1 1 1 1 1 1 1 1 • J*00 AACTTAATATATTATATTCTCTAAAATTTCCTACCA1TAAAAAAATTACAAAAATC111II1 UUrrTACATCTCTATCCCCTCTCACATACATCCCTCCC 340 ! 1 1 1 1 i 1 1 1 1 • 3700 ATTAACTAATCCATTA1L1U11C111ATACTTATATTT AATTTOCTTACATTATCTTATGCACTCGTTCAA11111UXXCAACCTATCATCGAAAATAT 370 1 1 1 1 1 1 1 h— 1 1 f 3800 1 1 1 1 1 • J»00 TAATATTCACTAACTCAAATCTAACTCAAMTAATTATACTT^Tt^TTTCTGAACAACTCAATTTCTTATTTATT^ 3S0 1 1 1 1 1 1 1 1 1 1 • »OO0 alllarhaThrLraSarA n CAAAAATATATATTATCTTAAAATCTATATrraACTAATTTTATATTATTTTrAAAATSCATOCACTT^ 4001 1 I— 1 1 1 1 1 1 1 * 4100 L«iiAlaClaS«i f roClnLaoAapalaLjraHat TATCACATATOCIAITCCAaMXACCAarrCCAATATATTTTCCTCCACATCACl 1 111 lACTCATACTACTAATOCTOCTACATATCACnrCAATCTTC 410 1 1 1 1 1 1 1 1 1 1 • 4200 TyrAapIlaCjaTjrS.rThrAlaAlaAlafroIlaTyrfhaProi'n^aHiaPbaValThrfllaThrtarAanClTilaTbrTyrCluPhaAaiil^ T TT<UTlXll^ll.lllAlACll.lllXTUacCCCTACTAATTAATACTACTAtllllllCCATTCAAIIIlllJWillllllLU>AATATCTAATCAATCTT aUapCljrAlaTalAlaTlirValGlTAavPTo 430 1 AlaL«uLauSarLao5«rValAlaThrAr(L«aAlaCln01oAapFroAlaPb«SarSarIlaLra8«rL«oAspTyrLnC l AA1I.1 lli l m.H.IUATTACCCACTCCCACIAATTCACjl.U 1UATAAAACATATACACCACAACAOCCACCTAAAICCIX11XICIAOCATCCATCTTA 440 1 1 1 1 1 1 1 1 1 1 • 4500 «TrATACA<XaAATCiCTAATaUCCAACTTCnACATCACTCATTArrACATTTCTACll.l 1111UUCCTCCTCATTCACAAAACAATTACCTCACGC 450 1 1 I 1 1 1 1 1 1 1 • 4600 U.llll.lU^lATAllll.ll.UTCTOCTa(aA«AAATACAICTATCTAACTAAlllllll.lUATATATOCTACAA*ACTCTTAATAAATCATA«CATAC 4701 1 1 1 1 1 1 1 1 1 • 4800 CTAAAATTTTAAAACTACATATCATACTCAACIATCTCTTATTATCTA1.1111.11UTTATTATTATTTTATAATATCCATCTCATATATATATCATACT 4801 1 1 1 1 1 1 1 1 1 • 4400 ACT& ^ 1 1 1 1 . 1 • 5000 CluAjnAlaLnTtuCl/rbrDirThrClultotAapAspAliiSarCltiAlaAninMCloUaLnf A111111111111111 1 JTATTACTATATCTarrCACTClATATTATTCATATTACTATTTTATTOCTAATTAAAAAACTTTAI 11U.I l l IAO, 111U - J10 1 1 1 1 1 1 1 1 I 1 • 5200 ffh»A I 4630 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research 1 1 1 • 5300 1 1 ^ MOO ICTl^Uia^lTTATCTAiXClllll^irCCCCCAAATACCCAAATAAATTAlLblUTCCCATCCCATGCTAlllUig 5*01 1 1 1 1 1 1 1 raiiTi^iTi.i^.n.mTTri.rrTTiriTiTfrrni^wTr.i -... . 1 1 1 1 1 1 5*00 f 5700 MOO TtyjAJ7Tnr^TTArriArAiTTAATTAi:Ar^TrrTTAATATrrrATTJyTAArTTrTAAAATAAArTTA 5801 1 1 1 —I 1 1 1 1 1 1 3»00 l I I. I liY^fintllTil l Hil l l*T*irAltTtA^Tfl^ 1 1 1 1 1 1 1 1 1 ^ 6000 1 6094 F1g. 2 Nucleotide sequence of xpat21 patatin gene and flanking sequences. Sequence is numbered from a Bglll site 2313 nucleotides upstream of the coding region to an Xbal site 844 nucleotides 3' of the patatin termination codon. The amino acids composing each exon are shown below the string of sequence. Features mentioned in the text are marked as follows on the figure: 5' start of transcription, an arrow 1n the direction of transcription at nucleotides 2267-2272; the putative TATA box and enhancer core sequences, boxed at positions 2244 and 2196 respectively; repeated DNA sequences at positions 1760 and 2080, 2437 and 2536, and 2733 and 5441 are underlined. points. Surprisingly most of the changes between xpat21 and the cUNA sequences were concentrated in exon 4, where 15t of the amino acids were different between genes. £xon 5 was highly conserved between xpat21 and GM2033, but contained 7 different amino acids in GMU1 3. These two exons presumably represent domains of the protein that have less stringent structural requirements for activity than other Invariant domains such as exon 2. The coding region of xpat21 contained no codons for AsnXSer/Thr, the canonical glucosylation site23. However, cDNA GH013 contains such a sequence. Transcript Mapping SI nuclease protection experiments showed a major protected fragment extending 171-176 bases 5' of the Hpall priming site (F1g 3, lane 1). This corresponded to positions 2267-2272 in Fig. 2, approximately 43 bp 5' of the putative methionine initiation codon and approximately 30 bp 3 1 of a TATA box motif starting at nucleotide 2244. The position of the 5' end of the mRNA was consistent with the position of many other transcription Initiation sites 1n eukaryotic genes21*. The 5' untranslated region of the putative xpat21 mRNA comprising approximately 43 bp as defined by SI nuclease mapping, was 4631 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research Table 1 Codon use in the patatin gene xpat21. F TTT 16. S TCT 8. Y TAT 10. C TGT 1. F TTC 3. S TCC 3. Y TAC 6. C TGC 1. L TTA 13. S TCA 9. * TAA 1. * TGA 0. L TTG 9. S TCG 0. * TAG 0. W TGG 2. L CTT 10. P CCT 4. H CAT 7. R CGT L CTC 5. P CCC 1. R CGC 2. H CAC L CTA 2. P CCA 12. R CGA 8. Q CAA L CTG 1. P CCG 2. R CGG 2. Q CAG I ATT 11. T ACT 20. N AAT 14. S AGT 7. I ATC 4. T ACC 1. N AAC 3. S AGC 2. I ATA 6. T ACA 12. K AAA 13. R AGA 2. M ATG 11. T ACG 2. K AAG 9. R AGG 4. V GTT 12. A GCT 17. D GAT 16. G GGT 7. V GTC 0. A GCC 2. D GAC 4. G GGC 6. V GTA 4. A GCA 17. E GAA 16. G GGA 10. V GTG 3. A GCG 2. E GAG 7. G GGG 0. total codons- 387. total acids- 386. molecular weight- 42504. The amino acids are indicated by the single letter code, and the frequency of use of each codon is shown next to the codon. identical to the first 38 bases 5' of the Initiation codon of cUNA clone GH013, but thereafter the sequence of GM01 was divergent from xpat21. When the sequences 3' of the termination codon of xpat21, at position 5252, were compared with the 3' non-coding sequences of GM01 and GM203, there was 9S% homology between xpat21 and (JM203. There was no homology between the last 14 bp of GM01, the last 20 bp of GM203, and the cognate sequence extending 31 of position 5431 1n xpat21. A canonical polyadenylation signal25 occurs at position 5441 in xpat21, although the 3' end of xpat21 mRNA has not yet been defined by nuclease mapping. Computer analysis15 of the sequence of xpat21 (Fig. 2) revealed six distinct duplications. All of the duplicates are direct and each member has at least 95$ homology with Its duplicate. Three of the pairs of repeats have noteworthy features and are underlined 1n Fig. 2: first, the 34 bp direct repeat at nucleotides 1760 and 2080, approximately 100 bp 5' of the putative TATA box, may be involved 1n transcriptional regulation26; second, the almost perfect head-to-tall duplication of 98 bp spans the boundary of exon 1 and Intron 1; and finally, a direct repeat of 24 bp within the second intron is also found at the putative 3' end of the mRNA for Xpat21 and contains sequences similar to a polyadenylation signal25. 4632 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research [ 1 2 3 ^"* "* ^* nuclease mapping of patatin transcription. , The figure shows an autoradiograph of an Bi urea til " ' polyacrylamide sequencing gel. Lane M, size markers > ( bases) of end-labelled pBK322 digested with in Hinfl ; lane 1, primer-extended probe annealed with polyadenylated tuber RNA and digested with SI nuclease; 900 M lane 2, probe annealed with polyadenylated potato leaf RNA and digested with SI nuclease; lane 3, probe digested with SI nuclease. 151 m uo m WSm Genomic Organisation of Patatin Genes Figure 4 shows an autoradiograph of a Southern blot of potato, tomato and tobacco DMA digested with either Xbal or Hindlll and hybridised with nick-translated GM203, a patatin cONA clone3. Both Marls Piper, a commercial tetraploid variety, and 7322, a monohaploid line17, had a 4.2 kb Xbal fragment of approximately two copies per haploid genome that hybridised with the cDNA probe (F1g. 4 panel A, lanes 1 and 3). This was the same size as the Xbal fragment cloned and sequenced in this study (see the reconstruction lane containing ipatl8 ONA digested with Xbal 1n Fig. 4, panel A) and Indicated that we had cloned an Intact gene. Another tetrapioid variety, Desiree, had a substantially different pattern of hybridisation to Xbal fragments (F1g. 4. panel A, lane 2). Panel B shows hybridisation of the same cDNA probe to Hindlll digested DNA. All of the potato lines (Fig. 4, panel 4633 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research M B 1 2 3 4 5 2c 1 2 3 4 5 2c MW (kb) — -5 - 3 - 2 - 1 Fig. 4 Southern blot analysis of patatin genes. The figure shows an autoradiograph of plant DNA digested with Xbal (panel A ) or HindiII (panel B) and hybridised with nick translated patatin cUNA probe GM203. Lane 1, potato cv. Marls Piper; lane 2, potato cv. Desiree; lane 3 potato monohaploid 7322; lane 4, tomato cv. UC82B; lane 5, N. tabacum var. Samsun. Lane 2C 1s a two copy reconstruction containing xpatl8 DNA digested with Xbal (panel A, a partial digestion) or Hindlll (panel B) . The position of size markers 1s shown on the right of the figure. B, lanes 1, 2, 3) contained approximately 2 copies of a Hindlll fragment of 1.3 kb, which was an Internal fragment of the Xpat21 gene, and a Hindlll band of 4 kb which was found 5' of the xpat21 gene and contained part of the coding region (see the reconstruction lane 1n panel B, containing Xpatl8 DNA digested with Hindlll). Both Marls Piper and 7322 also had a common hybridising Hindlll band of 5.5 kb, which contained coding region from the 3 1 end of the gene and 3' flanking sequences (Fig. 4, panel B, lanes 1 and 3) . Both the Xbal and Hindlll digestions revealed approximately 10 other hybridizing bands in 7322 and Marls Piper and Desiree. In addition, Desiree 4634 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research contained multiple copies (approximately 5-10 copies) of a 4.5 kb Hindi 11 band (Fig. 4, panel B, lane 2) which may represent an amplification of a particular class of patatin genes in Desiree. Because of the high stringency of the hybridisation and wash conditions, we believed most or all of the hybridising bands represent patatin genes. Consequently patatin exists as a multigene family in the three potato varieties examined. The precise number of patatin genes could not be estimated accurately because of uncertainties 1n the copy number estimation and amount of homology to the probe. Interestingly, the autoradiographs revealed faint hybridisation to tomato DNA (F1g. 4 panel A, lane 4; panel B, lane 4). This hybridisation Indicated that tomato may contain genes related to patatin. No hybridisation of the patatin cDNA probe to tobacco DNA was observed. DISCUSSION We have presented evidence for the Isolation and characterisation of an Intact patatin gene from the commercial tetraploid potato variety Marls Piper. A comparison of the restriction sites within the isolated genomic clones xpat21 and XpatlS and Southern blots of total potato UNA showed that both genoinic clones were co-linear with some of the fragments hybridising to a patatin cDNA probe. In addition the genes Isolated 1n this study appear to be found 1n the monohaploid variety 7322. The large number of fragments hybridising to patatin cUNA showed that patatin genes are part of a multigene family containing approximately 5-10 members. It is difficult to predict 1f the patatin gene isolated in this study is an active member of the gene family. Recently, an analysis of the Rubisco small subunit gene family in petunia2' using 3' gene specific transcript probes, Indicated that only a subset of genes in the family was transcriptionally active, while other members of the family, which did not appear to be pseudogenes, were not transcribed. The high homology of the 51 and 3' non-coding regions of the three known patatin genes UM01, GH203 and xpat21 means that gene-spedf1c probes cannot be used to distinguish transcription of a particular gene. Therefore it will be necessary to use isolated 5' and 31 regulatory sequences in transformation experiments to study the transcription of Individual patatin genes. The 5' non-coding region of Xpat21 was defined by SI nuclease mapping to extend 43±3 bases 5' of the Initiator methionine codon (Fig. 3, lane 1) . There was only one difference between these sequences and the first 40 bp of the 51 untranslated sequence of the cDNA clone GM01. Thereafter, 1n the 5' 4635 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research direction, the two sequences were unrelated; Apat21 had a canonical TATA box 30 bp 51 of the putative mRNA 5' end, while GM01 had another 40 bp of sequence that contained two methionine Initiator codons, with an appropriate Initiator context sequence28, in the same reading frame as the patatin gene. This structure 1s unusual 1n eukaryotic mRNAs, which usually initiate at the first methionine codon28. Inspection of the sequence of GrtOl revealed a perfect Inverted repeat of the first 36 bp of GMul extending from ami no acid 34 to amino ad d 47. If this duplication was an artifact of cDNA synthesis, cloning or sequencing, in which an Internal fragment of the gene was Ugated onto the true 51 end of the cDNA, then the 5' end of GM01 cUNA would be only approximately 5 bp shorter than the 51 end Identified for xpat21. In the hope of elucidating the function of Xpat21 from the DNA sequence presented here, we compared the protein sequence of xpat21 with the protein sequence of several soluble plant storage proteins (the globulins) using Diagon programmes15. No homology to pea providllin precursor29, oat globulin30, pea legumin31, bean phaseolin32, rape cruciferin33, or potato seed storage protein34, was found (data not shown). These findings do not exclude patatin from a role as a storage protein, but confirm the suggestion that somatic storage proteins are different from seed storage proteins31*. The observation that tomato, which has no somatic storage organ, contains sequences homologous to patatin may Indicate that patatin is found in tissues other than somatic storage organs. A closer examination of the expression of patatin 1n potato and tomato tissues would clarify this matter. Clearly the close association of LAH activity with patatin can now be tested definitively by expressing the patatin gene isolated in this study 1n a variety of plant tissues which have low endogenous LAH activity. It 1s Interesting to note that cv. Desiree, which contains an amplification of a 4.5 kb Hindlll band that may represent an increase 1n the copy number of a particular patatin gene, has tuber LAH activity 2-3 orders of magnitude lower than other varieties5. These findings may be reconciled by assuming that only a subset of the patatin gene family have LAH activity. Finally, the structural analysis conducted here has defined several putative elements that may be Involved 1n the regulation of transcription. A functional analysis of these will elucidate the mechanism of transcription of patatin. ACKNOWLEDGEMENTS We are grateful to Bill Park and colleagues for making available the patatin cDNA clone GH203, and to members of the Willmitzer laboratory for 4636 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research discussing their patatin sequence prior to publication. Thanks are also due to Ben Hall for sharing his Illuminating Ideas on patatin. R.6. and M.J. are employed by the Agricultural Genetics Company. G.I. receives a Ph.D. Fellowship from COSNET-S.E.P., Mexico. *To whom correspondence should be addressed REFERENCES 1 . Racusen, L>. and Foote, M. (1980) Food Biochem. 4^, 43-52. 2. Park, W.D., Blackwood, C , Mignery, G.A., Hermodsen, M.A. and Lister, R.M. (1983) Plant Physiol. U, 156-160. 3. Mignery, G.A., Pikaard, C.S., Hannapel, D.J. and Park, W.D. (1984) Nucl . Adds Res. 12, 7987-8000. 4 . Racusen, U. (1984j~ Can. J . Bot. 62, 1640-1644. 5. Gal Hard , T. and Matthew, J.A. (1973) J. Sc1. Fd Agri . 24, 623-627. 6. Paiva, E., Lister, R.M. and Park, W.U. (1983) Plant PhysTol. 71, 161-168. 7. Harmey, M.A., Crowley, M.P. and Clinch, P.E.M. (1966) Eur. Potato J. 9, 146-151. 8 . Palmer, C.E. and Smith, O.E. (1970) PI. Cell Physiol. 11, 303-314. 9. T1z1o, R. (1972) Potato Res. 15, 257-262. 10. Maxam, A.M. and Gilbert , W. (lUBo) JTK Grossman, L., Modave, K. (eds) Methods in Enzymology, Vol 65. Academic Press: New York, pp499-560. 11 . Barker, R.F., Idler, K.B., Thompson, D.V. and Kemp, J.D. (1983) Plant Molec. B1ol. 2. 335-350. 12. Bankier, A.T. and Barrel! , B.G. (1983) _In: Techniques 1n Lif e Sciences, Vol 85, Elsevier, Ireland. 13. Henikoff, S. (1984) Gene ^8 , 351-359. 14. Devereaux, J. , HaeberU, P. and Smithies, 0. (1984) Nucl. Acids Res. 12, 387-395. 15. "Staden, R. (1980) Nucl. Acids Res. 8, 3673-3694. 16. Nasmyth, K. (1983) Nature 302, 670-676. 17. Sopory, S.K., Jacobsen, E. ImTWenzel, G. (1978) Plant Sci. Letts. 12, 47-54. 18. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. 19. Frischauf, A.-M., Lehrach, H., Poustka, A. and Murray, N. (1983) J. Mol . Biol. 170, 827-842. 20. Southern, ETH7 (1975) J. Mol. Biol . 98, 503-518. 21 . Norrander, J. , Kempe, T. and Messing.T. (1983) Gene 26, 101-106. 22. Mount, S.M. (1982) Nucl. Acids Res. _10, 459-472. 23. Sharon, N. and L1s, H. (1979) Biochem. Soc. Transactions 7, 783-799. 24. Benoist, C. and Chambon, P. (1981) Nature (London) ^90, 3(54-310. 25. Proudfoot, N. (1982) Nature ^98 , 516-517. 26. Gluzman, Y. and Schenk, T., eds (1985) Eucaryotic transcription: the rol e of ds - and trans-acting elements 1n Initiation . (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 27. Dean, C , van den Elzen, P., Tamaki, S., Dunsmuir, P. and Bedbrook, J. (1985) EMBO J . j», 3055-3061. 28 . Kozak, M. (1983) Microbiol. Rev. ^7 , 1-45. 29. Lycett, G.H., Oelauney, A.J. , Gatehouse, J.A., Gilroy, J. , Croy, R.R.D. and Boulter, D. (1983) Nucl. Acids Res. 11, 2367-2380. 30. Walburg, G. and Larkins, B.A. (1986) Plant Mol. Biol . 6, 161-169. 4637 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research 31 . Croy, R.R.D., Lycett, G.W., Gatehouse, J.A., Yarwood, J.N. and Boulter, D. (1982) Nature ^95, 76-79. 3Z. Slightom, J.C., Sun, S.H. and Hall , T.C. (1983) Proc. Natl. Acad. Sc1. USA 80, 1898-19U1. 33. Simon, A.E. , Tenbarge, K.H., Scoffeld, S.R., Finkelsteln, R.K. and Crouch, M.L. (1985) PI. Mol. Biol . Ji, 191-200. 34. Boulter, D. and Harvey, P. (1985) Physiolia Vegetale ^3 , 61-74. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

The structure and transcription start site of major potato tuber protine gene

Download PDF
14 pages

Loading next page...
 
/lp/oxford-university-press/the-structure-and-transcription-start-site-of-major-potato-tuber-2CMZ9XD20Q

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Oxford University Press
Copyright
© IRL Press Limited, Oxford, England
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/14.11.4625
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Volume 14 Number 11 1986 Nucleic Acids Research The structure and transcription start site of a major potato tuber protein gene M.Bevan*, R.Barker, A.Goldsbrough, M.Jarvis, T.Kavanagh and G.Iturriaga Molecular Genetics Department, Plant Breeding Institute, Marts Lane, Trumpington, Cambridge, UK Received 26 March 1986; Revised and Accepted 6 May 1986 ABSTRACT We have isolated recombinant lambda clones containing intact major tuber protein (patatin) genes and flanking sequences from the commercial tetraploid variety Marls Piper. The gene is composed of seven exons and six Introns, spread over 4 kb of DNA. Nuclease mapping defined the 51 end of the mRNA approximately 45 bp upstream of the Initiation codon. The 5' end of the gene is preceeded by a canonical TATA box sequence. The three known patatin genes encode proteins of nearly identical M but very different isoelectric points. The sequence of the gene does not Indicate a role for patatin as one of the globulin class of plant storage proteins. INTRODUCTION The most abundant protein in potato tubers is a 40 kd glycoprotein called patatin, which represents approximately 40$ of the total protein in mature tubers1. Patatin exists as a complex mixture of differently charged isoforms within a variety2, but protein and cUNA sequencing have shown that there are only two major forms of patatin differing by 17 amino acids3. It is thought the extensive charge heterogeneity of patatin may also be due to glycosylation and other post-translat1onal modifications2. There is strong evidence that patatin is a lipolytic acyl hydrolase (LAH)\ an activity which Is thought to be involved in the response of tubers to pathogens 5 . The putative 23 amino ad d signal sequence Identified by cUNA sequencing is consistent with lipid hydrolase activity, which must be sequestered to avoid cell lysis. However, 1t is difficult to equate this lipid hydrolase activity with the massive quantity of patatin in tubers. Patatin may have a dual role as a somatic storage protein and as an enzyme Involved in host resistance. Patatin is not normally found In stems, leaves or roots of potatoes, but it can be Induced to accumulate in isolated single-node cuttings without differentiation into a stolon and tuber by removing the axillary bud6. Normally the axillary bud develops as a stolon and tuber under short-day treatment and as a shoot under long-day conditions. Tuber formation can also ©IR L Press Limited, Oxford, England. 4625 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research be stimulated by high levels of sucrose and cytokinin In the growth medium'' 8 , and retarded by exogenous gibberel hns 9 . As mKNA for patatin is only found in developing tubers3, i t is likely that factors such as day-length , sucrose and growth regulators act, directly or Indirectly, to stimulat e the transcription of patatin genes. We are interested in the regulatory mechanisms involved in patatin accumulation , and as a prelude to these investigations we report here the Isolatio n and UNA sequence of an intact patatin gene and flanking sequences from Solanum tuberosum. MATERIALS AND METHODS Bacteria l Strains E. col l K803 hsdR- hsdM" supE met" E. coll MC1U22 ara D139 A(ara, leu)7697 AlacZM15 galU galF StrA E. col i TG2 recA" FtraU36, proAB, lacls^, AlacZM15. Material s Restriction enzymes, alkaline phosphatase, T4 kinase and T4 ligase were obtained from BoehMnger, Amersham International or BKL, and were used according to the manufacturer's instructions. Chemicals used in UNA sequencing were obtained from the recommended suppliers10. Radiochemicals were obtained from NEN and Amersham International. UNA Sequencing Chemical UNA sequencing reactions were performed according to Haxam and Gilbert10, with modifications and sequencing gels run according to Barker et aJL u Uideoxy sequencing was conducted according to standard methods12. Templates for sequencing were obtained by direct cloning or by exonuclease III 13delet1ons . Computer analysis of the UNA and protein sequences were performed using the programs of the University of Wisconsin 11* and R. Staden15. RNA Analysis A single stranded radioactive probe was made by priming 16 an ml3jnplU clone of an Hpall - Xbal fragment that extended from nucleotide 1929 (an Xbal site) to nucieotide 2442 (an Hpall site 129 bp 3' of the putative Initiation codon). The radioactive single strands complementary to patatin mRNA were hybridised to 3 pg of polyadenylated tuber RNA, digested with SI nuclease, and electrophoresed on an 81 polyacrylamide 94 urea sequencing gel. Genomic DNA Analysis Ten yg samples of tobacco (N. tabacum var Samsun), tomato (Lycopersicon 4626 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research esculentum UC828), and potato (Solanum tuberosum var. Desiree, Haris Piper and 7322)w UNA were digested with restriction endonucleases, eletrophoresed i n 0.8% agarose gels, and blotted onto Hybond N nylon membranes according to the manufacturer's instructions. Blots were hybridised with nick-translated 1 8 patatin cDNA UM2033, washed in U.2x SSC, 0.1J SUS lmrt EDTA at 65°C, and exposed to X-ray film for 24-48 hours. Kecombinant Library Construction Two hundred pg of Haris Piper DNA was partiall y digested with Sau 3a, and size-fractionated by centrifugation on two 14 ml 1U-40J sucrose gradients in 1M NaCl, 5mM EUTA, 2U mM Tns HC1 pH 8.U for 6 hr at 40.UUO rpm, 20°C. Fractions containing UNA larger than 15 kb were pooled and re-fractionated on a single gradient. Fragments of 15-20 kb were pooled and ethanol precipitated . The lambda vector EMBL319 was digested with BamHl and EcoRl, phenol extracted and precipitated twice with 0.6 vol of isopropanol at 0°C. A large scale ligat ion containing 4 pg of vector DNA and 1 pg of size-fractionate d potato UNA was packaged in vitro to yiel d 1400 pi of solutio n with a titr e of 2.8 x 103 pfu/pl . This represented an efficiency of 2.84 x 105 pfu/pg of EMBL3 DNA. Packaging mix was adsorbed onto K803, plated onto 22 cm2 Nunc plates, and the resulting phage lawn was lifted onto nitrocellulose 1 8 and screened with nick-translated UM203 patatin cUNA probe. Pure plaques were obtained after 2-3 rounds of purification, and DNA was purifie d from large scale liquid lysates18of recombinant phage. RESULTS Isolation of Genomic Clones The hybridisation of nick-translated patatin cDNA probe3 to nitrocellulose lifts of 200,000 recombinant plaques revealed 5 strongly hybridising plaques. Only two of these were stable during subsequent growth on K8O3. UNA was Isolated from both phages and analysed by restriction digestion and Southern hybridisation20. Only one clone, xpat21, contained hybridising DNA fragments of the same size seen in genomic Southern blots hybridised with GM203 (see later). The region of UNA homologous to patatin cDNA was contained within a 4 kb Xbal fragment located approximately 0.3 kb from the left boundary of the phage Insert (see F1g. 1). This 4.0 kb Xbal fragment was subcloned into pUC1921 and sequenced using the Maxam and Gilbert method10. Regions of the clone inaccessible to this method were sequenced using exonuclease III generated deletions of xpat21 DNA cloned 1n M13mpl8 and mpl921. Inspection of the sequence revealed a putative AUG initiation codon 4627 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research P«» r * m *•• u,r * ? • ii till—L_L Fig. 1 Structure of recombinant lambda clones containing patatin genes. The line represents potato DNA inserted into the BamHI site of XEMBL3, with the left arm of EMBL3 on the left. The boxed regions represent the exons encoding patatin, while the direction of transcription 1s shown by an arrow. Abbreviations: B, BamHI; G, Bglll; H, Hindlll, P, PstI; X, Xbal. for patatin precursor polypeptide approximately 20U bp from an Xbal site, which was 300 bp from the left boundary of the plant clone. The 300 bp fragment containing the upstream flanking sequences of patatin was isolated, sequenced, and used to probe another library of 200,000 recombinant plaques. Five stable strongly hybridising plaques were Isolated. Southern analysis showed that they had a similar pattern of Pstl, Hindlll, BamHI, Xbal and Kpnl sites, but only one clone xpatl8, had at least 8 kb of 5' upstream sequence. The restriction map at Xpatl8 1s shown in F1g. 1. Fragments containing the 51 end of Xpatl8 were subcloned into mpl8 and mpl9 and sequenced. The sequences of xpatl8 and xpat21 were Identical over the 700 bp sequenced at their 51 ends and 500 bp sequenced at their 3' untranslated regions. This similarity leads us to conclude that the same patatin gene was Isolated from both libraries. Figure 2 shows the sequence of the coding region of the gene, which spans 2939 bp, 842 bp of 3' non-coding sequence, and 2313 bp of 5' non-coding region. The total sequence was 71.2% AT, while the coding regions were 63.8% AT. This was reflected in a strong bias towards the use of A or T in the third base position, as shown 1n Table 1. The gene contained seven exons all of which were delineated by canonical 5' GT-31 AG splice sites22. The introns were particularly AT rich and varied In size from 86 bp to 726 bp, while the exons varied 1n size from 57 bp to 288 bp, and encoded a polypeptide of M 42504. We refer to the Introns as IVS 1 to IVS 6, 51 to 3'. There were substantial differences 1n the amino ad d sequence of xpat21 and published cONA sequences3. Nearly all of the 25 amino acid changes occurred at the same positions 1n all three genes, and several of the changes Involved the substitution of differently charged amino acids. Consequently the three known patatin proteins encoded by Xpat 21, GM201 and GM203, had an almost identical M.W. but were predicted to have different isoelectric 4628 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research CCCATCTTAL1 11IATTCCC1111.1111ATTATCAII11 11ACACH.H.1U0I ICACTAATTCACCtCACACTAIACCATATAAiaCCTAAICACAlCTT 1 1 , 1 1 1 1 1 , > 100 AblUlUlllllATlllllUllATCTACAACACCAAllUllAAAMTATCAACTTGCTACTAT 1 CTTCA11I IICACTTATAATTTTACTCAATTGCAM 1111ACAATAI1111 lAATACTTACCAOl I H-ATCAATCATCAACTTTAH.11UXATATACAC 201 1 1 < 1 1 1 1 1 1 f 300 TACTTTCTOATtUTATACrrCAAAAACrrTCACTTATCTTAAATTTCTAATMTAAAATTtAATTATATTCTAAAICAAAAATTACrrA 301 1 1 1 1 1 1 1 1 1 • tOO ATTACAACATAIQUA<aCAAATTCT(rrTACAT*TTTTACrrTT(aCrCCAATAIOAATAICrCAATTTAAATCr 40 1 I 1 1 1 1 1 1 (UCCTAIAAAA<CTCjGA>TT&tACCAACATMTTCCAAGCTATCTCTCAOaCArr^^ 11 nCTCTA 50 1 1 1 i 1 1 P 1 1 1 ^ WO TTAJCTrATTTTTATTATATCATCATCCCTCAATTTTCATACAlATAl 11 lH.lUATTAAATAAATTAArrCATCACAACTTCAlTACTTTOC*T&tnAA 701 1 1 1 1 1— 1 1 1 1 • 800 AAAATCTATTATCCTACTtCCCTTTATTCTTAAA«TCAATAUllUAUlUAllU01UACAATTCTAA M l 1 1 1 1 1 1 1 1 1 y WO TTTATirATTTAAiy-AAAAAATA :TA A ATH A A A ArACTr-i-n><rreArr_ATATTATATi-l-ITTr A ArTATr-AAAAr^TA/^t-n T 1001 1 1 1 1 1 —I 1 1 y- f 1100 TTJTt?TTCTnrrrreATTi^ArTAAATAATTA/yf;A™;ATATAi. li rairrA/yTAATAAJ.i 11 I I n 1101 1 1 1 1 1 1 1 1 1 • •- H 1 • 1)00 AITf.l LI ATArTTTY>ACTr»|-ir AreTTTACTC ATT Af-Tri-l-reAITTA . . I I V^IY-tr ATA A A . Tl-m ^ ^p-A/T-A H f A 130 1 1 1 1 1 1 1 1 I 1 • 1400 TCUTTTATACATCAJXLAATTArrTCTCCCTCATAATCTAAl llUUbliCTCATCATTACTCll 11 U 111,111 LAI 1K.11ATCTTACTTCATTAAUA 1401 1 1 1 1 1 1 1 1 1 1 1S00 AAAAATCTCTCTTCTTATCAATTCTCACCTCTTTAATATCATAj^TTAJUAAATATTTTAATA™^ 1501 1 1 1 1 1 1 1 1 1 • 1600 ATATrreAATr.iV-ATTTTAT^ 1601 — 1 1 1 1 1 1 1 1 1 t 1700 tTCTA 1701 1 1 1 1 1 1 I I i =+ 1800 CACTGACCTCCCACCCACACAAIUI.11 lACTATCACACTCCATCATCTCTCAI.il IIATCCATATCACTCTMTTTCAACTCACTTTAACCAATTCICA 1801 I 1 1 1 1 1 I 1 1 • 1900 TAAaX£ICCAAAATU£ACT«rrtMMTCTACAAAAATCTCATACT1?rCA^ 1901 1 1 1 1 1 1 1 1 1 • 2000 CCCCAACCTCACCAAJUU^AAACCTCCIXTCAACAACCAJATrTCCCCTCCTAAACAATTT^^ 200 1 1 1 1 1 1 1 1 1 1 I 210 0 1 1 1 • 22O0 TAtqrCAAACTCAAAATAJUAlTrCTCAACTTOTTTAgrrCCCilATATATAtXATCCrTCTTATATC^ 220 1 1 1 1 1 1 1 1 1 1 • 2M 0 AACATTTCCAAAATCCCAACTACTAAA1L11111 lAATrTTArTTlTTATCATATTACCAAJ^ACTACTTCAACATCTCCTACCTrCCCAClAATCl^aA 230 1 1 1 1 1 1 1 1 1 1 • 2400 Tr^ATftf7^ATrATajAAACCTAATTATTATTCAAATAAATTAiU,llllLliATCTTACA>CTTATTT^rTA, ATTAI I I 11 11 |AATATATA»*TCTAr 270 1 1 I 1 1 1 1 1 1 1 • 2800 4629 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research TATCTCATTAAAAACTCACTTATTATTTATACSACTTAU 111L1111 CCACTCiCCAACTOCACAATAATAAACATCCAAaACTTCCACATTACTTICA 280 1 1 1 1 1 1 1 1 1 1 • 2900 roPbaAlaAlaAlaL7*AapIlaValPr o TTTTACTTCCAACATCCCCCTCATAl 111 lAlTTATACCTACATCTACATATmTAl IU.1111.1111AATTTA11IHUAATTTTAACTTCATACOC 300 1 1 1 1 1 1 1 ( 1 1 • 3100 ACTTTAiaLCa^OU^AAA<aTTTTTl^UrrCTTCACATCTCAAACCTATCAATATrrAAIA 1 TUTU, 11.1UAACATCTCTACTTCAAACTTCAAATCA 310 1 I 1 1 1 1 1 1 1 1 • 3200 1 1 • 3300 CATAAAA ^ 1 1 1 1 • 3400 TCTAAAAMTCTATAAAAAAATTACUTCllAUTAAACmTTTttATCTCUUATTCCAAA^ 340 1 1 1 1 1 1 1 1 1 1 ^ 3500 CTTACATOCACTAAAAAAAATA(XTCAAACAACTCCAAACAAACAA(KAGMTAT(7rTTCeACTAATGAAn^ 350 1 1 1 1 1 1 1 1 1 1 • J*00 AACTTAATATATTATATTCTCTAAAATTTCCTACCA1TAAAAAAATTACAAAAATC111II1 UUrrTACATCTCTATCCCCTCTCACATACATCCCTCCC 340 ! 1 1 1 1 i 1 1 1 1 • 3700 ATTAACTAATCCATTA1L1U11C111ATACTTATATTT AATTTOCTTACATTATCTTATGCACTCGTTCAA11111UXXCAACCTATCATCGAAAATAT 370 1 1 1 1 1 1 1 h— 1 1 f 3800 1 1 1 1 1 • J»00 TAATATTCACTAACTCAAATCTAACTCAAMTAATTATACTT^Tt^TTTCTGAACAACTCAATTTCTTATTTATT^ 3S0 1 1 1 1 1 1 1 1 1 1 • »OO0 alllarhaThrLraSarA n CAAAAATATATATTATCTTAAAATCTATATrraACTAATTTTATATTATTTTrAAAATSCATOCACTT^ 4001 1 I— 1 1 1 1 1 1 1 * 4100 L«iiAlaClaS«i f roClnLaoAapalaLjraHat TATCACATATOCIAITCCAaMXACCAarrCCAATATATTTTCCTCCACATCACl 1 111 lACTCATACTACTAATOCTOCTACATATCACnrCAATCTTC 410 1 1 1 1 1 1 1 1 1 1 • 4200 TyrAapIlaCjaTjrS.rThrAlaAlaAlafroIlaTyrfhaProi'n^aHiaPbaValThrfllaThrtarAanClTilaTbrTyrCluPhaAaiil^ T TT<UTlXll^ll.lllAlACll.lllXTUacCCCTACTAATTAATACTACTAtllllllCCATTCAAIIIlllJWillllllLU>AATATCTAATCAATCTT aUapCljrAlaTalAlaTlirValGlTAavPTo 430 1 AlaL«uLauSarLao5«rValAlaThrAr(L«aAlaCln01oAapFroAlaPb«SarSarIlaLra8«rL«oAspTyrLnC l AA1I.1 lli l m.H.IUATTACCCACTCCCACIAATTCACjl.U 1UATAAAACATATACACCACAACAOCCACCTAAAICCIX11XICIAOCATCCATCTTA 440 1 1 1 1 1 1 1 1 1 1 • 4500 «TrATACA<XaAATCiCTAATaUCCAACTTCnACATCACTCATTArrACATTTCTACll.l 1111UUCCTCCTCATTCACAAAACAATTACCTCACGC 450 1 1 I 1 1 1 1 1 1 1 • 4600 U.llll.lU^lATAllll.ll.UTCTOCTa(aA«AAATACAICTATCTAACTAAlllllll.lUATATATOCTACAA*ACTCTTAATAAATCATA«CATAC 4701 1 1 1 1 1 1 1 1 1 • 4800 CTAAAATTTTAAAACTACATATCATACTCAACIATCTCTTATTATCTA1.1111.11UTTATTATTATTTTATAATATCCATCTCATATATATATCATACT 4801 1 1 1 1 1 1 1 1 1 • 4400 ACT& ^ 1 1 1 1 . 1 • 5000 CluAjnAlaLnTtuCl/rbrDirThrClultotAapAspAliiSarCltiAlaAninMCloUaLnf A111111111111111 1 JTATTACTATATCTarrCACTClATATTATTCATATTACTATTTTATTOCTAATTAAAAAACTTTAI 11U.I l l IAO, 111U - J10 1 1 1 1 1 1 1 1 I 1 • 5200 ffh»A I 4630 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research 1 1 1 • 5300 1 1 ^ MOO ICTl^Uia^lTTATCTAiXClllll^irCCCCCAAATACCCAAATAAATTAlLblUTCCCATCCCATGCTAlllUig 5*01 1 1 1 1 1 1 1 raiiTi^iTi.i^.n.mTTri.rrTTiriTiTfrrni^wTr.i -... . 1 1 1 1 1 1 5*00 f 5700 MOO TtyjAJ7Tnr^TTArriArAiTTAATTAi:Ar^TrrTTAATATrrrATTJyTAArTTrTAAAATAAArTTA 5801 1 1 1 —I 1 1 1 1 1 1 3»00 l I I. I liY^fintllTil l Hil l l*T*irAltTtA^Tfl^ 1 1 1 1 1 1 1 1 1 ^ 6000 1 6094 F1g. 2 Nucleotide sequence of xpat21 patatin gene and flanking sequences. Sequence is numbered from a Bglll site 2313 nucleotides upstream of the coding region to an Xbal site 844 nucleotides 3' of the patatin termination codon. The amino acids composing each exon are shown below the string of sequence. Features mentioned in the text are marked as follows on the figure: 5' start of transcription, an arrow 1n the direction of transcription at nucleotides 2267-2272; the putative TATA box and enhancer core sequences, boxed at positions 2244 and 2196 respectively; repeated DNA sequences at positions 1760 and 2080, 2437 and 2536, and 2733 and 5441 are underlined. points. Surprisingly most of the changes between xpat21 and the cUNA sequences were concentrated in exon 4, where 15t of the amino acids were different between genes. £xon 5 was highly conserved between xpat21 and GM2033, but contained 7 different amino acids in GMU1 3. These two exons presumably represent domains of the protein that have less stringent structural requirements for activity than other Invariant domains such as exon 2. The coding region of xpat21 contained no codons for AsnXSer/Thr, the canonical glucosylation site23. However, cDNA GH013 contains such a sequence. Transcript Mapping SI nuclease protection experiments showed a major protected fragment extending 171-176 bases 5' of the Hpall priming site (F1g 3, lane 1). This corresponded to positions 2267-2272 in Fig. 2, approximately 43 bp 5' of the putative methionine initiation codon and approximately 30 bp 3 1 of a TATA box motif starting at nucleotide 2244. The position of the 5' end of the mRNA was consistent with the position of many other transcription Initiation sites 1n eukaryotic genes21*. The 5' untranslated region of the putative xpat21 mRNA comprising approximately 43 bp as defined by SI nuclease mapping, was 4631 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research Table 1 Codon use in the patatin gene xpat21. F TTT 16. S TCT 8. Y TAT 10. C TGT 1. F TTC 3. S TCC 3. Y TAC 6. C TGC 1. L TTA 13. S TCA 9. * TAA 1. * TGA 0. L TTG 9. S TCG 0. * TAG 0. W TGG 2. L CTT 10. P CCT 4. H CAT 7. R CGT L CTC 5. P CCC 1. R CGC 2. H CAC L CTA 2. P CCA 12. R CGA 8. Q CAA L CTG 1. P CCG 2. R CGG 2. Q CAG I ATT 11. T ACT 20. N AAT 14. S AGT 7. I ATC 4. T ACC 1. N AAC 3. S AGC 2. I ATA 6. T ACA 12. K AAA 13. R AGA 2. M ATG 11. T ACG 2. K AAG 9. R AGG 4. V GTT 12. A GCT 17. D GAT 16. G GGT 7. V GTC 0. A GCC 2. D GAC 4. G GGC 6. V GTA 4. A GCA 17. E GAA 16. G GGA 10. V GTG 3. A GCG 2. E GAG 7. G GGG 0. total codons- 387. total acids- 386. molecular weight- 42504. The amino acids are indicated by the single letter code, and the frequency of use of each codon is shown next to the codon. identical to the first 38 bases 5' of the Initiation codon of cUNA clone GH013, but thereafter the sequence of GM01 was divergent from xpat21. When the sequences 3' of the termination codon of xpat21, at position 5252, were compared with the 3' non-coding sequences of GM01 and GM203, there was 9S% homology between xpat21 and (JM203. There was no homology between the last 14 bp of GM01, the last 20 bp of GM203, and the cognate sequence extending 31 of position 5431 1n xpat21. A canonical polyadenylation signal25 occurs at position 5441 in xpat21, although the 3' end of xpat21 mRNA has not yet been defined by nuclease mapping. Computer analysis15 of the sequence of xpat21 (Fig. 2) revealed six distinct duplications. All of the duplicates are direct and each member has at least 95$ homology with Its duplicate. Three of the pairs of repeats have noteworthy features and are underlined 1n Fig. 2: first, the 34 bp direct repeat at nucleotides 1760 and 2080, approximately 100 bp 5' of the putative TATA box, may be involved 1n transcriptional regulation26; second, the almost perfect head-to-tall duplication of 98 bp spans the boundary of exon 1 and Intron 1; and finally, a direct repeat of 24 bp within the second intron is also found at the putative 3' end of the mRNA for Xpat21 and contains sequences similar to a polyadenylation signal25. 4632 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research [ 1 2 3 ^"* "* ^* nuclease mapping of patatin transcription. , The figure shows an autoradiograph of an Bi urea til " ' polyacrylamide sequencing gel. Lane M, size markers > ( bases) of end-labelled pBK322 digested with in Hinfl ; lane 1, primer-extended probe annealed with polyadenylated tuber RNA and digested with SI nuclease; 900 M lane 2, probe annealed with polyadenylated potato leaf RNA and digested with SI nuclease; lane 3, probe digested with SI nuclease. 151 m uo m WSm Genomic Organisation of Patatin Genes Figure 4 shows an autoradiograph of a Southern blot of potato, tomato and tobacco DMA digested with either Xbal or Hindlll and hybridised with nick-translated GM203, a patatin cONA clone3. Both Marls Piper, a commercial tetraploid variety, and 7322, a monohaploid line17, had a 4.2 kb Xbal fragment of approximately two copies per haploid genome that hybridised with the cDNA probe (F1g. 4 panel A, lanes 1 and 3). This was the same size as the Xbal fragment cloned and sequenced in this study (see the reconstruction lane containing ipatl8 ONA digested with Xbal 1n Fig. 4, panel A) and Indicated that we had cloned an Intact gene. Another tetrapioid variety, Desiree, had a substantially different pattern of hybridisation to Xbal fragments (F1g. 4. panel A, lane 2). Panel B shows hybridisation of the same cDNA probe to Hindlll digested DNA. All of the potato lines (Fig. 4, panel 4633 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research M B 1 2 3 4 5 2c 1 2 3 4 5 2c MW (kb) — -5 - 3 - 2 - 1 Fig. 4 Southern blot analysis of patatin genes. The figure shows an autoradiograph of plant DNA digested with Xbal (panel A ) or HindiII (panel B) and hybridised with nick translated patatin cUNA probe GM203. Lane 1, potato cv. Marls Piper; lane 2, potato cv. Desiree; lane 3 potato monohaploid 7322; lane 4, tomato cv. UC82B; lane 5, N. tabacum var. Samsun. Lane 2C 1s a two copy reconstruction containing xpatl8 DNA digested with Xbal (panel A, a partial digestion) or Hindlll (panel B) . The position of size markers 1s shown on the right of the figure. B, lanes 1, 2, 3) contained approximately 2 copies of a Hindlll fragment of 1.3 kb, which was an Internal fragment of the Xpat21 gene, and a Hindlll band of 4 kb which was found 5' of the xpat21 gene and contained part of the coding region (see the reconstruction lane 1n panel B, containing Xpatl8 DNA digested with Hindlll). Both Marls Piper and 7322 also had a common hybridising Hindlll band of 5.5 kb, which contained coding region from the 3 1 end of the gene and 3' flanking sequences (Fig. 4, panel B, lanes 1 and 3) . Both the Xbal and Hindlll digestions revealed approximately 10 other hybridizing bands in 7322 and Marls Piper and Desiree. In addition, Desiree 4634 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research contained multiple copies (approximately 5-10 copies) of a 4.5 kb Hindi 11 band (Fig. 4, panel B, lane 2) which may represent an amplification of a particular class of patatin genes in Desiree. Because of the high stringency of the hybridisation and wash conditions, we believed most or all of the hybridising bands represent patatin genes. Consequently patatin exists as a multigene family in the three potato varieties examined. The precise number of patatin genes could not be estimated accurately because of uncertainties 1n the copy number estimation and amount of homology to the probe. Interestingly, the autoradiographs revealed faint hybridisation to tomato DNA (F1g. 4 panel A, lane 4; panel B, lane 4). This hybridisation Indicated that tomato may contain genes related to patatin. No hybridisation of the patatin cDNA probe to tobacco DNA was observed. DISCUSSION We have presented evidence for the Isolation and characterisation of an Intact patatin gene from the commercial tetraploid potato variety Marls Piper. A comparison of the restriction sites within the isolated genomic clones xpat21 and XpatlS and Southern blots of total potato UNA showed that both genoinic clones were co-linear with some of the fragments hybridising to a patatin cDNA probe. In addition the genes Isolated 1n this study appear to be found 1n the monohaploid variety 7322. The large number of fragments hybridising to patatin cUNA showed that patatin genes are part of a multigene family containing approximately 5-10 members. It is difficult to predict 1f the patatin gene isolated in this study is an active member of the gene family. Recently, an analysis of the Rubisco small subunit gene family in petunia2' using 3' gene specific transcript probes, Indicated that only a subset of genes in the family was transcriptionally active, while other members of the family, which did not appear to be pseudogenes, were not transcribed. The high homology of the 51 and 3' non-coding regions of the three known patatin genes UM01, GH203 and xpat21 means that gene-spedf1c probes cannot be used to distinguish transcription of a particular gene. Therefore it will be necessary to use isolated 5' and 31 regulatory sequences in transformation experiments to study the transcription of Individual patatin genes. The 5' non-coding region of Xpat21 was defined by SI nuclease mapping to extend 43±3 bases 5' of the Initiator methionine codon (Fig. 3, lane 1) . There was only one difference between these sequences and the first 40 bp of the 51 untranslated sequence of the cDNA clone GM01. Thereafter, 1n the 5' 4635 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research direction, the two sequences were unrelated; Apat21 had a canonical TATA box 30 bp 51 of the putative mRNA 5' end, while GM01 had another 40 bp of sequence that contained two methionine Initiator codons, with an appropriate Initiator context sequence28, in the same reading frame as the patatin gene. This structure 1s unusual 1n eukaryotic mRNAs, which usually initiate at the first methionine codon28. Inspection of the sequence of GrtOl revealed a perfect Inverted repeat of the first 36 bp of GMul extending from ami no acid 34 to amino ad d 47. If this duplication was an artifact of cDNA synthesis, cloning or sequencing, in which an Internal fragment of the gene was Ugated onto the true 51 end of the cDNA, then the 5' end of GM01 cUNA would be only approximately 5 bp shorter than the 51 end Identified for xpat21. In the hope of elucidating the function of Xpat21 from the DNA sequence presented here, we compared the protein sequence of xpat21 with the protein sequence of several soluble plant storage proteins (the globulins) using Diagon programmes15. No homology to pea providllin precursor29, oat globulin30, pea legumin31, bean phaseolin32, rape cruciferin33, or potato seed storage protein34, was found (data not shown). These findings do not exclude patatin from a role as a storage protein, but confirm the suggestion that somatic storage proteins are different from seed storage proteins31*. The observation that tomato, which has no somatic storage organ, contains sequences homologous to patatin may Indicate that patatin is found in tissues other than somatic storage organs. A closer examination of the expression of patatin 1n potato and tomato tissues would clarify this matter. Clearly the close association of LAH activity with patatin can now be tested definitively by expressing the patatin gene isolated in this study 1n a variety of plant tissues which have low endogenous LAH activity. It 1s Interesting to note that cv. Desiree, which contains an amplification of a 4.5 kb Hindlll band that may represent an increase 1n the copy number of a particular patatin gene, has tuber LAH activity 2-3 orders of magnitude lower than other varieties5. These findings may be reconciled by assuming that only a subset of the patatin gene family have LAH activity. Finally, the structural analysis conducted here has defined several putative elements that may be Involved 1n the regulation of transcription. A functional analysis of these will elucidate the mechanism of transcription of patatin. ACKNOWLEDGEMENTS We are grateful to Bill Park and colleagues for making available the patatin cDNA clone GH203, and to members of the Willmitzer laboratory for 4636 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research discussing their patatin sequence prior to publication. Thanks are also due to Ben Hall for sharing his Illuminating Ideas on patatin. R.6. and M.J. are employed by the Agricultural Genetics Company. G.I. receives a Ph.D. Fellowship from COSNET-S.E.P., Mexico. *To whom correspondence should be addressed REFERENCES 1 . Racusen, L>. and Foote, M. (1980) Food Biochem. 4^, 43-52. 2. Park, W.D., Blackwood, C , Mignery, G.A., Hermodsen, M.A. and Lister, R.M. (1983) Plant Physiol. U, 156-160. 3. Mignery, G.A., Pikaard, C.S., Hannapel, D.J. and Park, W.D. (1984) Nucl . Adds Res. 12, 7987-8000. 4 . Racusen, U. (1984j~ Can. J . Bot. 62, 1640-1644. 5. Gal Hard , T. and Matthew, J.A. (1973) J. Sc1. Fd Agri . 24, 623-627. 6. Paiva, E., Lister, R.M. and Park, W.U. (1983) Plant PhysTol. 71, 161-168. 7. Harmey, M.A., Crowley, M.P. and Clinch, P.E.M. (1966) Eur. Potato J. 9, 146-151. 8 . Palmer, C.E. and Smith, O.E. (1970) PI. Cell Physiol. 11, 303-314. 9. T1z1o, R. (1972) Potato Res. 15, 257-262. 10. Maxam, A.M. and Gilbert , W. (lUBo) JTK Grossman, L., Modave, K. (eds) Methods in Enzymology, Vol 65. Academic Press: New York, pp499-560. 11 . Barker, R.F., Idler, K.B., Thompson, D.V. and Kemp, J.D. (1983) Plant Molec. B1ol. 2. 335-350. 12. Bankier, A.T. and Barrel! , B.G. (1983) _In: Techniques 1n Lif e Sciences, Vol 85, Elsevier, Ireland. 13. Henikoff, S. (1984) Gene ^8 , 351-359. 14. Devereaux, J. , HaeberU, P. and Smithies, 0. (1984) Nucl. Acids Res. 12, 387-395. 15. "Staden, R. (1980) Nucl. Acids Res. 8, 3673-3694. 16. Nasmyth, K. (1983) Nature 302, 670-676. 17. Sopory, S.K., Jacobsen, E. ImTWenzel, G. (1978) Plant Sci. Letts. 12, 47-54. 18. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. 19. Frischauf, A.-M., Lehrach, H., Poustka, A. and Murray, N. (1983) J. Mol . Biol. 170, 827-842. 20. Southern, ETH7 (1975) J. Mol. Biol . 98, 503-518. 21 . Norrander, J. , Kempe, T. and Messing.T. (1983) Gene 26, 101-106. 22. Mount, S.M. (1982) Nucl. Acids Res. _10, 459-472. 23. Sharon, N. and L1s, H. (1979) Biochem. Soc. Transactions 7, 783-799. 24. Benoist, C. and Chambon, P. (1981) Nature (London) ^90, 3(54-310. 25. Proudfoot, N. (1982) Nature ^98 , 516-517. 26. Gluzman, Y. and Schenk, T., eds (1985) Eucaryotic transcription: the rol e of ds - and trans-acting elements 1n Initiation . (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 27. Dean, C , van den Elzen, P., Tamaki, S., Dunsmuir, P. and Bedbrook, J. (1985) EMBO J . j», 3055-3061. 28 . Kozak, M. (1983) Microbiol. Rev. ^7 , 1-45. 29. Lycett, G.H., Oelauney, A.J. , Gatehouse, J.A., Gilroy, J. , Croy, R.R.D. and Boulter, D. (1983) Nucl. Acids Res. 11, 2367-2380. 30. Walburg, G. and Larkins, B.A. (1986) Plant Mol. Biol . 6, 161-169. 4637 Downloaded from https://academic.oup.com/nar/article/14/11/4625/2385384 by DeepDyve user on 21 August 2020 Nucleic Acids Research 31 . Croy, R.R.D., Lycett, G.W., Gatehouse, J.A., Yarwood, J.N. and Boulter, D. (1982) Nature ^95, 76-79. 3Z. Slightom, J.C., Sun, S.H. and Hall , T.C. (1983) Proc. Natl. Acad. Sc1. USA 80, 1898-19U1. 33. Simon, A.E. , Tenbarge, K.H., Scoffeld, S.R., Finkelsteln, R.K. and Crouch, M.L. (1985) PI. Mol. Biol . Ji, 191-200. 34. Boulter, D. and Harvey, P. (1985) Physiolia Vegetale ^3 , 61-74.

Journal

Nucleic Acids Research – Oxford University Press

Published: Jun 11, 1986

There are no references for this article.