Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Biochemical Analysis of Fructose-1,6-bisphosphatase Import into Vacuole Import and Degradation Vesicles Reveals a Role for UBC1 in Vesicle Biogenesis

Biochemical Analysis of Fructose-1,6-bisphosphatase Import into Vacuole Import and Degradation... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 13, Issue of March 30, pp. 10398 –10406, 2001 © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Biochemical Analysis of Fructose-1,6-bisphosphatase Import into Vacuole Import and Degradation Vesicles Reveals a Role for UBC1 in Vesicle Biogenesis* Received for publication, February 28, 2000, and in revised form, December 28, 2000 Published, JBC Papers in Press, December 29, 2000, DOI 10.1074/jbc.M001767200 Hui-Ling Shieh, Yong Chen, C. Randell Brown, and Hui-Ling Chiang‡ From the Department of Cellular and Molecular Physiology, Pennsylvania State College of Medicine, Hershey, Pennsylvania 17033 When Saccharomyces cerevisiae are shifted from me- ways (5–11). Regulation of the autophagic process can have dium containing poor carbon sources to medium con- important consequences on cellular physiology. For example, taining fresh glucose, the key gluconeogenic enzyme the tumor suppresser gene beclin-1 is homologous to APG6/ fructose-1,6-bisphosphatase (FBPase) is imported into VPS30 and induces autophagy in yeast and mammalian cells. Vid (vacuole import and degradation) vesicles and then Therefore, a decrease in autophagic protein degradation may to the vacuole for degradation. Here, we show that FB- contribute to the development or progression of human Pase import is independent of vacuole functions and malignancy (13). proteasome degradation. However, FBPase import re- A nonselective macroautophagy pathway is induced when S. quired the ubiquitin-conjugating enzyme Ubc1p. A cerevisiae are starved of nitrogen (5–11). This pathway requires strain containing a deletion of the UBC1 gene exhibited a novel ubiquitin-like conjugating system (14). Furthermore, defective FBPase import. Furthermore, FBPase import this pathway also overlaps with the cytoplasm to vacuole tar- was inhibited when cells overexpressed the K48R/K63R geting pathway for targeting aminopeptidase I from the cyto- ubiquitin mutant that fails to form multiubiquitin plasm (5–11). Aminopeptidase I trafficking to the vacuole oc- chains. The defects in FBPase import seen for the Dubc1 curs by two routes (11). Under normal growth conditions, and the K48R/K63R mutants were attributed to the Vid aminopeptidase I is targeted to the vacuole by cytoplasm to vesicle fraction. In the Dubc1 mutant, the level of the Vid vacuole targeting vesicles. When cells are starved of nitrogen, vesicle-specific marker Vid24p was reduced in the vesi- however, aminopeptidase I is delivered to the vacuole by the cle fraction, suggesting that UBC1 is required for either macroautophagy pathway (11). Recent evidence suggests that Vid vesicle production or Vid24p binding to Vid vesicles. However, the K48R/K63R mutant did not prevent Vid24p the cytoplasm to vacuole targeting pathway also shares com- binding to Vid vesicles, indicating that ubiquitin chain ponents with the peroxisome microautophagy pathway formation is dispensable for Vid24p binding to these (15–17). structures. Our results support the findings that ubiq- Fructose-1,6-bisphosphatase (FBPase), the key regulatory uitin conjugation and ubiquitin chain formation play enzyme in gluconeogenesis in S. cerevisiae, is induced when important roles in a number of cellular processes in- yeast cells are grown in medium containing poor carbon cluding organelle biogenesis. sources (18). When fresh glucose is added to the medium, however, FBPase is targeted to the vacuole and degraded (19, 20). This redistribution of FBPase to the vacuole has been The vacuole of the yeast Saccharomyces cerevisiae is homol- observed by immunofluorescence microscopy, cell fraction- ogous to the lysosome of higher eucaryotes and as such, plays ation, and electron microscopy (19, 20). More recently, FBPase an important role in protein degradation (1– 4). The function of targeting to the vacuole has been reconstituted in vitro using the vacuole requires the targeting of a number of vacuole permeabilized yeast cells incubated with purified radiolabeled resident proteins into this organelle. These proteins are sorted FBPase in the presence of ATP, an ATP regenerating system to this organelle by several mechanisms and require the assist- and cytosolic proteins (21). ance of numerous genes. For example, targeting of the vacuole FBPase is imported into a novel type of Vid (vacuole import lumenal protein carboxypeptidase Y (CPY) from the late Golgi and degradation) vesicle prior to its uptake by the vacuole (22). requires more than 40 VPS genes (1– 4). These vesicles have been purified to near homogeneity from Proteins and organelles can be delivered to the vacuole from wild-type cells (22). The identification of Vid vesicles in the the cytoplasm by the microautophagy or macroautophagy path- FBPase degradation pathway suggests that this pathway can be divided into at least two steps. The first step is the targeting * This work was supported by National Institutes of Health Grant and sequestration of FBPase into Vid vesicles. The second step RO1GM59480 (to H-L. C.). The costs of publication of this article were is the delivery of FBPase from Vid vesicles to the vacuole for defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 degradation. U.S.C. Section 1734 solely to indicate this fact. Since Vid vesicles do not contain markers from known or- ‡ To whom correspondence should be addressed: Dept. of Cellular and ganelles, they may represent a novel transport structure, al- Molecular Physiology, Penn State College of Medicine, 500 University though it is possible that Vid vesicles are derived from existing Dr., Hershey, PA 17033. Tel.: 717-531-0860; Fax: 717-531-0859; E-mail: [email protected]. structures. Thus far, the heat shock protein Ssa2p is the only The abbreviations used are: CPY, carboxypeptidase Y; FBPase, molecule that has been shown to play a role in the import of fructose-1,6-bisphosphatase; VPS, vacuole protein sorting; VID, vacuole FBPase into Vid vesicles (23). To identify more molecules in- import and degradation; PAGE, polyacrylamide gel electrophoresis; volved in this process, we analyzed the import of FBPase into MG132, carbobenzoxyl-leucinyl-leucinyl-leucinal; ATPgS, adenosine 59-O-(thiotriphosphate). Vid vesicles using various inhibitors and mutants. We found 10398 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. A Role for UBC1 in Vid Vesicle Biogenesis 10399 TABLE I Yeast strains used in this study Strain Genotype Sources HLY001 Mata his3-D200 ura3–52 leu2,3–112 isel::URA3 HLY208 Mata ura3–52 leu2,3–112 trp1 lys2–801 ise1::URA3 fbp1::LEU2 HLY227 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 vid24::TRP1 HLY232 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 vid24::TRP1 fbp1::LEU2 HLY247 Mata his3-D200 ura3–52 leu2,3–112 trp1 ise1::URA3 pep4::TRP1 fbp1::LEU2 HLY233 Mata his3-D200 ura3–52 leu2,3–112 trp1 vid24::TRP1 pep4::URA3 fbp1::LEU2 HLY193 Mata leu2–3,112 his3 trp1–1 ura3–52 fbp1::LEU2 HLY195 Mata his3-D200 ura3–52 leu2,3–112 trp1 pep4::TRP1 HLY223 Mata leu2–3,112 his3 trp1–1 ura3–52 lys2–801 vma3-D1 Mata ade6 ura3–52 leu2,3–112 pep4–3 gal2 vma3-D1::URA3 Ref. 39 HLY217 Mata a de6 ura3–52 leu2,3–112 pep4–3 gal2 vma3-D1::URA3 fbp1::LEU2 Dubc1 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc1::HIS3 Ref. 43 Dubc6 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc6::HIS3 Ref. 12 Dubc7 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc7::HIS3 Ref. 12 pre1–1pre2–1 Mata his3–11,15 ura3–52 leu2,3–112 pre1–1 pre2–1 HLY212 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc1::HIS3 fbp1::LEU2 HLY213 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc6::HIS3 fbp1::LEU2 HLY214 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc7::HIS3 fbp1::LEU2 HLY215 Mata his3–11,15 ura3–52 leu2,3–112 pre1–1 pre2–1 fbp1::LEU2 ise1 Mata his7–2 ura3–52 leu2,3–112 ise1 Ref. 36 HLY823 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUB223 (myc-K48R/K63R Ub) HLY824 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUB141 (myc-Ub) HLY819 Mata leu2–3, 112 his3 trp1–1 ura3–52 fbp::LEU2 pUB223 (myc-K48R/K63R Ub) HLY820 Mata leu2–3, 112 his3 trp1–1 ura3–52 fbp::LEU2 pUB141 (myc-Ub) HLY806 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 vid24::TRP1 pUB141 (myc-Ub) HLY807 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 vid24::TRP1 pUB223 (myc-K48R/K63R Ub) HLY821 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUb-Pro-b-galactosidase HLY827 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUb-Pro-b-galactosidase pUB141 (myc-Ub) vided by Dr. T. Stevens (University of Oregon). This plasmid was that FBPase import was not affected by inhibitors or mutants digested with EcoRI and XhoI to disrupt the PEP4 locus (32). The defect that block vacuole acidification, vacuole proteolysis, or protea- in the pep4 null strains was confirmed by the accumulation of the p2 some degradation. However, FBPase import did require ubiq- form of CPY intracellularly. A strain with a null mutation of the VID1 uitin chain formation and the ubiquitin conjugation enzyme gene was also utilized. The VID1 gene is identical to the ISE1 or ERG6 Ubc1p. The Dubc1 mutant contained defective vesicles, but gene. The gene was amplified by polymerase chain reaction and cloned competent cytosol. Furthermore, FBPase import was inhibited into a TA cloning vector (Invitrogen) using a 59 primer AGCGGC- CGCGGGATGGGGAGTGAAACAGAATTGAGAAAA and a 39 primer when cells overexpressed a ubiquitin mutant (K48R/K63R) TGAGGCGGCCGCCTTGAGTTGCTTCTTGGGAAGTTTGGG. A dele- that prevents the formation of multiubiquitin chains. The de- tion construct was produced by removing 80% of the gene via KpnI and fect of the K48R/K63R mutant was associated with Vid vesi- PflMI digestion, and religating with a URA3 containing fragment pro- cles, indicating that ubiquitin chain formation is required to duced by digesting the YIP352 plasmid with SmaI and HpaI. The produce competent Vid vesicles. resultant construct was linearized with NotI and transformed into a In the absence of the UBC1 gene, the level of the Vid vesicle- wild type strain. The deletion was confirmed by polymerase chain reaction analysis. The pUB141 plasmid containing the wild type Myc- specific marker Vid24p was reduced in the Vid vesicle pellet tagged ubiquitin, the pUB223 plasmid containing the Myc-tagged fraction, suggesting that UBC1 is required for Vid vesicle pro- K48R/K63R ubiquitin mutant and the Ub-Pro-bgal plasmid (33, 34) duction. Alternatively, Vid24p binding to Vid vesicles may be were obtained from Dr. D. Finley (Harvard Medical School). compromised in the absence of ubiquitination. However, over- YPD is a complete medium (10 g/liter of Bacto-yeast extract, 20 production of the K48R/K63R mutant did not prevent Vid24p g/liter of Bacto-peptone, Difco Labs Inc.) supplemented with 20 g/liter binding to Vid vesicles. Since ubiquitin chain formation is dextrose (Fisher Scientific). YPKG contained 10 g/liter Bacto-yeast extract, 20 g/liter Bacto-peptone, 10 g/liter potassium acetate, and 5 necessary for Vid vesicle function, but is dispensable for Vid24p g/liter dextrose. Synthetic minimal medium consisted of 6.7 g/liter yeast binding to Vid vesicles, these results are consistent with the nitrogen base without amino acids, supplemented with 5 g/liter hypothesis that Vid vesicle formation is regulated by ubiquitin casamino acids, 40 mg/liter adenine, 60 mg/liter leucine, and 20 g/liter conjugation and ubiquitin chain formation. Thus, our work dextrose. Inhibitors used in this study included ATPgS, N-ethylmale- complements previous studies in which ubiquitin conjugation imide, brefeldin A, bafilomycin A, and concanamycin A and were pur- is important for peroxisome biogenesis (24), mitochondrial in- chased from Sigma. MG132 (carbobenzoxyl-leucinyl-leucinyl-leucinal) and b-lactone were gifts from Dr. A. Goldberg (Harvard Medical heritance (25), mitochondrial targeting (26), and receptor-me- School). Tran S-label (10 mCi/mmol) was obtained from ICN. Rabbit diated endocytosis (27–31). anti-FBPase and rabbit anti-CPY polyclonal antibodies were raised by Berkeley Antibody Co. (Berkeley, CA) using purified FBPase and CPY EXPERIMENTAL PROCEDURES (Sigma). Mouse and rabbit anti-Myc antibodies were purchased from Yeast Strains, Chemicals, and Antibodies—S. cerevisiae strains used Berkeley Antibody Co. Mouse anti-b-galactosidase antibodies were pur- in this study are listed in Table I. For the in vitro experiments, the chased from Promega. endogenous FBP1 gene was deleted and a known quantity of purified The FBPase Import Assay—The FBPase import assay was performed FBPase was added to the reaction. To produce the fbp1 null strain, the according to Shieh and Chiang (21). In a typical experiment, the reac- FBP1 gene was cloned into pBR322 to yield the plasmid pJS31. The tion mixture (100 ml) contained 3 A units of semi-intact cells, 11 mg 600 nm fbp1 deletion construct was generated by removing 90% of the FBP1 of S-FBPase, an ATP regenerating system (0.5 mM ATP, 0.2 mg/ml gene from pJS31 with StuI and religating with a LEU2 containing creatine phosphokinase, 40 mM creatine phosphate), and 0.5 mg/ml fragment which was produced by digestion of the YEP13 plasmid with cytosolic proteins. The mixture was incubated at 30 °C for the indicated BglII. The deletion construct was then digested with BamHI and Hin- times, after which 0.8 mg/ml proteinase K was added to identify the dIII and transformed into yeast strains using the standard lithium acetate method. The deletion of FBP1 was confirmed by Western blot- ting with anti-FBPase antibodies. H-L. Shieh, Y. Chen, C. R. Brown, and H-L. Chiang, unpublished A pep4 null mutation was produced using the pTS15 plasmid pro- results. 10400 A Role for UBC1 in Vid Vesicle Biogenesis FIG.2. The Dise1 mutant contains defective vesicles. The Dise1 (HLY208) and Dvid24 (HLY 232) mutants were shifted to glucose for 20 min. Semi-intact (SI) cells and cytosol were prepared from the Dise1 and Dvid24 mutants and combined as indicated. Lane 1, FBPase import using Dise1 cytosol and Dise1 semi-intact cells. Lane 2, FBPase import into Dvid24 semi-intact cells with Dvid24 cytosol. Lane 3, FBPase import into Dise1 semi-intact cells with cytosol from Dvid24. Lane 4, FBPase import into Dvid24 semi-intact cells with cytosol from the Dise1 mutant. FIG.1. The kinetics of FBPase import into the Dise1 and conversion to semi-intact cells. Purified FBPase was incubated Dvid24 semi-intact cells. A, wild type (HLY223), Dise1 (HLY001), and with semi-intact cells in the absence or presence of ATP, an Dvid24 (HLY227) were grown in YPKG to induce FBPase. Cells were shifted to glucose for 0, 60, and 120 min. Total lysates from these cells ATP regenerating system and cytosol. At selected times, pro- were solubilized in SDS buffer, separated by SDS-PAGE and FBPase teinase K was added to digest the FBPase that was not pro- degradation was followed in these cells. B, both Dise1 (HLY208) and tected in a membrane-sealed compartment. In the absence of Dvid24 (HLY232) mutants were shifted to glucose for 20 min. Semi- both ATP and cytosol, FBPase import into the Dvid24 semi- intact cells and cytosol were prepared as described (21). FBPase import was measured for 0, 10, 20, and 30 min in the absence or presence of intact cells was minimal (Fig. 1B). In the presence of ATP and ATP and cytosol. The % FBPase import is indicated. cytosol, however, FBPase import increased in a time-dependent manner. When quantitated, ;25–35% of the total added FB- fraction of FBPase that was sequestered in a proteinase K-resistant Pase was proteinase K protected after 30 min of import. In compartment. Samples were processed and resuspended in 200 mlof contrast, the Dise1 mutant had background levels of FBPase SDS-loading buffer. The proteins (15 ml) were then resolved by SDS- PAGE and analyzed by a Fuji FUJIX BAS 1000 Bioimaging Analyzer import either in the presence or in the absence of ATP and (Fuji Medical Systems). cytosol (Fig. 1B). Miscellaneous Assays—Isolation of Vid vesicles by differential cen- The Dise1 Mutant Contains Defective Vesicles—The defect of trifugation was performed as described (23). Briefly, total lysates were FBPase import seen for the Dise1 mutant could result from an subjected to differential centrifugation at 13,000 3 g for 20 min and the inability of cytosol to stimulate FBPase import or an inability of supernatant was further centrifuged at 200,000 3 g for 2 h. The distri- Vid vesicles to take up FBPase. To determine the site of this bution of Vid24p in the high speed pellet (200,000 3 g pellet) and the high speed supernatant (200,000 3 g supernatant) was determined by defect, we performed an in vitro assay using various combina- Western blotting with anti-Vid24p antibodies. The biosynthesis of CPY tions of semi-intact cells and cytosol from the Dise1 and Dvid24 was studied using the protocol described by Graham et al. (35). The mutants. When the Dise1 semi-intact cells were used, FBPase exponentially grown Dise1, Dise1Dpep4, Dvid24, and Dvid24Dpep4 import was defective regardless of whether the cytosol was strains were labeled with Tran S-label for 10 min at 30 °C and then isolated from the Dise1 (Fig. 2, lane 1)orthe Dvid24 mutants chased for 40 min at 30 °C. To examine the effect of brefeldin A on CPY (lane 3). By contrast, FBPase import into the Dvid24 semi- processing, an ise1 strain was preincubated in the presence or absence of brefeldin A (75 mg/ml) at 22 °C for 10 min. Cells were pulsed for 10 intact cells was observed when cytosol was prepared from ei- min, chased for 40 min, and then harvested. Total lysates were immu- ther the Dvid24 mutant (lane 2)orthe Dise1 mutant (lane 4). noprecipitated with CPY antiserum, subjected to SDS-PAGE using This experiment suggests that the Dise1 mutant strain has 7.5% polyacrylamide gels, and analyzed with a Fuji Bioimaging Ana- competent cytosol that can stimulate FBPase import into com- lyzer. The degradation of short-lived and long-lived proteins was exam- petent Vid vesicles. However, the Dise1 mutant contains defec- ined using the protocols described by Lee and Goldberg (36). tive vesicles that cannot support FBPase import, even when RESULTS combined with import-competent cytosol. FBPase Import in Vitro—To biochemically analyze FBPase FBPase Import Is Independent of Vacuole Proteolysis and import into Vid vesicles, we used an in vitro system that repro- Vacuole Acidification—Next, we utilized our in vitro assay to duces the defects seen for mutants affecting the FBPase deg- investigate whether FBPase import into Vid vesicles was de- radation pathway. For example, both the Dvid1 (Dise1) and pendent on other cellular processes such as vacuole proteolysis Dvid24 mutants inhibit the degradation of FBPase in vivo (Fig. or vacuole acidification. The PEP4 gene is required for the 1A). However, these mutations affect different steps in the maturation of several major vacuolar proteinases including FBPase degradation pathway. The Dvid24 mutant strain im- CPY. Hence, the deletion of the PEP4 gene renders cells defec- ports FBPase into Vid vesicles normally, but this mutation tive in vacuolar proteolysis (1, 3). In wild type cells, CPY is blocks the trafficking of Vid vesicles to the vacuole. As such, synthesized as prepro-CPY and then translocated into the en- this mutation results in the accumulation of FBPase in Vid doplasmic reticulum where it is glycosylated to p1-CPY in the vesicles (37). On the other hand, a mutation of the VID1 gene endoplasmic reticulum (1– 4). CPY is further modified in the (a gene that is identical to the ISE1 or ERG6 gene) blocks Golgi to p2-CPY and finally processed to the mature form in the FBPase import into Vid vesicles (38) and serves as a negative vacuole (1– 4). Therefore, the deletion of the PEP4 gene re- control for in vitro import. sulted in the accumulation of p2-CPY in the Dise1Dpep4 and To examine FBPase import in the Dise1 and Dvid24 strains, Dvid24Dpep4 strains (Fig. 3A). When FBPase import was the endogenous FBP1 gene was deleted so that a known quan- measured, the level was low in the Dise1 single mutant (Fig. tity of radiolabeled, purified FBPase could be added and fol- 3B, lane 1) and there was no significant increase in the FBPase lowed in the in vitro system. Each strain was glucose starved import in the Dise1Dpep4 double mutant (lane 2). Likewise, and then shifted to glucose containing medium prior to their there was no significant change in FBPase import in the A Role for UBC1 in Vid Vesicle Biogenesis 10401 FIG.4. FBPase import into Vid vesicles is defective in the Dubc1 mutant. A, the degradation of short-lived proteins was exam- ined in wild type (WT), pre1-1pre2-1, Dubc1, Dubc6, and Dubc7 cells. The pre1-1pre2-1 was pulsed at 22 °C and chased at 37 °C, while Dubc1, Dubc6, and Dubc7 were pulsed and chased at 30 °C. B, the strains Dubc1 (HLY212), Dubc6 (HLY213), and Dubc7 (HLY214) were shifted to glu- cose for 20 min. The pre1-1pre2-1 (HLY 215) was shifted to glucose at FIG.3. FBPase import into Vid vesicles is not affected by PEP4 37 °C. FBPase import into Vid vesicles was conducted as described or VMA3 mutants. A, the biosynthesis of CPY was examined by under “Experimental Procedures.” pulse-chase experiments in the Dise1, Dise1Dpep4, Dvid24, and Dvid24Dpep4 strains. B, the strains Dise1 (HLY208), Dise1Dpep4 (HLY247), Dvid24 (HLY232), Dvid24Dpep4 (HLY233), and Dvma3 (HLY217) were shifted to glucose for 20 min. The cytosol and semi- (lanes 2 and 3), suggesting a specific role for UBC1 in the intact cells were prepared and FBPase import was measured in the import process. presence of ATP and cytosol. The percentage of FBPase import in each One of the major functions of ubiquitin conjugation is to strain is indicated. target proteins for degradation by the proteasome (41, 42). However, ubiquitin conjugation can also have other important Dvid24Dpep4 double mutant (lane 4) as compared with the functions unrelated to protein degradation (24 –31, 41, 42). We Dvid24 single mutant (lane 3). Since uptake of FBPase by Vid investigated whether the proteasome plays a role in FBPase vesicles is independent of the PEP4 gene, this supports our import using the pre1-1pre2-1 proteasome mutant. PRE1 and model that FBPase import into Vid vesicles occurs prior to PRE2 encode subunits of the 20 S core particle of the protea- trafficking to the vacuole. some and an interaction between Pre1p and Pre2p is necessary As is shown in Fig. 1, the addition of ATP and cytosol stim- for formation of the chymotrypsin-like active site in the protea- ulates FBPase import into Vid vesicles. This suggests that some (47, 48). A decrease in the degradation rate of short-lived ATPases and/or ATP hydrolysis (see below) may play some role proteins was observed for the pre1-1pre2-1 mutant strain (Fig. in FBPase import. The VMA3 gene, which encodes the 16-kDa 4A). However, the import of FBPase in the pre1-1pre2-1 mutant proteolipid subunit of the membrane sector of the V-ATPase (1, was not altered (Fig. 4B, lane 4). Thus, the proteasome is 39), has previously been shown to play a role in autophagy (40). unlikely to be involved in the import process. However, when FBPase import was measured in the vma3 Inhibitor Studies—We next investigated whether FBPase deletion mutant, there was no significant defect (Fig. 3B, lane import was dependent upon vacuole acidification or protea- 5). Therefore, V-ATPase is not essential for FBPase import into some degradation using inhibitors that block these processes Vid vesicles. (Fig. 5). For these experiments, Dvid24 semi-intact cells and FBPase Import Requires the UBC1 Gene—Ubiquitination cytosol were preincubated with various concentrations of inhib- plays an important role in distinct biological functions includ- itors. These concentrations were chosen based upon previous ing DNA repair, protein degradation, organelle biogenesis, and studies demonstrating maximal inhibition in the yeast system protein trafficking (41, 42). For example, the ubiquitin protein (35, 36, 49 –51). FBPase, ATP, and an ATP regenerating system ligase Rsp5p is essential for mitochondrial inheritance and were then added to the reaction mixture to commence the mitochondrial import (25, 26). Rsp5p is also involved in recep- import process. The in vitro import of FBPase was inhibited by tor-mediated internalization of Ste2p, Ste3p, and other cell nonhydrolyzable ATPgS (Fig. 5A, lane 3). However, N-ethyl- surface proteins (31). In addition, the ubiquitin-conjugating maleimide, which inhibits V-ATPase (1) did not affect FBPase enzyme Ubc10p plays a critical role in peroxisomal biogenesis import in vitro (lane 4). Likewise, brefeldin A had no effect on (24). Ubc10p is one of 13 ubiquitin-conjugating enzymes found in vitro FBPase import (lane 5), even though this inhibitor in yeast (41, 42). UBC1, UBC4, and UBC5 are functionally caused accumulation of p1-CPY in the ise1 (brefeldin A perme- overlapping and are involved in degrading abnormal or short- able) strain (Fig. 5B, lane 2). FBPase import was also unaf- lived proteins (43, 44). As expected, the Dubc1 strain displayed fected by the proteasome inhibitors MG132 or b-lactone (Fig. a reduced rate of degradation of short-lived proteins as com- 5A, lanes 6 and 7), although these inhibitors did reduce the pared with the wild type control (Fig. 4A). In contrast, UBC6 degradation of short-lived proteins in vivo (Fig. 5C). Inhibitors and UBC7 are involved in the ubiquitination of misfolded or that perturb vacuole acidification such as bafilomycin A and unassembled proteins in the endoplasmic reticulum degrada- concanamycin A (1, 50, 51) also had no effect on FBPase import tion pathway (45, 46). Therefore, Dubc6 and Dubc7 strains did (Fig. 5A, lanes 8 and 9), but they did reduce the degradation of not inhibit the degradation of short-lived proteins (Fig. 4A). long-lived proteins in vivo (Fig. 5D). Taken together, the mu- When the Dubc1, Dubc6, and Dubc7 strains were tested for tant analyses and the inhibitor studies suggest that FBPase FBPase import, a reduced level of import was observed for import into Vid vesicles is independent of vacuole proteolysis, Dubc1 (Fig. 4B, lane 1), but not for the Dubc6 and Dubc7 strains vacuole acidification, and proteasome degradation. However, 10402 A Role for UBC1 in Vid Vesicle Biogenesis FIG.5. The effects of inhibitors on FBPase import. A, FBPase import into semi-intact Dvid24 cells (HLY232) was carried out in the absence (lane 1) or pres- ence (lane 2) of ATP and cytosol or with preincubation of various inhibitors (lanes 3–12). ATPgS (50 mM), N-ethylmaleimide (10 mM), brefeldin A (75 mg/ml), MG132 (100 mM), b-lactone (50 mM), bafilomycin A (20 mM), and concanamycin A (0.3 mM) were added to semi-intact cells and cy- tosol for 20 min before the addition of FBPase, ATP, and an ATP regenerating system. FBPase import was measured as described. The percentage of FBPase im- port in semi-intact cells treated with var- ious inhibitors is indicated. B, the addi- tion of brefeldin A caused p1-CPY to accumulate in the ise1 strain (lane 2). C, the degradation of short-lived proteins was inhibited by MG132 and b-lactone. D, inhibitors that perturb the acidification of the vacuole reduced the degradation of long-lived proteins. this import does require ATP hydrolysis and the UBC1 gene. If UBC1 is required for Vid vesicle formation, the number of UBC1 Is Necessary for FBPase Import—Since the Dubc1 Vid vesicles should be reduced in the Dubc1 mutant. This would strain displayed defective FBPase import in vitro, we next be reflected as a decreased level of Vid24p within fractions that determined whether this strain was also defective in FBPase contain Vid vesicles. Conversely, if UBC1 is required for the degradation in vivo. As is shown in Fig. 6A, wild type cells function of the import machinery, the level of Vid24p would not degraded FBPase after a shift to glucose for 180 min. In con- be altered in the Vid vesicle containing fractions. To test these trast, FBPase degradation was significantly retarded in the possibilities, the wild type, Dubc1, and Dubc6 strains were Dubc1 mutant, but was normal in the Dubc6 mutant. There- shifted to glucose and cell extracts were subjected to differen- fore, UBC1 is required for FBPase degradation, whereas UBC6 tial centrifugation using the protocol described previously (23). is not. In wild type and Dubc6 mutant cells, most of the Vid24p was in We next examined whether the defect in FBPase import the Vid vesicle containing pellet fraction (Fig. 7B). By contrast, observed for the Dubc1 mutant resulted from an inability of the Dubc1 mutant exhibited a significantly decreased level of cytosol to support FBPase import or an inability of Vid vesicles Vid24p in the pellet fraction, but a greater concentration of to take up FBPase. As is shown in Fig. 6B, when cytosol and Vid24p in the soluble fraction (Fig. 7B). The decreased level of semi-intact cells from the Dubc1 strain were used, FBPase Vid24p in the pellet fraction most likely represents a reduced import was impaired (lane 1). By contrast, when cytosol and production of Vid vesicles, since Vid24p induction is not altered semi-intact cells from the Dvid24 strain were combined, a high in the Dubc1 strain. However, a decreased binding of Vid24p to level of FBPase import was observed (lane 2). FBPase import Vid vesicles in the Dubc1 strain could also account for this decreased when Dubc1 semi-intact cells were incubated with observation. cytosol from the Dvid24 strain (lane 3). Since the Dvid24 strain The K48R/K63R Ubiquitin Mutant Inhibits FBPase Degra- contained import competent cytosol, this result indicates that dation—Ubiquitin molecules are most often linked to one an- the Dubc1 mutant had defective vesicles. In contrast, the Dubc1 other by isopeptide bonds between the carboxyl terminus of one strain appears to contain competent cytosol, because cytosol ubiquitin and the e-amino group of lysine 48 of the next ubiq- from the Dubc1 strain supported FBPase import into import uitin (41, 42). However, ubiquitin chains can also be formed at competent Vid vesicles in Dvid24 semi-intact cells (lane 4). lysine 63 (41, 42). Therefore, when both lysine 48 and lysine 63 The impaired ability of the Dubc1 semi-intact cells to import are replaced with arginine (K48R/K63R), the formation of mul- FBPase could be due to a decrease in Vid vesicle production. tiubiquitin chains is inhibited. To study the effect of ubiquitin Alternatively, the reduced import could result from a defect in chain formation on FBPase degradation, a strain overexpress- the import machinery. In initial experiments, we examined the ing the K48R/K63R mutation was used. When wild type ubiq- levels of the Vid vesicle specific marker, Vid24p. Vid24p is uitin was overproduced, FBPase was degraded in response to induced in response to glucose and a significant portion of this glucose in vivo (Fig. 8A). However, when the K48R/K63R ubiq- protein is associated with Vid vesicles as a peripheral protein uitin mutant was overexpressed, FBPase degradation was im- (37). When cells were maintained in low glucose medium (t 5 0 paired (Fig. 8A). Therefore, the degradation of FBPase requires min), Vid24p was undetectable in total lysates. However, this the formation of multiubiquitin chains. protein was induced to a similar level after wild type, Dubc1, FBPase Import into Vid Vesicles Is Inhibited by the K48R/ and Dubc6 strains were shifted to glucose for 20 min (Fig. 7A). K63R Ubiquitin Mutant—We investigated whether ubiquitin Therefore, Vid24p production is not altered in the Dubc1 chain formation is necessary for FBPase import in vitro. FB- mutant. Pase was imported when cytosol and semi-intact cells were A Role for UBC1 in Vid Vesicle Biogenesis 10403 FIG.6. The Dubc1 mutant contains defective vesicles, but normal cy- tosol. A, FBPase degradation was fol- lowed in wild type, Dubc1 and Dubc6 cells for 0, 45, 90, 120, and 180 min. B, both Dvid24 (HLY232) and Dubc1 (HLY212) were shifted to glucose for 20 min. Semi- intact cells and cytosol were prepared from the glucose-shifted Dvid24 and Dubc1 strains. Lane 1, FBPase import into Dubc1 semi-intact cells with cytosol from the Dubc1 strain. Lane 2, FBPase import into Dvid24 semi-intact cells with Dvid24 cytosol. Lane 3, FBPase import into Dubc1 semi-intact cells with Dvid24 cytosol. Lane 4, FBPase import into Dvid24 semi-intact cells with Dubc1 cytosol. the distribution of Vid24p might be altered when the K48R/ K63R mutant was overproduced. When Vid24p was induced in cells overexpressing wild type ubiquitin, most of the Vid24p was in the pellet fraction and very little was in the supernatant fraction (Fig. 8C). However, in cells overproducing the K48R/ K63R mutant, the level of Vid24p decreased to one-third of that observed in cells overexpressing wild type ubiquitin (Fig. 8C). It is unknown why the K48R/K63R mutant reduced total amounts of Vid24p. However, this was not due to an overall decrease in protein concentration, because both wild type and K48R/K63R strains had similar protein concentrations in total lysates as well as in individual supernatant (9.92 versus 8.88 mg/ml) and pellet (4.16 versus 4.61 mg/ml) fractions. When Vid24p distribution was quantitated in the K48R/K63R mu- tant, more than 90% of the Vid24p was in the pellet fraction and less than 10% was in the soluble fraction. Thus, the ratio of FIG.7. Vid vesicle function is impaired in the Dubc1 mutant. A, bound versus unbound Vid24p was not altered when the K48R/ wild type (HLY223), Dubc1, and Dubc6 strains were glucose starved (t 5 K63R mutant was overproduced. Given that the association of 0), or glucose starved and then shifted to glucose for 20 min (t 5 20). Vid24p with Vid vesicles was not prevented by the K48R/K63R Total lysates from t 5 0 and t 5 20 were separated by SDS-PAGE and Vid24p was detected by Western blotting with Vid24p antibodies. B, mutant, polyubiquitination is not required for Vid24p binding wild type, Dubc1, and Dubc6 strains were shifted to glucose for 20 min. to the Vid vesicles. Therefore, these data are consistent with Cells were homogenized and subjected to differential centrifugation. the hypothesis that the Dubc1 and K48R/K63R mutations re- Proteins from the high speed supernatant (S) and high speed pellet (P) were solubilized in SDS buffer and resolved by SDS-PAGE. The distri- sult in a decreased production of Vid vesicles. bution of Vid24p in the S and P fractions was detected by anti-Vid24p We next examined whether Vid24p was ubiquitinated by antibodies. The lower panel indicates the % recovery of Vid24p in each transforming wild type and Dvid24 strain with or without the fraction from these strains. Myc-tagged wild type ubiquitin plasmid. These strains were incubated in glucose poor medium containing copper to induce prepared from the wild type strain overexpressing wild type Myc ubiquitin and FBPase. Cells were then shifted to glucose ubiquitin (Fig. 8B, lane 1). By contrast, in vitro FBPase import for 20 min to induce Vid24p. Ub-Pro-b-galactosidase was used was significantly reduced when both cytosol and semi-intact as a positive control since Ub-Pro-b -galactosidase is known to cells were prepared from the strain that overproduced the be polyubiquitinated constitutively (34). Immunoblotting ex- K48R/K63R mutant (lane 2). When cytosol from the K48R/ periments indicate that high levels of Myc ubiquitin were ex- K63R strain was incubated with semi-intact cells from the pressed in cells transformed with the Myc ubiquitin plasmid, strain overexpressing wild type ubiquitin, a high level of FB- but not in cells that did not harbor the Myc ubiquitin plasmid Pase was imported (Fig. 8B, lane 3). By contrast, FBPase (Fig. 9A, lanes 1– 4). As shown by immunoblotting and immu- import decreased when cytosol from the strain overexpressing noprecipitation experiments, Ub-Pro-b-galactosidase was pres- wild type ubiquitin was incubated with semi-intact cells from ent as multiple bands in cells transformed with the Ub-Pro-b- the K48R/K63R strain (lane 4). Therefore, the K48R/K63R galactosidase plasmid (lanes 5, 6, 9, and 10). However, these mutant inhibits the function of Vid vesicles to import FBPase, bands were not observed in control cells that did not contain but does not affect the ability of cytosol to stimulate FBPase the Ub-Pro-b-galactosidase plasmid (lanes 7, 8, 11, and 12). In import into competent Vid vesicles. The K48R/K63R Mutant Does Not Prevent Vid24p Binding cells transformed with both Ub-Pro-b-galactosidase and Myc ubiquitin plasmids, multiple Ub-Pro-b-galactosidase bands to Vid Vesicles—As mentioned above, the decreased level of Vid24p in the Dubc1 high speed pellet may result from a re- were detected by anti-Myc antibodies, suggesting that these duced number of Vid vesicles, or it may be due to a decreased bands were polyubiqutinated forms of Ub-Pro-b-galactosidase binding of this protein to Vid vesicles. Accordingly, if ubiquitin (lane 14). By contrast, no Myc signal could be found in cells that chain formation is necessary for Vid24p binding to Vid vesicles, did not harbor the Myc ubiquitin plasmid (lane 13) or in cells 10404 A Role for UBC1 in Vid Vesicle Biogenesis FIG.8. FBPase import is impaired when ubiquitin chain formation is in- hibited. A, wild type cells were trans- formed with multicopy plasmids contain- ing either the wild type ubiquitin (HLY824) or the K48R/K63R ubiquitin mutant (HLY823) under an inducible cop- per promoter. The transformants were grown in synthetic medium and ubiquitin was induced by 100 mM CuSO using the protocol described by Schork et al. (52). These cells were then shifted to glucose for the indicated times and FBPase deg- radation was examined. B, wild type cells overexpressing either wild type ubiquitin (HLY820) or the K48R/K63R ubiquitin mutant (HLY819) were shifted to glucose for 20 min. Cytosol and semi-intact cells from these strains were combined as in- dicated and in vitro import of FBPase was performed as described under “Experi- mental Procedures.” C, total lysates from wild type cells over-expressing either wild type ubiquitin (HLY824) or the K48R/ K63R ubiquitin mutant (HLY823) were fractionated by differential centrifuga- tion. The distribution of Vid24p in total (T), high speed pellet (P), and high speed supernatant (S) fractions was examined by Western blotting with anti-Vid24p antibodies. that did not contain the Ub-Pro-b-galactosidase plasmid (lanes that did not have the FBP1 gene (lanes 15 and 16). Thus, these 15 and 16). bands were unlikely to represent polyubiquitinated FBPase. To determine whether Vid24p was ubiquitinated, this pro- Similarly, no polyubiquitination of FBPase was detected when tein was immunoprecipitated from total lysates of wild type wild type cells were pulsed-chased and then immunoprecipi- cells and then immunoblotted with anti-Myc antibodies. tated with anti-FBPase antibodies (data not shown). Since Vid24p was expressed in wild type cells, but was absent in the purified FBPase without ubiquitination was imported into Vid Dvid24 strain, as indicated by immunoblotting (Fig. 9B, lanes vesicles in vitro, polyubiquitination of FBPase is unlikely to be 5– 8) and immunoprecipitation experiments (lanes 9 –12). When required for the import process. the precipitated Vid24p was immunoblotted with anti-Myc an- DISCUSSION tibodies, there was no detectable Myc signal (lane 14). Like- wise, no ubiquitination of Vid24p could be found in cells that In this study, we analyzed FBPase import into Vid vesicles to did not contain the Myc ubiquitin plasmid (lane 13), or in the identify molecules involved in early stages of the FBPase deg- Dvid24 strain (lanes 15 and 16). Furthermore, no ubiquitina- radation pathway. Our results suggest that vacuole proteoly- tion of Vid24p could be detected using pulse-chase experiments sis, vacuole acidification, and proteasome degradation are un- followed by immunoprecipitation with anti-Vid24p antibodies likely to be involved in FBPase import. The Dise1Dpep4 or (data not shown). Therefore, Vid24p is unlikely to be ubiquiti- Dvid24Dpep4 double mutants did not alter FBPase import as nated. This supports our contention that ubiquitination is not compared with the Dise1 or Dvid24 single mutants, suggesting required for the function of Vid24p. that FBPase import is independent of the PEP4 gene. Further- Although the site of FBPase degradation has been a matter more, the vma3 deletion mutant and compounds such as bafilo- of debate (52, 53), a PEP4-dependent degradation of FBPase mycin A or concanamycin A that block acidification of the was confirmed by an independent research group (54). To ex- vacuole did not inhibit FBPase import. Therefore, FBPase im- amine whether FBPase was polyubiquitinated, wild type and port is independent of the two major vacuole functions, vacuole Dfbp1 strains were transformed with or without the Myc- proteolysis and vacuole acidification. This further supports our tagged ubiquitin plasmid using the protocol described by the model that FBPase import into Vid vesicles occurs prior to the Wolf group (52, 53). FBPase was reported to be polyubiquiti- trafficking to the vacuole. nated under these conditions (52, 53). As shown by both immu- Our results indicate that the cytosolic ubiquitin-conjugating noblotting (Fig. 9C, lanes 5– 8) and immunoprecipitation (lanes enzyme Ubc1p is an important regulator of the FBPase import 9 –12) experiments, FBPase was detected in wild type cells, but process. FBPase import into Vid vesicles is defective in the not in the Dfbp1 strain. When the precipitated FBPase was Dubc1 mutant, but not in the Dubc6 or Dubc7 mutants, sug- immunoblotted with anti-Myc antibodies, some faint bands gesting a specific role for UBC1 in the import process. However, migrating below the IgG band were detected in wild type cells this requirement is not linked to proteasome degradation. The transformed with the Myc ubiquitin plasmid (lane 14). How- pre1-1pre2-1 proteasome mutant showed normal FBPase im- ever, these bands were also seen in cells that did not harbor the port and proteasome inhibitors such as MG132 and b-lactone Myc ubiquitin plasmid (lane 13) as well as in the Dfbp1 strain had no effect on FBPase degradation. A Role for UBC1 in Vid Vesicle Biogenesis 10405 FIG.9. Vid24p is not ubiquitinated. A, wild type cells were transformed with or without a multicopy Ub-Pro-b-galactosidase plasmid. These cells were then transformed with or without a multicopy Myc ubiquitin plasmid. Cells were grown in synthetic medium and then shifted to synthetic medium containing 2% ethanol and 100 mM CuSO for5hto induce FBPase and ubiquitin. Cells were transferred to synthetic medium containing fresh 2% glucose for 20 min. Total lysates from these cells were aliquoted into two parts. One-half of the lysates were immunoblotted with anti-Myc antibodies (lanes 1– 4), or anti-b-galactosidase antibodies (lanes 5– 8). Another half of the total lysates were immunoprecipitated first with anti-b-galactosidase antibodies and then immunoblotted with either anti-b-galactosidase antibodies (lanes 9 –12) or with anti-Myc antibodies (lanes 13–16). B, wild type or Dvid24 strains were transformed with or without a multicopy Myc ubiquitin plasmid under a copper inducible promoter. Total lysates were aliquoted into two portions. Half of the lysates were subjected to immunoblotting with anti-Myc antibodies (lanes 1– 4) or anti-Vid24p antibodies (lanes 5– 8). The other half of the total lysates were subjected to immunoprecipitation with anti-Vid24p antibodies and then immunoblotted with either Vid24p antibodies (lanes 9 –12) or anti-Myc antibodies (lanes 13–16). C, wild type and Dfbp1 strains were transformed with or without a multicopy Myc ubiquitin plasmid. Half of the total lysates were immunoblotted with anti-Myc antibodies (lanes 1– 4) or FBPase antibodies (lanes 5– 8). Another half of the lysates were immunoprecipitated with FBPase antibodies and then immunoblotted with anti-FBPase antibodies (lanes 9 –12) or anti-Myc antibodies (lanes 13–16). Our data show that UBC1 is required for the proper function of Vid vesicles. The Dubc1 mutant contained defective vesicles, but normal cytosol. In the absence of the UBC1 gene, cells may decrease the production of Vid vesicles or reduce the efficiency of the import machinery. In the control wild type and Dubc6 strains, most of the Vid vesicle marker Vid24p was found in fractions containing Vid vesicles. When quantitated, ;90% of the Vid24p was recovered in the Vid vesicle containing pellet fraction in wild type cells. However, in the Dubc1 strain, about 25% of the Vid24p was in the pellet fraction, while most of the FIG. 10. The FBPase degradation pathway. When glucose- starved cells are shifted to medium containing fresh glucose, FBPase is Vid24p was in the soluble fraction. The reduced levels of imported into Vid vesicles and then to the vacuole for degradation. The Vid24p in the pellet fraction could result from decreased Vid cytosolic heat shock protein Ssa2p is required for FBPase import into vesicle production or a decreased binding of Vid24p to Vid Vid vesicles. After FBPase is sequestered inside the vesicles, Vid vesi- vesicles. However, the K48R/K63R mutant did not prevent cles then carry FBPase to the vacuole in a process that is dependent Vid24p binding to Vid vesicles, even though it inhibited vesicle upon Vid24p. Although the origin of Vid vesicles is not known, the formation of Vid vesicles is regulated by the cytosolic ubiquitin conju- import. Therefore, polyubiquitination is necessary for FBPase gating enzyme Ubc1p through unidentified factors that are likely to be import into Vid vesicles, but does not play an important role in polyubiquinated. Vid24p binding to Vid vesicles. Based upon results from this study and from previous stud- ies (23, 37), we have proposed a model for the FBPase degra- presence of the heat shock protein Ssa2p. Following FBPase dation pathway (Fig. 10). In the initial step, FBPase is im- sequestration inside these structures, the loaded vesicles then ported into Vid vesicles through a process that requires the traffic to the vacuole via a process controlled by Vid24p. At 10406 A Role for UBC1 in Vid Vesicle Biogenesis Mol. Biol. Cell 10, 1337–1351 present, the site of origin for Vid vesicles is unknown, although 17. Yuan, W., Stromhaug, D. E., and Dunn, W. A., Jr. (1999) Mol. Biol. Cell 10, the formation of these organelles appears to be regulated by the 1353–1366 cytosolic ubiquitin-conjugating enzyme Ubc1p. In the absence 18. Gancedo, C. (1971) J. Bacteriol. 107, 401– 405 19. Chiang, H.-L., and Schekman, R. (1991) Nature 350, 313–318 of this enzyme, levels of Vid vesicles are reduced and FBPase 20. Chiang, H.-L., Schekman, R., and Hamamoto, S. (1996) J. Biol. Chem. 271, degradation is compromised. Therefore, we propose that ubiq- 9934 –9941 uitination plays an important role in the degradation of FB- 21. Shieh, H.-L., and Chiang, H.-L. (1998) J. Biol. Chem. 273, 3381–3387 22. Huang, P.-H., and Chiang, H.-L. (1997) J. Cell Biol. 136, 803– 810 Pase through its effect on the machinery (Vid vesicles) that 23. Brown, C. R., McCann, J. A., and Chiang, H-L. (2000) J. Cell Biol. 150, 65–76 transports FBPase to the vacuole. Identification of the factors 24. Wiebel, F. F., and Kunau, W. H. (1992) Nature 359, 73–76 25. Fisk, H. A., and Yaffe, M. P. (1999) J. Cell Biol. 145, 1199 –1208 that are polyubiquitinated by Ubc1p may ultimately help iden- 26. Zoladek, T., Tobiasz, G., Vaduva, M., Boguta, N., Martin, C., and Hopper, A. K. tify their sites of action as well as to elucidate how FBPase is (1997) Genetics 145, 595– 603 imported into Vid vesicles. 27. Galan, J. M., Moreau, V., Andre, B., Volland, C., and Haguenauer-Tsapis, R. (1996) J. Biol. Chem. 271, 10946 –10952 Acknowledgments—We thank Drs. Graham Hung and Ly Brown for 28. Roth, A. F., and Davis, N. G. (1996) J. Cell Biol. 134, 661– 674 critically reading this manuscript. We also thank Dr. Stefan Jentsch 29. Hicke, L., and Riezman, H. (1996) Cell 84, 277–287 30. Kolling, R., and Hollenberg, C. P. (1994) EMBO J. 13, 3261–3271 (University of Heidelberg, Germany) for the Dubc1, Dubc6, and Dubc7 31. Hicke, L. (1997) FASEB J. 11, 1215–1226 strains and Dr. Alfred Goldberg (Harvard Medical School) for the pre1- 32. Ammerer, G., Hunter, C. P., Rothman, J. H., Saari, G. C., Valls, L. A., and 1pre2-1, ise1 strains, and proteasome inhibitors. We also thank Dr. Dan Stevens, T. H. (1986) Mol. Cell. Biol. 6, 2490 –2499 Finley (Harvard Medical School) for the wild type ubiquitin plasmid, 33. Ellison, M. J., and Hochstrasser, M. (1991) J. Biol. Chem. 266, 21150 –21157 the K48R/K63R ubiquitin plasmid and the Ub-Pro-b-galactosidase 34. Bachmair, A., Finley, D., and Varshavsky, A.(1986) Science 234, 179 –186 plasmid. 35. Graham, T. R., Scott, P. A., and Emr, S. D. (1993) EMBO J. 12, 869 – 877 36. Lee, D. H., and Goldberg, A. L. (1996) J. Biol. Chem. 271, 27280 –27284 REFERENCES 37. Chiang, M.-C., and Chiang, H.-L. (1998) J. Cell Biol. 140, 1347–1356 1. Klionsky, D. J., Banta, L. M., and Emr, S. D. (1990) Microbiol. Rev. 54, 38. Hoffman, M., and Chiang, H-L. (1996) Genetics 143, 1555–1566 266 –292 39. Kane, P. M., Kuehn, M. C., Howald-Stevenson, I., and Stevens, T. H. (1992) 2. Raymond, C. K., Howald-Stevenson, I., Vater, C. A., and Stevens, T. H. (1992) J. Biol. Chem. 267, 447– 454 Int. Rev. Cyt. 139, 59 –120 40. Nakamura, N., Matsuura, A., Wada, Y., and Ohsumi, Y. (1997) J. Biochem. 3. Jones, E. W. (1991) J. Biol. Chem. 266, 7963–7966 (Tokyo) 121, 338 –344 4. Conibear, E., and Stevens, T. (1998) Biochim. Biophys. Acta 1404, 211–230 41. Hochstrasser, M. (1996) Annu. Rev. Genet. 30, 405– 439 5. Klionsky, D. J., and Ohsumi, Y. (1999) Annu. Rev. Cell Dev. Biol. 15, 1–32 42. Jentsch, S. (1992) Annu. Rev. Genet. 26, 179 –207 6. Scott, S. V., and Klinosky, D. J. (1998) Curr. Opin. Cell Biol. 10, 523–529 43. Seufert, W., McGrath, J. P., and Jentsch, S. (1990) EMBO J. 9, 4535– 4541 7. Klionsky, D. J. (1998) J. Biol. Chem. 273, 10807–10810 44. Seufert, W., and Jentsch, S. (1990) EMBO J. 9, 543–550 8. Scott, V. S., and Klionsky, D. J. (1997) Trends Cell Biol. 7, 225–227 45. Hiller, M. M., Finger, A., Schweiger, M., and Wolf, D. H. (1996) Science 273, 9. Harding, T., Morano, K. A., Scott, S. A., and Klionsky, D. J. (1995) J. Cell Biol. 1725–1728 131, 591– 602 46. Biederer, T., Volkwein, C., and Sommer, T. (1996) EMBO J. 15, 2069 –2076 10. Yoshihisa, T., and Anraku, Y. (1990) J. Biol. Chem. 265, 22418 –22425 47. Hilt, W., and Wolf, D. H. (1996) Trends Biochem. Sci. 21, 96 –102 11. Baba, M., Osumi, M., Scott, S. V., Klionsky, D. J., and Ohsumi, Y. (1997) J. Cell 48. Heinemeyer, W., Gruhler, A., Mohrle, V., Mahe, Y., and Wolf, D. (1993) J. Biol. Biol. 139, 1687–1695 Chem. 268, 5115–5120 12. Jungmann, J., Reins, H. A., Schobert, C., and Jentsch, S. (1993) Nature 361, 49. Haas, A., and Wickner, W. (1996) EMBO J. 15, 3296 –3305 369 –371 50. Drose, S., and Altendorf, K. (1997) J. Exp. Biol. 200, 1– 8 13. Liang, X. H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., 51. Parra, K. J., and Kane, P. M. (1998) Mol. Cell. Biol. 18, 7064 –7074 and Levine, B. (1999) Nature 402, 672– 676 52. Schork, S. M., Thumm, M., and Wolf, D. H. (1995) J. Biol. Chem. 270, 14. Mizushima, N., Noda, T., Yoshimori, T., Tanaka, Y., Ishii, T., George, M. D., 26446 –26450 Klionsky, D. J., Ohsumi, M., and Ohsumi, Y. (1998) Nature 395, 395–398 53. Schule, T., Rose, M., Entian, K. D., Thumm, M., and Wolf, D. H. (2000) EMBO 15. Hutchins, M. U., Veenhuis, M., and Klionsky, D. J. (1999) J. Cell Sci. 112, 4079 – 4087 J. 15, 2161–2167. 54. Jiang, Y., Davis, C., Broach, J. R.(1998) EMBO J. 17, 6942– 6951 16. Kim, J., Dalton, V. M., Eggerton, K. P., Scott, S. V., and Klionsky, D. J. (1999) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Biochemical Analysis of Fructose-1,6-bisphosphatase Import into Vacuole Import and Degradation Vesicles Reveals a Role for UBC1 in Vesicle Biogenesis

Shieh, Hui-Ling; Chen, Yong; Randell Brown, C.; Chiang, Hui-Ling
Journal of Biological Chemistry – Mar 1, 2001
Download PDF
9 pages

Loading next page...
 
/lp/unpaywall/biochemical-analysis-of-fructose-1-6-bisphosphatase-import-into-0BerMI1Llz

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m001767200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 13, Issue of March 30, pp. 10398 –10406, 2001 © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Biochemical Analysis of Fructose-1,6-bisphosphatase Import into Vacuole Import and Degradation Vesicles Reveals a Role for UBC1 in Vesicle Biogenesis* Received for publication, February 28, 2000, and in revised form, December 28, 2000 Published, JBC Papers in Press, December 29, 2000, DOI 10.1074/jbc.M001767200 Hui-Ling Shieh, Yong Chen, C. Randell Brown, and Hui-Ling Chiang‡ From the Department of Cellular and Molecular Physiology, Pennsylvania State College of Medicine, Hershey, Pennsylvania 17033 When Saccharomyces cerevisiae are shifted from me- ways (5–11). Regulation of the autophagic process can have dium containing poor carbon sources to medium con- important consequences on cellular physiology. For example, taining fresh glucose, the key gluconeogenic enzyme the tumor suppresser gene beclin-1 is homologous to APG6/ fructose-1,6-bisphosphatase (FBPase) is imported into VPS30 and induces autophagy in yeast and mammalian cells. Vid (vacuole import and degradation) vesicles and then Therefore, a decrease in autophagic protein degradation may to the vacuole for degradation. Here, we show that FB- contribute to the development or progression of human Pase import is independent of vacuole functions and malignancy (13). proteasome degradation. However, FBPase import re- A nonselective macroautophagy pathway is induced when S. quired the ubiquitin-conjugating enzyme Ubc1p. A cerevisiae are starved of nitrogen (5–11). This pathway requires strain containing a deletion of the UBC1 gene exhibited a novel ubiquitin-like conjugating system (14). Furthermore, defective FBPase import. Furthermore, FBPase import this pathway also overlaps with the cytoplasm to vacuole tar- was inhibited when cells overexpressed the K48R/K63R geting pathway for targeting aminopeptidase I from the cyto- ubiquitin mutant that fails to form multiubiquitin plasm (5–11). Aminopeptidase I trafficking to the vacuole oc- chains. The defects in FBPase import seen for the Dubc1 curs by two routes (11). Under normal growth conditions, and the K48R/K63R mutants were attributed to the Vid aminopeptidase I is targeted to the vacuole by cytoplasm to vesicle fraction. In the Dubc1 mutant, the level of the Vid vacuole targeting vesicles. When cells are starved of nitrogen, vesicle-specific marker Vid24p was reduced in the vesi- however, aminopeptidase I is delivered to the vacuole by the cle fraction, suggesting that UBC1 is required for either macroautophagy pathway (11). Recent evidence suggests that Vid vesicle production or Vid24p binding to Vid vesicles. However, the K48R/K63R mutant did not prevent Vid24p the cytoplasm to vacuole targeting pathway also shares com- binding to Vid vesicles, indicating that ubiquitin chain ponents with the peroxisome microautophagy pathway formation is dispensable for Vid24p binding to these (15–17). structures. Our results support the findings that ubiq- Fructose-1,6-bisphosphatase (FBPase), the key regulatory uitin conjugation and ubiquitin chain formation play enzyme in gluconeogenesis in S. cerevisiae, is induced when important roles in a number of cellular processes in- yeast cells are grown in medium containing poor carbon cluding organelle biogenesis. sources (18). When fresh glucose is added to the medium, however, FBPase is targeted to the vacuole and degraded (19, 20). This redistribution of FBPase to the vacuole has been The vacuole of the yeast Saccharomyces cerevisiae is homol- observed by immunofluorescence microscopy, cell fraction- ogous to the lysosome of higher eucaryotes and as such, plays ation, and electron microscopy (19, 20). More recently, FBPase an important role in protein degradation (1– 4). The function of targeting to the vacuole has been reconstituted in vitro using the vacuole requires the targeting of a number of vacuole permeabilized yeast cells incubated with purified radiolabeled resident proteins into this organelle. These proteins are sorted FBPase in the presence of ATP, an ATP regenerating system to this organelle by several mechanisms and require the assist- and cytosolic proteins (21). ance of numerous genes. For example, targeting of the vacuole FBPase is imported into a novel type of Vid (vacuole import lumenal protein carboxypeptidase Y (CPY) from the late Golgi and degradation) vesicle prior to its uptake by the vacuole (22). requires more than 40 VPS genes (1– 4). These vesicles have been purified to near homogeneity from Proteins and organelles can be delivered to the vacuole from wild-type cells (22). The identification of Vid vesicles in the the cytoplasm by the microautophagy or macroautophagy path- FBPase degradation pathway suggests that this pathway can be divided into at least two steps. The first step is the targeting * This work was supported by National Institutes of Health Grant and sequestration of FBPase into Vid vesicles. The second step RO1GM59480 (to H-L. C.). The costs of publication of this article were is the delivery of FBPase from Vid vesicles to the vacuole for defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 degradation. U.S.C. Section 1734 solely to indicate this fact. Since Vid vesicles do not contain markers from known or- ‡ To whom correspondence should be addressed: Dept. of Cellular and ganelles, they may represent a novel transport structure, al- Molecular Physiology, Penn State College of Medicine, 500 University though it is possible that Vid vesicles are derived from existing Dr., Hershey, PA 17033. Tel.: 717-531-0860; Fax: 717-531-0859; E-mail: [email protected]. structures. Thus far, the heat shock protein Ssa2p is the only The abbreviations used are: CPY, carboxypeptidase Y; FBPase, molecule that has been shown to play a role in the import of fructose-1,6-bisphosphatase; VPS, vacuole protein sorting; VID, vacuole FBPase into Vid vesicles (23). To identify more molecules in- import and degradation; PAGE, polyacrylamide gel electrophoresis; volved in this process, we analyzed the import of FBPase into MG132, carbobenzoxyl-leucinyl-leucinyl-leucinal; ATPgS, adenosine 59-O-(thiotriphosphate). Vid vesicles using various inhibitors and mutants. We found 10398 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. A Role for UBC1 in Vid Vesicle Biogenesis 10399 TABLE I Yeast strains used in this study Strain Genotype Sources HLY001 Mata his3-D200 ura3–52 leu2,3–112 isel::URA3 HLY208 Mata ura3–52 leu2,3–112 trp1 lys2–801 ise1::URA3 fbp1::LEU2 HLY227 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 vid24::TRP1 HLY232 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 vid24::TRP1 fbp1::LEU2 HLY247 Mata his3-D200 ura3–52 leu2,3–112 trp1 ise1::URA3 pep4::TRP1 fbp1::LEU2 HLY233 Mata his3-D200 ura3–52 leu2,3–112 trp1 vid24::TRP1 pep4::URA3 fbp1::LEU2 HLY193 Mata leu2–3,112 his3 trp1–1 ura3–52 fbp1::LEU2 HLY195 Mata his3-D200 ura3–52 leu2,3–112 trp1 pep4::TRP1 HLY223 Mata leu2–3,112 his3 trp1–1 ura3–52 lys2–801 vma3-D1 Mata ade6 ura3–52 leu2,3–112 pep4–3 gal2 vma3-D1::URA3 Ref. 39 HLY217 Mata a de6 ura3–52 leu2,3–112 pep4–3 gal2 vma3-D1::URA3 fbp1::LEU2 Dubc1 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc1::HIS3 Ref. 43 Dubc6 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc6::HIS3 Ref. 12 Dubc7 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc7::HIS3 Ref. 12 pre1–1pre2–1 Mata his3–11,15 ura3–52 leu2,3–112 pre1–1 pre2–1 HLY212 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc1::HIS3 fbp1::LEU2 HLY213 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc6::HIS3 fbp1::LEU2 HLY214 Mata his3-D200 ura3–52 leu2,3–112 trp1 lys2–801 ubc7::HIS3 fbp1::LEU2 HLY215 Mata his3–11,15 ura3–52 leu2,3–112 pre1–1 pre2–1 fbp1::LEU2 ise1 Mata his7–2 ura3–52 leu2,3–112 ise1 Ref. 36 HLY823 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUB223 (myc-K48R/K63R Ub) HLY824 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUB141 (myc-Ub) HLY819 Mata leu2–3, 112 his3 trp1–1 ura3–52 fbp::LEU2 pUB223 (myc-K48R/K63R Ub) HLY820 Mata leu2–3, 112 his3 trp1–1 ura3–52 fbp::LEU2 pUB141 (myc-Ub) HLY806 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 vid24::TRP1 pUB141 (myc-Ub) HLY807 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 vid24::TRP1 pUB223 (myc-K48R/K63R Ub) HLY821 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUb-Pro-b-galactosidase HLY827 Mata leu2–3, 112 his3 trp1–1 ura3–52 lys2–801 pUb-Pro-b-galactosidase pUB141 (myc-Ub) vided by Dr. T. Stevens (University of Oregon). This plasmid was that FBPase import was not affected by inhibitors or mutants digested with EcoRI and XhoI to disrupt the PEP4 locus (32). The defect that block vacuole acidification, vacuole proteolysis, or protea- in the pep4 null strains was confirmed by the accumulation of the p2 some degradation. However, FBPase import did require ubiq- form of CPY intracellularly. A strain with a null mutation of the VID1 uitin chain formation and the ubiquitin conjugation enzyme gene was also utilized. The VID1 gene is identical to the ISE1 or ERG6 Ubc1p. The Dubc1 mutant contained defective vesicles, but gene. The gene was amplified by polymerase chain reaction and cloned competent cytosol. Furthermore, FBPase import was inhibited into a TA cloning vector (Invitrogen) using a 59 primer AGCGGC- CGCGGGATGGGGAGTGAAACAGAATTGAGAAAA and a 39 primer when cells overexpressed a ubiquitin mutant (K48R/K63R) TGAGGCGGCCGCCTTGAGTTGCTTCTTGGGAAGTTTGGG. A dele- that prevents the formation of multiubiquitin chains. The de- tion construct was produced by removing 80% of the gene via KpnI and fect of the K48R/K63R mutant was associated with Vid vesi- PflMI digestion, and religating with a URA3 containing fragment pro- cles, indicating that ubiquitin chain formation is required to duced by digesting the YIP352 plasmid with SmaI and HpaI. The produce competent Vid vesicles. resultant construct was linearized with NotI and transformed into a In the absence of the UBC1 gene, the level of the Vid vesicle- wild type strain. The deletion was confirmed by polymerase chain reaction analysis. The pUB141 plasmid containing the wild type Myc- specific marker Vid24p was reduced in the Vid vesicle pellet tagged ubiquitin, the pUB223 plasmid containing the Myc-tagged fraction, suggesting that UBC1 is required for Vid vesicle pro- K48R/K63R ubiquitin mutant and the Ub-Pro-bgal plasmid (33, 34) duction. Alternatively, Vid24p binding to Vid vesicles may be were obtained from Dr. D. Finley (Harvard Medical School). compromised in the absence of ubiquitination. However, over- YPD is a complete medium (10 g/liter of Bacto-yeast extract, 20 production of the K48R/K63R mutant did not prevent Vid24p g/liter of Bacto-peptone, Difco Labs Inc.) supplemented with 20 g/liter binding to Vid vesicles. Since ubiquitin chain formation is dextrose (Fisher Scientific). YPKG contained 10 g/liter Bacto-yeast extract, 20 g/liter Bacto-peptone, 10 g/liter potassium acetate, and 5 necessary for Vid vesicle function, but is dispensable for Vid24p g/liter dextrose. Synthetic minimal medium consisted of 6.7 g/liter yeast binding to Vid vesicles, these results are consistent with the nitrogen base without amino acids, supplemented with 5 g/liter hypothesis that Vid vesicle formation is regulated by ubiquitin casamino acids, 40 mg/liter adenine, 60 mg/liter leucine, and 20 g/liter conjugation and ubiquitin chain formation. Thus, our work dextrose. Inhibitors used in this study included ATPgS, N-ethylmale- complements previous studies in which ubiquitin conjugation imide, brefeldin A, bafilomycin A, and concanamycin A and were pur- is important for peroxisome biogenesis (24), mitochondrial in- chased from Sigma. MG132 (carbobenzoxyl-leucinyl-leucinyl-leucinal) and b-lactone were gifts from Dr. A. Goldberg (Harvard Medical heritance (25), mitochondrial targeting (26), and receptor-me- School). Tran S-label (10 mCi/mmol) was obtained from ICN. Rabbit diated endocytosis (27–31). anti-FBPase and rabbit anti-CPY polyclonal antibodies were raised by Berkeley Antibody Co. (Berkeley, CA) using purified FBPase and CPY EXPERIMENTAL PROCEDURES (Sigma). Mouse and rabbit anti-Myc antibodies were purchased from Yeast Strains, Chemicals, and Antibodies—S. cerevisiae strains used Berkeley Antibody Co. Mouse anti-b-galactosidase antibodies were pur- in this study are listed in Table I. For the in vitro experiments, the chased from Promega. endogenous FBP1 gene was deleted and a known quantity of purified The FBPase Import Assay—The FBPase import assay was performed FBPase was added to the reaction. To produce the fbp1 null strain, the according to Shieh and Chiang (21). In a typical experiment, the reac- FBP1 gene was cloned into pBR322 to yield the plasmid pJS31. The tion mixture (100 ml) contained 3 A units of semi-intact cells, 11 mg 600 nm fbp1 deletion construct was generated by removing 90% of the FBP1 of S-FBPase, an ATP regenerating system (0.5 mM ATP, 0.2 mg/ml gene from pJS31 with StuI and religating with a LEU2 containing creatine phosphokinase, 40 mM creatine phosphate), and 0.5 mg/ml fragment which was produced by digestion of the YEP13 plasmid with cytosolic proteins. The mixture was incubated at 30 °C for the indicated BglII. The deletion construct was then digested with BamHI and Hin- times, after which 0.8 mg/ml proteinase K was added to identify the dIII and transformed into yeast strains using the standard lithium acetate method. The deletion of FBP1 was confirmed by Western blot- ting with anti-FBPase antibodies. H-L. Shieh, Y. Chen, C. R. Brown, and H-L. Chiang, unpublished A pep4 null mutation was produced using the pTS15 plasmid pro- results. 10400 A Role for UBC1 in Vid Vesicle Biogenesis FIG.2. The Dise1 mutant contains defective vesicles. The Dise1 (HLY208) and Dvid24 (HLY 232) mutants were shifted to glucose for 20 min. Semi-intact (SI) cells and cytosol were prepared from the Dise1 and Dvid24 mutants and combined as indicated. Lane 1, FBPase import using Dise1 cytosol and Dise1 semi-intact cells. Lane 2, FBPase import into Dvid24 semi-intact cells with Dvid24 cytosol. Lane 3, FBPase import into Dise1 semi-intact cells with cytosol from Dvid24. Lane 4, FBPase import into Dvid24 semi-intact cells with cytosol from the Dise1 mutant. FIG.1. The kinetics of FBPase import into the Dise1 and conversion to semi-intact cells. Purified FBPase was incubated Dvid24 semi-intact cells. A, wild type (HLY223), Dise1 (HLY001), and with semi-intact cells in the absence or presence of ATP, an Dvid24 (HLY227) were grown in YPKG to induce FBPase. Cells were shifted to glucose for 0, 60, and 120 min. Total lysates from these cells ATP regenerating system and cytosol. At selected times, pro- were solubilized in SDS buffer, separated by SDS-PAGE and FBPase teinase K was added to digest the FBPase that was not pro- degradation was followed in these cells. B, both Dise1 (HLY208) and tected in a membrane-sealed compartment. In the absence of Dvid24 (HLY232) mutants were shifted to glucose for 20 min. Semi- both ATP and cytosol, FBPase import into the Dvid24 semi- intact cells and cytosol were prepared as described (21). FBPase import was measured for 0, 10, 20, and 30 min in the absence or presence of intact cells was minimal (Fig. 1B). In the presence of ATP and ATP and cytosol. The % FBPase import is indicated. cytosol, however, FBPase import increased in a time-dependent manner. When quantitated, ;25–35% of the total added FB- fraction of FBPase that was sequestered in a proteinase K-resistant Pase was proteinase K protected after 30 min of import. In compartment. Samples were processed and resuspended in 200 mlof contrast, the Dise1 mutant had background levels of FBPase SDS-loading buffer. The proteins (15 ml) were then resolved by SDS- PAGE and analyzed by a Fuji FUJIX BAS 1000 Bioimaging Analyzer import either in the presence or in the absence of ATP and (Fuji Medical Systems). cytosol (Fig. 1B). Miscellaneous Assays—Isolation of Vid vesicles by differential cen- The Dise1 Mutant Contains Defective Vesicles—The defect of trifugation was performed as described (23). Briefly, total lysates were FBPase import seen for the Dise1 mutant could result from an subjected to differential centrifugation at 13,000 3 g for 20 min and the inability of cytosol to stimulate FBPase import or an inability of supernatant was further centrifuged at 200,000 3 g for 2 h. The distri- Vid vesicles to take up FBPase. To determine the site of this bution of Vid24p in the high speed pellet (200,000 3 g pellet) and the high speed supernatant (200,000 3 g supernatant) was determined by defect, we performed an in vitro assay using various combina- Western blotting with anti-Vid24p antibodies. The biosynthesis of CPY tions of semi-intact cells and cytosol from the Dise1 and Dvid24 was studied using the protocol described by Graham et al. (35). The mutants. When the Dise1 semi-intact cells were used, FBPase exponentially grown Dise1, Dise1Dpep4, Dvid24, and Dvid24Dpep4 import was defective regardless of whether the cytosol was strains were labeled with Tran S-label for 10 min at 30 °C and then isolated from the Dise1 (Fig. 2, lane 1)orthe Dvid24 mutants chased for 40 min at 30 °C. To examine the effect of brefeldin A on CPY (lane 3). By contrast, FBPase import into the Dvid24 semi- processing, an ise1 strain was preincubated in the presence or absence of brefeldin A (75 mg/ml) at 22 °C for 10 min. Cells were pulsed for 10 intact cells was observed when cytosol was prepared from ei- min, chased for 40 min, and then harvested. Total lysates were immu- ther the Dvid24 mutant (lane 2)orthe Dise1 mutant (lane 4). noprecipitated with CPY antiserum, subjected to SDS-PAGE using This experiment suggests that the Dise1 mutant strain has 7.5% polyacrylamide gels, and analyzed with a Fuji Bioimaging Ana- competent cytosol that can stimulate FBPase import into com- lyzer. The degradation of short-lived and long-lived proteins was exam- petent Vid vesicles. However, the Dise1 mutant contains defec- ined using the protocols described by Lee and Goldberg (36). tive vesicles that cannot support FBPase import, even when RESULTS combined with import-competent cytosol. FBPase Import in Vitro—To biochemically analyze FBPase FBPase Import Is Independent of Vacuole Proteolysis and import into Vid vesicles, we used an in vitro system that repro- Vacuole Acidification—Next, we utilized our in vitro assay to duces the defects seen for mutants affecting the FBPase deg- investigate whether FBPase import into Vid vesicles was de- radation pathway. For example, both the Dvid1 (Dise1) and pendent on other cellular processes such as vacuole proteolysis Dvid24 mutants inhibit the degradation of FBPase in vivo (Fig. or vacuole acidification. The PEP4 gene is required for the 1A). However, these mutations affect different steps in the maturation of several major vacuolar proteinases including FBPase degradation pathway. The Dvid24 mutant strain im- CPY. Hence, the deletion of the PEP4 gene renders cells defec- ports FBPase into Vid vesicles normally, but this mutation tive in vacuolar proteolysis (1, 3). In wild type cells, CPY is blocks the trafficking of Vid vesicles to the vacuole. As such, synthesized as prepro-CPY and then translocated into the en- this mutation results in the accumulation of FBPase in Vid doplasmic reticulum where it is glycosylated to p1-CPY in the vesicles (37). On the other hand, a mutation of the VID1 gene endoplasmic reticulum (1– 4). CPY is further modified in the (a gene that is identical to the ISE1 or ERG6 gene) blocks Golgi to p2-CPY and finally processed to the mature form in the FBPase import into Vid vesicles (38) and serves as a negative vacuole (1– 4). Therefore, the deletion of the PEP4 gene re- control for in vitro import. sulted in the accumulation of p2-CPY in the Dise1Dpep4 and To examine FBPase import in the Dise1 and Dvid24 strains, Dvid24Dpep4 strains (Fig. 3A). When FBPase import was the endogenous FBP1 gene was deleted so that a known quan- measured, the level was low in the Dise1 single mutant (Fig. tity of radiolabeled, purified FBPase could be added and fol- 3B, lane 1) and there was no significant increase in the FBPase lowed in the in vitro system. Each strain was glucose starved import in the Dise1Dpep4 double mutant (lane 2). Likewise, and then shifted to glucose containing medium prior to their there was no significant change in FBPase import in the A Role for UBC1 in Vid Vesicle Biogenesis 10401 FIG.4. FBPase import into Vid vesicles is defective in the Dubc1 mutant. A, the degradation of short-lived proteins was exam- ined in wild type (WT), pre1-1pre2-1, Dubc1, Dubc6, and Dubc7 cells. The pre1-1pre2-1 was pulsed at 22 °C and chased at 37 °C, while Dubc1, Dubc6, and Dubc7 were pulsed and chased at 30 °C. B, the strains Dubc1 (HLY212), Dubc6 (HLY213), and Dubc7 (HLY214) were shifted to glu- cose for 20 min. The pre1-1pre2-1 (HLY 215) was shifted to glucose at FIG.3. FBPase import into Vid vesicles is not affected by PEP4 37 °C. FBPase import into Vid vesicles was conducted as described or VMA3 mutants. A, the biosynthesis of CPY was examined by under “Experimental Procedures.” pulse-chase experiments in the Dise1, Dise1Dpep4, Dvid24, and Dvid24Dpep4 strains. B, the strains Dise1 (HLY208), Dise1Dpep4 (HLY247), Dvid24 (HLY232), Dvid24Dpep4 (HLY233), and Dvma3 (HLY217) were shifted to glucose for 20 min. The cytosol and semi- (lanes 2 and 3), suggesting a specific role for UBC1 in the intact cells were prepared and FBPase import was measured in the import process. presence of ATP and cytosol. The percentage of FBPase import in each One of the major functions of ubiquitin conjugation is to strain is indicated. target proteins for degradation by the proteasome (41, 42). However, ubiquitin conjugation can also have other important Dvid24Dpep4 double mutant (lane 4) as compared with the functions unrelated to protein degradation (24 –31, 41, 42). We Dvid24 single mutant (lane 3). Since uptake of FBPase by Vid investigated whether the proteasome plays a role in FBPase vesicles is independent of the PEP4 gene, this supports our import using the pre1-1pre2-1 proteasome mutant. PRE1 and model that FBPase import into Vid vesicles occurs prior to PRE2 encode subunits of the 20 S core particle of the protea- trafficking to the vacuole. some and an interaction between Pre1p and Pre2p is necessary As is shown in Fig. 1, the addition of ATP and cytosol stim- for formation of the chymotrypsin-like active site in the protea- ulates FBPase import into Vid vesicles. This suggests that some (47, 48). A decrease in the degradation rate of short-lived ATPases and/or ATP hydrolysis (see below) may play some role proteins was observed for the pre1-1pre2-1 mutant strain (Fig. in FBPase import. The VMA3 gene, which encodes the 16-kDa 4A). However, the import of FBPase in the pre1-1pre2-1 mutant proteolipid subunit of the membrane sector of the V-ATPase (1, was not altered (Fig. 4B, lane 4). Thus, the proteasome is 39), has previously been shown to play a role in autophagy (40). unlikely to be involved in the import process. However, when FBPase import was measured in the vma3 Inhibitor Studies—We next investigated whether FBPase deletion mutant, there was no significant defect (Fig. 3B, lane import was dependent upon vacuole acidification or protea- 5). Therefore, V-ATPase is not essential for FBPase import into some degradation using inhibitors that block these processes Vid vesicles. (Fig. 5). For these experiments, Dvid24 semi-intact cells and FBPase Import Requires the UBC1 Gene—Ubiquitination cytosol were preincubated with various concentrations of inhib- plays an important role in distinct biological functions includ- itors. These concentrations were chosen based upon previous ing DNA repair, protein degradation, organelle biogenesis, and studies demonstrating maximal inhibition in the yeast system protein trafficking (41, 42). For example, the ubiquitin protein (35, 36, 49 –51). FBPase, ATP, and an ATP regenerating system ligase Rsp5p is essential for mitochondrial inheritance and were then added to the reaction mixture to commence the mitochondrial import (25, 26). Rsp5p is also involved in recep- import process. The in vitro import of FBPase was inhibited by tor-mediated internalization of Ste2p, Ste3p, and other cell nonhydrolyzable ATPgS (Fig. 5A, lane 3). However, N-ethyl- surface proteins (31). In addition, the ubiquitin-conjugating maleimide, which inhibits V-ATPase (1) did not affect FBPase enzyme Ubc10p plays a critical role in peroxisomal biogenesis import in vitro (lane 4). Likewise, brefeldin A had no effect on (24). Ubc10p is one of 13 ubiquitin-conjugating enzymes found in vitro FBPase import (lane 5), even though this inhibitor in yeast (41, 42). UBC1, UBC4, and UBC5 are functionally caused accumulation of p1-CPY in the ise1 (brefeldin A perme- overlapping and are involved in degrading abnormal or short- able) strain (Fig. 5B, lane 2). FBPase import was also unaf- lived proteins (43, 44). As expected, the Dubc1 strain displayed fected by the proteasome inhibitors MG132 or b-lactone (Fig. a reduced rate of degradation of short-lived proteins as com- 5A, lanes 6 and 7), although these inhibitors did reduce the pared with the wild type control (Fig. 4A). In contrast, UBC6 degradation of short-lived proteins in vivo (Fig. 5C). Inhibitors and UBC7 are involved in the ubiquitination of misfolded or that perturb vacuole acidification such as bafilomycin A and unassembled proteins in the endoplasmic reticulum degrada- concanamycin A (1, 50, 51) also had no effect on FBPase import tion pathway (45, 46). Therefore, Dubc6 and Dubc7 strains did (Fig. 5A, lanes 8 and 9), but they did reduce the degradation of not inhibit the degradation of short-lived proteins (Fig. 4A). long-lived proteins in vivo (Fig. 5D). Taken together, the mu- When the Dubc1, Dubc6, and Dubc7 strains were tested for tant analyses and the inhibitor studies suggest that FBPase FBPase import, a reduced level of import was observed for import into Vid vesicles is independent of vacuole proteolysis, Dubc1 (Fig. 4B, lane 1), but not for the Dubc6 and Dubc7 strains vacuole acidification, and proteasome degradation. However, 10402 A Role for UBC1 in Vid Vesicle Biogenesis FIG.5. The effects of inhibitors on FBPase import. A, FBPase import into semi-intact Dvid24 cells (HLY232) was carried out in the absence (lane 1) or pres- ence (lane 2) of ATP and cytosol or with preincubation of various inhibitors (lanes 3–12). ATPgS (50 mM), N-ethylmaleimide (10 mM), brefeldin A (75 mg/ml), MG132 (100 mM), b-lactone (50 mM), bafilomycin A (20 mM), and concanamycin A (0.3 mM) were added to semi-intact cells and cy- tosol for 20 min before the addition of FBPase, ATP, and an ATP regenerating system. FBPase import was measured as described. The percentage of FBPase im- port in semi-intact cells treated with var- ious inhibitors is indicated. B, the addi- tion of brefeldin A caused p1-CPY to accumulate in the ise1 strain (lane 2). C, the degradation of short-lived proteins was inhibited by MG132 and b-lactone. D, inhibitors that perturb the acidification of the vacuole reduced the degradation of long-lived proteins. this import does require ATP hydrolysis and the UBC1 gene. If UBC1 is required for Vid vesicle formation, the number of UBC1 Is Necessary for FBPase Import—Since the Dubc1 Vid vesicles should be reduced in the Dubc1 mutant. This would strain displayed defective FBPase import in vitro, we next be reflected as a decreased level of Vid24p within fractions that determined whether this strain was also defective in FBPase contain Vid vesicles. Conversely, if UBC1 is required for the degradation in vivo. As is shown in Fig. 6A, wild type cells function of the import machinery, the level of Vid24p would not degraded FBPase after a shift to glucose for 180 min. In con- be altered in the Vid vesicle containing fractions. To test these trast, FBPase degradation was significantly retarded in the possibilities, the wild type, Dubc1, and Dubc6 strains were Dubc1 mutant, but was normal in the Dubc6 mutant. There- shifted to glucose and cell extracts were subjected to differen- fore, UBC1 is required for FBPase degradation, whereas UBC6 tial centrifugation using the protocol described previously (23). is not. In wild type and Dubc6 mutant cells, most of the Vid24p was in We next examined whether the defect in FBPase import the Vid vesicle containing pellet fraction (Fig. 7B). By contrast, observed for the Dubc1 mutant resulted from an inability of the Dubc1 mutant exhibited a significantly decreased level of cytosol to support FBPase import or an inability of Vid vesicles Vid24p in the pellet fraction, but a greater concentration of to take up FBPase. As is shown in Fig. 6B, when cytosol and Vid24p in the soluble fraction (Fig. 7B). The decreased level of semi-intact cells from the Dubc1 strain were used, FBPase Vid24p in the pellet fraction most likely represents a reduced import was impaired (lane 1). By contrast, when cytosol and production of Vid vesicles, since Vid24p induction is not altered semi-intact cells from the Dvid24 strain were combined, a high in the Dubc1 strain. However, a decreased binding of Vid24p to level of FBPase import was observed (lane 2). FBPase import Vid vesicles in the Dubc1 strain could also account for this decreased when Dubc1 semi-intact cells were incubated with observation. cytosol from the Dvid24 strain (lane 3). Since the Dvid24 strain The K48R/K63R Ubiquitin Mutant Inhibits FBPase Degra- contained import competent cytosol, this result indicates that dation—Ubiquitin molecules are most often linked to one an- the Dubc1 mutant had defective vesicles. In contrast, the Dubc1 other by isopeptide bonds between the carboxyl terminus of one strain appears to contain competent cytosol, because cytosol ubiquitin and the e-amino group of lysine 48 of the next ubiq- from the Dubc1 strain supported FBPase import into import uitin (41, 42). However, ubiquitin chains can also be formed at competent Vid vesicles in Dvid24 semi-intact cells (lane 4). lysine 63 (41, 42). Therefore, when both lysine 48 and lysine 63 The impaired ability of the Dubc1 semi-intact cells to import are replaced with arginine (K48R/K63R), the formation of mul- FBPase could be due to a decrease in Vid vesicle production. tiubiquitin chains is inhibited. To study the effect of ubiquitin Alternatively, the reduced import could result from a defect in chain formation on FBPase degradation, a strain overexpress- the import machinery. In initial experiments, we examined the ing the K48R/K63R mutation was used. When wild type ubiq- levels of the Vid vesicle specific marker, Vid24p. Vid24p is uitin was overproduced, FBPase was degraded in response to induced in response to glucose and a significant portion of this glucose in vivo (Fig. 8A). However, when the K48R/K63R ubiq- protein is associated with Vid vesicles as a peripheral protein uitin mutant was overexpressed, FBPase degradation was im- (37). When cells were maintained in low glucose medium (t 5 0 paired (Fig. 8A). Therefore, the degradation of FBPase requires min), Vid24p was undetectable in total lysates. However, this the formation of multiubiquitin chains. protein was induced to a similar level after wild type, Dubc1, FBPase Import into Vid Vesicles Is Inhibited by the K48R/ and Dubc6 strains were shifted to glucose for 20 min (Fig. 7A). K63R Ubiquitin Mutant—We investigated whether ubiquitin Therefore, Vid24p production is not altered in the Dubc1 chain formation is necessary for FBPase import in vitro. FB- mutant. Pase was imported when cytosol and semi-intact cells were A Role for UBC1 in Vid Vesicle Biogenesis 10403 FIG.6. The Dubc1 mutant contains defective vesicles, but normal cy- tosol. A, FBPase degradation was fol- lowed in wild type, Dubc1 and Dubc6 cells for 0, 45, 90, 120, and 180 min. B, both Dvid24 (HLY232) and Dubc1 (HLY212) were shifted to glucose for 20 min. Semi- intact cells and cytosol were prepared from the glucose-shifted Dvid24 and Dubc1 strains. Lane 1, FBPase import into Dubc1 semi-intact cells with cytosol from the Dubc1 strain. Lane 2, FBPase import into Dvid24 semi-intact cells with Dvid24 cytosol. Lane 3, FBPase import into Dubc1 semi-intact cells with Dvid24 cytosol. Lane 4, FBPase import into Dvid24 semi-intact cells with Dubc1 cytosol. the distribution of Vid24p might be altered when the K48R/ K63R mutant was overproduced. When Vid24p was induced in cells overexpressing wild type ubiquitin, most of the Vid24p was in the pellet fraction and very little was in the supernatant fraction (Fig. 8C). However, in cells overproducing the K48R/ K63R mutant, the level of Vid24p decreased to one-third of that observed in cells overexpressing wild type ubiquitin (Fig. 8C). It is unknown why the K48R/K63R mutant reduced total amounts of Vid24p. However, this was not due to an overall decrease in protein concentration, because both wild type and K48R/K63R strains had similar protein concentrations in total lysates as well as in individual supernatant (9.92 versus 8.88 mg/ml) and pellet (4.16 versus 4.61 mg/ml) fractions. When Vid24p distribution was quantitated in the K48R/K63R mu- tant, more than 90% of the Vid24p was in the pellet fraction and less than 10% was in the soluble fraction. Thus, the ratio of FIG.7. Vid vesicle function is impaired in the Dubc1 mutant. A, bound versus unbound Vid24p was not altered when the K48R/ wild type (HLY223), Dubc1, and Dubc6 strains were glucose starved (t 5 K63R mutant was overproduced. Given that the association of 0), or glucose starved and then shifted to glucose for 20 min (t 5 20). Vid24p with Vid vesicles was not prevented by the K48R/K63R Total lysates from t 5 0 and t 5 20 were separated by SDS-PAGE and Vid24p was detected by Western blotting with Vid24p antibodies. B, mutant, polyubiquitination is not required for Vid24p binding wild type, Dubc1, and Dubc6 strains were shifted to glucose for 20 min. to the Vid vesicles. Therefore, these data are consistent with Cells were homogenized and subjected to differential centrifugation. the hypothesis that the Dubc1 and K48R/K63R mutations re- Proteins from the high speed supernatant (S) and high speed pellet (P) were solubilized in SDS buffer and resolved by SDS-PAGE. The distri- sult in a decreased production of Vid vesicles. bution of Vid24p in the S and P fractions was detected by anti-Vid24p We next examined whether Vid24p was ubiquitinated by antibodies. The lower panel indicates the % recovery of Vid24p in each transforming wild type and Dvid24 strain with or without the fraction from these strains. Myc-tagged wild type ubiquitin plasmid. These strains were incubated in glucose poor medium containing copper to induce prepared from the wild type strain overexpressing wild type Myc ubiquitin and FBPase. Cells were then shifted to glucose ubiquitin (Fig. 8B, lane 1). By contrast, in vitro FBPase import for 20 min to induce Vid24p. Ub-Pro-b-galactosidase was used was significantly reduced when both cytosol and semi-intact as a positive control since Ub-Pro-b -galactosidase is known to cells were prepared from the strain that overproduced the be polyubiquitinated constitutively (34). Immunoblotting ex- K48R/K63R mutant (lane 2). When cytosol from the K48R/ periments indicate that high levels of Myc ubiquitin were ex- K63R strain was incubated with semi-intact cells from the pressed in cells transformed with the Myc ubiquitin plasmid, strain overexpressing wild type ubiquitin, a high level of FB- but not in cells that did not harbor the Myc ubiquitin plasmid Pase was imported (Fig. 8B, lane 3). By contrast, FBPase (Fig. 9A, lanes 1– 4). As shown by immunoblotting and immu- import decreased when cytosol from the strain overexpressing noprecipitation experiments, Ub-Pro-b-galactosidase was pres- wild type ubiquitin was incubated with semi-intact cells from ent as multiple bands in cells transformed with the Ub-Pro-b- the K48R/K63R strain (lane 4). Therefore, the K48R/K63R galactosidase plasmid (lanes 5, 6, 9, and 10). However, these mutant inhibits the function of Vid vesicles to import FBPase, bands were not observed in control cells that did not contain but does not affect the ability of cytosol to stimulate FBPase the Ub-Pro-b-galactosidase plasmid (lanes 7, 8, 11, and 12). In import into competent Vid vesicles. The K48R/K63R Mutant Does Not Prevent Vid24p Binding cells transformed with both Ub-Pro-b-galactosidase and Myc ubiquitin plasmids, multiple Ub-Pro-b-galactosidase bands to Vid Vesicles—As mentioned above, the decreased level of Vid24p in the Dubc1 high speed pellet may result from a re- were detected by anti-Myc antibodies, suggesting that these duced number of Vid vesicles, or it may be due to a decreased bands were polyubiqutinated forms of Ub-Pro-b-galactosidase binding of this protein to Vid vesicles. Accordingly, if ubiquitin (lane 14). By contrast, no Myc signal could be found in cells that chain formation is necessary for Vid24p binding to Vid vesicles, did not harbor the Myc ubiquitin plasmid (lane 13) or in cells 10404 A Role for UBC1 in Vid Vesicle Biogenesis FIG.8. FBPase import is impaired when ubiquitin chain formation is in- hibited. A, wild type cells were trans- formed with multicopy plasmids contain- ing either the wild type ubiquitin (HLY824) or the K48R/K63R ubiquitin mutant (HLY823) under an inducible cop- per promoter. The transformants were grown in synthetic medium and ubiquitin was induced by 100 mM CuSO using the protocol described by Schork et al. (52). These cells were then shifted to glucose for the indicated times and FBPase deg- radation was examined. B, wild type cells overexpressing either wild type ubiquitin (HLY820) or the K48R/K63R ubiquitin mutant (HLY819) were shifted to glucose for 20 min. Cytosol and semi-intact cells from these strains were combined as in- dicated and in vitro import of FBPase was performed as described under “Experi- mental Procedures.” C, total lysates from wild type cells over-expressing either wild type ubiquitin (HLY824) or the K48R/ K63R ubiquitin mutant (HLY823) were fractionated by differential centrifuga- tion. The distribution of Vid24p in total (T), high speed pellet (P), and high speed supernatant (S) fractions was examined by Western blotting with anti-Vid24p antibodies. that did not contain the Ub-Pro-b-galactosidase plasmid (lanes that did not have the FBP1 gene (lanes 15 and 16). Thus, these 15 and 16). bands were unlikely to represent polyubiquitinated FBPase. To determine whether Vid24p was ubiquitinated, this pro- Similarly, no polyubiquitination of FBPase was detected when tein was immunoprecipitated from total lysates of wild type wild type cells were pulsed-chased and then immunoprecipi- cells and then immunoblotted with anti-Myc antibodies. tated with anti-FBPase antibodies (data not shown). Since Vid24p was expressed in wild type cells, but was absent in the purified FBPase without ubiquitination was imported into Vid Dvid24 strain, as indicated by immunoblotting (Fig. 9B, lanes vesicles in vitro, polyubiquitination of FBPase is unlikely to be 5– 8) and immunoprecipitation experiments (lanes 9 –12). When required for the import process. the precipitated Vid24p was immunoblotted with anti-Myc an- DISCUSSION tibodies, there was no detectable Myc signal (lane 14). Like- wise, no ubiquitination of Vid24p could be found in cells that In this study, we analyzed FBPase import into Vid vesicles to did not contain the Myc ubiquitin plasmid (lane 13), or in the identify molecules involved in early stages of the FBPase deg- Dvid24 strain (lanes 15 and 16). Furthermore, no ubiquitina- radation pathway. Our results suggest that vacuole proteoly- tion of Vid24p could be detected using pulse-chase experiments sis, vacuole acidification, and proteasome degradation are un- followed by immunoprecipitation with anti-Vid24p antibodies likely to be involved in FBPase import. The Dise1Dpep4 or (data not shown). Therefore, Vid24p is unlikely to be ubiquiti- Dvid24Dpep4 double mutants did not alter FBPase import as nated. This supports our contention that ubiquitination is not compared with the Dise1 or Dvid24 single mutants, suggesting required for the function of Vid24p. that FBPase import is independent of the PEP4 gene. Further- Although the site of FBPase degradation has been a matter more, the vma3 deletion mutant and compounds such as bafilo- of debate (52, 53), a PEP4-dependent degradation of FBPase mycin A or concanamycin A that block acidification of the was confirmed by an independent research group (54). To ex- vacuole did not inhibit FBPase import. Therefore, FBPase im- amine whether FBPase was polyubiquitinated, wild type and port is independent of the two major vacuole functions, vacuole Dfbp1 strains were transformed with or without the Myc- proteolysis and vacuole acidification. This further supports our tagged ubiquitin plasmid using the protocol described by the model that FBPase import into Vid vesicles occurs prior to the Wolf group (52, 53). FBPase was reported to be polyubiquiti- trafficking to the vacuole. nated under these conditions (52, 53). As shown by both immu- Our results indicate that the cytosolic ubiquitin-conjugating noblotting (Fig. 9C, lanes 5– 8) and immunoprecipitation (lanes enzyme Ubc1p is an important regulator of the FBPase import 9 –12) experiments, FBPase was detected in wild type cells, but process. FBPase import into Vid vesicles is defective in the not in the Dfbp1 strain. When the precipitated FBPase was Dubc1 mutant, but not in the Dubc6 or Dubc7 mutants, sug- immunoblotted with anti-Myc antibodies, some faint bands gesting a specific role for UBC1 in the import process. However, migrating below the IgG band were detected in wild type cells this requirement is not linked to proteasome degradation. The transformed with the Myc ubiquitin plasmid (lane 14). How- pre1-1pre2-1 proteasome mutant showed normal FBPase im- ever, these bands were also seen in cells that did not harbor the port and proteasome inhibitors such as MG132 and b-lactone Myc ubiquitin plasmid (lane 13) as well as in the Dfbp1 strain had no effect on FBPase degradation. A Role for UBC1 in Vid Vesicle Biogenesis 10405 FIG.9. Vid24p is not ubiquitinated. A, wild type cells were transformed with or without a multicopy Ub-Pro-b-galactosidase plasmid. These cells were then transformed with or without a multicopy Myc ubiquitin plasmid. Cells were grown in synthetic medium and then shifted to synthetic medium containing 2% ethanol and 100 mM CuSO for5hto induce FBPase and ubiquitin. Cells were transferred to synthetic medium containing fresh 2% glucose for 20 min. Total lysates from these cells were aliquoted into two parts. One-half of the lysates were immunoblotted with anti-Myc antibodies (lanes 1– 4), or anti-b-galactosidase antibodies (lanes 5– 8). Another half of the total lysates were immunoprecipitated first with anti-b-galactosidase antibodies and then immunoblotted with either anti-b-galactosidase antibodies (lanes 9 –12) or with anti-Myc antibodies (lanes 13–16). B, wild type or Dvid24 strains were transformed with or without a multicopy Myc ubiquitin plasmid under a copper inducible promoter. Total lysates were aliquoted into two portions. Half of the lysates were subjected to immunoblotting with anti-Myc antibodies (lanes 1– 4) or anti-Vid24p antibodies (lanes 5– 8). The other half of the total lysates were subjected to immunoprecipitation with anti-Vid24p antibodies and then immunoblotted with either Vid24p antibodies (lanes 9 –12) or anti-Myc antibodies (lanes 13–16). C, wild type and Dfbp1 strains were transformed with or without a multicopy Myc ubiquitin plasmid. Half of the total lysates were immunoblotted with anti-Myc antibodies (lanes 1– 4) or FBPase antibodies (lanes 5– 8). Another half of the lysates were immunoprecipitated with FBPase antibodies and then immunoblotted with anti-FBPase antibodies (lanes 9 –12) or anti-Myc antibodies (lanes 13–16). Our data show that UBC1 is required for the proper function of Vid vesicles. The Dubc1 mutant contained defective vesicles, but normal cytosol. In the absence of the UBC1 gene, cells may decrease the production of Vid vesicles or reduce the efficiency of the import machinery. In the control wild type and Dubc6 strains, most of the Vid vesicle marker Vid24p was found in fractions containing Vid vesicles. When quantitated, ;90% of the Vid24p was recovered in the Vid vesicle containing pellet fraction in wild type cells. However, in the Dubc1 strain, about 25% of the Vid24p was in the pellet fraction, while most of the FIG. 10. The FBPase degradation pathway. When glucose- starved cells are shifted to medium containing fresh glucose, FBPase is Vid24p was in the soluble fraction. The reduced levels of imported into Vid vesicles and then to the vacuole for degradation. The Vid24p in the pellet fraction could result from decreased Vid cytosolic heat shock protein Ssa2p is required for FBPase import into vesicle production or a decreased binding of Vid24p to Vid Vid vesicles. After FBPase is sequestered inside the vesicles, Vid vesi- vesicles. However, the K48R/K63R mutant did not prevent cles then carry FBPase to the vacuole in a process that is dependent Vid24p binding to Vid vesicles, even though it inhibited vesicle upon Vid24p. Although the origin of Vid vesicles is not known, the formation of Vid vesicles is regulated by the cytosolic ubiquitin conju- import. Therefore, polyubiquitination is necessary for FBPase gating enzyme Ubc1p through unidentified factors that are likely to be import into Vid vesicles, but does not play an important role in polyubiquinated. Vid24p binding to Vid vesicles. Based upon results from this study and from previous stud- ies (23, 37), we have proposed a model for the FBPase degra- presence of the heat shock protein Ssa2p. Following FBPase dation pathway (Fig. 10). In the initial step, FBPase is im- sequestration inside these structures, the loaded vesicles then ported into Vid vesicles through a process that requires the traffic to the vacuole via a process controlled by Vid24p. At 10406 A Role for UBC1 in Vid Vesicle Biogenesis Mol. Biol. Cell 10, 1337–1351 present, the site of origin for Vid vesicles is unknown, although 17. Yuan, W., Stromhaug, D. E., and Dunn, W. A., Jr. (1999) Mol. Biol. Cell 10, the formation of these organelles appears to be regulated by the 1353–1366 cytosolic ubiquitin-conjugating enzyme Ubc1p. In the absence 18. Gancedo, C. (1971) J. Bacteriol. 107, 401– 405 19. Chiang, H.-L., and Schekman, R. (1991) Nature 350, 313–318 of this enzyme, levels of Vid vesicles are reduced and FBPase 20. Chiang, H.-L., Schekman, R., and Hamamoto, S. (1996) J. Biol. Chem. 271, degradation is compromised. Therefore, we propose that ubiq- 9934 –9941 uitination plays an important role in the degradation of FB- 21. Shieh, H.-L., and Chiang, H.-L. (1998) J. Biol. Chem. 273, 3381–3387 22. Huang, P.-H., and Chiang, H.-L. (1997) J. Cell Biol. 136, 803– 810 Pase through its effect on the machinery (Vid vesicles) that 23. Brown, C. R., McCann, J. A., and Chiang, H-L. (2000) J. Cell Biol. 150, 65–76 transports FBPase to the vacuole. Identification of the factors 24. Wiebel, F. F., and Kunau, W. H. (1992) Nature 359, 73–76 25. Fisk, H. A., and Yaffe, M. P. (1999) J. Cell Biol. 145, 1199 –1208 that are polyubiquitinated by Ubc1p may ultimately help iden- 26. Zoladek, T., Tobiasz, G., Vaduva, M., Boguta, N., Martin, C., and Hopper, A. K. tify their sites of action as well as to elucidate how FBPase is (1997) Genetics 145, 595– 603 imported into Vid vesicles. 27. Galan, J. M., Moreau, V., Andre, B., Volland, C., and Haguenauer-Tsapis, R. (1996) J. Biol. Chem. 271, 10946 –10952 Acknowledgments—We thank Drs. Graham Hung and Ly Brown for 28. Roth, A. F., and Davis, N. G. (1996) J. Cell Biol. 134, 661– 674 critically reading this manuscript. We also thank Dr. Stefan Jentsch 29. Hicke, L., and Riezman, H. (1996) Cell 84, 277–287 30. Kolling, R., and Hollenberg, C. P. (1994) EMBO J. 13, 3261–3271 (University of Heidelberg, Germany) for the Dubc1, Dubc6, and Dubc7 31. Hicke, L. (1997) FASEB J. 11, 1215–1226 strains and Dr. Alfred Goldberg (Harvard Medical School) for the pre1- 32. Ammerer, G., Hunter, C. P., Rothman, J. H., Saari, G. C., Valls, L. A., and 1pre2-1, ise1 strains, and proteasome inhibitors. We also thank Dr. Dan Stevens, T. H. (1986) Mol. Cell. Biol. 6, 2490 –2499 Finley (Harvard Medical School) for the wild type ubiquitin plasmid, 33. Ellison, M. J., and Hochstrasser, M. (1991) J. Biol. Chem. 266, 21150 –21157 the K48R/K63R ubiquitin plasmid and the Ub-Pro-b-galactosidase 34. Bachmair, A., Finley, D., and Varshavsky, A.(1986) Science 234, 179 –186 plasmid. 35. Graham, T. R., Scott, P. A., and Emr, S. D. (1993) EMBO J. 12, 869 – 877 36. Lee, D. H., and Goldberg, A. L. (1996) J. Biol. Chem. 271, 27280 –27284 REFERENCES 37. Chiang, M.-C., and Chiang, H.-L. (1998) J. Cell Biol. 140, 1347–1356 1. Klionsky, D. J., Banta, L. M., and Emr, S. D. (1990) Microbiol. Rev. 54, 38. Hoffman, M., and Chiang, H-L. (1996) Genetics 143, 1555–1566 266 –292 39. Kane, P. M., Kuehn, M. C., Howald-Stevenson, I., and Stevens, T. H. (1992) 2. Raymond, C. K., Howald-Stevenson, I., Vater, C. A., and Stevens, T. H. (1992) J. Biol. Chem. 267, 447– 454 Int. Rev. Cyt. 139, 59 –120 40. Nakamura, N., Matsuura, A., Wada, Y., and Ohsumi, Y. (1997) J. Biochem. 3. Jones, E. W. (1991) J. Biol. Chem. 266, 7963–7966 (Tokyo) 121, 338 –344 4. Conibear, E., and Stevens, T. (1998) Biochim. Biophys. Acta 1404, 211–230 41. Hochstrasser, M. (1996) Annu. Rev. Genet. 30, 405– 439 5. Klionsky, D. J., and Ohsumi, Y. (1999) Annu. Rev. Cell Dev. Biol. 15, 1–32 42. Jentsch, S. (1992) Annu. Rev. Genet. 26, 179 –207 6. Scott, S. V., and Klinosky, D. J. (1998) Curr. Opin. Cell Biol. 10, 523–529 43. Seufert, W., McGrath, J. P., and Jentsch, S. (1990) EMBO J. 9, 4535– 4541 7. Klionsky, D. J. (1998) J. Biol. Chem. 273, 10807–10810 44. Seufert, W., and Jentsch, S. (1990) EMBO J. 9, 543–550 8. Scott, V. S., and Klionsky, D. J. (1997) Trends Cell Biol. 7, 225–227 45. Hiller, M. M., Finger, A., Schweiger, M., and Wolf, D. H. (1996) Science 273, 9. Harding, T., Morano, K. A., Scott, S. A., and Klionsky, D. J. (1995) J. Cell Biol. 1725–1728 131, 591– 602 46. Biederer, T., Volkwein, C., and Sommer, T. (1996) EMBO J. 15, 2069 –2076 10. Yoshihisa, T., and Anraku, Y. (1990) J. Biol. Chem. 265, 22418 –22425 47. Hilt, W., and Wolf, D. H. (1996) Trends Biochem. Sci. 21, 96 –102 11. Baba, M., Osumi, M., Scott, S. V., Klionsky, D. J., and Ohsumi, Y. (1997) J. Cell 48. Heinemeyer, W., Gruhler, A., Mohrle, V., Mahe, Y., and Wolf, D. (1993) J. Biol. Biol. 139, 1687–1695 Chem. 268, 5115–5120 12. Jungmann, J., Reins, H. A., Schobert, C., and Jentsch, S. (1993) Nature 361, 49. Haas, A., and Wickner, W. (1996) EMBO J. 15, 3296 –3305 369 –371 50. Drose, S., and Altendorf, K. (1997) J. Exp. Biol. 200, 1– 8 13. Liang, X. H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., 51. Parra, K. J., and Kane, P. M. (1998) Mol. Cell. Biol. 18, 7064 –7074 and Levine, B. (1999) Nature 402, 672– 676 52. Schork, S. M., Thumm, M., and Wolf, D. H. (1995) J. Biol. Chem. 270, 14. Mizushima, N., Noda, T., Yoshimori, T., Tanaka, Y., Ishii, T., George, M. D., 26446 –26450 Klionsky, D. J., Ohsumi, M., and Ohsumi, Y. (1998) Nature 395, 395–398 53. Schule, T., Rose, M., Entian, K. D., Thumm, M., and Wolf, D. H. (2000) EMBO 15. Hutchins, M. U., Veenhuis, M., and Klionsky, D. J. (1999) J. Cell Sci. 112, 4079 – 4087 J. 15, 2161–2167. 54. Jiang, Y., Davis, C., Broach, J. R.(1998) EMBO J. 17, 6942– 6951 16. Kim, J., Dalton, V. M., Eggerton, K. P., Scott, S. V., and Klionsky, D. J. (1999)

Journal

Journal of Biological Chemistry – Unpaywall

Published: Mar 1, 2001

There are no references for this article.