Access the full text.
Sign up today, get DeepDyve free for 14 days.
I. Yu, V. Planelles-Herrero, Yannick Sourigues, D. Moussaoui, Helena Sirkia, C. Kikuti, David Stroebel, M. Titus, A. Houdusse (2017)
Myosin 7 and its adaptors link cadherins to actinNature Communications, 8
Sue Richards, Nazneen Aziz, S. Bale, D. Bick, Soma Das, J. Gastier-Foster, W. Grody, M. Hegde, E. Lyon, E. Spector, K. Voelkerding, H. Rehm (2015)
Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular PathologyGenetics in medicine : official journal of the American College of Medical Genetics, 17
Jianchao Li, Yunyun He, Meredith Weck, Q. Lu, M. Tyska, Mingjie Zhang (2017)
Structure of Myo7b/USH1C complex suggests a general PDZ domain binding mode by MyTH4-FERM myosinsProceedings of the National Academy of Sciences, 114
F. Ammar-Khodja, V. Faugère, D. Baux, C. Giannesini, Susana Léonard, M. Makrelouf, R. Malek, D. Djennaoui, A. Zenati, M. Claustres, A. Roux (2009)
Molecular screening of deafness in Algeria: high genetic heterogeneity involving DFNB1 and the Usher loci, DFNB2/USH1B, DFNB12/USH1D and DFNB23/USH1F.European journal of medical genetics, 52 4
Tina Likar, M. Hasanhodžić, N. Teran, A. Maver, B. Peterlin, K. Writzl (2018)
Diagnostic outcomes of exome sequencing in patients with syndromic or non-syndromic hearing lossPLoS ONE, 13
L. Ming, Yangxia Wang, Wei Lu, Tingyi Sun (2019)
A Mutational Analysis of GJB2, SLC26A4, MT-RNA1, and GJB3 in Children with Nonsyndromic Hearing Loss in the Henan Province of China.Genetic testing and molecular biomarkers, 23 1
Zheng-Yi Chen, Tama Hasson, Philip Kelley, B. Schwender, B. Schwender, Marc Schwartz, Meena Ramakrishnan, William Kimberling, M. Mooseker, David Corey, David Corey (1996)
Molecular cloning and domain structure of human myosin-VIIa, the gene product defective in Usher syndrome 1B.Genomics, 36 3
Julia Doll, B. Vona, Linda Schnapp, F. Rüschendorf, I. Khan, Saadullah Khan, N. Muhammad, Sher Khan, Hamed Nawaz, Ajmal Khan, Naseer Ahmad, Susanne Kolb, L. Kühlewein, J. Labonne, L. Layman, M. Hofrichter, Tabea Röder, M. Dittrich, T. Müller, Tyler Graves, I. Kong, I. Nanda, Hyung-Goo Kim, T. Haaf (2020)
Genetic Spectrum of Syndromic and Non-Syndromic Hearing Loss in Pakistani FamiliesGenes, 11
V. Bali, Z. Bebok (2015)
Decoding mechanisms by which silent codon changes influence protein biogenesis and function.The international journal of biochemistry & cell biology, 64
C. Morton, W. Nance (2006)
Newborn hearing screening--a silent revolution.The New England journal of medicine, 354 20
Andrea Oza, Marina DiStefano, Sarah Hemphill, Brandon Cushman, Andrew Grant, Rebecca Siegert, Jun Shen, Alex Chapin, Nicole Boczek, L. Schimmenti, J. Murry, L. Hasadsri, Kiyomitsu Nara, M. Kenna, K. Booth, H. Azaiez, Andrew Griffith, K. Avraham, H. Kremer, H. Rehm, S. Amr, A. Tayoun (2018)
Expert Specification of the ACMG/AMP Variant Interpretation Guidelines for Genetic Hearing LossbioRxiv
X. Liu, J. Walsh, P. Mburu, J. Kendrick-jones, M. Cope, K. Steel, S. Brown (1997)
Mutations in the myosin VIIA gene cause non-syndromic recessive deafnessNature Genetics, 16
S. Riazuddin, Sabiha Nazli, Zubair Ahmed, Yi Yang, Fareeha Zulfiqar, R. Shaikh, Ahmed Zafar, Shaheen Khan, Farooq Sabar, Fouzia Javid, E. Wilcox, E. Tsilou, E. Boger, J. Sellers, I. Belyantseva, S. Riazuddin, T. Friedman (2008)
Mutation spectrum of MYO7A and evaluation of a novel nonsyndromic deafness DFNB2 allele with residual functionHuman Mutation, 29
Zheng-Yi Chen, T. Hasson, P. Kelley, B. Schwender, M. Schwartz, M. Ramakrishnan, W. Kimberling, M. Mooseker, D. Corey (1996)
Molecular Cloning and Domain Structure of Human Myosin-VIIa , the Gene Product Defective in Usher Syndrome 1 B
Kay Chang (2015)
Genetics of Hearing Loss--Nonsyndromic.Otolaryngologic clinics of North America, 48 6
Tama Hasson, M. Heintzelman, Joseph Santos-Sacchi, David Corey, M. Mooseker (1995)
Expression in cochlea and retina of myosin VIIa, the gene product defective in Usher syndrome type 1B.Proceedings of the National Academy of Sciences of the United States of America, 92 21
S. Asgharzade, S. Reiisi, Mohammad Tabatabaiefar, M. Chaleshtori (2017)
Screening of Myo7A Mutations in Iranian Patients with Autosomal Recessive Hearing Loss from West of IranIranian Journal of Public Health, 46
L. Galbis-Martínez, F. Blanco-Kelly, G. García-García, A. Avila-Fernandez, T. Jaijo, Carla Fuster-García, I. Perea-Romero, Olga Zurita-Muñoz, B. Jimenez-Rolando, E. Carreño, B. García‐Sandoval, J. Millán, C. Ayuso (2021)
Genotype–phenotype correlation in patients with Usher syndrome and pathogenic variants in MYO7A: implications for future clinical trialsActa Ophthalmologica, 99
Y. Aoto, T. Horinouchi, Tomohiko Yamamura, Atsushi Kondo, Sadayuki Nagai, S. Ishiko, Eri Okada, Rini Rossanti, Nana Sakakibara, C. Nagano, H. Awano, H. Nagase, Yuko Shima, K. Nakanishi, M. Matsuo, K. Iijima, K. Nozu (2021)
Last Nucleotide Substitutions of COL4A5 Exons Cause Aberrant SplicingKidney International Reports, 7
R. Kabahuma, W. Schubert, Christiaan Labuschagne, D. Yan, S. Blanton, M. Pepper, X. Liu (2021)
Spectrum of MYO7A Mutations in an Indigenous South African Population Further Elucidates the Nonsyndromic Autosomal Recessive Phenotype of DFNB2 to Include Both Homozygous and Compound Heterozygous MutationsGenes, 12
Li-na Li, Hu Yuan, Hongyang Wang, J. Guan, L. Lan, Da-yong Wang, L. Zong, Qiong Liu, B. Han, D. Huang, Qiuju Wang (2018)
Identification of a MYO7A mutation in a large Chinese DFNA11 family and genotype–phenotype review for DFNA11Acta Oto-Laryngologica, 138
Xue Gao, Guo-jian Wang, Yongyi Yuan, Feng Xin, M. Han, Jingqiao Lu, Hui Zhao, Fei Yu, Jin-Cao Xu, Mei-Guang Zhang, Jia-hui Dong, Xi Lin, P. Dai (2014)
Novel Compound Heterozygous Mutations in MYO7A Associated with Usher Syndrome 1 in a Chinese FamilyPLoS ONE, 9
Elayne Santana, Carla Fuster-García, E. Aller, T. Jaijo, B. García-Bohórquez, G. García-García, J. Millán, A. Lantigua (2019)
Genetic Screening of the Usher Syndrome in CubaFrontiers in Genetics, 10
S. Kirchner, Z. Cai, Robert Rauscher, N. Kastelic, Melanie Anding, Andreas Czech, B. Kleizen, L. Ostedgaard, I. Braakman, D. Sheppard, Z. Ignatova (2017)
Alteration of protein function by a silent polymorphism linked to tRNA abundancePLoS Biology, 15
S. Ben-Salem, H. Rehm, Patrick Willems, Zakaria Tamimi, H. Ayadi, B. Ali, L. Al-Gazali (2013)
Analysis of two Arab families reveals additional support for a DFNB2 nonsyndromic phenotype of MYO7AMolecular Biology Reports, 41
Z. Sauna, C. Kimchi-Sarfaty (2011)
Understanding the contribution of synonymous mutations to human diseaseNature Reviews Genetics, 12
Parth Patel, Joshua Gorham, K. Ito, C. Seidman (2018)
In Vivo and In Vitro Methods to Identify DNA Sequence Variants that Alter RNA SplicingCurrent Protocols in Human Genetics, 97
Yan-bao Xiang, Chen-yang Xu, Yun-zhi Xu, Huan Li, Lili Zhou, Xue-qin Xu, Zihui Chen, Shaohua Tang (2020)
Next‐generation sequencing identifies rare pathogenic and novel candidate variants in a cohort of Chinese patients with syndromic or nonsyndromic hearing lossMolecular Genetics & Genomic Medicine, 8
A. Bakhchane, M. Charif, A. Bousfiha, Redouane Boulouiz, Halima Nahili, H. Rouba, H. Charoute, G. Lenaers, A. Barakat (2017)
Novel compound heterozygous MYO7A mutations in Moroccan families with autosomal recessive non-syndromic hearing lossPLoS ONE, 12
Sun Joo, G. Na, Jung Kim, Jee Yoo, Da Kim, Se Kim, S. Jang, Seyoung Yu, Hye-Youn Kim, J. Choi, H. Gee, Jinsei Jung (2022)
Clinical Heterogeneity Associated with MYO7A Variants Relies on Affected DomainsBiomedicines, 10
Gene Yeo, C. Burge (2003)
Maximum entropy modeling of short sequence motifs with applications to RNA splicing signalsJournal of computational biology : a journal of computational molecular cell biology, 11 2-3
Z. Brownstein, Amal Abu-Rayyan, Daphne Karfunkel-Doron, S. Sirigu, Bella Davidov, M. Shohat, M. Frydman, A. Houdusse, M. Kanaan, K. Avraham (2013)
Novel myosin mutations for hereditary hearing loss revealed by targeted genomic capture and massively parallel sequencingEuropean Journal of Human Genetics, 22
Amel Bahloul, Vincent Michel, J. Hardelin, Sylvie Nouaille, S. Hoos, A. Houdusse, P. England, C. Petit (2010)
Cadherin-23, myosin VIIa and harmonin, encoded by Usher syndrome type I genes, form a ternary complex and interact with membrane phospholipidsHuman Molecular Genetics, 19
Yoel Hirsch, C. Tangshewinsirikul, K. Booth, H. Azaiez, Devorah Yefet, Adina Quint, Tzvi Weiden, Z. Brownstein, M. Macarov, Bella Davidov, J. Pappas, R. Rabin, M. Kenna, Andrea Oza, Katherine Lafferty, S. Amr, H. Rehm, D. Kolbe, K. Frees, C. Nishimura, Minjie Luo, C. Farra, C. Morton, Sholem Scher, J. Ekstein, K. Avraham, Richard Smith, Jun Shen (2021)
A synonymous variant in MYO15A enriched in the Ashkenazi Jewish population causes autosomal recessive hearing loss due to abnormal splicingEuropean Journal of Human Genetics, 29
T. Sakai, H. Jung, O. Sato, M. Yamada, D. You, R. Ikebe, M. Ikebe (2015)
Structure and Regulation of the Movement of Human Myosin VIIA*The Journal of Biological Chemistry, 290
J. Barendregt, W. Nusselder, L. Bonneux (1997)
Global burden of diseaseThe Lancet, 350
Songfeng Zou, Xueshuang Mei, Weiqiang Yang, Rvfei Zhu, T. Yang, Hongyi Hu (2019)
Whole‐exome sequencing identifies rare pathogenic and candidate variants in sporadic Chinese Han deaf patientsClinical Genetics, 97
Yan-bao Xiang, Shaohua Tang, Huan Li, Chen-yang Xu, Chong Chen, Yun-zhi Xu, Lirong Ding, Xue-qin Xu (2019)
Mutation analysis of common deafness-causing genes among 506 patients with nonsyndromic hearing loss from Wenzhou city, China.International journal of pediatric otorhinolaryngology, 122
Lin Wu, L. Pan, Zhiyi Wei, Mingjie Zhang (2011)
Structure of MyTH4-FERM Domains in Myosin VIIa Tail Bound to CargoScience, 331
Yunlong Li, Jie Su, Chao Ding, F. Yu, B. Zhu (2019)
Identification of four novel mutations in MYO7A gene and their association with nonsyndromic deafness and Usher Syndrome 1B.International journal of pediatric otorhinolaryngology, 120
M. Grati, B. Kachar (2011)
Myosin VIIa and sans localization at stereocilia upper tip-link density implicates these Usher syndrome proteins in mechanotransductionProceedings of the National Academy of Sciences, 108
INTRODUCTIONHearing loss (HL) is a disorder of human perception that exhibits extreme genetic and clinical heterogeneity. Data from the World Health Organization (WHO) indicate that nearly 5% of the world's population has HL.1 HL has both genetic and environmental contributors; genetic cases of HL account for more than 50% of HL cases.2,3 Further, approximately 30% of hereditary HL is syndromic and presents with other complications, while the other 70% is nonsyndromic.4 Research has found more than 110 genes and 150 loci to be related to HL (https://hereditaryhearingloss.org/). Among Chinese patients with nonsyndromic hearing loss (NSHL), GJB2, SLC26A4, and mtDNA 12SrRNA are the most frequently identified genes, representing 40%–50% of cases.5,6 The remainder of cases result from other rare mutations of HL genes or other unidentified etiologies.7,8The human MYO7A gene is located on chromosome 11q13.5 and encodes the actin‐binding dynamic protein myosin VIIa, which belongs to the unconventional myosin family.9 It is composed of 2215 amino acids and influences retinal pigment epithelium, retinal photoreceptor cells, and cochlea and vestibular neuroepithelia.9,10 Thus, MYO7A pathogenic variants can cause both syndromic and NSHL, including autosomal dominant nonsyndromic hearing loss (ADNSHL, DFNA11), autosomal recessive nonsyndromic hearing loss (ARNSHL, DFNB2), and syndromic deaf‐blindness (Usher Type 1B, USH1B).11–13 Studies have identified an interaction between the myosin VIIa protein, the SANS (encoded by USH1G gene) protein, and the harmonin (encoded by USH1C gene); this triplet in hair cell stereocilium transports the protein complex to the tip which, in turn, regulates mechanoelectrical transduction (MET).14,15 The MYO7A protein contains a domain that provides its motor and cargo binding functions.16,17 The intact head domain includes an ATP binding site and an actin‐binding site in the N‐terminal area and the neck region, which is composed of five isoleucine‐glutamine (IQ) motifs to which calmodulin binds. They are then followed by a steady single α‐helix (SAH) and a pair of myosin tail homology 4 (MyTH4) domains and integrant 4.1‐ezrinradixin‐moesin (FERM) domains, which are screened off by an SH3 domain in the tail domain of the C‐terminal region.16,17 It has been demonstrated that the tail domain regulates dimerization and binding with different cargo and proteins; this plays an important role in MYO7A protein movement.16According to the Human Gene Mutation database (HGMD; http://www.hgmd.cf.ac.uk/ac/all.php; professional version dated 2021.04), 427 deleterious variants on the MYO7A gene have been found to be associated with HL to date. In contrast, <10% of these variants are responsible for the clinical phenotype of NSHL, and none of these variants in NSHL patients are synonymous. As synonymous variants do not exhibit altered amino acid sequences and most are considered benign or possibly benign, they are often filtered in bioinformatic analyses in accordance with the American College of Medical Genetics and Genomics/Association for Molecular Pathology (ACMG/AMP) recommendations and ClinGen Hearing Loss Expert Panel specifications.18,19This study describes the genetic, molecular, and clinical features of a Chinese Han family with ARNSHL. In a previous investigation, the proband of the family was not found to harbor any of the common mutant deafness genes, including GJB2 (c.35delG, c.176_191del16, c.235delC, c.299‐300delAT), SLC26A4 (c.919‐2A > G, c.1174A > T, c.1226G > A, c.1229C > T, c.1707 + 5G > A, c.1975G > C, c.2027 T > A, c.2168A > G), and MT‐RNR1 (m.1494C > T, m.1555A > G), and GJB3 (c.538C > T). Thus, we carried out targeted next‐generation sequencing (TNGS) to identify whether the proband harbored any rare pathogenic variants. The results revealed that the proband harbored a compound heterozygous maternally inherited variant, c.2904G > A (p.Glu968=), and a paternally inherited variant, c.5994G > T (p.Trp1998Cys, NM_000260.3), in the MYO7A gene (NM_000260.3). c.5994G > T is a missense mutation at exon 44 of the MYO7A gene, whereas the c.2904G > A variant is a synonymous variant at the last base of exon 23 (Figure 1). Both variants are novel and have not been reported in HL patients before. To determine whether the two variants were pathogenic sites for the proband, an MYO7A gene c.2904G > A and c.5994G > T mutation pathogenicity study was performed.1FIGURE(A) Pedigree and genotype data of all family members; (B) Electropherogram presenting the MYO7A wild‐type sequences and heterozygous mutations identified in the DFNB2 family; (C) Domains with mutations in the MYO7A proteinMATERIALS AND METHODSPatients and clinical informationA nonconsanguineous Chinese Han family containing two siblings, a daughter (14‐year old) and a son (two‐year old), both suffering from congenital bilateral HL, took part in this study. The proband (the elder sister) and her family members underwent hereditary hearing impairment mutation screening at the Department of Genetics, Wenzhou Central Hospital (Figure 1A). The proband underwent comprehensive clinical examinations. High‐resolution computed tomography (HRCT) of the proband's temporal bones was performed to exclude vestibular aqueduct enlargement or other malformations of the inner ear. Tandem gait and Romberg testing were performed to assess her vestibular function. An ophthalmologic evaluation, including dilated fundus ophthalmoscopy and best‐corrected visual acuity measurement, was also performed. To examine the proband's degree of HL, pure‐tone audiometry (PTA) was performed, and the auditory brainstem response (ABR) was evaluated. The classification of HL severity was performed as follows: complete (95 dB or greater), profound (80 to <95 dB), severe (65 to <80 dB), moderately severe (50 to <65 dB), moderate (35 to <50 dB), and mild (20 to <35 dB). This research was approved and supported by the proband, her family, and the Ethics Committee of Wenzhou Central Hospital.TNGS, data analysis, and co‐segregationBlood samples were obtained from each parent and both affected patients. Genomic DNA was extracted from the whole blood using a Qiagen DNA Blood Midi/Mini Kit (Qiagen). For TNGS, a customized human array was built with Roche NimbleGen to target the exons and 10 bp flanking intron sequences of 127 genes that are implicated in deafness (Table S1). DNA sequencing was conducted using the HiSeq2000 platform (Illumina). After quality control, the Burrows–Wheeler Aligner (BWA) was used to further align the clean data in accordance with the human genome reference sequence hg19 (GRCH37). SAMtools and GATK were used to annotate the BAM files. Potential pathogenic variants were identified, based on a frequency lower than 0.005, using NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp), the Genome Aggregation database (http://gnomAD.broadinstitute.org/), and the 1000 Genomes Project database (http://browser.1000genomes.org). Using the mutation databases HGMD and Clinvar (http://www.ncbi.nlm.nih.gov/clinvar), previously documented HL pathogenic mutations were identified. Then, synonymous variations in coding regions, untranslated regions, and introns (except for splice mutations that could create ectopic sites or disrupt ordinary splice sites) were screened out. Prediction of the pathogenicity of missense variants was performed using Polyphen‐2, SIFT, and Mutation Taster. The bioinformatics splicing tool MaxEntScan algorithms was used for prediction of the functional effect of splicing site variants (if the value ∆MaxEnt = MaxEntvar‐MaxEntref <0, a variant sequence was denoted as a potential deleterious site that may disrupt of potential acceptor or donor sites splicing).20,21 Conservation analyses were carried out using the NCBI database by aligning the amino acid sequences of MYO7A proteins among multiple diverse species. Given the proband's family history, we suspected a recessive inheritance model; thus, compound heterozygous or homozygous mutations were selected. Sanger sequencing of the proband's family was performed to determine co‐segregation of the disease phenotype and candidate mutations. The primers included the following: MYO7A‐2904‐F/R: CCTCTGAGTGGTCCAGAGGT/TCTCTGCTCCCCACTGTTCA; MYO7A‐5994‐F/R: GACGTGAGC ACTCCTCTGTG/GCCTGAACAGGTAGGG. The variants identified were eventually categorized with reference to ACMG/AMP recommendations and ClinGen Hearing Loss Expert Panel specifications.18,19In addition, to exclude potential causative copy number variants (CNVs) that may have caused the HL phenotype in the proband, chromosomal microarray analysis (CMA) was performed using Affymetrix CytoScan 750 k Array, according to the manufacturer's instructions.Molecular modelingIn order to predict the influence of p.Trp1998Cys amino acid substitution on the MYO7A protein structure, a molecular modeling method was employed. We constructed the 3D structures of the homomeric wild‐type and mutated MYO7A MyTH4‐FERM tandem domain (MF2) using the Swiss‐Model Server (http://swissmodel.expasy.org), and the structures were illustrated using the PyMol Molecular Graphic system. The resolved structure of Myosin VIIa encoded by the MYO7A gene was used as a template (Protein Data Bank No.5mv9, a complex of harmonin‐a PDZ3 domain and human Myosin VIIa C‐terminal MyTH4‐FERM domain)Minigene construction and expressionThe synonymous variant c.2904G > A (p.Glu968=) situated at the last base of exon 23, which is a highly conserved base that is part of the 5′ splice site. This variant was selected based on bioinformatic prediction. To analyze the influence of the variant on splicing, DNA fragment exons 22–24, including exon 22, intron 22, exon 23, intron 23, and exon 24 were amplified using the following primers: MYO7A‐exon22‐F: gagacccaagctggctagcgccaccATGTATCTGTGGCGCCTCGAGGCTG and MYO7A‐exon24‐R: cttggtaccgagctcggatccCAGCTGGTCACCCTCGTCGTCATG (lowercase letters in primer F and R indicate the addition of nucleotides to the primers to depict the NheI and BamHI restriction sites, respectively). The PCR product was distilled and embedded in the pCDNA3.1 vector that was digested with NheI and BamHI through recombination. The designated clones were then sequenced by Sanger sequencing to verify that the mutant‐type (pcDNA3.1‐MYO7A‐Mut) and wild‐type clones (pcDNA3.1‐MYO7A‐Wt) were successfully obtained.Using standard procedures, HEK293T (human embryonic kidney 293 T) cells were cultured in Dulbecco's minimum essential medium (DMEM) comprising 10% fetal bovine serum (Invitrogen, Carlsbad, USA) at 37°C in a 5% CO2 atmosphere. Then, Lipofectamine 2000 (Invitrogen) was used to transiently transfect of 4 μg wild‐type and mutant minigene constructs into HEK293T cells. 48 h after transfection, TRIzol reagent (Invitrogen) was employed to extract total RNA from the HEK293T cells. Further, reverse transcription of 2 μg of total RNA was performed using the reverse transcription system Takara. For RNA retrotranscription, 200 ng of cDNA from the wild‐type and mutate minigene constructs, respectively, was PCR amplified using primers Det‐Mini‐F:CTATAGGGAGACCCAAGCT and Det‐Mini‐R:CAACTAGAAGGCACAGTCG. 2% agarose gel electrophoresis was used to confirm and sequence the PCR product.RESULTSClinical featuresThe affected individuals (II1 andII2) were born to a healthy nonconsanguineous Chinese family with congenital bilateral HL. PTA and ABR revealed that the proband had complete sensorineural HL with average thresholds >100 dB in both the left and right ear. No HL features were evident in the parents. An HRCT scan of the temporal bone did not indicate any inner ear malformities. The middle ear structures and ossicles also appeared normal. A clinical examination, including vestibular function evaluation and visual examination (Figures S1–S2), of the proband appeared to be normal, with no deformities suggestive of syndromic HL. Thus, the results of the clinical examination and audiological evaluation of the proband were in accordance with the clinical diagnosis of NSHL.TNGS results and co‐segregationTNGS was performed in the proband. A mean depth of 225.17 for the covered exons was achieved, and 99.95% of the bases were covered by at least 30 sequencing reads. In view of the filter criteria and recessive genetic model, two novel compound heterozygous mutants, c.2904G > A (p.Glu968=) and c.5994G > T, in the MYO7A gene of the proband, were suspected to be potentially related to the disease. No other pathogenic variants in HL genes were identified. No potential pathogenic CNVs were detected by chromosomal microarray analysis (Figure S2). The missense variant c.5994G > T (p.Trp1998Cys) was absent from the dbSNP, 1000 Genomes Project, and gnomAD databases. The synonymous variant c.2904G > A was not identified in the 1000 Genomes Project database but was registered in dbSNP (rs111033233) with a relatively low frequency in the global population of gnomAD (0.0000041). Sanger sequencing of MYO7A showed that both the proband and her brother had compound heterozygous variations of c.2904G > A and c.5994G > T, whereas the healthy parents carried the heterozygous c.5994G > T variant and the heterozygous c.2904G > A variant, respectively (Figure 1A/B). These results suggest that the compound heterozygous variants (c.2904G > A and c.5994G > T) are co‐segregated with the clinical phenotype and could lead to deafness in the next generation.Bioinformation analysis and structure modelingConservation analysis results revealed that the aromatic amino acid tryptophan at site 1998 (p.Trp1998) is highly conserved across species (Figure 2), and its replacement by the sulfur amino acid cysteine was predicted to be deleterious using Polyphen‐2 (0.997, possibly destructive), SIFT (0.000, destructive), and Mutation Taster (disease‐causing) in silico prediction software. For the c.2904G > A variant, substitution occurred at the last base of exon 23 and did not change the amino acid sequence of site 968 (p.Glu968=); yet, it was suggested to affect splicing with disruption of the exon 23 donor site, according to the MaxEntScan algorithm (MaxEntvariant value −2.09; MaxEntreference value 6.43; ∆MaxEnt = −8.52 < 0).2FIGUREAlignment of the MYO7A amino acid sequences in diverse species. The amino acid variants are highly conserved residuesThe crystal structure of MYO7A MyTH4‐FERM (Protein Data Bank No.5mv9) was used as a template for modeling the second MyTH4‐FERM tandem domain. The alternation of p.Trp1998Cys may influence intramolecular interactions between Trp1998 and its neighboring residues: Trp1998 forms hydrogen bonds with Thr2001, Tyr2197, and the harmonin (USH1C) PDZ3 domain Phe552. Cys1998 significantly changes the hydrogen bonds. The interaction with Thr2001 and Tyr2197 remains, but with the harmonin PDZ3 domain Phe552, the hydrogen bond disappears. In addition, a new hydrogen bond appears between Cys1998 and Lys2135 (Figure 3).3FIGUREFunctional and structural influences of the MYO7A c.5994G > T (p.Trp1998Cys) missense mutation, as predicted by molecular modelingSplicing study of MYO7A c.2904G > A by minigene assayFigure 4A illustrates the minigene structure. After cell transfection of pcDNA3.1‐MYO7A‐Wt, RT‐PCR of total RNA was performed, resulting in a 623 bp band consistent with the correct splicing of mRNA, and a distinct 413 bp band in cells transfected with pcDNA3.1‐MYO7A‐Mut (Figure 4B). After purification and sequencing of the RT‐PCR products, it appeared that the MYO7A synonymous mutation (c.2904G > A) resulted in the complete absence of exon 23 of the MYO7A gene during mRNA splicing (Figure 4C/D).4FIGURESplicing changes confirmed with minigene assay. (A) Construction of the pcDNA3.1‐MYO7A‐WT/Mut vector containing exon 22 to exon 24 sequences from wild‐type or mutant types (c.2904G > A) of the MYO7A gene; (B) Agarose gel (2%) electrophoresis of RT‐PCR products acquired from RNA of HEK 293 T cells transfected with the wild‐type or mutant‐type minigene vector; Lanes WT and Mut refer to different transfections of the wild‐type (c.2904G) or mutant‐type (c.2904A) constructs; (C) Schematic diagram of minigene construction and schematic diagram of Sanger sequencing of RT‐PCR products; (D) Sequencing traces of the normally spliced 623 bp fragment (wild‐type) and the 413 bp fragment (mutant‐type) skipping exon 23DISCUSSIONThe majority of synonymous variants are considered likely benign and are often disregarded in genetic analyses as they do not alter amino acid sequences.15 However, synonymous variants involving disease‐causing genes have been increasingly reported in over 50 human diseases. Thus, identification of the pathogenicity of synonymous mutations could enhance gene diagnosis.22 The possible mechanisms of pathogenic synonymous variants have been clarified using various approaches and include changes to RNA splicing (creating a cryptic new donor/acceptor splice site resulting in aberrant splicing; loss of a classical donor/acceptor splice site resulting an exon skipping, etc.); alterations to the secondary structure of mRNA, which affects mRNA stability; regulation of the translation rate, which influences protein expression or enzymatic activity.23–26 Although various computational predictions, such as Human Splicing Finder (HSF), MaxEntScan, and Splice AI, can be used to predict pathogenic synonymous variants, these predictions can be unreliable. Consequently, in vivo and (or) in vitro functional assays, such as the minigene splicing assay and protein expression experiment, must be performed to verify these predictions.24,25 This may contribute to the exploration of pathomechanism of pathogenic synonymous variants.At present, we identified a novel c.2904G > A (p.Glu968=) synonymous mutation and a new missense mutation in a Chinese family with NSHL using targeted 127 HL gene and next‐generation sequencing; this was then validated by Sanger sequencing. The c.2904G > A (p.Glu968=) synonymous mutation is at the last base of exon 23, which is a highly conserved base that is part of the 5′ splice region. As it involves the characteristic consensus sequence of the splicing donor site, AG/GUAAGU, mutation at this position may change the donor splice site of intron 24. The MaxEntScan algorithm also predicted that this mutation is likely to influence the splicing process by the loss of a donor splice site. To further elucidate the pathogenicity of this synonymous mutation, RT‐PCR splicing validation was performed through the construction of a minigene vector. The RT‐PCR findings indicated that the c.2904G > A variation led to abnormal splicing and the complete skipping of exon 23, thus producing incomplete myosin VIIa which is missing part of the MyTH4‐FERM 1 (MF1) subdomain (Figure 4C/D). This may significantly affect the folding of the MF1 subdomain and probably interferes with the mutual effect between the SANS protein and myosin VIIa.15,27 Precise cooperation between the myosin VIIa, SANS and harmonin proteins is essential as they are key factors in the structure of stereocilia, and failure of this cooperation can lead to defective stereocilia and HL.15,28MYO7A c.5994G > T (p.Trp1998Cys) is located in the second MyTH4‐FERM (MF2) subdomain. It is known to play a vital role in the interaction with the harmonin (USH1C) PDZ3 domain.15,27,28 Mutations occurring in MF2 are reported to perturb harmonin binding, which is likely the molecular basis underlying disruption of the tripartite complex assembly and mechanotransduction function.16,29 As shown in the crystal structure model, the substitution of p.Trp1998Cys may hinder intramolecular and intermolecular relationships between Trp1998 and its neighboring residues: Trp1998 forms hydrogen bonds with Thr2001, Tyr2197, and the harmonin (USH1C) PDZ3 domain Phe552 (Figure 3A). For Cys1998, the interaction with Thr2001 and Tyr2197 remains, but with harmonin PDZ3 Phe552, the hydrogen bond is absent. In addition, a new hydrogen bond occurs between Cys1998 and Lys2135 (Figure 3B). Therefore, it seems that the protein subdomain interaction between myosin VIIa MF2 and harmonin PDZ3 is influenced, and intramolecular interactions among the MF2 subdomain are reinforced. These changes may cause nonfunctional tripartite complexes in the stereocilium, resulting in poor MET and even HL.Based on the ACMG/AMP recommendations and Expert Panel specifications for interpreting genetic HL variants, a pathogenicity analysis was performed on these two mutations. For c.2904G > A: (a) an in vitro validation experiment involving the construction of a minigene vector indicated that the c.2904G > A synonymous variant caused complete skipping of exon 23 in MYO7A, which subsequently led to gene function impairment; this confirms the pathogenicity of the variant (PS3); (b) the c.2904G > A mutation is not present in the 1000 Genomes Project database and has a low frequency in the global population of the gnomAD database (0.0000041) (moderate pathogenic evidence PM2); (c) both the proband and her younger affected brother carry the MYO7A c.2904G > A and c.5994G > T compound heterozygous mutations, while their parents, free from hearing disorder, only carry one mutant allele in MYO7A (the father carries the MYO7A c.5994G > T variant while the mother harbors the c.2904G > A variant), suggesting that the phenotype of HL was co‐segregated with the MYO7A genotype in members of the family (supporting pathogenic evidence, PP1). Overall, the research suggests that the c.2904G > A variation is “PS3 + PM2 + PP1,” and thus, it is considered a pathogenic variation. For c.5994G > T: (a) the novel missense is not found in the dbSNP, 1000 Genomes Project, and gnomAD databases (moderate pathogenic evidence PM2); (b) the DFNB2 HL phenotype is a recessive disease and has been found to be associated with a likely pathogenic variation in c.2904G > A; thus, there is moderate pathogenic evidence (PM3) for the second allele, c.5994G > T, in the proband and her sibling; (c) the phenotype of HL was co‐segregated with the MYO7A genotype in the family members (supporting pathogenic evidence, PP1); (d) c.5994G > T is conserved in several vertebrates and may lead to disease according to the prediction results of Polyphen‐2, SIFT, and Mutation Taster. The crystal structure analysis of this mutation also exhibited altered intra‐ or intermolecular interactions, as compared to wild‐type myosin VIIa (supportive pathogenic evidence, pp3). Thus, c.5994G > T was also identified as “likely pathogenic” based on the above “PM2 + PM3 + PP1 + PP3” evidence.To date, hundreds of MYO7A variations have been detected in people suffering from Usher syndrome, and about 30 of them have been clearly characterized in 25 DFNB2 families. As there is no current treatment for retinitis pigmentosa, patients with the Usher syndrome are supposed to have worse survival quality than patients with DFNB2 phenotype. Thus, the exploration of the MYO7A genotype–phenotype correlation is of great significance. The recent study of DFNA11 families with MYO7A heterozygous mutations showed that individuals carrying myosin VIIa protein tail variants had more severe audiological phenotypes than patients with mutations in the motor domain. This suggests that audiological differences among ADNSHL patients correspond to specific domains.29 However, the type of MYO7A variant does not seem to change the onset, severity, or course of the visual disease in Usher syndrome patients, suggesting no correlation between the MYO7A genotype and phenotype in Usher patients.30 Further, compared with Usher syndrome, there are few differences in the spatial distribution, site, or type of variants that cause DFNB2, according to a report by Kabahuma et al.12 In this research, we hypothesized that the mutations identified in the previously reported 25 DFNB2 families (Table 1) could be divided into tail region (including MF1 and MF2 subdomains) mutations and non‐tail region (including motor, IQ1‐5, and SAH subdomains) mutations (Figure 1C). We were surprised to find that biallelic mutations in the 22/25 families were derived from or have affected the identical myosin VIIa region (non‐tail + non‐tail or tail + tail), indicating that mutations occurring in identical tail or non‐tail regions may be more likely to result in the DFNB2 phenotype in comparison with mutations detected in the alien region (Tables 1 and 2). The findings of this research are in line with our prior research which found that both c.2904G > A and c.5994G > T affect identical tail region function, suggesting a tail + tail pattern. The hypothesis should be further verified by more data from DFNB2 families.1TABLEReported MYO7A mutations and their mutation regions in 25 DFNB2 familiesNo.Population groupFamily IDAllele 1 (Nucleotide/protein)Allele 2 (Nucleotide/protein)Mutation regionReference1ChineseF01c.731G > C/p.R244Pc.731G > C/p.R244PNon‐tail + non‐tail312ChineseF05c.133‐2A > G/Splice regionc.3597insT/p.V1199insTNon‐tail + tail313PakistaniPKDF034c.5142_5144del/p.E1716delc.5142_5144del/p.E1716delTail + tail324IraqiF1c.1592_1593insAG/p.C652Gfs*11c.1592_1593insAG/p.C652Gfs*11Non‐tail + non‐tail335PalestiniansF2c.5660C > T/p.P1887Lc.5660C > T/p.P1887LTail + tail336JewishD75c.620A > G/p.Asn207Serc.620A > G/p.Asn207SerNon‐tail + non‐tail337JewishD79c.29 T > C/p.Val10Alac.1969C > T/p.Arg657TrpNon‐tail + non‐tail348PalestiniansQS004c.4153‐2A > G/Splice regionc.4153‐2A > G/Splice regionTail + tail349PalestiniansQS025c.6211C > T/p.Gln2071*c.6211C > T/p.Gln2071*Tail + tail3410MoroccanSF01c.6025delG/p.Ala2009Profs*32c.6229 T > A//p.Trp2077ArgTail + tail3511MoroccanSF42‐1c.3500 T > A/p.Leu1167Hisc.4487C > A/p.Thr1496LysTail + tail3512MoroccanSF42‐2c.3500 T > A/p.Leu1167Hisc.5617C > T/p.Arg1873TrpTail + tail3513IranianF13c.6487G > A/p.G2163Sc.6487G > A/p.G2163STail + tail3614IranianF32c.448 C > T/p.Arg150*c.448 C > T/p.Arg150XNon‐tail + non‐tail3615ChineseG2c.2183 T > C/p.L728Pc.2187 + 2_ + 8delTGAGCAC/Splice regionNon‐tail + non‐tail3716PakistaniF4c.470G > A/p.S157Asnc.470G > A/p.S157AsnNon‐tail + non‐tail3817PakistaniF5c.3502 C > T/p.R1168Wc.3502 C > T/p.R1168WTail + tail3818South AfricansTS065/TS100c.5339A > C/p.Tyr1780Serc.5339A > C/p.Tyr1780SerTail + tail1219South AfricansBS044c.1849 T > C/p.Ser617Proc.1849 T > C/p.Ser617ProNon‐tail + non‐tail1220South AfricansTS076c.5339A > C/p.Tyr1780Serc.6375delC/p.Pro2126Leufs*5Tail + tail1221South AfricansTS074c.986G > A/p.Gly329Aspc.5339A > C/p.Tyr1780SerNon‐tail + tail1222South AfricansTS093c.5339A > C/p.Tyr1780Serc.5339A > C/p.Tyr1780SerTail + Tail1223South AfricansTS040c.1554 + 7C > T/p.Tyr1780Serc.6375delC/p.Pro2126Leufs*5Non‐tail + tail1224South AfricansTS036c.1118G > A/p.Arg373Hisc.1142C > T/p.Thr381MetNon‐tail + non‐tail1225South AfricansTS070c.247C > A/p.Arg83Cysc.247C > A/p.Arg83CysNon‐tail + non‐tail12Note: Non‐tail mutation region: MYO7A mutations in Motor, IQ1‐5 and SAH subdomains; Tail mutation region: MYO7A mutations in MF1 and MF2 subdomains.*stands for frameshift mutation or stop codon mutation.2TABLECombinatorial patterns of biallelic mutation regions and their ratios in 25 reported DFNB2 familiesBiallelic mutation regionsNumber of familiesTotalRatioIdenticalNon‐tail + non‐tail102288.0% (22/25)Tail + tail12Non‐identicalNon‐tail + tail3312.0% (3/25)Note: This suggests that biallelic mutations occurring in identical tail or non‐tail regions may be more likely to result in the DFNB2 phenotype in comparison with mutations detected in the alien region (88.0% vs. 12%). Non‐tail mutation: MYO7A mutations in Motor, IQ1‐5 and SAH subdomains; Tail mutation region: MYO7A mutations in MF1 and MF2 subdomain.Although the clinical data to date indicate the NSHL phenotype in this family, the diagnosis of Usher syndrome cannot be totally excluded since MYO7A‐related Usher syndrome usually presents with late‐onset retinal pigmented epithelium. The clinical features of Usher syndrome vary among and between families, especially with respect to the age of onset of eye disorder.30,39 Further, one report suggested that DFNB2 and Usher syndrome patients may share the same mutations in MYO7A‐mutated families.39 Besides, several identical mutations can cause both NSHL and Usher syndrome in different families.12,35,40 Thus, eye disorder should be followed up in this family.In summary, this study describes a novel c.5994G > T missense variant and a synonymous coding base change c.2904G > A variant involving the splicing site in a DFNB2 patient. Minigene splicing assays are crucial in assessing the pathogenicity of synonymous mutations and help us to understand the potential involvement of these mutations in diseases. The findings of this research also broaden our knowledge about the MYO7A variant spectrum in DFNB2 and will assist in the provision of genetic counseling for genetic disorders related to the MYO7A gene.AUTHOR CONTRIBUTIONSY.B. Xiang and X.Q. Xu were in charge of the theme of the study. Y.B. Xiang, L.L. Zhou, and Y.Z. Xu were responsible for the experiments and data collection. S.H. Tang and X.Q. Xu are genetic counselors for HL patients. Experimental design and manuscript drafting were carried out by Y.B. Xiang and C.Y. Xu. All authors reviewed and submitted the final draft.ACKNOWLEDGMENTSWe express our earnest gratitude to all participants for their participation and cooperation in the research process. The study was co‐financed by The Medical and Health of Science and Technology program of Zhejiang Province (2020KY922), The Basic Public Welfare Research Program of Zhejiang Province (LGF21H260005), and The Key Laboratory of Precision Medicine of Wenzhou (2021HZSY0065).CONFLICT OF INTERESTThe authors declare that there exist no competing interests.DATA AVAILABILITY STATEMENTThe data evidence of this research is available from corresponding authors with reasonable request.REFERENCESMathers C, Boerma T, Ma Fat D. The global burden of disease 2004. WHO 2004.Chang KW. Genetics of hearing loss—nonsyndromic. Otolaryngol Clin North Am. 2015;48(6):1063‐1072.Morton CC, Nance WE. Newborn hearing screening—a silent revolution. N Engl J Med. 2006;354:2151‐2164.Likar T, Hasanhodzic M, Teran N, Maver A, Peterlin B, Writzl K. Diagnostic outcomes of exome sequencing in patients with syndromic or non‐syndromic hearing loss. PLoS One. 2018;13(1):e0188578.Ming L, Wang Y, Lu W, Sun T. A mutational analysis of GJB2, SLC26A4, MT‐RNA1, and GJB3 in children with nonsyndromic hearing loss in the Henan Province of China. Genet Test Mol Biomarkers. 2019;23(1):51‐56.Xiang YB, Tang SH, Li HZ, et al. Mutation analysis of common deafness‐causing genes among 506 patients with nonsyndromic hearing loss from Wenzhou city, China. Int J Pediatr Otorhinolaryngol. 2019;122:185‐190.Zou S, Mei X, Yang W, Zhu R, Yang T, Hu H. Whole‐exome sequencing identifies rare pathogenic and candidate variants in sporadic Chinese Han deaf patients. Clin Genet. 2020;97(2):352‐356.Xiang YB, Xu CY, Xu YZ, et al. Next‐generation sequencing identifies rare pathogenic and novel candidate variants in a cohort of Chinese patients with syndromic or nonsyndromic hearing loss. Mol Genet Genomic Med. 2020;8(12):e1539.Chen ZY, Hasson T, Kelley PM, et al. Molecular cloning and domain structure of human myosin‐VIIa, the gene product defective in usher syndrome 1B. Genomics. 1996;36(3):440‐448.Hasson T, Heintzelman MB, Santos‐Sacchi CDP, Mooseker MS. Expression in cochlea and retina of myosin VIIa, the gene product defective in usher syndrome type 1B. Proc Natl Acad Sci. 1995;92(21):9815‐9819.Li L, Yuan H, Wang H, et al. Identification of a MYO7A mutation in a large Chinese DFNA11 family and genotype‐phenotype review for DFNA11. Acta Otolaryngol. 2018;138(5):463‐470.Kabahuma RI, Schubert WD, Labuschagne C, et al. Spectrum of MYO7A mutations in an indigenous south African population further elucidates the nonsyndromic autosomal recessive phenotype of DFNB2 to include both homozygous and compound heterozygous mutations. Genes. 2021;12(2):274.Santana EE, Fuster‐Garcia C, Aller E, et al. Genetic screening of the usher syndrome in Cuba. Acta Otolaryngol. 2019;10:501.Grati M, Kachar B. Myosin VIIa and sans localization at stereocilia upper tip‐link density implicates these usher syndrome proteins in mechanotransduction. Proc Natl Acad Sci. 2011;108(28):11476‐11481.Bahloul A, Michel V, Hardelin JP, et al. Cadherin‐23, myosin VIIa and harmonin, encoded by usher syndrome type I genes, form a ternary complex and interact with membrane phospholipids. Human Mol Genet. 2010;19(18):3557‐3565.Wu L, Pan L, Wei Z, Zhang M. Structure of MyTH4‐FERM domains in myosin VIIa tail bound to cargo. Science. 2011;331(6018):757‐760.Sakai T, Jung HS, Sato O, et al. Structure and regulation of the movement of human myosin VIIA. J Biol Chem. 2015;290(28):17587‐17598.Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405‐424.Oza AM, Distefano MT, Hemphill SE, et al. Expert specification of the ACMG/AMP variant interpretation guidelines for genetic hearing loss. Human Mutat. 2018;39(11):1593‐1613.Yeo G, Burge CB. Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. J Comput. 2004;11(2–3):377‐394.Patel PN, Gorham JM, Ito K, Seidman CE. In vivo and in vitro methods to identify DNA sequence variants that alter RNA splicing. Curr Protoc Hum Genet. 2018;97(1):e60.Sauna ZE, Kimchi‐Sarfaty C. Understanding the contribution of synonymous mutations to human disease. Nat Rev Genet. 2011;12(10):683‐691.Bali V, Bebok Z. Decoding mechanisms by which silent codon changes influence protein biogenesis and function. Int J Biochem Cell Biol. 2015;64:58‐74.Hirsch Y, Tangshewinsirikui C, Booth KT, et al. A synonymous variant in MYO15A enriched in the Ashkenazi Jewish population causes autosomal recessive hearing loss due to abnormal splicing. Eur J Hum Genet. 2021;29(6):988‐997.Aoto Y, Horinouchi T, Yamamura T, et al. Last nucleotide substitutions of COL4A5 exons cause aberrant splicing. Kidney Int Rep. 2022;7(1):108‐116.Kirchner S, Cai Z, Rauscher R, et al. Alteration of protein function by a silent polymorphism linked to tRNA abundance. PLoS Biol. 2017;15(5):e2000779.Li J, He Y, Weck ML, et al. Structure of Myo7b/USH1C complex suggests a general PDZ domain binding mode by MyTH4‐FERM myosins. Proc Natl Acad Sci. 2017;114(19):E3776‐E3785.Yu IM, Planelles‐Herrero VJ. Myosin 7 and its adaptors link cadherins to Actin. Nat Commun. 2017;8:158641.Joo SY, Na G, Kim JA, et al. Clinical heterogeneity associated with MYO7A variants relies on affected domains. Biomedicine. 2022;10(4):798.Galbis‐Martínez L, Blanco‐Kelly F, García‐García G, et al. Genotype‐phenotype correlation in patients with usher syndrome and pathogenic variants in MYO7A: implications for future clinical trials. Acta Ophthalmol. 2021;99(8):922‐930.Liu XZ, Walsh J, Mburu P, et al. Mutations in the myosin VIIA gene cause non‐syndromic recessive deafness. Nat Genet. 1997;16(2):188‐190.Riazuddin S, Nazli S, Ahmed ZM, et al. Mutation spectrum of MYO7A and evaluation of a novel nonsyndromic deafness DFNB2 allele with residual function. Hum Mutat. 2008;29(4):502‐511.Ben‐Salem S, Rehm HL, Willems PJ, et al. Analysis of two Arab families reveals additional support for a DFNB2 nonsyndromic phenotype of MYO7A. Mol Biol Rep. 2014;41(1):193‐200.Brownstein Z, Abu‐Rayyan A, Karfunkel‐Doron D, et al. Novel myosin mutations for hereditary hearing loss revealed by targeted genomic capture and massively parallel sequencing. Eur J Hum Genet. 2014;22(6):768‐775.Bakhchane A, Charif M, Bousfiha A, et al. Novel compound heterozygous MYO7A mutations in Moroccan families with autosomal recessive non‐syndromic hearing loss. PLoS One. 2017;12(5):e0176516.Asgharzade S, Reiisi S, Tabatabaiefar MA, Chaleshtori MH. Screening of MYO7A mutations in Iranian patients with autosomal recessive hearing loss from west of Iran. Iran J Public Heath. 2017;46(1):76‐82.Li Y, Su J, Ding C, Yu F, Zhu B. Identification of four novel mutations in MYO7A gene and their association with nonsyndromic deafness and usher syndrome 1B. Int J Pediatr Otohinolaryngol. 2019;120:166‐172.Doll J, Vona B, Schnapp L, et al. Genetic Spectrum of syndromic and non‐syndromic hearing loss in Pakistani families. Genes (Basel). 2020;11(11):1329.Gao X, Wang GJ, Yuan YY, et al. Novel compound heterozygous mutations in MYO7A associated with usher syndrome 1 in a Chinese family. PLoS One. 2014;9(7):e103415.Ammar‐Khodja F, Faugère V, Baux D, et al. Molecular screening of deafness in Algeria: high genetic heterogeneity involving DFNB1 and the usher loci, DFNB2/USH1B, DFNB12/USH1D and DFNB23/USH1F. Eur J Med Genet. 2009;52(4):174‐179.
Journal of Clinical Laboratory Analysis – Wiley
Published: Nov 1, 2022
Keywords: DFNB2; minigene splicing assay; MYO7A gene; nonsyndromic hearing loss; synonymous variant
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.