The thermo-sensitive gene expression signatures of spermatogenesis

The thermo-sensitive gene expression signatures of spermatogenesis Background: Spermatogenesis in most mammals (including human and rat) occurs at ~ 3 °C lower than body temperature in a scrotum and fails rapidly at 37 °C inside the abdomen. The present study investigates the heat-sensitive transcriptome and miRNAs in the most vulnerable germ cells (spermatocytes and round spermatids) that are primarily targeted at elevated temperature in a bid to identify novel targets for contraception and/or infertility treatment. Methods: Testes of adult male rats subjected to surgical cryptorchidism were obtained at 0, 24, 72 and 120 h post-surgery, followed by isolation of primary spermatocytes and round spermatids and purification to > 90% purity using a combination of trypsin digestion, centrifugal elutriation and density gradient centrifugation techniques. RNA isolated from these cells was sequenced by massive parallel sequencing technique to identify the most-heat sensitive mRNAs and miRNAs. Results: Heat stress altered the expression of a large number of genes by ≥2.0 fold, out of which 594 genes (286↑; 308↓) showed alterations in spermatocytes and 154 genes (105↑;49↓) showed alterations in spermatids throughout the duration of experiment. 62 heat-sensitive genes were common to both cell types. Similarly, 66 and 60 heat-sensitive miRNAs in spermatocytes and spermatids, respectively, were affected by ≥1.5 fold, out of which 6 were common to both the cell types. Conclusion: The study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be tightly regulated by heat sensitive miRNAs rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P. Background electrical devices [2] has limited its wide-scale potential In most mammals, normal spermatogenesis occurs in a clinical application as a method of contraception. scrotum at a temperature lower than body (~ 3 °C), but fails Cryptorchidism (undescended testes) is a condition in rapidlyinsidethe abdomenatbodytemperature.Incon- which the testes fail to descend into the scrotum and re- trast to other developmental and biological processes, main in abdomen due to developmental defects. It is one of which occur normally at body temperature (~ 37 °C), the most common congenital abnormalities observed in 1– spermatogenesis completely ceases at this temperature. The 5% of full-term male births and is a risk factor for infertility scrotum is nature’s uniquely designed organ to maintain [3]. It has been well documented that meiotic (pachytene/ testes at ~ 3 °C lower than the body-temperature. Limited diplotene spermatocytes) and post-meiotic (round sperma- clinical studies have reported that transient testicular heat- tids) are the most heat sensitive germ cell types that ing of adult human males results in reversible spermato- undergo quick apoptosis under heat-stress/cryptorchidism genic arrest, and hence could be used as a method of in men [4] and rats [5, 6]. The higher sensitivity of germ contraception [1]. However, the practical-feasibility of cells to mild heat stress in comparison to the somatic cells physically heating the testis by thermal insulators and/or (e.g. Sertoli and Leydig cells) could apparently be due to their high proliferative activity [7], making it an attractive target for contraceptive intervention. * Correspondence: g_gupta@cdri.res.in † The spermatogenesis is regulated at transcriptional, Santosh K. Yadav and Aastha Pandey contributed equally to this work. Division of Endocrinology, CSIR-Central Drug Research Institute, BS-10/1, post-transcriptional and epigenetic levels by integrated Sector-10, Jankipuram Extension, Sitapur Road, Lucknow 226031, India expressions of an array of testicular genes in a precise Academy of Scientific and Innovative Research (AcSIR), New Delhi 110001, temporal fashion [8, 9]. In recent years, several high India © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 2 of 22 throughput differential gene expression studies on Hematoxylin and eosin (H&E) and TUNEL assay spermatogenesis have been performed in rodents, mostly Testes tissues fixed in 10% buffered formalin were embed- using microarray technology, either in whole testes of ded in paraffin and 5 μ sections were cut using a micro- prepubertal animals [10–12] or elutriation/Staput-en- tome (Leica Biosystems, Nussloch, Germany). Sections riched primary spermatocytes and round spermatids were processed for H&E staining and thereafter analyzed [13–15]. Though microarray technique has been under a light microscope (Nikon) and their images were employed as a potential tool to identify candidate genes captured using NIS elements software, at suitable magnifi- playing important roles in fertility [16, 17], it is limited cation. Tunel assay was performed using paraffin embed- by its application to known transcripts, and does not ded tissue sections by following the instructions provided contemplate testicular peculiarities such as the remark- with Promega Tunel assay kit (cat no. G3250). Briefly, the able number of splice variants that are differentially paraffin embedded tissue sections were deparaffinised, expressed in spermatogenic cells [18, 19]. Recently, rehydrated in a series of ethanol, fixed with 4% parafor- massive parallel sequencing has been applied success- maldehyde, treated with proteinase-K solution followed by fully to undertake gene expression analysis because of its treatment with equilibrating buffer and rTDT incubation better sensitivity and capability to identify and quantify buffer for 1 h. Finally the tissues were washed counter- novel transcribed regions and splice variants [20–22]. stained with DAPI and stored at 4 °C. Thereafter tissue Most recently, da Cruz et al. [23] employed this technol- sections were analysed under flourescence microscope ogy to analyze meiotic and post-meiotic gene expression (Nikon) and the images were captured using NIS elements signatures of mouse transcriptome. However, the software, at suitable magnification. For statistical analysis thermo-sensitive transcriptome of germ cells reflecting of the number of primary spermatocytes and round sper- early degenerative changes in these cells have not been matids present in sham (control), 24, 72 and 120 h of explored. In addition to improving our understanding of cryptorchid testes, the same were counted in three molecular regulation of spermatogenesis, identification different areas of three different sections from each group, of thermo-sensitive genes could be exploited to achieve and the data has been analysed by one-way analysis of contraception by ‘molecular heating’ in testis instead of variance (ANOVA). P values less than 0.05 were consid- actual physical heating. The present study investigates ered as significant. the changes in transcriptome profile of spermatocytes and spermatids from rat testes subjected to surgical Isolation and purification of spermatocytes and round cryptorchidism to identify the most heat-sensitive genes spermatids from rat testis in testes. Primary spermatocytes and round spermatids were iso- lated by trypsin digestion and purified by centrifugal elu- Methods triation and density gradient centrifugation by the Animals method of Meistrich et al. [24]. Briefly, the testes were The Institutional Animal Ethics Committee of CDRI, Luck- decapsulated and minced with scissors in Basal Medium now, approved the study. Adult male Sprague-Dawley (SD) Eagle (BME). Subsequently, the minced suspension was rats, aged 14 to 16 weeks and weighing 220–250 g, main- incubated for 15 min with shaking in a water bath at tained in institute’s air conditioned (24 ± 1 °C) quarters with 34 °C in Basal Medium Eagle (BME) supplemented with constant photoperiod of 12 h light and 12 h dark and free 0.1% trypsin (w/v), 0.1% glucose and 17 μg/ml DNase. access to the standard pellet diet and water ad libitum, were After incubation, the enzyme reaction was stopped by used in these investigations. addition of Soybean trypsin inhibitor (0.04% w/v), and the cell-suspension was filtered through a nylon mesh Surgical cryptorchidism (36 μm) and passed through a column of glass wool to Rats were anesthetized with ketamine (50 mg/kg) and remove sperm. The ensued cell suspension was centri- xylazine (10 mg/kg), and bilateral cryptorchidism was in- fuged at 400 g for 5 min at 4 °C and the cell pellet ob- duced surgically through the abdominal route by an- tained was washed twice with BME. The mixed germ choring both the testes to the inner lateral abdominal cell population was suspended in BME containing wall using a suture passing through the connective tissue DNase (2 μg/ml) and FBS (8% V/V) and kept on ice. of the cauda epididymis. The animals were autopsied 24, Later, the cell suspension was elutriated with a Beckman 72 and 120 h after the surgery and the testes were re- Elutriator Rotor (JE-5) fitted with a standard chamber moved. One testis from each animal of every group was and mounted on a Beckman High Speed Centrifuge fixed in 10% formalin for histological studies while the (Avanti J-26S–XP). Two fractions (I and II) were col- other testis was used for isolation of germ cells. Each lected at 3000 rpm at flow rates of 18.0 and 31.5 ml/ group consisted of 5 animals and sham-operated rats min, and then the rotor speed was reduced to 2000 rpm served as controls. and another two fractions (III and IV) were collected at Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 3 of 22 flow rates of 23.0 and 40.0 ml/min, respectively. Frac- Validation of mRNA expression by real time RT-PCR tions II and IV contained pachytene spermatocytes and Total RNA was isolated using Trizol reagent (Invitrogen round spermatids at purities of ~ 80% and ~ 75%, re- Life Technologies, Carlsbad, CA) and 3 μg of RNA was spectively. The fractions II and IV were layered separ- converted to cDNA using the RevertAid H Minus First ately over linear Percoll gradients of 25–37% and 23– Strand cDNA Synthesis Kit (Fermentas, Waltham, MA) 33% Percoll, respectively, and centrifuged at 4025 g for following the manufacturer’s instructions. Real time PCR 60 min in a swinging bucket rotor fitted on to a Sigma was performed on a Light Cycler 480 (Roche, Basel, 3-30 K refrigerated centrifuge. The major band was re- Switzerland) detection system using SYBR Green I covered through a puncture in the side of the tube, Master mix (Roche, Basel, Switzerland) in 96-well plates. washed and diluted with BME. Further, the purity of iso- All reactions were run in triplicates and relative gene lated cells was checked visually under a microscope and expression was normalized to steady state expression of through DNA quantitation using flow cytometry. GAPDH, calculations made by using the 2-ΔΔCt method. RNA isolation and sequencing Results A Qiagen RNeasy Micro Kit (74,004, Qiagen) was used Histology of control and cryptorchid testes to extract RNA from the sorted cells. The extraction was The H & E stained testes sections of control and crypt- performed according to Quick-Start Protocol suggested orchid rat suggest that at 24 h there was negligible vis- by the manufacturers. miRNA was isolated from the ible change in any stage of spermatogenesis and most of total RNA population by the ligation of a 3’ RNA the stages were present (Fig. 1b), as in control (Fig. 1a). adapter using t4 RNA ligase and ligation buffer. The However, at 72 h there was a marked increase in the in- 3’adapter ligated small RNA was again 5′ ligated with cidence of germ cell apoptosis predominantly at stages 5’RNA adapter and then the corresponding small RNA I–V and the late stages XI–XIV, while stages V-X were was reverse transcribed and amplified to generate cDNA comparatively less affected (Fig. 1c). On the other hand, constructs. These cDNA constructs were purified using at 120 h stages I–VI were badly distorted while stages 6% PAGE and the corresponding small RNA bands were X–XIV were not distinguishable at all. However, stages excised between 140 and 160 bp lengths. The cDNA VII and VIII were visible but cell apoptosis was quite construct from the gel was recovered by filtration and significant (Fig. 1d). There was a significant reduction in subsequently precipitated with ethanol. These were number of spermatocytes at 72 (P < 0.05) and 120 (P < quantified and subjected to sequencing and data ana- 0.01) h of cryptochidism (Fig. 1e). In case of spermatids, lysis. The integrity and quality of the extracted RNAs a significant reduction in their number was evident at 24 were checked by Agilent 2100 bioanalyzer and the quali- (P < 0.05), 72 and 120 (P < 0.001) h (Fig. 1f). fied RNA samples were used for sequencing. A total of 3 pools were prepared for each type of cells to have three Tunnel assay of paraffin embedded testis tissues biological replicates. Dynabeads mRNA DIRECTTM kit Tunnel assay was performed to check whether the loss (610.12, Life Technologies) was used to enrich RNAs of cells in cryptorchid testes was due to heat-induced with polyA tail. mRNA-seq library was prepared using apoptosis (Fig. 2). Results indicated that apoptosis was TruSeq RNA kit (RS-122-2001, Illumina). Sequencing induced in testicular germ cells at body temperature and was performed on Illumina Hiseq 2500 next generation the number of apoptotic cells gradually increased with sequencing platform. Sequencing-v3 (634,848, Clontech the duration of heat exposure (Fig. 2a,d,g,j). Though Laboratories) was used to amplify the cDNA derived very few yet significant number of apoptotic cells were from these cells before sequencing was performed. observed at 24 h (P < 0.05) of heat-stress, the number increased significantly thereafter at 72 h (P < 0.001) Raw data production and preprocessing and 120 h (P < 0.001) (Fig. 2m), which was in agree- TopHat (v2.0.8b, http://tophat.cbcb.umd.edu/) was used ment with H&E data. to map the RNA-seq reads to rat genome build hg19 (UCSC). The reads with low quality were removed from Isolation, purification and characterization of primary the raw sequencing reads. Read mapping were performed spermatocytes and round spermatids using Tophat (R software), reads count were obtained The enzymatic digestion of testicular parenchyma re- using HTSeq (http://www-huber.embl.de/users/anders/ sulted in complete dispersion of testicular cells (Fig. 3a). HTSeq/doc/overview.html). Differentially expressed genes The two cell types i.e. spermatocytes and round sperma- were analysed using DESeq R software pack. tids were isolated up to the purity of ~ 75% and ~ 80%, re- Benjamini-Hochberg multiple testing corrections were spectively, by using centrifugal elutriation method. The employed to reveal the differentially expressed genes. homogeneity of spermatocytes and round spermatids was Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 4 of 22 Fig. 1 Representative picture of testes histology at 0 h [sham, a], 24 h [b], 72 h [c] and 120 h [d] of cryptorchidism (Bar = 10 μm). Average number of spermatocytes (e) and spermatids (f) after 0, 24, 72 and 120 h of cryptorchidism. (Mean ± SE; *P < 0.05; **P < 0.01; ***P < 0.001) further increased to ~ 90 and > 92%, respectively, by Per- transcriptome from spermatocytes of control testis coll density gradient centrifugation method (Fig. 3b and (0-Cr-Sc) was compared with that of 24 h crypt (24-Cr-Sc) c). The purity of the two cell types was confirmed by and 72 h crypt (72-Cr-Sc) testes. Similarly, the transcrip- FACS, which exhibited a single peak in both the cell prep- tome from control spermatids (0-Cr-Sd) was compared arations with negligible number of contaminating cells with 24, 72 and 120 h crypt spermatids (24-Cr-Sd; (Fig. 3d and e). The trypan blue exclusion test showed > 72-Cr-Sd; 120-Cr-Sd). In spermatocytes, the expression of 95% viability of the purified cells in the two fractions (data total 1602 genes was altered (897 up regulated and 705 not shown). down regulated) after 24 h of cryptorchidism, and the ex- pression of 1807 genes was altered (987 up regulated and Transcriptome profiling and differential gene expression 820 down regulated) after 72 h of cryptorchidism. Simi- analysis larly in spermatids, after 24, 72, 120 h of cryptorchidism Total RNA was extracted from highly purified primary altered expression of 1210 (505 up regulated and 705 spermatocytes and round spermatids, isolated from the down regulated), 1718 (990 up regulated and 728 down testicular tissues of all the experimental groups, and sub- regulated) and 3559 (2180 up regulated and 1379 down jected to sequencing using Illumina NextSeq 2500. We regulated) transcripts, respectively, was seen. The genes performed pairwise differential gene expression (DGE) showing change in the expression within 24 h could be comparisons between samples to detect the genes exhibit- categorized as early response genes while those showing ing differences in expression by at least 2-fold. The alteration after 24 h could be termed as mid and late Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 5 of 22 Fig. 2 Apoptosis of germ cells by Tunel Assay in rat testis at 0 h [1a, b, c]; 24 h [1d, e, f]; 72 h [1g, h, i] and 120 h [1 j, k, l] of cryptorchidism. (a, d, g, j – FITC staining for DNA fragmentation; b, e, h, k – DAPI staining of DNA; c, f, i, l – merged images) (Bar = 10 μm). Average number of TUNEL positive cells (M; Mean ± SE; *P < 0.05; ***P < 0.001) response genes. Overall observations clearly indicate that expression profile of temperature-sensitive genes in the the number of genes with altered expression increased two cell types has been prepared (Fig. 5). A number of with an increase in the time period of heat exposure. genes showed more than one transcript variant, which Venn analysis indicated that all through 24–72 h of exhibited different expression patterns in spermatocytes cryptorchidism, a total of 286 genes were up-regulated and spermatids. and 308 genes were down-regulated in spermatocytes. Similarly, in spermatids 105 genes were up-regulated Gene ontology and 49 genes were down-regulated during 24–120 h of With the aim of finding the pathways/biological cryptorchidism. Further, Venn analysis suggested that 62 processes prominently affected by heat stress, gene genes were altered in both the cell types during the en- ontology of 62 crucial genes was performed. The tire period of hyperthermia (Fig. 4). A heat map of the PANTHER online analysis tool indicated that the Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 6 of 22 Fig. 3 Isolation and purification of pachytene spermatocytes and round spermatids from rat testes. a-Mixed population after trypsin digestion; b- purified pachytene spermatocytes (~ 90%), c-purified round spermatids (> 90%), d- cell cycle analysis of spermatocyte fraction and e- cell cycle analysis of spermatid fraction by Flow Cytometry affected transcripts had catalytic (26), binding (21), structural (7), and transporter (6) functions (Table 1). These transcripts were mostly related to cellular (29) and metabolic processes (26), or to biological regula- tion (6), localization (9), reproduction (1), develop- mental process (6), or to cellular component organization and biogenesis (8). A single gene may be involved in more than one process. According to the PANTHER tool, the shortlisted genes encoded pro- teins belonging to the class of nucleic acid binding (9), enzyme modulators (5), hydrolases (8), transfer- ases (5), transcription factors (4), and signaling mole- cules (3). Validation of deep sequencing data by qPCR For validation of deep sequencing data, we selected 15 heat-sensitive genes related to important biological processes i.e. metabolism (Mct1, Mct2, Mct4, Glut3, ++ Ldhc), lipid biogenesis (Acly), ROS and Ca medi- Fig. 4 Venn diagram showing heat-sensitive genes in spermatocytes ated signaling pathway (Daxx, Camk2d), apoptotic and spermatids signaling pathway (p53, Daxx), gene expression Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 7 of 22 Fig. 5 Heat map showing changes in expression of the 62 common hyperthermia-sensitive genes in pachytene spermatocytes (left panel) and round spermatids (right panel) after 24 and 72 h of heat stress regulation (Taf9, Gtf2b, Cnot8), spermatogenesis miRNA profiling of heat stressed spermatocytes and (spata22), redox pathway (Txnrd1) and mitochondria spermatids by deep sequencing related pathway (Mrps14) for validation by RT-PCR. Similar to mRNA sequencing data analysis, we also For all the 15 genes, the qPCR data followed almost performed miRNA sequencing data analysis for sper- the same pattern as depicted by sequencing data for matocytes and round spermatids from normal and both the cell types (Fig. 6). cryptorchid rat testes. A change of ≥1.5 fold in Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 8 of 22 Table 1 Gene ontology of genes affected by heat in both spermatocytes and spermatids Nō.of Name of genes genes Molecular functions Binding (GO:0005488) 21 Taf9, Cast, Apbb1, Crip1, Zfp202, Timp1, Lilrb3l, AC120291 (Mbd3), Sptbn1, Cast, Sept4, AC120291 (Mex3d), Prpf8, Rabgap1l, Gtf2b, Tdrd5, Micu1, Upf1, Prelp, Micu2, Camk2d Catalytic activity (GO:0003824) 26 Cst, Clk3, Hsd11b1, Mink1, Timp1, Abcc12, AC120291 (Atp8b3), Scpep1, Cast, Sept4, Grip1, AC120291 (Mex3d), Acly, Serpinf1, Prpf8, Ptpru, Rabgap1l, Tdrd5, Txnrd1, Upf1, Nt5c3b, ldhc, Mipep, Scamp1, LOC316124, Camk2d Receptor activity (GO:0004872) 2 Lilrb3l, Ptpru Signal transducer activity (GO:0004871) 1 Mink1 Structural molecule activity (GO:0005198) 7 Emp1, Crip1, Mgp, C1qa, Sptbn1, Sept4, Mrps14 Transporter activity (GO:0005215) 6 Abcc12, AC120291 (Atp8b3), Mct4, LOC316124, Mct2,Mct1 Biological process Biological adhesion (GO:0022610) 7 Cfb, Col6a2, Ccdc80, C1qa, Cfb, Rabgap1l, Prelp Biological regulation (GO:0065007) 6 Crip1, Mink1, Timp1, AC120291 (Atp8b3), AC120291 (Mbd3), Serpinf1 Cellular component organization or 8 Col6a2, Crip1, Mink1, AC120291 (Atp8b3), C1qa, AC120291 (Mbd3) biogenesis (GO:0071840) Cellular process (GO:0009987) 29 Emp1, Cfb, Col6a2, Apbb1, Ccdc80, AC120291 (Plk5), Zfp202, Mink1, Timp1, AC120291 (Atp8b3), C1qa, Lilrb3l, AC120291 (Mbd3), Wdr36, Scpep1, Sptbn1, Cfb, Sept4, Grip1, Prpf8, Rabgap1l, Prkar2b, Upf1, Prelp, Mipep, Mct4, Mrps14, Mct2, Camk2d Developmental process (GO:0032502) 6 Crip1, Mink1, C1qa, Sptbn1, Prelp, Camk2d Immune system process (GO:0002376) 9 Cfb, Col6a2, Crip1, Ccdc80, Abcc12, C1qa, Col3a1, Cfb, LOC316124 Localization (GO:0051179) 9 Abcc12, AC120291, Cast, Rabgap1l, Scamp1, Mct4, LOC316124, Mct2, Mct1 Metabolic process (GO:0008152) 26 Taf9, Cast, Apbb1, Crip1, Zfp202, Hsd11b1, Mink1, Timp1, AC120291 (Atp8b3), AC120291 (Mbd3), Wdr36, Scpep1, AC120291 (Mex3d), Acly, Prpf8, Ptpru, Sdhaf3, Gtf2b, Tdrd5, Txnrd1, Upf1, ldhc, Prelp, Mipep, LOC316124, Mrps14 Multicellular organismal process (GO:0032501) 4 Mink1, Col3a1, Grip1, Prelp Reproduction (GO:0000003) 1 Crip1 Response to stimulus (GO:0050896) 8 Taf9, Cfb, Lilrb3, Crip1, Mink1, Timp1, Abcc12, Cfb Cellular Component Cell junction (GO:0030054) 1 Grip1 Cell part (GO:0044464) 15 Emp1, Apbb1, Crip1, Zfp202, Mink1, AC120291 (Atp8b3), AC120291 (Mbd3), Wdr36, Sptbn1, Sept4, Prpf8, Ptpru, Mipep, Mrps14, Camk2d Extracellular matrix (GO:0031012) 4 Col6a2, Timp1, C1qa, Prelp Extracellular region (GO:0005576) 4 Timp1, C1qa, Serpinf1, Prelp Macromolecular complex (GO:0032991) 3 Wdr36, Prpf8, Mrps14 Membrane (GO:0016020) 4 AC120291 (Atp8b3), Grip1, Mct4, Mct1 Organelle (GO:0043226) 9 Apbb1, Zfp202, AC120291 (Atp8b3), AC120291 (Mbd3), AC120291, Sept4, Prpf8, Prelp, Mipep Protein class Calcium-binding protein (PC00060) 3 Mgp, Micu1, Micu2 Cell adhesion molecule (PC00069) 1 C1qa Cell junction protein (PC00070) 1 Grip1 Cytoskeletal protein (PC00085) 5 Emp1, Crip1, Ivns1abp, Sptbn1, Sept4 Defense/immunity protein (PC00090) 1 Lilrb3l Enzyme modulator (PC00095) 5 Cast, Cast (Erc2), Sept4, Serpinf1, Rabgap1l Extracellular matrix protein (PC00102) 3 Mgp, C1qa, Prelp Hydrolase (PC00121) 8 Ivns1abp, AC120291 (Atp8b3), Scpep1, Ptpru, Rabgap1l, Upf1, Nt5c3b, Mipep Ligase (PC00142) 3 AC120291 (Mex3d), Acly, LOC316124 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 9 of 22 Table 1 Gene ontology of genes affected by heat in both spermatocytes and spermatids (Continued) Nō.of Name of genes genes lyase (PC00144) 1 Acly Membrane traffic protein (PC00150) 1 Cast Nucleic acid binding (PC00171) 9 Taf9, Crip1, AC120291 (Mbd3), Wdr36, AC120291 (Mex3d), Prpf8, Tdrd5, Upf1, Mrps14 Oxidoreductase (PC00176) 3 Hsd11b1, Txnrd1, ldhc Signaling molecule (PC00207) 3 Apbb1, Mgp, Lilrb3l Structural protein (PC00211) 1 Mgp Transcription factor (PC00218) 4 Taf9, Crip1, Ivns1abp, Gtf2b Transferase (PC00220) 5 Clk3, Grip1, Acly, Scamp1, Camk2d Transporter (PC00227) 5 Abcc12, AC120291 (Atp8b3), Mct4, Mct2, Mct1 Transfer carrier protein 1 Scamp1 Receptors 2 Ptpru, Prelp Pathways Alzheimer disease-amyloid secretase pathway (P00003) 1 Apbb1 Alzheimer disease-presenilin pathway (P00004) 1 Apbb1 Angiogenesis (P00005) 1 AC120291 (Apc2) Cytoskeletal regulation by Rho GTPase (P00016) 2 Arpc2, Gtf2b General transcription regulation (P00023) 2 Taf9, Gtf2b Inflammation mediated by chemokine and cytokine 3 Col6a2, Arpc2, camk2d signaling pathway (P00031) Integrin signalling pathway (P00034) 3 Col6a2, Arpc2, Col3a1 Parkinson disease (P00049) 1 Sept4 Pyruvate metabolism (P02772) 1 Acly Transcription regulation by bZIP transcription 3 Taf9, Gtf2b, Prkar2b factor (P00055) Wnt signaling pathway (P00057) 1 AC120291 (Apc2) 5HT receptor Mediated signaling 1 Prkar2b Apoptosis signalling pathway 1 daxx b 1 adrenergic signaaling 1 Prkar2b b2 adrenegenic signalling 1 Prkar2b dopamine receptor mediated signaling 1 Prkar2b fas signalling pathway 1 daxx endothilin signalling pathway 1 Prkar2b muscarinie acetylcholine receptor 2 and 4 signalling 1 Prkar2b metabotropic glutamate receptor III pathway 1 Prkar2b metabotropic glutamate receptor II pathway 1 Prkar2b ionotropic glutamate receptor pathway 1 Camk2d GABA b receptor signaling 1 Prkar2b expression of miRNAs under heat stress was consid- expression, respectively. Venn analysis (Fig. 7)indi- ered as significant. In spermatocytes, after 24, 72 cated that 66 miRNAs remained affected throughout and 120 h of cryptorchidism, 175 (93 upregulated 24–120 h of heat stress in spermatocytes, which in- and 82 down regulated), 185 (71 upregulated and cluded 3 novel miRNAs (Table 2). On the other 114 down regulated) and 280 (126 upregulated and hand, in spermatids after 24, 72 and 120 h of crypt- 154 down regulated) miRNAs exhibited altered orchidism, 265 (147 upregulated and 118 down Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 10 of 22 Fig. 6 Validation of deep sequencing data by qPCR. top left - deep sequencing data of spermatocytes; top right - deep sequencing data of round spermatids; bottom left - qPCR data for spermatocytes; bottom right - qPCR data for round spermatids. (Mean ± SE; *P <0.05; **P < 0.01; ***P < 0.001) regulated), 301 (160 upregulated and 141 down common miRNAs in both the cell types is presented regulated), and 328 (162 upregulated and 166 down in Fig. 8. regulated) genes exhibited altered expression, re- spectively. Venn analysis (Fig. 7)showedthat60 Prediction of novel miRNAs miRNAs (including 6 novel) (Table 2) remained sig- Among novel miRNAs, we identified 3 and 6 miRNAs nificantly affected throughout 24–120 h of crypt- that were most heat-sensitive in spermatocytes and orchidism. The heat map of the expression profile of round spermatids, respectively (Table 3). Fig. 7 Venn diagram showing heat-sensitive miRNAs in spermatocytes and round spermatids Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 11 of 22 Table 2 miRNAs with altered expression in spermatocytes and round spermatid under heat stress Major miRNAs altered by heat in spermatocytes Major miRNAs altered by heat in round spermatids bta-miR-339a; bta-miR-339b; bta-miR-423-3p; bta-miR-99a-5p; cfa-miR-101; bta-miR-22-3p; bta-miR-3600; bta-miR-363; cgr-miR-222-3p; cgr-miR-24-5p; cfa-miR-1306; cgr-miR-28-5p; cgr-miR-298-5p; chi-miR-15a-5p; efu-miR-29a; cgr-miR-28-5p; cgr-miR-664-3p; cgr-miR-7b; chi-miR-361-3p; chi-miR-363- efu-miR-34a; efu-miR-381; ggo-miR-146a; ggo-miR-148a; ggo-miR-151a; 3p; efu-miR-30a; ggo-miR-381; hsa-let-7c-5p; efu-miR-34a; efu-miR-7a; efu-miR-7b; ggo-miR-151a; ggo-miR-328; hsa-miR-100-5p; hsa-miR-101-3p; hsa-miR-10a-5p; hsa-miR-1306-5p; ggo-miR-423; hsa-miR-100-5p; hsa-miR-151b; hsa-miR-22-3p; hsa-miR-148a-3p; hsa-miR-22-5p; hsa-miR-3184-3p; hsa-miR-32-3p; hsa-miR-361-3p; hsa-miR-202-5p; hsa-miR-28-5p; hsa-miR-381-3p; hsa-miR-423-3p; hsa-miR-423-5p; hsa-miR-449b-5p; mdo-miR-100-5p; mdo-miR-106-5p; hsa-miR-99a-5p; mdo-miR-15a-5p; mdo-miR-22-3p; mml-miR-32-3p; mml-miR-411-3p; mdo-miR-100-5p; mdo-miR-10b-5p; mdo-miR-199b-2-5p; mmu-let-7i-5p; mml-miR-99b-3p; mmu-miR-129-5p mmu-miR-101c; mmu-miR-146a-5p; mmu-miR-151-5p; mmu-miR-151-5p; mmu-miR-204-3p; mmu-miR-24-2-5p; mmu-miR-28c; mmu-miR-201-5p; mmu-miR-202-5p; mmu-miR-296-5p; mmu-miR-298-5p; mmu-miR-301a-5p; mmu-miR-3074-2-3p; mmu-miR-32-3p; mmu-miR- mmu-miR-300-3p; mmu-miR-3074-5p; mmu-miR-3470b; mmu-miR-501-3p; 7b-5p; mmu-miR-99b-3p; mmu-miR-674-3p; Novel_1015; Novel_3011; Novel_66; oan-miR-1386; mmu-miR-99b-5p; Novel_1113; Novel_1204; Novel_2956; Novel_3356; oar-miR-10a; oar-miR-374b; Novel_4066; Novel_4398; rno-miR-298-3p; oar-miR-99a; ppy-miR-378d; rno-miR-148a-5p; rno-miR-25-5p; rno-miR-301a-5p; rno-miR-32-3p; rno-miR-328a-3p; rno-miR-3586-3p; rno-miR-339-5p; rno-miR-3560; rno-miR-3585-5p; rno-miR-3586-3p; rno-miR-411-3p; rno-miR-466c-5p; rno-miR-483-3p; rno-miR-501-3p; rno-miR-547-3p; rno-miR-423-5p; rno-miR-664-3p; ssc-miR-20a; ssc-miR-411 rno-miR-676; sha-miR-202; ssc-let-7i; ssc-miR-186; ssc-miR-339 Target prediction of heat-sensitive miRNAs in round of gene expression during spermatogenesis under heat spermatids and gene ontology of predicted targets stress could be advantageous in identifying key The heat-sensitive miRNAs, among known miRNAs in rat heat-sensitive genes regulating gamete production for the species, were selected for target prediction. The gene on- development of male contraceptives. While a few studies tologies of predicted targets have been detailed for sper- have investigated the differential gene expression (DGE) matocytes (Table 4) and spermatids (Table 5). in mouse during normal spermatogenesis [20–22], none The crucial thermo-sensitive genes regulated tightly by has tried to study the regulation of transcriptome in the miRNAs have been selected with the help of online vulnerable germ cell types (spermatocytes and spermatids) miRDB tool. The table below lists the most heat sensitive during cryptorchidism. A careful analysis of transcriptome miRNAs and their probable target proteins in temperature data suggested that though there is a general disturbance vulnerable meiotic and post-meiotic germ cells of rat testis in metabolic/biological processes and pathways under heat at 24/72/120 h of heat stress, during which their numbers stress in both spermatocytes and spermatids, the most decrease to significantly low numbers. Capturing molecu- strongly affected genes were related to solute carrier fam- lar changes early in heat exposure could identify the core ily (transporters), energy metabolism, ROS, ribosomal, thermo-regulators, while longer exposure may result in a ring/zinc finger, proteasomal, ubiquitination, HSPs, tran- host of secondary molecular changes, which may not be scription factors, apoptotsis and transmembrane proteins. the key thermo-regulators. However, the expression profile in the two cell popula- tions was distinct for several genes. The site of spermatogenesis i.e. seminiferous tubules is Thermo- Fold change Fold change Predicted Cell Type sensitive in miRNA in target gene one of the most heterogenic niches of the body where miRNAs mRNA targets about 30 types of cells coexist. These cells not only vary in rno-miR-22-3P + 3.4 −13.5 Acly Spermatid their size, morphology, and function, but also in their rno-miR-22-5P + 1.8 −13.5 Acly Spermatid DNA content; e.g. 2C (spermatogonia, Sertoli cells, Leydig rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte cells etc), 4C (G2 phase spermaocytes), and 1C or C (round and elongating spermatids, and spermatozoa). The rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte heterogeneity of testicular cells and the lack of in vitro rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte systems for spermatogenic cell culture [27] are the major rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid hurdles in gene expression studies at different stages of spermatogenesis [23]. To overcome this, enrichment of stage-specific germ-cell populations is mandatory. The Discussion gravimetric decantation in BSA gradients (staput) [28–30] Crytorchidism is a state wherein the loss of germ cells and the centrifugal elutriation [31]are amongst the most takes place by apoptosis leading to infertility, and widely used techniques of germ cell enrichment. Using transient testicular heating has been shown to provide the centrifugal elutriation technique coupled with Percoll® reversible contraception in men [25] and temporary density gradient centrifugation, successful enrichment of sterility in rats [26]. Therefore, determining the dynamics pachytene spermatocytes and round spermatids to purity Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 12 of 22 Fig. 8 Heat map for expression of miRNAs in spermatocytes (left panel) and spermatids (right panel) after 24, 72 and 120 h of heat stress levels of > 90% was achieved. To our understanding, this is We observed altered expression of HSP members the best method of achieving germ cell purification to a belonging to Hspa, Hsp90, Hspe, Hspd and Hspb. Hspe1 is a high level. Nevertheless, less than 10% cross-contamination mitochondrial co-chaperonin, necessary for the folding of would not affect the findings of the study except screening newly imported and stress-denatured mitochondrial proteins out genes with minor differences between the two cell and works in association with Hsp60 (Hspd) in the presence types. of ATP [32]. Hspe1showed>3.0foldup-regulation in heat Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 13 of 22 Table 3 Details of novel miRNAs common in spermatocytes and round spermatids S. no Name Sequence Nucleotide length (bases) Common in spermatids 1 Novel_1204 CAAGAGGTGCATGCTGACAG 20 2 Novel_2956 GATTTAGCTCAGTGGTAGAG 20 3 Novel_3356 GGCTATTCTCGGCTGTCAGC 20 4 Novel_4066 TACCTCACTGTAGTCTAGGG 20 5 Novel_4398 TCCAGGTCCACTCTGCTGAGCACT 24 6 Novel_1113 ATTCTGGCTGTGTCTCTCAGGAGC 24 Common in round spermatocytes 7 Novel_1015 ATGGGCTGTAGAATTTCTCT 20 8 Novel_3011 GCAGTGGAACATGTATTTAA 20 9 Novel_66 AACTGGAGGGCAACATGTATTA 22 stressed round spermatids and its companion protein Hspd1 on spermatogonia, spermatocytes and spermatids, while was up-regulated (3.2 fold) after 120 h of cryptorchidism. MCT2 is reported to be present on the tails of elongated However, in case of pachytene spermatocytes the Hspd1 ex- spermatids and sperm [41]. This indicated that the hibited higher expression after 24 h of cryptorchidism but metabolism of heat stressed germ cells is disturbed which expression of Hspe1 remained unchanged. Thus, it can be may lead to apoptosis of the spermatids and assumed that round spermatids could delay the apoptotic re- spermatocytes. Furthermore, lactate taken up by germ sponse due to heat stress with the help of these HSPs. On cells is metabolized to pyruvate with the resultant increase the other hand, Hspa13 was continuously down-regulated in NADH, which is a substrate for NOX4. Reactive from 24 h of heat stressed in both the cell types and max- Oxygen Species (ROS) produced by NOX4 activity may imum down expression (− 9.9 fold) was observed in sper- act as second messengers in regulating the signal matocytes at 72 h of heat stress. According to Yunoki et al. transduction pathways and gene expression. This indicates [33] Hspa13 is non-inducible to heat stress in human fibro- that besides energy metabolism, lactate also has a blast cells. Hspa13 is over expressed under UVB treatment paracrine role and may also play a decisive role as a and inhibits apoptosis [34] in the presence of alkannin. Thus cell-signalling molecule in the seminiferous tubules after higher under expression of Hspa13 in spermatocytes suggest being secreted by the Sertoli cells [42]. higher susceptibility to apoptosis. When we observed expres- The other targets include ATP-citrate lyase (ACLY), which sion of Hsf2, an important heat stress transcription factor, we is known to be the primary enzyme responsible for the syn- didn’t find any change in round spermatids while a slight thesis of cytosolic acetyl-CoA in many tissues for the synthe- down regulation in spermatocytes was reported. sis of lipids to meet the great demand for membrane It is well known that the more mature germ cells, expansion of rapidly proliferating cells [43]. Inhibition of specifically spermatocytes and spermatids, rely on lactate ATP citrate lyase (ACLY), leads to growth suppression and as their energy source [35, 36], which is provided by the apoptosis in a subset of human cancer cells [44]. In heat Sertoli cells. This lactate is further converted into pyruvate stressed testis, the level of Acly was found to be decreased in with the help of LDHc and is accompanied by the spermatids which could also be a reason for apoptosis of the generation of reduced NAD . LDHc is testis specific germ cells. Acly is target of the miRNAs rno-miR-22-3p and isozyme of LDH expressed in male germ cells [37]. rno-miR-22-5p. Acetyl-CoA is the requisite building block Moreover the fertility of Ldhc null males was severely for the endogenous synthesis of fatty acids, cholesterol, and compromised, which further confirmed the importance of isoprenoids as well as acetylation reactions that modify pro- this isozyme in fertility [38]. Due to this fact, LDHc teins. ACL-generated oxaloacetate is reduced to malate, attracted the attention of researchers as a fertility target which can return to the mitochondria, recycling carbon and for developing contraceptive vaccine [39, 40]. Significant shuttling reducing equivalents into the mitochondria. The changes in the expression levels of LDHc, lactate conversion of cytosolic oxaloacetate to malate is driven by transporters (MCT1, MCT2, MCT4) and GLUT3 genes the high cytosolic NADH/NAD+ ratio present in glycolytic in germ cells was observed under heat stress, which were cells. Malate can enter the mitochondrial matrix and be further validated by real time PCR. The lactate formed in converted there to oxaloacetate to complete the substrate the Sertoli cells is transferred to the germ cells with help cycle. The coupled conversion of NAD+ to NADH provides of monocarboxylate transporters i.e., MCT1, MCT2, a continuing mechanism to preserve the mitochondrial MCT4 which are present on germ cells. MCT1 is present membrane potential (MMP) and sustain a high Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 14 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes No of genes Predicted targets Molecular functions Binding 15 Taf9b, Syt4, Cpeb1, Upf2, Arhgef2, Plch1, Net1, Arid3b, Enc1, Pole4, Impad1, Rfx7, Camk1d, Aph1a, Nfyb Catalytic activity 22 Atp11c, Upf2, Dusp10, Arhgef2, Plch1, Mtor, Net1, Tmtc3, Casp9, Cnot8, Kbtbd8, Pole4, Impad1, Tesk2, Camk1d, Mapk8, Map3k14, Aph1a, Map4k3, Acly, Map3k3, Nfyb Receptor activity 1 Net1 Signal transducer activity 2 Dusp10, Map4k3 Structural molecule activity 1 Enc1 Translation regulator activity 1 Cpeb1 Transporter activity 3 Atp11c, Cacna1a, Slc30a4 Biological processes Biological adhesion 3 Arhgef2, Net1, Net1 Biological regulation 9 Atp11c, Syt4, Cacna1a, Dusp10, Casp9, Slc30a4, Map3k14, Map4k3, Map3k3 Cellular component organization or biogenesis 3 Atp11c, Syt4, Tesk2 Cellular process 28 Atp11c, Syt4, Cpeb1, Cacna1a, Dusp10, Arhgef2, Plch1,Mtor, Net1, Tmtc3, Net1, Cltc, Casp9, Cnot8, Enc1, Slc30a4, Kbtbd8, Smurf1, Impad1, Rfx7, Tesk2, Camk1d, Gphn, Mapk8, Map3k14, Map4k3, Map3k3, Nfyb Developmental process 11 Lmtk2, Arhgef2, Epha4, Net1, Net1, Casp9, Enc1, Tesk2, Map3k14, Map4k3, Map3k3 Immune system process 2 Tesk2, Mapk8 Localization 2 Atp11c, Cltc Metabolic process 23 Taf9b, Atp11c, Cpeb1, Upf2, Dusp10, Plch1, Mtor, Tmtc3, Arid3b, Cnot8, Kbtbd8, Smurf1, Pole4, Impad1, Rfx7, Tesk2, Gphn, Map3k14, Aph1a, Map4k3, Acly, Map3k3, Nfyb Multicellular organismal process 3 Syt4, Net1, Cltc Reproduction 1 Tesk2 Response to stimulus 11 Taf9b, Dusp10, Mtor, Casp9, Slc30a4, Smurf1, Tesk2, Mapk8, Map3k14, Map4k3, Map3k3 Cellular components Cell part 16 Atp11c, Cpeb1, Cltc, Casp9, Cnot8, Enc1, Kbtbd8, Smurf1, Pole4, Impad1, Rfx7, Camk1d, Gphn, Map3k14, Map4k3, Map3k3 Extracellular matrix 1 Net1 Extracellular region 1 Net1 Macromolecular complex 4 Cpeb1, Cltc, Cnot8, Kbtbd8 Membrane 3 Atp11c, Syt4, Cacna1a Organelle 4 Atp11c, Cpeb1, Pole4, Rfx7 Protein classes Calcium binding protein 1 Plch1 Cytoskeletal protein 1 Enc1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 15 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes (Continued) No of genes Predicted targets Enzyme modulator 5 Arhgef2,Plch1,Net1,Casp9,Aph1a Extracellular matrix protein 1 Net1 Hydrolase 4 Atp11c,Plch1,Casp9,Impad1 Ligase 2 Smurf1,Acly Lyase 1 Acly Membrane traffic protein 2 Syt4,Cltc Nucleic acid binding 8 Taf9b,Cpeb1,Upf2,Mtor,Arid3b, Pole4, Rfx7, Nfyb Receptor 1 Net1 Signalling molecule 1 Plch1 Transcription factor 6 Taf9b,Arid3b, Cnot8, Pole4, Rfx7, Nfyb Transferase 6 Mtor, Tmtc3, Tesk2, Camk1d, Mapk8, Acly Transporter 3 Atp11c, Cacna1a, Slc30a4 Pathways 5HT2 type receptor mediated signaling pathway 1 Plch1 Alzheimer disease-amyloid secretase pathway 2 Mapk8, Aph1a Alzheimer disease-presenilin pathway 1 Aph1a Angiogenesis 2 Casp9, Mapk8 Apoptosis signaling pathway 4 Casp9, Mapk8, Map3k14, Map4k3 Axon guidance mediated by Slit/Robo 1 Net1 Axon guidance mediated by netrin 1 Net1 B cell activation 2 Mapk8, Map3k3 CCKR signaling map 2 Mapk8, Map3k14 EGF receptor signaling pathway 2 Mapk8, Map3k3 Endogenous cannabinoid signaling 1 Cacna1a FAS signaling pathway 2 Casp9, Mapk8 FGF signaling pathway 2 Mapk8, Map3k3 GABA-B receptor II signaling 1 Cacna1a General transcription regulation Gonadotropin-releasing hormone receptor pathway 6 Syt4, Mapk8, Map3k3, Map3k14, Map4k3, Nfyb Heterotrimeric G-protein signaling pathway-Gi alpha and Gs 1 Cltc alpha mediated pathway Heterotrimeric G-protein signaling pathway-Gq alpha and 2 Cacna1a, Cltc Go alpha mediated pathway Histamine H1 receptor mediated signaling pathway 1 Plch1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 16 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes (Continued) No of genes Predicted targets Hypoxia response via HIF activation 1 Mtor Inflammation mediated by chemokine and cytokine signaling pathway 1 Plch1 Integrin signalling pathway 2 Mapk8, Map3k3 Interferon-gamma signaling pathway 1 Mapk8 Interleukin signaling pathway 1 Mtor Ionotropic glutamate receptor pathway 1 Cacna1a Metabotropic glutamate receptor group II pathway 1 Cacna1a Metabotropic glutamate receptor group III pathway 1 Cacna1a Notch signaling pathway 1 Aph1a Oxidative stress response 2 Dusp10, Mapk8 Oxytocin receptor mediated signaling pathway 1 Plch1 PDGF signaling pathway 2 Mtor, Mapk8 PI3 kinase pathway 1 Casp9 Parkinson disease 1 Mapk8 Pyruvate metabolism 1 Acly Ras Pathway 1 Mapk8 T cell activation 1 Mapk8 TGF-beta signaling pathway 2 Smurf1, Mapk8 Thyrotropin-releasing hormone receptor signaling pathway 2 Cacna1a Plch1 Toll receptor signaling pathway 1 Mapk8 Transcription regulation by bZIP transcription factor 1 Taf9b Ubiquitin proteasome pathway 1 Smurf1 VEGF signaling pathway 1 Casp9 p38 MAPK pathway 1 Dusp10 p53 pathway by glucose deprivation 1 Mtor Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 17 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids No. of Name of genes gene Molecular functions Binding 7 Pak7, Arhgef2, Cast, Tp63, Cast, Dazl, Wnt5b Catalytic activity 18 Grip1, Ddx4, Mapk8, Rictor, Pak7, Arhgef2, Ddx6, Cast, Txnrd1, Mapk6, Cnot7, Dhx57, Arhgap1, Cybrd1, Map2k1, RragB, Cdk14 Gsk3a Receptor activity 1 Calcr Structural molecule activity 1 Slc25a43 Translation regulator activity Eif4e2,Eif4g2 Transporter activity 17 Slc6a6, Slc38a11, Cacna1d, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Slc30a7, Slc5a9, Slc35a2, Slc44a1, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc20a2, Slc1a3 Biological functions Biological adhesion 1 Arhgef2 Biological regulation 13 Ddx4, Rictor, Pak7, Cacna1d, Ddx6, Tp63, Slc30a7, Cnot7, Wnt5b, Arhgap1, Map2k1, Slc4a10, RragB Cellular component organisation or biogenesis 3 Rictor, Pak7, Ddx6 Cellular process 36 Calcr, Slc6a6, Slc25a43, Grip1, Slc38a11, Ddx4, Slc12a6, Mapk8, Rictor, Pak7, Cacna1d, Slc38a2, Slc6a8, Arhgef2, Slc13a5, Ddx6, Slc16a7, Tp63, Slc8a3, Mapk6, Slc30a7, Slc5a9, Cnot7, Prkar2b, Dhx57, Wnt5b, Slc17a5, Arhgap1, Slc6a1, Map2k1 Slc4a10, RragB, Slc20a2, Cdk14, Slc1a3, Gsk3a Developmental process Calcr,Pak7, Notch4, Arhgef2, Tp63, Wnt5b Map2k1, Cdk14, Gsk3a,Eif4g2 Immune system process 2 Mapk8, Mapk6 Localization 17 Calcr, Slc6a6, Slc38a11, Pak7, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Cast, Slc5a9, Slc35a2, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc20a2, Slc1a3 Locomotion 1 Pak7 Metabolic process 15 Slc25a43, Ddx4, Ddx6, Cast, Tp63, Txnrd1, Slc35a2, Cnot7, Dhx57, Arhgap1, Slc23a2, RragB, Cdk14, Slc1a3, Gsk3a Multicellular organismal process 8 Calcr, Grip1, Slc12a6, Wnt5b, Slc6a1, Cdk14, Slc1a3, Gsk3a Reproduction 2 Calcr, Dazl Response to stimulus 10 Calcr, Mapk8, Rictor, Pak7, Tp63, Mapk6, Slc30a7, Wnt5b, Map2k1, RragB Cellular components cell junction 1 Grip1 cell part 23 Slc6a6, Grip1, Ddx4, Rictor, Pak7, Cacna1d, Slc38a2,Slc6a8, Slc13a5, Ddx6,Slc16a7,Tp63, Slc30a7, Slc5a9, Cnot7, Dhx, Arhgap1,Slc6a1, Cybrd1, Map2k1,Slc4a10,RragB,Slc20a2 extracellular region 1 Wnt5b macromolecular complex 6 Ddx4, Rictor, Ddx6, Tp63, Cnot7, RragB membrane transporter 12 Slc6a6, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Slc5a9, Slc17a5, Slc6a1, Cybrd1, Slc4a10, RragB, Slc20a2 Organelle 9 Ddx4, Slc38a2, Ddx6, Tp63, Slc30a7, Cnot7, Dhx57, Cybrd1, RragB Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 18 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene Protein classes calcium-binding protein 1 Slc25a43 cell junction protein 1 Grip1 defense/immunity protein 1 Calcr enzyme modulator 4 Arhgef2, Cast,Arhgap1,RragB membrane traffic protein 1 Cast nucleic acid binding 7 Slc25a43, Ddx4, Ddx6, Eif4e2, Dazl, Dhx57, Eif4g2 Oxidoreductase 2 Txnrd1, Cybrd1 receptor 1 Calcr signaling molecule 1 Wnt5b transcription factor 2 Tp63, Cnot7 transfer/carrier protein 1 Slc25a43 transferase 5 Grip1, Mapk8, Mapk6, Cdk14, Gsk3a transporter 17 Slc6a6, Slc25a43, Slc38a11, Cacna1d,Slc38a2 Slc6a8, Slc13a5,Slc16a7, Slc30a7, Slc5a9, Slc35a2, Slc44a1, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc1a3 Pathways 5HT1 type receptor mediated signaling pathway 1 Prkar2b 5HT2 type receptor mediated signaling pathway 1 Cacna1d Alzheimer disease-amyloid secretase pathway 3 Mapk8, Cacna1d, Mapk6 Alzheimer disease-presenilin pathway 2 Notch4, Wnt5b Angiogenesis 6 Mapk8, Notch4, Mapk6, Wnt5b, Arhgap1,Map2k1 Angiotensin II-stimulated signaling through G proteins and beta-arrestin 1 Map2k1 Apoptosis signaling pathway 1 Mapk8 B cell activation 2 Mapk8, Map2k1 Beta1 adrenergic receptor signaling pathway 2 Cacna1d, Prkar2b Beta2 adrenergic receptor signaling pathway 2 Cacna1d, Prkar2b CCKR signaling map 2 Mapk8, Map2k1 Cadherin signaling pathway 1 Wnt5b Cytoskeletal regulation by Rho GTPase 2 Pak7, Arhgap1 Dopamine receptor mediated signaling pathway 1 Prkar2b EGF receptor signaling pathway 2 Mapk8, Map2k1 Endothelin signaling pathway 2 Prkar2b, Map2k1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 19 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene Enkephalin release 1 Prkar2b FAS signaling pathway 1 Mapk8 FGF signaling pathway 2 Mapk8,Map2k1 GABA-B receptor II signaling 1 Prkar2b Gonadotropin-releasing hormone receptor pathway 4 Mapk8,Cacna1d, Map3k7,Map2k1 Hedgehog signaling pathway 1 Prkar2b Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated 2 Prkar2b, Gsk3a pathway Histamine H2 receptor mediated signaling pathway 1 Prkar2b Huntington disease 1 Tp63 Inflammation mediated by chemokine and cytokine signaling pathway 2 Pak7, Map3k7 Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade 1 Map2k1 Ionotropic glutamate receptor pathway 1 Slc1a3 Insulin/IGF pathway-protein kinase B signaling cascade 1 Gsk3a Integrin signalling pathway 3 Mapk8, Mapk6, Map2k1 Interferon-gamma signaling Pathway 1 Mapk8 Interleukin signaling pathway 2 Map3k7, Mapk6 Muscarinic acetylcholine receptor 2 and 4 signaling pathway 2 Slc6a8, Prkar2b Metabotropic glutamate receptor group III pathway 2 Prkar2b, Slc1a3 Metabotropic glutamate receptor group II pathway 1 Prkar2b Nicotinic acetylcholine receptor signaling pathway 2 Cacna1d, Slc6a8 Notch signaling pathway 2 Notch4, Gsk3a Oxidative stress response 1 Mapk8 Oxytocin receptor mediated signaling pathway 1 Cacna1d P53 pathway feedback loops 1 1 Tp63 PDGF signaling pathway 4 Mapk8, Mapk6,Arhgap1,Map2k1 Parkinson disease 1 Mapk8 Ras Pathway 3 Mapk8,Map2k1,Gsk3a T cell activation 2 Mapk8,Map2k1 TGF-beta signaling pathway 2 Mapk8, Map3k7 Toll receptor signaling pathway 3 Mapk8, Map3k7, Map2k1 Transcription regulation by bZIP transcription factor 1 Prkar2b Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 20 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene VEGF signaling pathway Mapk6, Arhgap1, Map2k1 Wnt signaling pathway Map3k7,Wnt5b p38 MAPK pathway Map3k7 p53 pathway by glucose deprivation Tp63 p53 pathway feedback loops 2 Tp63 p53 pathway Tp63 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 21 of 22 mitochondrial NADH/NAD+ ratio that maintains the TCA Received: 23 January 2018 Accepted: 22 May 2018 cycle in a repressed state. Thus, ACL enzymatic activity is poised to affect both glucose-dependent lipogenesis and cellular bioenergetics [45]. References 1. Mieusset R, Bujan L. The potential of mild testicular heating as a safe, effective and reversible contraceptive method for men. Int J Androl. 1994; Conclusions 17(4):186–91. 2. Fahim MS, Fahim Z, Der R, Hall DG, Harman J. Heat in male contraception In conclusion, transcriptome analysis on the most heat (hot water 60 °C, infrared, microwave, and ultrasound). Contraception. 1975; sensitive germ cells in the testis identified a large number of 11(5):549–62. genes that were altered by ≥2.0 fold, out of which 594 genes 3. Toppari J, Larsen JC, Christiansen P, Giwercman A, Grandjean P, Guillette LJ, Jégou B, Jensen TK, Jouannet P, Keiding N, Leffers H, McLachlan JA, Meyer (286↑; 308↓) showed alterations in spermatocytes and 154 O, Müller J, Rajpert-De Meyts E, Scheike T, Sharpe R, Sumpter J, Skakkebaek genes (105↑;49↓) showed alterations in spermatids NE. Male reproductive health and environmental xenoestrogens. Environ throughout the duration of experiment. 62 heat-sensitive Health Perspect. 1996;104:741–803. genes were common to both cell types. Similarly, 66 and 60 4. Carlsen E, Andersson AM, Petersen JH, Skakkebaek NE. History of febrile illness and variation in semen quality. Hum Reprod. 2003;18:2089–92. heat-sensitive miRNAs in spermatocytes and spermatids, re- 5. Chowdhury AK, Steinberger E. Early changes in the germinal epithelium of spectively, were affected by ≥1.5 fold, out of which 6 were rat testes following exposure to heat. J Reprod Fertil. 1970;22:205–12. common to both the cell types. Among various pathways af- 6. Lue YH, Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, Wang C. Single exposure to heat induces stage-specific germ cell apoptosis in rats: fected significantly by heat stress, the study has identified role of intratesticular testosterone on stage specificity. Endocrinology. 1999; Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as poten- 140:1709–17. tial heat sensitive targets in germ cells, which may be under 7. Shiraishi K, Matsuyama H, Takihara H. Pathophysiology of varicocele in male infertility in the era of assisted reproductive technology. Int J Urol. 2012;19: tight regulation of heat sensitive miRNAs, rno-miR-22-3P, 538–50. rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno- 8. Steger K. Haploid spermatids exhibit translationally repressed mRNAs. Anat miR-3560 and rno-miR-466c-5P, as predicted by miRDB Embryol (Berl). 2001;203(5):323–34. 9. Eddy EM. Male germ cell gene expression. Recent Prog Horm Res. 2002;57: tool. The regulatory targets of these miRNAs, particularly 103–28. their effect on the top genes altered by heat stress, remain 10. Iguchi N, Tobias JW, Hecht NB. Expression profiling reveals meiotic male to be worked out. This study has not only advanced our un- germ cell mRNAs that are translationally up- and down-regulated. Proc Natl Acad Sci. 2006;103:7712–7. derstanding of molecular cues in spermatogenesis but also 11. Xiao P, Tang A, Yu Z, Gui Y, Cai Z. Gene expression profile of 2058 identified the potential targets for fertility regulation. spermatogenesis-related genes in mice. Biol Pharm Bull. 2008;31:201–6. 12. Waldman Ben-Asher H, Shahar I, Yitzchak A, Mehr R, Don J. Expression and Acknowledgments chromosomal organization of mouse meiotic genes. Mol Reprod Dev. 2010; The authors gratefully acknowledge the grant of research fellowships by the 77:241–8. Council of Scientific and Industrial Research, New Delhi, India (SKY and RV), 13. Yu Z, Guo R, Ge Y, Ma J, Guan J, Li S, Sun X, Xue S, Han D. Gene expression the Indian Council of Medical Research New Delhi, India (AP) and the profiles in different stages of mouse spermatogenic cells. Biol Reprod. 2003; Department of Biotechnology New Delhi, India (AD). Thanks are due to the 69:37–47. SAIF division for their help in obtaining FACS data. 14. Geisinger A, Rodríguez-Casuriaga R. Flow cytometry for gene expression studies in mammalian spermatogenesis. Cytogenet Genome Res. 2010;128:46–56. Funding 15. Johnston DS, Wright WW, Dicandeloro P, Wilson E, Kopf GS, Jelinsky SA. Stage- This study was supported by the CSIR-network project BSC0101. specific gene expression is a fundamental characteristic of rat spermatogenic cells and Sertoli cells. Proc Natl Acad Sci. 2008;10524:8315–20. 16. Schultz N, Hamra FK, Garbers DL. A multitude of genes expressed solely in Availability of data and materials meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive The datasets supporting the conclusions of this article are included within targets. Proc Natl Acad Sci. 2003;100:12201–6. the article and its files. 17. Schlecht U, Demougin P, Koch R, Hermida L, Wiederkehr C, Descombes P, Pineau C, Jégou B, Primig M. Expression profiling of mammalian male Authors’ contributions meiosis and gametogenesis identifies novel candidate genes for roles in the SKY, AP, LK, AD, BK and RV performed the animal surgeries, cell purification, regulation of fertility. Molec Biol Cell. 2004;15:1031–43. histology and FACS, gene-expression analysis and all other bench experiments, 18. Xu Q, Modrek B, Lee C. Genome-wide detection of tissue-specific alternative analysed the data and drafted the manuscript. GG, JPM and SR supervised the splicing in the human transcriptome. Nucleic Acids Res. 2002;30:3754–66. experiments, data analysis and bioinformatics. GG and SR conceived the study, 19. Huang X, Li J, Lu L, Xu M, Xiao J, Yin L, Zhu H, Zhou Z, Sha J. Novel designed the experiments and finalized the manuscript. All authors read, edited development-related alternative splices in human testis identified by cDNA and approved the final manuscript. microarrays. J Androl. 2005;26:189–96. 20. Laiho A, Kotaja N, Gyenesei A, Sironen A. Transcriptome profiling of the Ethics approval murine testis during the first wave of spermatogenesis. PLoS One. 2013;8: All animal experiments were approved by the Institutional Animal Ethics e61558. Committee (IAEC) of CSIR-CDRI, Lucknow. 21. Soumillon M, Necsulea A, Weier M, Brawand D, Zhang X, Gu H, Barthès P, Kokkinaki M, Nef S, Gnirke A, Dym M, de Massy B, Mikkelsen TS, Kaessmann Competing interests H. Cellular source and mechanisms of high transcriptome complexity in the The authors declare that they have no competing interests. mammalian testis. Cell Rep. 2013;3:2179–90. 22. Margolin G, Khil PP, Kim J, Bellani MA, Camerini-Otero RD. Integrated transcriptome analysis of mouse spermatogenesis. BMC Genomics. 2014;15:39. Publisher’sNote 23. da Cruz I, Rodríguez-Casuriaga R, Santiñaque FF, Farías J, Curti G, Capoano Springer Nature remains neutral with regard to jurisdictional claims in CA, Folle GA, Benavente R, Sotelo-Silveira JR, Geisinger A. Transcriptome published maps and institutional affiliations. analysis of highly purified mouse spermatogenic cell populations: gene Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 22 of 22 expression signatures switch from meiotic-to postmeiotic-related processes at pachytene stage. BMC Genomics. 2016;17:294. 24. Meistrich ML, Longtin J, Brock WA, Grimes SR, Macc ML. Purification of rat spermatogenic cells and preliminary biochemical analysis of these cells. Biol Reprod. 1981;25:1065–77. 25. Vogeli M. Contraception through temporary male sterilization. Lancet. 1956; http://www.puzzlepiece.org/bcontrol/voegeli1956.txt. 26. Lue YH, Sinha Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, Wang C. Single exposure to heat induces stage-specific germ cell apoptosis in rats: role of intratesticular testosterone on stage specificity. Endocrinology. 1999 Apr 1;140(4):1709–17. 27. Reuter K, Schlatt S, Ehmcke J, Wistuba J. Fact or fiction: in vitro spermatogenesis. Spermatogenesis. 2012;2:245–52. 28. Lam DMK, Furrer R, Bruce WR. The separation, physical characterization, and differentiation kinetics of spermatogonial cells of the mouse. Proc Natl Acad Sci. 1970;65:192–9. 29. Go VLW, Vernon RG, Fritz IB. Studies on spermatogenesis in rats. I. Application of the sedimentation velocity technique to an investigation of spermatogenesis. Can J Biochem. 1971;49:753–60. 30. Romrell LJ, Bellvé AR, Fawcet DW. Separation of mouse spermatogenic cells by sedimentation velocity. Dev Biol. 1976;19:119–31. 31. Meistrich ML. Separation of spermatogenic cells and nuclei from rodent testes. Methods Cell Biol. 1977;15:15–54. 32. Levy-Rimler G, Viitanen P, Weiss C, Sharkia R, Greenberg A, Niv A, Lustig A, Delarea Y, Azem A. The effect of nucleotides and mitochondrial chaperonin 10 on the structure and chaperone activity of mitochondrial chaperonin 60. Eur J Biochem. 2001;268:3465–72. 33. Yunoki T, Kariya A, Kondo T, Hayashi A, Tabuchi Y. Gene expression analysis of heat shock protein a family members responsive to hyperthermic treatments in normal human fibroblastic cells. Therm Med. 2012;28:73–85. 34. Yoshihisa Y, Hassan MA, Furusawa Y, Tabuchi Y, Kondo T, Shimizu T. Alkannin, HSP70 inducer, protects against UVB-induced apoptosis in human keratinocytes. PLoS One. 2012;7(10):e47903. 35. Boussouar F, Benahmed M. Lactate and energy metabolism in male germ cells. Trends Endocrinol Metab. 2004;15:345–50. 36. Mita M, Hall PF. Metabolism of round spermatids from rats: lactate as the preferred substrate. Biol Reprod. 1982;26:445–55. 37. Goldberg E, Eddy EM, Duan C, Odet F. LDHc the ultimate testis specific gene. J Androl. 2010;31(1):86–94. 38. Odet F, Duan C, Willis WD, Goulding EH, Kung A, Eddy EM, Goldberg E. Expression of the gene for mouse lactate dehydrogenase C (Ldhc) is required for male fertility. Biol Reprod. 2008;79(1):26–34. 39. Millan JL, Driscoll CE, LeVan KM, Goldberg E. Epitopes of human testis- specific lactate dehydrogenase deduced from a cDNA sequence. Proc Natl Acad Sci. 1987;84:5311–5. 40. Murdoch FE, Goldberg E. Male contraception: another holy grail. Bioorg Med Chem Lett. 2014;24(2):419–24. 41. Kishimoto A, Ishiguro-Oonuma T, Takahashi R, Maekawa M, Toshimori K, Watanabe M, Iwanaga T. Immunohistochemical localization of GLUT3, MCT1, and MCT2 in the testes of mice and rats: the use of different energy sources in spermatogenesis. Biomed Res. 2015;36(4):225–34. 42. Galardo MN, Regueira M, Riera MF, Pellizzari EH, Cigorraga SB, Meroni SB. Lactate regulates rat male germ cell function through reactive oxygen species. PLoS One. 2014;9(1):e88024. 43. Lin R, Tao R, Gao X, Li T, Zhou X, Guan KL, Xiong Y, Lei QY. Acetylation stabilizes ATP-citrate lyase to promote lipid biosynthesis and tumor growth. Mol Cell. 2013;51(4):506–18. 44. Migita T, Okabe S, Ikeda K, Igarashi S, Sugawara S, Tomida A, Taguchi R, Soga T, Seimiya H. Inhibition of ATP citrate lyase induces an anticancer effect via reactive oxygen species: AMPK as a predictive biomarker for therapeutic impact. Am J Pathol. 2013;182(5):1800–10. 45. Hatzivassiliou G, Zhao F, Bauer DE, Andreadis C, Shaw AN, Dhanak D, Hingorani SR, Tuveson DA, Thompson CB. ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell. 2005;8(4):311–21. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Reproductive Biology and Endocrinology Springer Journals

Loading next page...
 
/lp/springer_journal/the-thermo-sensitive-gene-expression-signatures-of-spermatogenesis-1FukiDIqiM
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s).
Subject
Medicine & Public Health; Reproductive Medicine; Endocrinology
eISSN
1477-7827
D.O.I.
10.1186/s12958-018-0372-8
Publisher site
See Article on Publisher Site

Abstract

Background: Spermatogenesis in most mammals (including human and rat) occurs at ~ 3 °C lower than body temperature in a scrotum and fails rapidly at 37 °C inside the abdomen. The present study investigates the heat-sensitive transcriptome and miRNAs in the most vulnerable germ cells (spermatocytes and round spermatids) that are primarily targeted at elevated temperature in a bid to identify novel targets for contraception and/or infertility treatment. Methods: Testes of adult male rats subjected to surgical cryptorchidism were obtained at 0, 24, 72 and 120 h post-surgery, followed by isolation of primary spermatocytes and round spermatids and purification to > 90% purity using a combination of trypsin digestion, centrifugal elutriation and density gradient centrifugation techniques. RNA isolated from these cells was sequenced by massive parallel sequencing technique to identify the most-heat sensitive mRNAs and miRNAs. Results: Heat stress altered the expression of a large number of genes by ≥2.0 fold, out of which 594 genes (286↑; 308↓) showed alterations in spermatocytes and 154 genes (105↑;49↓) showed alterations in spermatids throughout the duration of experiment. 62 heat-sensitive genes were common to both cell types. Similarly, 66 and 60 heat-sensitive miRNAs in spermatocytes and spermatids, respectively, were affected by ≥1.5 fold, out of which 6 were common to both the cell types. Conclusion: The study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be tightly regulated by heat sensitive miRNAs rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P. Background electrical devices [2] has limited its wide-scale potential In most mammals, normal spermatogenesis occurs in a clinical application as a method of contraception. scrotum at a temperature lower than body (~ 3 °C), but fails Cryptorchidism (undescended testes) is a condition in rapidlyinsidethe abdomenatbodytemperature.Incon- which the testes fail to descend into the scrotum and re- trast to other developmental and biological processes, main in abdomen due to developmental defects. It is one of which occur normally at body temperature (~ 37 °C), the most common congenital abnormalities observed in 1– spermatogenesis completely ceases at this temperature. The 5% of full-term male births and is a risk factor for infertility scrotum is nature’s uniquely designed organ to maintain [3]. It has been well documented that meiotic (pachytene/ testes at ~ 3 °C lower than the body-temperature. Limited diplotene spermatocytes) and post-meiotic (round sperma- clinical studies have reported that transient testicular heat- tids) are the most heat sensitive germ cell types that ing of adult human males results in reversible spermato- undergo quick apoptosis under heat-stress/cryptorchidism genic arrest, and hence could be used as a method of in men [4] and rats [5, 6]. The higher sensitivity of germ contraception [1]. However, the practical-feasibility of cells to mild heat stress in comparison to the somatic cells physically heating the testis by thermal insulators and/or (e.g. Sertoli and Leydig cells) could apparently be due to their high proliferative activity [7], making it an attractive target for contraceptive intervention. * Correspondence: g_gupta@cdri.res.in † The spermatogenesis is regulated at transcriptional, Santosh K. Yadav and Aastha Pandey contributed equally to this work. Division of Endocrinology, CSIR-Central Drug Research Institute, BS-10/1, post-transcriptional and epigenetic levels by integrated Sector-10, Jankipuram Extension, Sitapur Road, Lucknow 226031, India expressions of an array of testicular genes in a precise Academy of Scientific and Innovative Research (AcSIR), New Delhi 110001, temporal fashion [8, 9]. In recent years, several high India © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 2 of 22 throughput differential gene expression studies on Hematoxylin and eosin (H&E) and TUNEL assay spermatogenesis have been performed in rodents, mostly Testes tissues fixed in 10% buffered formalin were embed- using microarray technology, either in whole testes of ded in paraffin and 5 μ sections were cut using a micro- prepubertal animals [10–12] or elutriation/Staput-en- tome (Leica Biosystems, Nussloch, Germany). Sections riched primary spermatocytes and round spermatids were processed for H&E staining and thereafter analyzed [13–15]. Though microarray technique has been under a light microscope (Nikon) and their images were employed as a potential tool to identify candidate genes captured using NIS elements software, at suitable magnifi- playing important roles in fertility [16, 17], it is limited cation. Tunel assay was performed using paraffin embed- by its application to known transcripts, and does not ded tissue sections by following the instructions provided contemplate testicular peculiarities such as the remark- with Promega Tunel assay kit (cat no. G3250). Briefly, the able number of splice variants that are differentially paraffin embedded tissue sections were deparaffinised, expressed in spermatogenic cells [18, 19]. Recently, rehydrated in a series of ethanol, fixed with 4% parafor- massive parallel sequencing has been applied success- maldehyde, treated with proteinase-K solution followed by fully to undertake gene expression analysis because of its treatment with equilibrating buffer and rTDT incubation better sensitivity and capability to identify and quantify buffer for 1 h. Finally the tissues were washed counter- novel transcribed regions and splice variants [20–22]. stained with DAPI and stored at 4 °C. Thereafter tissue Most recently, da Cruz et al. [23] employed this technol- sections were analysed under flourescence microscope ogy to analyze meiotic and post-meiotic gene expression (Nikon) and the images were captured using NIS elements signatures of mouse transcriptome. However, the software, at suitable magnification. For statistical analysis thermo-sensitive transcriptome of germ cells reflecting of the number of primary spermatocytes and round sper- early degenerative changes in these cells have not been matids present in sham (control), 24, 72 and 120 h of explored. In addition to improving our understanding of cryptorchid testes, the same were counted in three molecular regulation of spermatogenesis, identification different areas of three different sections from each group, of thermo-sensitive genes could be exploited to achieve and the data has been analysed by one-way analysis of contraception by ‘molecular heating’ in testis instead of variance (ANOVA). P values less than 0.05 were consid- actual physical heating. The present study investigates ered as significant. the changes in transcriptome profile of spermatocytes and spermatids from rat testes subjected to surgical Isolation and purification of spermatocytes and round cryptorchidism to identify the most heat-sensitive genes spermatids from rat testis in testes. Primary spermatocytes and round spermatids were iso- lated by trypsin digestion and purified by centrifugal elu- Methods triation and density gradient centrifugation by the Animals method of Meistrich et al. [24]. Briefly, the testes were The Institutional Animal Ethics Committee of CDRI, Luck- decapsulated and minced with scissors in Basal Medium now, approved the study. Adult male Sprague-Dawley (SD) Eagle (BME). Subsequently, the minced suspension was rats, aged 14 to 16 weeks and weighing 220–250 g, main- incubated for 15 min with shaking in a water bath at tained in institute’s air conditioned (24 ± 1 °C) quarters with 34 °C in Basal Medium Eagle (BME) supplemented with constant photoperiod of 12 h light and 12 h dark and free 0.1% trypsin (w/v), 0.1% glucose and 17 μg/ml DNase. access to the standard pellet diet and water ad libitum, were After incubation, the enzyme reaction was stopped by used in these investigations. addition of Soybean trypsin inhibitor (0.04% w/v), and the cell-suspension was filtered through a nylon mesh Surgical cryptorchidism (36 μm) and passed through a column of glass wool to Rats were anesthetized with ketamine (50 mg/kg) and remove sperm. The ensued cell suspension was centri- xylazine (10 mg/kg), and bilateral cryptorchidism was in- fuged at 400 g for 5 min at 4 °C and the cell pellet ob- duced surgically through the abdominal route by an- tained was washed twice with BME. The mixed germ choring both the testes to the inner lateral abdominal cell population was suspended in BME containing wall using a suture passing through the connective tissue DNase (2 μg/ml) and FBS (8% V/V) and kept on ice. of the cauda epididymis. The animals were autopsied 24, Later, the cell suspension was elutriated with a Beckman 72 and 120 h after the surgery and the testes were re- Elutriator Rotor (JE-5) fitted with a standard chamber moved. One testis from each animal of every group was and mounted on a Beckman High Speed Centrifuge fixed in 10% formalin for histological studies while the (Avanti J-26S–XP). Two fractions (I and II) were col- other testis was used for isolation of germ cells. Each lected at 3000 rpm at flow rates of 18.0 and 31.5 ml/ group consisted of 5 animals and sham-operated rats min, and then the rotor speed was reduced to 2000 rpm served as controls. and another two fractions (III and IV) were collected at Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 3 of 22 flow rates of 23.0 and 40.0 ml/min, respectively. Frac- Validation of mRNA expression by real time RT-PCR tions II and IV contained pachytene spermatocytes and Total RNA was isolated using Trizol reagent (Invitrogen round spermatids at purities of ~ 80% and ~ 75%, re- Life Technologies, Carlsbad, CA) and 3 μg of RNA was spectively. The fractions II and IV were layered separ- converted to cDNA using the RevertAid H Minus First ately over linear Percoll gradients of 25–37% and 23– Strand cDNA Synthesis Kit (Fermentas, Waltham, MA) 33% Percoll, respectively, and centrifuged at 4025 g for following the manufacturer’s instructions. Real time PCR 60 min in a swinging bucket rotor fitted on to a Sigma was performed on a Light Cycler 480 (Roche, Basel, 3-30 K refrigerated centrifuge. The major band was re- Switzerland) detection system using SYBR Green I covered through a puncture in the side of the tube, Master mix (Roche, Basel, Switzerland) in 96-well plates. washed and diluted with BME. Further, the purity of iso- All reactions were run in triplicates and relative gene lated cells was checked visually under a microscope and expression was normalized to steady state expression of through DNA quantitation using flow cytometry. GAPDH, calculations made by using the 2-ΔΔCt method. RNA isolation and sequencing Results A Qiagen RNeasy Micro Kit (74,004, Qiagen) was used Histology of control and cryptorchid testes to extract RNA from the sorted cells. The extraction was The H & E stained testes sections of control and crypt- performed according to Quick-Start Protocol suggested orchid rat suggest that at 24 h there was negligible vis- by the manufacturers. miRNA was isolated from the ible change in any stage of spermatogenesis and most of total RNA population by the ligation of a 3’ RNA the stages were present (Fig. 1b), as in control (Fig. 1a). adapter using t4 RNA ligase and ligation buffer. The However, at 72 h there was a marked increase in the in- 3’adapter ligated small RNA was again 5′ ligated with cidence of germ cell apoptosis predominantly at stages 5’RNA adapter and then the corresponding small RNA I–V and the late stages XI–XIV, while stages V-X were was reverse transcribed and amplified to generate cDNA comparatively less affected (Fig. 1c). On the other hand, constructs. These cDNA constructs were purified using at 120 h stages I–VI were badly distorted while stages 6% PAGE and the corresponding small RNA bands were X–XIV were not distinguishable at all. However, stages excised between 140 and 160 bp lengths. The cDNA VII and VIII were visible but cell apoptosis was quite construct from the gel was recovered by filtration and significant (Fig. 1d). There was a significant reduction in subsequently precipitated with ethanol. These were number of spermatocytes at 72 (P < 0.05) and 120 (P < quantified and subjected to sequencing and data ana- 0.01) h of cryptochidism (Fig. 1e). In case of spermatids, lysis. The integrity and quality of the extracted RNAs a significant reduction in their number was evident at 24 were checked by Agilent 2100 bioanalyzer and the quali- (P < 0.05), 72 and 120 (P < 0.001) h (Fig. 1f). fied RNA samples were used for sequencing. A total of 3 pools were prepared for each type of cells to have three Tunnel assay of paraffin embedded testis tissues biological replicates. Dynabeads mRNA DIRECTTM kit Tunnel assay was performed to check whether the loss (610.12, Life Technologies) was used to enrich RNAs of cells in cryptorchid testes was due to heat-induced with polyA tail. mRNA-seq library was prepared using apoptosis (Fig. 2). Results indicated that apoptosis was TruSeq RNA kit (RS-122-2001, Illumina). Sequencing induced in testicular germ cells at body temperature and was performed on Illumina Hiseq 2500 next generation the number of apoptotic cells gradually increased with sequencing platform. Sequencing-v3 (634,848, Clontech the duration of heat exposure (Fig. 2a,d,g,j). Though Laboratories) was used to amplify the cDNA derived very few yet significant number of apoptotic cells were from these cells before sequencing was performed. observed at 24 h (P < 0.05) of heat-stress, the number increased significantly thereafter at 72 h (P < 0.001) Raw data production and preprocessing and 120 h (P < 0.001) (Fig. 2m), which was in agree- TopHat (v2.0.8b, http://tophat.cbcb.umd.edu/) was used ment with H&E data. to map the RNA-seq reads to rat genome build hg19 (UCSC). The reads with low quality were removed from Isolation, purification and characterization of primary the raw sequencing reads. Read mapping were performed spermatocytes and round spermatids using Tophat (R software), reads count were obtained The enzymatic digestion of testicular parenchyma re- using HTSeq (http://www-huber.embl.de/users/anders/ sulted in complete dispersion of testicular cells (Fig. 3a). HTSeq/doc/overview.html). Differentially expressed genes The two cell types i.e. spermatocytes and round sperma- were analysed using DESeq R software pack. tids were isolated up to the purity of ~ 75% and ~ 80%, re- Benjamini-Hochberg multiple testing corrections were spectively, by using centrifugal elutriation method. The employed to reveal the differentially expressed genes. homogeneity of spermatocytes and round spermatids was Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 4 of 22 Fig. 1 Representative picture of testes histology at 0 h [sham, a], 24 h [b], 72 h [c] and 120 h [d] of cryptorchidism (Bar = 10 μm). Average number of spermatocytes (e) and spermatids (f) after 0, 24, 72 and 120 h of cryptorchidism. (Mean ± SE; *P < 0.05; **P < 0.01; ***P < 0.001) further increased to ~ 90 and > 92%, respectively, by Per- transcriptome from spermatocytes of control testis coll density gradient centrifugation method (Fig. 3b and (0-Cr-Sc) was compared with that of 24 h crypt (24-Cr-Sc) c). The purity of the two cell types was confirmed by and 72 h crypt (72-Cr-Sc) testes. Similarly, the transcrip- FACS, which exhibited a single peak in both the cell prep- tome from control spermatids (0-Cr-Sd) was compared arations with negligible number of contaminating cells with 24, 72 and 120 h crypt spermatids (24-Cr-Sd; (Fig. 3d and e). The trypan blue exclusion test showed > 72-Cr-Sd; 120-Cr-Sd). In spermatocytes, the expression of 95% viability of the purified cells in the two fractions (data total 1602 genes was altered (897 up regulated and 705 not shown). down regulated) after 24 h of cryptorchidism, and the ex- pression of 1807 genes was altered (987 up regulated and Transcriptome profiling and differential gene expression 820 down regulated) after 72 h of cryptorchidism. Simi- analysis larly in spermatids, after 24, 72, 120 h of cryptorchidism Total RNA was extracted from highly purified primary altered expression of 1210 (505 up regulated and 705 spermatocytes and round spermatids, isolated from the down regulated), 1718 (990 up regulated and 728 down testicular tissues of all the experimental groups, and sub- regulated) and 3559 (2180 up regulated and 1379 down jected to sequencing using Illumina NextSeq 2500. We regulated) transcripts, respectively, was seen. The genes performed pairwise differential gene expression (DGE) showing change in the expression within 24 h could be comparisons between samples to detect the genes exhibit- categorized as early response genes while those showing ing differences in expression by at least 2-fold. The alteration after 24 h could be termed as mid and late Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 5 of 22 Fig. 2 Apoptosis of germ cells by Tunel Assay in rat testis at 0 h [1a, b, c]; 24 h [1d, e, f]; 72 h [1g, h, i] and 120 h [1 j, k, l] of cryptorchidism. (a, d, g, j – FITC staining for DNA fragmentation; b, e, h, k – DAPI staining of DNA; c, f, i, l – merged images) (Bar = 10 μm). Average number of TUNEL positive cells (M; Mean ± SE; *P < 0.05; ***P < 0.001) response genes. Overall observations clearly indicate that expression profile of temperature-sensitive genes in the the number of genes with altered expression increased two cell types has been prepared (Fig. 5). A number of with an increase in the time period of heat exposure. genes showed more than one transcript variant, which Venn analysis indicated that all through 24–72 h of exhibited different expression patterns in spermatocytes cryptorchidism, a total of 286 genes were up-regulated and spermatids. and 308 genes were down-regulated in spermatocytes. Similarly, in spermatids 105 genes were up-regulated Gene ontology and 49 genes were down-regulated during 24–120 h of With the aim of finding the pathways/biological cryptorchidism. Further, Venn analysis suggested that 62 processes prominently affected by heat stress, gene genes were altered in both the cell types during the en- ontology of 62 crucial genes was performed. The tire period of hyperthermia (Fig. 4). A heat map of the PANTHER online analysis tool indicated that the Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 6 of 22 Fig. 3 Isolation and purification of pachytene spermatocytes and round spermatids from rat testes. a-Mixed population after trypsin digestion; b- purified pachytene spermatocytes (~ 90%), c-purified round spermatids (> 90%), d- cell cycle analysis of spermatocyte fraction and e- cell cycle analysis of spermatid fraction by Flow Cytometry affected transcripts had catalytic (26), binding (21), structural (7), and transporter (6) functions (Table 1). These transcripts were mostly related to cellular (29) and metabolic processes (26), or to biological regula- tion (6), localization (9), reproduction (1), develop- mental process (6), or to cellular component organization and biogenesis (8). A single gene may be involved in more than one process. According to the PANTHER tool, the shortlisted genes encoded pro- teins belonging to the class of nucleic acid binding (9), enzyme modulators (5), hydrolases (8), transfer- ases (5), transcription factors (4), and signaling mole- cules (3). Validation of deep sequencing data by qPCR For validation of deep sequencing data, we selected 15 heat-sensitive genes related to important biological processes i.e. metabolism (Mct1, Mct2, Mct4, Glut3, ++ Ldhc), lipid biogenesis (Acly), ROS and Ca medi- Fig. 4 Venn diagram showing heat-sensitive genes in spermatocytes ated signaling pathway (Daxx, Camk2d), apoptotic and spermatids signaling pathway (p53, Daxx), gene expression Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 7 of 22 Fig. 5 Heat map showing changes in expression of the 62 common hyperthermia-sensitive genes in pachytene spermatocytes (left panel) and round spermatids (right panel) after 24 and 72 h of heat stress regulation (Taf9, Gtf2b, Cnot8), spermatogenesis miRNA profiling of heat stressed spermatocytes and (spata22), redox pathway (Txnrd1) and mitochondria spermatids by deep sequencing related pathway (Mrps14) for validation by RT-PCR. Similar to mRNA sequencing data analysis, we also For all the 15 genes, the qPCR data followed almost performed miRNA sequencing data analysis for sper- the same pattern as depicted by sequencing data for matocytes and round spermatids from normal and both the cell types (Fig. 6). cryptorchid rat testes. A change of ≥1.5 fold in Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 8 of 22 Table 1 Gene ontology of genes affected by heat in both spermatocytes and spermatids Nō.of Name of genes genes Molecular functions Binding (GO:0005488) 21 Taf9, Cast, Apbb1, Crip1, Zfp202, Timp1, Lilrb3l, AC120291 (Mbd3), Sptbn1, Cast, Sept4, AC120291 (Mex3d), Prpf8, Rabgap1l, Gtf2b, Tdrd5, Micu1, Upf1, Prelp, Micu2, Camk2d Catalytic activity (GO:0003824) 26 Cst, Clk3, Hsd11b1, Mink1, Timp1, Abcc12, AC120291 (Atp8b3), Scpep1, Cast, Sept4, Grip1, AC120291 (Mex3d), Acly, Serpinf1, Prpf8, Ptpru, Rabgap1l, Tdrd5, Txnrd1, Upf1, Nt5c3b, ldhc, Mipep, Scamp1, LOC316124, Camk2d Receptor activity (GO:0004872) 2 Lilrb3l, Ptpru Signal transducer activity (GO:0004871) 1 Mink1 Structural molecule activity (GO:0005198) 7 Emp1, Crip1, Mgp, C1qa, Sptbn1, Sept4, Mrps14 Transporter activity (GO:0005215) 6 Abcc12, AC120291 (Atp8b3), Mct4, LOC316124, Mct2,Mct1 Biological process Biological adhesion (GO:0022610) 7 Cfb, Col6a2, Ccdc80, C1qa, Cfb, Rabgap1l, Prelp Biological regulation (GO:0065007) 6 Crip1, Mink1, Timp1, AC120291 (Atp8b3), AC120291 (Mbd3), Serpinf1 Cellular component organization or 8 Col6a2, Crip1, Mink1, AC120291 (Atp8b3), C1qa, AC120291 (Mbd3) biogenesis (GO:0071840) Cellular process (GO:0009987) 29 Emp1, Cfb, Col6a2, Apbb1, Ccdc80, AC120291 (Plk5), Zfp202, Mink1, Timp1, AC120291 (Atp8b3), C1qa, Lilrb3l, AC120291 (Mbd3), Wdr36, Scpep1, Sptbn1, Cfb, Sept4, Grip1, Prpf8, Rabgap1l, Prkar2b, Upf1, Prelp, Mipep, Mct4, Mrps14, Mct2, Camk2d Developmental process (GO:0032502) 6 Crip1, Mink1, C1qa, Sptbn1, Prelp, Camk2d Immune system process (GO:0002376) 9 Cfb, Col6a2, Crip1, Ccdc80, Abcc12, C1qa, Col3a1, Cfb, LOC316124 Localization (GO:0051179) 9 Abcc12, AC120291, Cast, Rabgap1l, Scamp1, Mct4, LOC316124, Mct2, Mct1 Metabolic process (GO:0008152) 26 Taf9, Cast, Apbb1, Crip1, Zfp202, Hsd11b1, Mink1, Timp1, AC120291 (Atp8b3), AC120291 (Mbd3), Wdr36, Scpep1, AC120291 (Mex3d), Acly, Prpf8, Ptpru, Sdhaf3, Gtf2b, Tdrd5, Txnrd1, Upf1, ldhc, Prelp, Mipep, LOC316124, Mrps14 Multicellular organismal process (GO:0032501) 4 Mink1, Col3a1, Grip1, Prelp Reproduction (GO:0000003) 1 Crip1 Response to stimulus (GO:0050896) 8 Taf9, Cfb, Lilrb3, Crip1, Mink1, Timp1, Abcc12, Cfb Cellular Component Cell junction (GO:0030054) 1 Grip1 Cell part (GO:0044464) 15 Emp1, Apbb1, Crip1, Zfp202, Mink1, AC120291 (Atp8b3), AC120291 (Mbd3), Wdr36, Sptbn1, Sept4, Prpf8, Ptpru, Mipep, Mrps14, Camk2d Extracellular matrix (GO:0031012) 4 Col6a2, Timp1, C1qa, Prelp Extracellular region (GO:0005576) 4 Timp1, C1qa, Serpinf1, Prelp Macromolecular complex (GO:0032991) 3 Wdr36, Prpf8, Mrps14 Membrane (GO:0016020) 4 AC120291 (Atp8b3), Grip1, Mct4, Mct1 Organelle (GO:0043226) 9 Apbb1, Zfp202, AC120291 (Atp8b3), AC120291 (Mbd3), AC120291, Sept4, Prpf8, Prelp, Mipep Protein class Calcium-binding protein (PC00060) 3 Mgp, Micu1, Micu2 Cell adhesion molecule (PC00069) 1 C1qa Cell junction protein (PC00070) 1 Grip1 Cytoskeletal protein (PC00085) 5 Emp1, Crip1, Ivns1abp, Sptbn1, Sept4 Defense/immunity protein (PC00090) 1 Lilrb3l Enzyme modulator (PC00095) 5 Cast, Cast (Erc2), Sept4, Serpinf1, Rabgap1l Extracellular matrix protein (PC00102) 3 Mgp, C1qa, Prelp Hydrolase (PC00121) 8 Ivns1abp, AC120291 (Atp8b3), Scpep1, Ptpru, Rabgap1l, Upf1, Nt5c3b, Mipep Ligase (PC00142) 3 AC120291 (Mex3d), Acly, LOC316124 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 9 of 22 Table 1 Gene ontology of genes affected by heat in both spermatocytes and spermatids (Continued) Nō.of Name of genes genes lyase (PC00144) 1 Acly Membrane traffic protein (PC00150) 1 Cast Nucleic acid binding (PC00171) 9 Taf9, Crip1, AC120291 (Mbd3), Wdr36, AC120291 (Mex3d), Prpf8, Tdrd5, Upf1, Mrps14 Oxidoreductase (PC00176) 3 Hsd11b1, Txnrd1, ldhc Signaling molecule (PC00207) 3 Apbb1, Mgp, Lilrb3l Structural protein (PC00211) 1 Mgp Transcription factor (PC00218) 4 Taf9, Crip1, Ivns1abp, Gtf2b Transferase (PC00220) 5 Clk3, Grip1, Acly, Scamp1, Camk2d Transporter (PC00227) 5 Abcc12, AC120291 (Atp8b3), Mct4, Mct2, Mct1 Transfer carrier protein 1 Scamp1 Receptors 2 Ptpru, Prelp Pathways Alzheimer disease-amyloid secretase pathway (P00003) 1 Apbb1 Alzheimer disease-presenilin pathway (P00004) 1 Apbb1 Angiogenesis (P00005) 1 AC120291 (Apc2) Cytoskeletal regulation by Rho GTPase (P00016) 2 Arpc2, Gtf2b General transcription regulation (P00023) 2 Taf9, Gtf2b Inflammation mediated by chemokine and cytokine 3 Col6a2, Arpc2, camk2d signaling pathway (P00031) Integrin signalling pathway (P00034) 3 Col6a2, Arpc2, Col3a1 Parkinson disease (P00049) 1 Sept4 Pyruvate metabolism (P02772) 1 Acly Transcription regulation by bZIP transcription 3 Taf9, Gtf2b, Prkar2b factor (P00055) Wnt signaling pathway (P00057) 1 AC120291 (Apc2) 5HT receptor Mediated signaling 1 Prkar2b Apoptosis signalling pathway 1 daxx b 1 adrenergic signaaling 1 Prkar2b b2 adrenegenic signalling 1 Prkar2b dopamine receptor mediated signaling 1 Prkar2b fas signalling pathway 1 daxx endothilin signalling pathway 1 Prkar2b muscarinie acetylcholine receptor 2 and 4 signalling 1 Prkar2b metabotropic glutamate receptor III pathway 1 Prkar2b metabotropic glutamate receptor II pathway 1 Prkar2b ionotropic glutamate receptor pathway 1 Camk2d GABA b receptor signaling 1 Prkar2b expression of miRNAs under heat stress was consid- expression, respectively. Venn analysis (Fig. 7)indi- ered as significant. In spermatocytes, after 24, 72 cated that 66 miRNAs remained affected throughout and 120 h of cryptorchidism, 175 (93 upregulated 24–120 h of heat stress in spermatocytes, which in- and 82 down regulated), 185 (71 upregulated and cluded 3 novel miRNAs (Table 2). On the other 114 down regulated) and 280 (126 upregulated and hand, in spermatids after 24, 72 and 120 h of crypt- 154 down regulated) miRNAs exhibited altered orchidism, 265 (147 upregulated and 118 down Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 10 of 22 Fig. 6 Validation of deep sequencing data by qPCR. top left - deep sequencing data of spermatocytes; top right - deep sequencing data of round spermatids; bottom left - qPCR data for spermatocytes; bottom right - qPCR data for round spermatids. (Mean ± SE; *P <0.05; **P < 0.01; ***P < 0.001) regulated), 301 (160 upregulated and 141 down common miRNAs in both the cell types is presented regulated), and 328 (162 upregulated and 166 down in Fig. 8. regulated) genes exhibited altered expression, re- spectively. Venn analysis (Fig. 7)showedthat60 Prediction of novel miRNAs miRNAs (including 6 novel) (Table 2) remained sig- Among novel miRNAs, we identified 3 and 6 miRNAs nificantly affected throughout 24–120 h of crypt- that were most heat-sensitive in spermatocytes and orchidism. The heat map of the expression profile of round spermatids, respectively (Table 3). Fig. 7 Venn diagram showing heat-sensitive miRNAs in spermatocytes and round spermatids Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 11 of 22 Table 2 miRNAs with altered expression in spermatocytes and round spermatid under heat stress Major miRNAs altered by heat in spermatocytes Major miRNAs altered by heat in round spermatids bta-miR-339a; bta-miR-339b; bta-miR-423-3p; bta-miR-99a-5p; cfa-miR-101; bta-miR-22-3p; bta-miR-3600; bta-miR-363; cgr-miR-222-3p; cgr-miR-24-5p; cfa-miR-1306; cgr-miR-28-5p; cgr-miR-298-5p; chi-miR-15a-5p; efu-miR-29a; cgr-miR-28-5p; cgr-miR-664-3p; cgr-miR-7b; chi-miR-361-3p; chi-miR-363- efu-miR-34a; efu-miR-381; ggo-miR-146a; ggo-miR-148a; ggo-miR-151a; 3p; efu-miR-30a; ggo-miR-381; hsa-let-7c-5p; efu-miR-34a; efu-miR-7a; efu-miR-7b; ggo-miR-151a; ggo-miR-328; hsa-miR-100-5p; hsa-miR-101-3p; hsa-miR-10a-5p; hsa-miR-1306-5p; ggo-miR-423; hsa-miR-100-5p; hsa-miR-151b; hsa-miR-22-3p; hsa-miR-148a-3p; hsa-miR-22-5p; hsa-miR-3184-3p; hsa-miR-32-3p; hsa-miR-361-3p; hsa-miR-202-5p; hsa-miR-28-5p; hsa-miR-381-3p; hsa-miR-423-3p; hsa-miR-423-5p; hsa-miR-449b-5p; mdo-miR-100-5p; mdo-miR-106-5p; hsa-miR-99a-5p; mdo-miR-15a-5p; mdo-miR-22-3p; mml-miR-32-3p; mml-miR-411-3p; mdo-miR-100-5p; mdo-miR-10b-5p; mdo-miR-199b-2-5p; mmu-let-7i-5p; mml-miR-99b-3p; mmu-miR-129-5p mmu-miR-101c; mmu-miR-146a-5p; mmu-miR-151-5p; mmu-miR-151-5p; mmu-miR-204-3p; mmu-miR-24-2-5p; mmu-miR-28c; mmu-miR-201-5p; mmu-miR-202-5p; mmu-miR-296-5p; mmu-miR-298-5p; mmu-miR-301a-5p; mmu-miR-3074-2-3p; mmu-miR-32-3p; mmu-miR- mmu-miR-300-3p; mmu-miR-3074-5p; mmu-miR-3470b; mmu-miR-501-3p; 7b-5p; mmu-miR-99b-3p; mmu-miR-674-3p; Novel_1015; Novel_3011; Novel_66; oan-miR-1386; mmu-miR-99b-5p; Novel_1113; Novel_1204; Novel_2956; Novel_3356; oar-miR-10a; oar-miR-374b; Novel_4066; Novel_4398; rno-miR-298-3p; oar-miR-99a; ppy-miR-378d; rno-miR-148a-5p; rno-miR-25-5p; rno-miR-301a-5p; rno-miR-32-3p; rno-miR-328a-3p; rno-miR-3586-3p; rno-miR-339-5p; rno-miR-3560; rno-miR-3585-5p; rno-miR-3586-3p; rno-miR-411-3p; rno-miR-466c-5p; rno-miR-483-3p; rno-miR-501-3p; rno-miR-547-3p; rno-miR-423-5p; rno-miR-664-3p; ssc-miR-20a; ssc-miR-411 rno-miR-676; sha-miR-202; ssc-let-7i; ssc-miR-186; ssc-miR-339 Target prediction of heat-sensitive miRNAs in round of gene expression during spermatogenesis under heat spermatids and gene ontology of predicted targets stress could be advantageous in identifying key The heat-sensitive miRNAs, among known miRNAs in rat heat-sensitive genes regulating gamete production for the species, were selected for target prediction. The gene on- development of male contraceptives. While a few studies tologies of predicted targets have been detailed for sper- have investigated the differential gene expression (DGE) matocytes (Table 4) and spermatids (Table 5). in mouse during normal spermatogenesis [20–22], none The crucial thermo-sensitive genes regulated tightly by has tried to study the regulation of transcriptome in the miRNAs have been selected with the help of online vulnerable germ cell types (spermatocytes and spermatids) miRDB tool. The table below lists the most heat sensitive during cryptorchidism. A careful analysis of transcriptome miRNAs and their probable target proteins in temperature data suggested that though there is a general disturbance vulnerable meiotic and post-meiotic germ cells of rat testis in metabolic/biological processes and pathways under heat at 24/72/120 h of heat stress, during which their numbers stress in both spermatocytes and spermatids, the most decrease to significantly low numbers. Capturing molecu- strongly affected genes were related to solute carrier fam- lar changes early in heat exposure could identify the core ily (transporters), energy metabolism, ROS, ribosomal, thermo-regulators, while longer exposure may result in a ring/zinc finger, proteasomal, ubiquitination, HSPs, tran- host of secondary molecular changes, which may not be scription factors, apoptotsis and transmembrane proteins. the key thermo-regulators. However, the expression profile in the two cell popula- tions was distinct for several genes. The site of spermatogenesis i.e. seminiferous tubules is Thermo- Fold change Fold change Predicted Cell Type sensitive in miRNA in target gene one of the most heterogenic niches of the body where miRNAs mRNA targets about 30 types of cells coexist. These cells not only vary in rno-miR-22-3P + 3.4 −13.5 Acly Spermatid their size, morphology, and function, but also in their rno-miR-22-5P + 1.8 −13.5 Acly Spermatid DNA content; e.g. 2C (spermatogonia, Sertoli cells, Leydig rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte cells etc), 4C (G2 phase spermaocytes), and 1C or C (round and elongating spermatids, and spermatozoa). The rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte heterogeneity of testicular cells and the lack of in vitro rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte systems for spermatogenic cell culture [27] are the major rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid hurdles in gene expression studies at different stages of spermatogenesis [23]. To overcome this, enrichment of stage-specific germ-cell populations is mandatory. The Discussion gravimetric decantation in BSA gradients (staput) [28–30] Crytorchidism is a state wherein the loss of germ cells and the centrifugal elutriation [31]are amongst the most takes place by apoptosis leading to infertility, and widely used techniques of germ cell enrichment. Using transient testicular heating has been shown to provide the centrifugal elutriation technique coupled with Percoll® reversible contraception in men [25] and temporary density gradient centrifugation, successful enrichment of sterility in rats [26]. Therefore, determining the dynamics pachytene spermatocytes and round spermatids to purity Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 12 of 22 Fig. 8 Heat map for expression of miRNAs in spermatocytes (left panel) and spermatids (right panel) after 24, 72 and 120 h of heat stress levels of > 90% was achieved. To our understanding, this is We observed altered expression of HSP members the best method of achieving germ cell purification to a belonging to Hspa, Hsp90, Hspe, Hspd and Hspb. Hspe1 is a high level. Nevertheless, less than 10% cross-contamination mitochondrial co-chaperonin, necessary for the folding of would not affect the findings of the study except screening newly imported and stress-denatured mitochondrial proteins out genes with minor differences between the two cell and works in association with Hsp60 (Hspd) in the presence types. of ATP [32]. Hspe1showed>3.0foldup-regulation in heat Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 13 of 22 Table 3 Details of novel miRNAs common in spermatocytes and round spermatids S. no Name Sequence Nucleotide length (bases) Common in spermatids 1 Novel_1204 CAAGAGGTGCATGCTGACAG 20 2 Novel_2956 GATTTAGCTCAGTGGTAGAG 20 3 Novel_3356 GGCTATTCTCGGCTGTCAGC 20 4 Novel_4066 TACCTCACTGTAGTCTAGGG 20 5 Novel_4398 TCCAGGTCCACTCTGCTGAGCACT 24 6 Novel_1113 ATTCTGGCTGTGTCTCTCAGGAGC 24 Common in round spermatocytes 7 Novel_1015 ATGGGCTGTAGAATTTCTCT 20 8 Novel_3011 GCAGTGGAACATGTATTTAA 20 9 Novel_66 AACTGGAGGGCAACATGTATTA 22 stressed round spermatids and its companion protein Hspd1 on spermatogonia, spermatocytes and spermatids, while was up-regulated (3.2 fold) after 120 h of cryptorchidism. MCT2 is reported to be present on the tails of elongated However, in case of pachytene spermatocytes the Hspd1 ex- spermatids and sperm [41]. This indicated that the hibited higher expression after 24 h of cryptorchidism but metabolism of heat stressed germ cells is disturbed which expression of Hspe1 remained unchanged. Thus, it can be may lead to apoptosis of the spermatids and assumed that round spermatids could delay the apoptotic re- spermatocytes. Furthermore, lactate taken up by germ sponse due to heat stress with the help of these HSPs. On cells is metabolized to pyruvate with the resultant increase the other hand, Hspa13 was continuously down-regulated in NADH, which is a substrate for NOX4. Reactive from 24 h of heat stressed in both the cell types and max- Oxygen Species (ROS) produced by NOX4 activity may imum down expression (− 9.9 fold) was observed in sper- act as second messengers in regulating the signal matocytes at 72 h of heat stress. According to Yunoki et al. transduction pathways and gene expression. This indicates [33] Hspa13 is non-inducible to heat stress in human fibro- that besides energy metabolism, lactate also has a blast cells. Hspa13 is over expressed under UVB treatment paracrine role and may also play a decisive role as a and inhibits apoptosis [34] in the presence of alkannin. Thus cell-signalling molecule in the seminiferous tubules after higher under expression of Hspa13 in spermatocytes suggest being secreted by the Sertoli cells [42]. higher susceptibility to apoptosis. When we observed expres- The other targets include ATP-citrate lyase (ACLY), which sion of Hsf2, an important heat stress transcription factor, we is known to be the primary enzyme responsible for the syn- didn’t find any change in round spermatids while a slight thesis of cytosolic acetyl-CoA in many tissues for the synthe- down regulation in spermatocytes was reported. sis of lipids to meet the great demand for membrane It is well known that the more mature germ cells, expansion of rapidly proliferating cells [43]. Inhibition of specifically spermatocytes and spermatids, rely on lactate ATP citrate lyase (ACLY), leads to growth suppression and as their energy source [35, 36], which is provided by the apoptosis in a subset of human cancer cells [44]. In heat Sertoli cells. This lactate is further converted into pyruvate stressed testis, the level of Acly was found to be decreased in with the help of LDHc and is accompanied by the spermatids which could also be a reason for apoptosis of the generation of reduced NAD . LDHc is testis specific germ cells. Acly is target of the miRNAs rno-miR-22-3p and isozyme of LDH expressed in male germ cells [37]. rno-miR-22-5p. Acetyl-CoA is the requisite building block Moreover the fertility of Ldhc null males was severely for the endogenous synthesis of fatty acids, cholesterol, and compromised, which further confirmed the importance of isoprenoids as well as acetylation reactions that modify pro- this isozyme in fertility [38]. Due to this fact, LDHc teins. ACL-generated oxaloacetate is reduced to malate, attracted the attention of researchers as a fertility target which can return to the mitochondria, recycling carbon and for developing contraceptive vaccine [39, 40]. Significant shuttling reducing equivalents into the mitochondria. The changes in the expression levels of LDHc, lactate conversion of cytosolic oxaloacetate to malate is driven by transporters (MCT1, MCT2, MCT4) and GLUT3 genes the high cytosolic NADH/NAD+ ratio present in glycolytic in germ cells was observed under heat stress, which were cells. Malate can enter the mitochondrial matrix and be further validated by real time PCR. The lactate formed in converted there to oxaloacetate to complete the substrate the Sertoli cells is transferred to the germ cells with help cycle. The coupled conversion of NAD+ to NADH provides of monocarboxylate transporters i.e., MCT1, MCT2, a continuing mechanism to preserve the mitochondrial MCT4 which are present on germ cells. MCT1 is present membrane potential (MMP) and sustain a high Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 14 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes No of genes Predicted targets Molecular functions Binding 15 Taf9b, Syt4, Cpeb1, Upf2, Arhgef2, Plch1, Net1, Arid3b, Enc1, Pole4, Impad1, Rfx7, Camk1d, Aph1a, Nfyb Catalytic activity 22 Atp11c, Upf2, Dusp10, Arhgef2, Plch1, Mtor, Net1, Tmtc3, Casp9, Cnot8, Kbtbd8, Pole4, Impad1, Tesk2, Camk1d, Mapk8, Map3k14, Aph1a, Map4k3, Acly, Map3k3, Nfyb Receptor activity 1 Net1 Signal transducer activity 2 Dusp10, Map4k3 Structural molecule activity 1 Enc1 Translation regulator activity 1 Cpeb1 Transporter activity 3 Atp11c, Cacna1a, Slc30a4 Biological processes Biological adhesion 3 Arhgef2, Net1, Net1 Biological regulation 9 Atp11c, Syt4, Cacna1a, Dusp10, Casp9, Slc30a4, Map3k14, Map4k3, Map3k3 Cellular component organization or biogenesis 3 Atp11c, Syt4, Tesk2 Cellular process 28 Atp11c, Syt4, Cpeb1, Cacna1a, Dusp10, Arhgef2, Plch1,Mtor, Net1, Tmtc3, Net1, Cltc, Casp9, Cnot8, Enc1, Slc30a4, Kbtbd8, Smurf1, Impad1, Rfx7, Tesk2, Camk1d, Gphn, Mapk8, Map3k14, Map4k3, Map3k3, Nfyb Developmental process 11 Lmtk2, Arhgef2, Epha4, Net1, Net1, Casp9, Enc1, Tesk2, Map3k14, Map4k3, Map3k3 Immune system process 2 Tesk2, Mapk8 Localization 2 Atp11c, Cltc Metabolic process 23 Taf9b, Atp11c, Cpeb1, Upf2, Dusp10, Plch1, Mtor, Tmtc3, Arid3b, Cnot8, Kbtbd8, Smurf1, Pole4, Impad1, Rfx7, Tesk2, Gphn, Map3k14, Aph1a, Map4k3, Acly, Map3k3, Nfyb Multicellular organismal process 3 Syt4, Net1, Cltc Reproduction 1 Tesk2 Response to stimulus 11 Taf9b, Dusp10, Mtor, Casp9, Slc30a4, Smurf1, Tesk2, Mapk8, Map3k14, Map4k3, Map3k3 Cellular components Cell part 16 Atp11c, Cpeb1, Cltc, Casp9, Cnot8, Enc1, Kbtbd8, Smurf1, Pole4, Impad1, Rfx7, Camk1d, Gphn, Map3k14, Map4k3, Map3k3 Extracellular matrix 1 Net1 Extracellular region 1 Net1 Macromolecular complex 4 Cpeb1, Cltc, Cnot8, Kbtbd8 Membrane 3 Atp11c, Syt4, Cacna1a Organelle 4 Atp11c, Cpeb1, Pole4, Rfx7 Protein classes Calcium binding protein 1 Plch1 Cytoskeletal protein 1 Enc1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 15 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes (Continued) No of genes Predicted targets Enzyme modulator 5 Arhgef2,Plch1,Net1,Casp9,Aph1a Extracellular matrix protein 1 Net1 Hydrolase 4 Atp11c,Plch1,Casp9,Impad1 Ligase 2 Smurf1,Acly Lyase 1 Acly Membrane traffic protein 2 Syt4,Cltc Nucleic acid binding 8 Taf9b,Cpeb1,Upf2,Mtor,Arid3b, Pole4, Rfx7, Nfyb Receptor 1 Net1 Signalling molecule 1 Plch1 Transcription factor 6 Taf9b,Arid3b, Cnot8, Pole4, Rfx7, Nfyb Transferase 6 Mtor, Tmtc3, Tesk2, Camk1d, Mapk8, Acly Transporter 3 Atp11c, Cacna1a, Slc30a4 Pathways 5HT2 type receptor mediated signaling pathway 1 Plch1 Alzheimer disease-amyloid secretase pathway 2 Mapk8, Aph1a Alzheimer disease-presenilin pathway 1 Aph1a Angiogenesis 2 Casp9, Mapk8 Apoptosis signaling pathway 4 Casp9, Mapk8, Map3k14, Map4k3 Axon guidance mediated by Slit/Robo 1 Net1 Axon guidance mediated by netrin 1 Net1 B cell activation 2 Mapk8, Map3k3 CCKR signaling map 2 Mapk8, Map3k14 EGF receptor signaling pathway 2 Mapk8, Map3k3 Endogenous cannabinoid signaling 1 Cacna1a FAS signaling pathway 2 Casp9, Mapk8 FGF signaling pathway 2 Mapk8, Map3k3 GABA-B receptor II signaling 1 Cacna1a General transcription regulation Gonadotropin-releasing hormone receptor pathway 6 Syt4, Mapk8, Map3k3, Map3k14, Map4k3, Nfyb Heterotrimeric G-protein signaling pathway-Gi alpha and Gs 1 Cltc alpha mediated pathway Heterotrimeric G-protein signaling pathway-Gq alpha and 2 Cacna1a, Cltc Go alpha mediated pathway Histamine H1 receptor mediated signaling pathway 1 Plch1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 16 of 22 Table 4 Gene ontology of predicted targets for heat-sensitive miRNAs found in pachytene spermatocytes (Continued) No of genes Predicted targets Hypoxia response via HIF activation 1 Mtor Inflammation mediated by chemokine and cytokine signaling pathway 1 Plch1 Integrin signalling pathway 2 Mapk8, Map3k3 Interferon-gamma signaling pathway 1 Mapk8 Interleukin signaling pathway 1 Mtor Ionotropic glutamate receptor pathway 1 Cacna1a Metabotropic glutamate receptor group II pathway 1 Cacna1a Metabotropic glutamate receptor group III pathway 1 Cacna1a Notch signaling pathway 1 Aph1a Oxidative stress response 2 Dusp10, Mapk8 Oxytocin receptor mediated signaling pathway 1 Plch1 PDGF signaling pathway 2 Mtor, Mapk8 PI3 kinase pathway 1 Casp9 Parkinson disease 1 Mapk8 Pyruvate metabolism 1 Acly Ras Pathway 1 Mapk8 T cell activation 1 Mapk8 TGF-beta signaling pathway 2 Smurf1, Mapk8 Thyrotropin-releasing hormone receptor signaling pathway 2 Cacna1a Plch1 Toll receptor signaling pathway 1 Mapk8 Transcription regulation by bZIP transcription factor 1 Taf9b Ubiquitin proteasome pathway 1 Smurf1 VEGF signaling pathway 1 Casp9 p38 MAPK pathway 1 Dusp10 p53 pathway by glucose deprivation 1 Mtor Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 17 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids No. of Name of genes gene Molecular functions Binding 7 Pak7, Arhgef2, Cast, Tp63, Cast, Dazl, Wnt5b Catalytic activity 18 Grip1, Ddx4, Mapk8, Rictor, Pak7, Arhgef2, Ddx6, Cast, Txnrd1, Mapk6, Cnot7, Dhx57, Arhgap1, Cybrd1, Map2k1, RragB, Cdk14 Gsk3a Receptor activity 1 Calcr Structural molecule activity 1 Slc25a43 Translation regulator activity Eif4e2,Eif4g2 Transporter activity 17 Slc6a6, Slc38a11, Cacna1d, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Slc30a7, Slc5a9, Slc35a2, Slc44a1, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc20a2, Slc1a3 Biological functions Biological adhesion 1 Arhgef2 Biological regulation 13 Ddx4, Rictor, Pak7, Cacna1d, Ddx6, Tp63, Slc30a7, Cnot7, Wnt5b, Arhgap1, Map2k1, Slc4a10, RragB Cellular component organisation or biogenesis 3 Rictor, Pak7, Ddx6 Cellular process 36 Calcr, Slc6a6, Slc25a43, Grip1, Slc38a11, Ddx4, Slc12a6, Mapk8, Rictor, Pak7, Cacna1d, Slc38a2, Slc6a8, Arhgef2, Slc13a5, Ddx6, Slc16a7, Tp63, Slc8a3, Mapk6, Slc30a7, Slc5a9, Cnot7, Prkar2b, Dhx57, Wnt5b, Slc17a5, Arhgap1, Slc6a1, Map2k1 Slc4a10, RragB, Slc20a2, Cdk14, Slc1a3, Gsk3a Developmental process Calcr,Pak7, Notch4, Arhgef2, Tp63, Wnt5b Map2k1, Cdk14, Gsk3a,Eif4g2 Immune system process 2 Mapk8, Mapk6 Localization 17 Calcr, Slc6a6, Slc38a11, Pak7, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Cast, Slc5a9, Slc35a2, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc20a2, Slc1a3 Locomotion 1 Pak7 Metabolic process 15 Slc25a43, Ddx4, Ddx6, Cast, Tp63, Txnrd1, Slc35a2, Cnot7, Dhx57, Arhgap1, Slc23a2, RragB, Cdk14, Slc1a3, Gsk3a Multicellular organismal process 8 Calcr, Grip1, Slc12a6, Wnt5b, Slc6a1, Cdk14, Slc1a3, Gsk3a Reproduction 2 Calcr, Dazl Response to stimulus 10 Calcr, Mapk8, Rictor, Pak7, Tp63, Mapk6, Slc30a7, Wnt5b, Map2k1, RragB Cellular components cell junction 1 Grip1 cell part 23 Slc6a6, Grip1, Ddx4, Rictor, Pak7, Cacna1d, Slc38a2,Slc6a8, Slc13a5, Ddx6,Slc16a7,Tp63, Slc30a7, Slc5a9, Cnot7, Dhx, Arhgap1,Slc6a1, Cybrd1, Map2k1,Slc4a10,RragB,Slc20a2 extracellular region 1 Wnt5b macromolecular complex 6 Ddx4, Rictor, Ddx6, Tp63, Cnot7, RragB membrane transporter 12 Slc6a6, Slc38a2, Slc6a8, Slc13a5, Slc16a7, Slc5a9, Slc17a5, Slc6a1, Cybrd1, Slc4a10, RragB, Slc20a2 Organelle 9 Ddx4, Slc38a2, Ddx6, Tp63, Slc30a7, Cnot7, Dhx57, Cybrd1, RragB Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 18 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene Protein classes calcium-binding protein 1 Slc25a43 cell junction protein 1 Grip1 defense/immunity protein 1 Calcr enzyme modulator 4 Arhgef2, Cast,Arhgap1,RragB membrane traffic protein 1 Cast nucleic acid binding 7 Slc25a43, Ddx4, Ddx6, Eif4e2, Dazl, Dhx57, Eif4g2 Oxidoreductase 2 Txnrd1, Cybrd1 receptor 1 Calcr signaling molecule 1 Wnt5b transcription factor 2 Tp63, Cnot7 transfer/carrier protein 1 Slc25a43 transferase 5 Grip1, Mapk8, Mapk6, Cdk14, Gsk3a transporter 17 Slc6a6, Slc25a43, Slc38a11, Cacna1d,Slc38a2 Slc6a8, Slc13a5,Slc16a7, Slc30a7, Slc5a9, Slc35a2, Slc44a1, Slc17a5, Slc6a1, Slc23a2, Slc4a10, Slc1a3 Pathways 5HT1 type receptor mediated signaling pathway 1 Prkar2b 5HT2 type receptor mediated signaling pathway 1 Cacna1d Alzheimer disease-amyloid secretase pathway 3 Mapk8, Cacna1d, Mapk6 Alzheimer disease-presenilin pathway 2 Notch4, Wnt5b Angiogenesis 6 Mapk8, Notch4, Mapk6, Wnt5b, Arhgap1,Map2k1 Angiotensin II-stimulated signaling through G proteins and beta-arrestin 1 Map2k1 Apoptosis signaling pathway 1 Mapk8 B cell activation 2 Mapk8, Map2k1 Beta1 adrenergic receptor signaling pathway 2 Cacna1d, Prkar2b Beta2 adrenergic receptor signaling pathway 2 Cacna1d, Prkar2b CCKR signaling map 2 Mapk8, Map2k1 Cadherin signaling pathway 1 Wnt5b Cytoskeletal regulation by Rho GTPase 2 Pak7, Arhgap1 Dopamine receptor mediated signaling pathway 1 Prkar2b EGF receptor signaling pathway 2 Mapk8, Map2k1 Endothelin signaling pathway 2 Prkar2b, Map2k1 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 19 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene Enkephalin release 1 Prkar2b FAS signaling pathway 1 Mapk8 FGF signaling pathway 2 Mapk8,Map2k1 GABA-B receptor II signaling 1 Prkar2b Gonadotropin-releasing hormone receptor pathway 4 Mapk8,Cacna1d, Map3k7,Map2k1 Hedgehog signaling pathway 1 Prkar2b Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated 2 Prkar2b, Gsk3a pathway Histamine H2 receptor mediated signaling pathway 1 Prkar2b Huntington disease 1 Tp63 Inflammation mediated by chemokine and cytokine signaling pathway 2 Pak7, Map3k7 Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade 1 Map2k1 Ionotropic glutamate receptor pathway 1 Slc1a3 Insulin/IGF pathway-protein kinase B signaling cascade 1 Gsk3a Integrin signalling pathway 3 Mapk8, Mapk6, Map2k1 Interferon-gamma signaling Pathway 1 Mapk8 Interleukin signaling pathway 2 Map3k7, Mapk6 Muscarinic acetylcholine receptor 2 and 4 signaling pathway 2 Slc6a8, Prkar2b Metabotropic glutamate receptor group III pathway 2 Prkar2b, Slc1a3 Metabotropic glutamate receptor group II pathway 1 Prkar2b Nicotinic acetylcholine receptor signaling pathway 2 Cacna1d, Slc6a8 Notch signaling pathway 2 Notch4, Gsk3a Oxidative stress response 1 Mapk8 Oxytocin receptor mediated signaling pathway 1 Cacna1d P53 pathway feedback loops 1 1 Tp63 PDGF signaling pathway 4 Mapk8, Mapk6,Arhgap1,Map2k1 Parkinson disease 1 Mapk8 Ras Pathway 3 Mapk8,Map2k1,Gsk3a T cell activation 2 Mapk8,Map2k1 TGF-beta signaling pathway 2 Mapk8, Map3k7 Toll receptor signaling pathway 3 Mapk8, Map3k7, Map2k1 Transcription regulation by bZIP transcription factor 1 Prkar2b Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 20 of 22 Table 5 Gene ontology of predicted targets for heat-sensitive miRNAs found in round spermatids (Continued) No. of Name of genes gene VEGF signaling pathway Mapk6, Arhgap1, Map2k1 Wnt signaling pathway Map3k7,Wnt5b p38 MAPK pathway Map3k7 p53 pathway by glucose deprivation Tp63 p53 pathway feedback loops 2 Tp63 p53 pathway Tp63 Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 21 of 22 mitochondrial NADH/NAD+ ratio that maintains the TCA Received: 23 January 2018 Accepted: 22 May 2018 cycle in a repressed state. Thus, ACL enzymatic activity is poised to affect both glucose-dependent lipogenesis and cellular bioenergetics [45]. References 1. Mieusset R, Bujan L. The potential of mild testicular heating as a safe, effective and reversible contraceptive method for men. Int J Androl. 1994; Conclusions 17(4):186–91. 2. Fahim MS, Fahim Z, Der R, Hall DG, Harman J. Heat in male contraception In conclusion, transcriptome analysis on the most heat (hot water 60 °C, infrared, microwave, and ultrasound). Contraception. 1975; sensitive germ cells in the testis identified a large number of 11(5):549–62. genes that were altered by ≥2.0 fold, out of which 594 genes 3. Toppari J, Larsen JC, Christiansen P, Giwercman A, Grandjean P, Guillette LJ, Jégou B, Jensen TK, Jouannet P, Keiding N, Leffers H, McLachlan JA, Meyer (286↑; 308↓) showed alterations in spermatocytes and 154 O, Müller J, Rajpert-De Meyts E, Scheike T, Sharpe R, Sumpter J, Skakkebaek genes (105↑;49↓) showed alterations in spermatids NE. Male reproductive health and environmental xenoestrogens. Environ throughout the duration of experiment. 62 heat-sensitive Health Perspect. 1996;104:741–803. genes were common to both cell types. Similarly, 66 and 60 4. Carlsen E, Andersson AM, Petersen JH, Skakkebaek NE. History of febrile illness and variation in semen quality. Hum Reprod. 2003;18:2089–92. heat-sensitive miRNAs in spermatocytes and spermatids, re- 5. Chowdhury AK, Steinberger E. Early changes in the germinal epithelium of spectively, were affected by ≥1.5 fold, out of which 6 were rat testes following exposure to heat. J Reprod Fertil. 1970;22:205–12. common to both the cell types. Among various pathways af- 6. Lue YH, Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, Wang C. Single exposure to heat induces stage-specific germ cell apoptosis in rats: fected significantly by heat stress, the study has identified role of intratesticular testosterone on stage specificity. Endocrinology. 1999; Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as poten- 140:1709–17. tial heat sensitive targets in germ cells, which may be under 7. Shiraishi K, Matsuyama H, Takihara H. Pathophysiology of varicocele in male infertility in the era of assisted reproductive technology. Int J Urol. 2012;19: tight regulation of heat sensitive miRNAs, rno-miR-22-3P, 538–50. rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno- 8. Steger K. Haploid spermatids exhibit translationally repressed mRNAs. Anat miR-3560 and rno-miR-466c-5P, as predicted by miRDB Embryol (Berl). 2001;203(5):323–34. 9. Eddy EM. Male germ cell gene expression. Recent Prog Horm Res. 2002;57: tool. The regulatory targets of these miRNAs, particularly 103–28. their effect on the top genes altered by heat stress, remain 10. Iguchi N, Tobias JW, Hecht NB. Expression profiling reveals meiotic male to be worked out. This study has not only advanced our un- germ cell mRNAs that are translationally up- and down-regulated. Proc Natl Acad Sci. 2006;103:7712–7. derstanding of molecular cues in spermatogenesis but also 11. Xiao P, Tang A, Yu Z, Gui Y, Cai Z. Gene expression profile of 2058 identified the potential targets for fertility regulation. spermatogenesis-related genes in mice. Biol Pharm Bull. 2008;31:201–6. 12. Waldman Ben-Asher H, Shahar I, Yitzchak A, Mehr R, Don J. Expression and Acknowledgments chromosomal organization of mouse meiotic genes. Mol Reprod Dev. 2010; The authors gratefully acknowledge the grant of research fellowships by the 77:241–8. Council of Scientific and Industrial Research, New Delhi, India (SKY and RV), 13. Yu Z, Guo R, Ge Y, Ma J, Guan J, Li S, Sun X, Xue S, Han D. Gene expression the Indian Council of Medical Research New Delhi, India (AP) and the profiles in different stages of mouse spermatogenic cells. Biol Reprod. 2003; Department of Biotechnology New Delhi, India (AD). Thanks are due to the 69:37–47. SAIF division for their help in obtaining FACS data. 14. Geisinger A, Rodríguez-Casuriaga R. Flow cytometry for gene expression studies in mammalian spermatogenesis. Cytogenet Genome Res. 2010;128:46–56. Funding 15. Johnston DS, Wright WW, Dicandeloro P, Wilson E, Kopf GS, Jelinsky SA. Stage- This study was supported by the CSIR-network project BSC0101. specific gene expression is a fundamental characteristic of rat spermatogenic cells and Sertoli cells. Proc Natl Acad Sci. 2008;10524:8315–20. 16. Schultz N, Hamra FK, Garbers DL. A multitude of genes expressed solely in Availability of data and materials meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive The datasets supporting the conclusions of this article are included within targets. Proc Natl Acad Sci. 2003;100:12201–6. the article and its files. 17. Schlecht U, Demougin P, Koch R, Hermida L, Wiederkehr C, Descombes P, Pineau C, Jégou B, Primig M. Expression profiling of mammalian male Authors’ contributions meiosis and gametogenesis identifies novel candidate genes for roles in the SKY, AP, LK, AD, BK and RV performed the animal surgeries, cell purification, regulation of fertility. Molec Biol Cell. 2004;15:1031–43. histology and FACS, gene-expression analysis and all other bench experiments, 18. Xu Q, Modrek B, Lee C. Genome-wide detection of tissue-specific alternative analysed the data and drafted the manuscript. GG, JPM and SR supervised the splicing in the human transcriptome. Nucleic Acids Res. 2002;30:3754–66. experiments, data analysis and bioinformatics. GG and SR conceived the study, 19. Huang X, Li J, Lu L, Xu M, Xiao J, Yin L, Zhu H, Zhou Z, Sha J. Novel designed the experiments and finalized the manuscript. All authors read, edited development-related alternative splices in human testis identified by cDNA and approved the final manuscript. microarrays. J Androl. 2005;26:189–96. 20. Laiho A, Kotaja N, Gyenesei A, Sironen A. Transcriptome profiling of the Ethics approval murine testis during the first wave of spermatogenesis. PLoS One. 2013;8: All animal experiments were approved by the Institutional Animal Ethics e61558. Committee (IAEC) of CSIR-CDRI, Lucknow. 21. Soumillon M, Necsulea A, Weier M, Brawand D, Zhang X, Gu H, Barthès P, Kokkinaki M, Nef S, Gnirke A, Dym M, de Massy B, Mikkelsen TS, Kaessmann Competing interests H. Cellular source and mechanisms of high transcriptome complexity in the The authors declare that they have no competing interests. mammalian testis. Cell Rep. 2013;3:2179–90. 22. Margolin G, Khil PP, Kim J, Bellani MA, Camerini-Otero RD. Integrated transcriptome analysis of mouse spermatogenesis. BMC Genomics. 2014;15:39. Publisher’sNote 23. da Cruz I, Rodríguez-Casuriaga R, Santiñaque FF, Farías J, Curti G, Capoano Springer Nature remains neutral with regard to jurisdictional claims in CA, Folle GA, Benavente R, Sotelo-Silveira JR, Geisinger A. Transcriptome published maps and institutional affiliations. analysis of highly purified mouse spermatogenic cell populations: gene Yadav et al. Reproductive Biology and Endocrinology (2018) 16:56 Page 22 of 22 expression signatures switch from meiotic-to postmeiotic-related processes at pachytene stage. BMC Genomics. 2016;17:294. 24. Meistrich ML, Longtin J, Brock WA, Grimes SR, Macc ML. Purification of rat spermatogenic cells and preliminary biochemical analysis of these cells. Biol Reprod. 1981;25:1065–77. 25. Vogeli M. Contraception through temporary male sterilization. Lancet. 1956; http://www.puzzlepiece.org/bcontrol/voegeli1956.txt. 26. Lue YH, Sinha Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, Wang C. Single exposure to heat induces stage-specific germ cell apoptosis in rats: role of intratesticular testosterone on stage specificity. Endocrinology. 1999 Apr 1;140(4):1709–17. 27. Reuter K, Schlatt S, Ehmcke J, Wistuba J. Fact or fiction: in vitro spermatogenesis. Spermatogenesis. 2012;2:245–52. 28. Lam DMK, Furrer R, Bruce WR. The separation, physical characterization, and differentiation kinetics of spermatogonial cells of the mouse. Proc Natl Acad Sci. 1970;65:192–9. 29. Go VLW, Vernon RG, Fritz IB. Studies on spermatogenesis in rats. I. Application of the sedimentation velocity technique to an investigation of spermatogenesis. Can J Biochem. 1971;49:753–60. 30. Romrell LJ, Bellvé AR, Fawcet DW. Separation of mouse spermatogenic cells by sedimentation velocity. Dev Biol. 1976;19:119–31. 31. Meistrich ML. Separation of spermatogenic cells and nuclei from rodent testes. Methods Cell Biol. 1977;15:15–54. 32. Levy-Rimler G, Viitanen P, Weiss C, Sharkia R, Greenberg A, Niv A, Lustig A, Delarea Y, Azem A. The effect of nucleotides and mitochondrial chaperonin 10 on the structure and chaperone activity of mitochondrial chaperonin 60. Eur J Biochem. 2001;268:3465–72. 33. Yunoki T, Kariya A, Kondo T, Hayashi A, Tabuchi Y. Gene expression analysis of heat shock protein a family members responsive to hyperthermic treatments in normal human fibroblastic cells. Therm Med. 2012;28:73–85. 34. Yoshihisa Y, Hassan MA, Furusawa Y, Tabuchi Y, Kondo T, Shimizu T. Alkannin, HSP70 inducer, protects against UVB-induced apoptosis in human keratinocytes. PLoS One. 2012;7(10):e47903. 35. Boussouar F, Benahmed M. Lactate and energy metabolism in male germ cells. Trends Endocrinol Metab. 2004;15:345–50. 36. Mita M, Hall PF. Metabolism of round spermatids from rats: lactate as the preferred substrate. Biol Reprod. 1982;26:445–55. 37. Goldberg E, Eddy EM, Duan C, Odet F. LDHc the ultimate testis specific gene. J Androl. 2010;31(1):86–94. 38. Odet F, Duan C, Willis WD, Goulding EH, Kung A, Eddy EM, Goldberg E. Expression of the gene for mouse lactate dehydrogenase C (Ldhc) is required for male fertility. Biol Reprod. 2008;79(1):26–34. 39. Millan JL, Driscoll CE, LeVan KM, Goldberg E. Epitopes of human testis- specific lactate dehydrogenase deduced from a cDNA sequence. Proc Natl Acad Sci. 1987;84:5311–5. 40. Murdoch FE, Goldberg E. Male contraception: another holy grail. Bioorg Med Chem Lett. 2014;24(2):419–24. 41. Kishimoto A, Ishiguro-Oonuma T, Takahashi R, Maekawa M, Toshimori K, Watanabe M, Iwanaga T. Immunohistochemical localization of GLUT3, MCT1, and MCT2 in the testes of mice and rats: the use of different energy sources in spermatogenesis. Biomed Res. 2015;36(4):225–34. 42. Galardo MN, Regueira M, Riera MF, Pellizzari EH, Cigorraga SB, Meroni SB. Lactate regulates rat male germ cell function through reactive oxygen species. PLoS One. 2014;9(1):e88024. 43. Lin R, Tao R, Gao X, Li T, Zhou X, Guan KL, Xiong Y, Lei QY. Acetylation stabilizes ATP-citrate lyase to promote lipid biosynthesis and tumor growth. Mol Cell. 2013;51(4):506–18. 44. Migita T, Okabe S, Ikeda K, Igarashi S, Sugawara S, Tomida A, Taguchi R, Soga T, Seimiya H. Inhibition of ATP citrate lyase induces an anticancer effect via reactive oxygen species: AMPK as a predictive biomarker for therapeutic impact. Am J Pathol. 2013;182(5):1800–10. 45. Hatzivassiliou G, Zhao F, Bauer DE, Andreadis C, Shaw AN, Dhanak D, Hingorani SR, Tuveson DA, Thompson CB. ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell. 2005;8(4):311–21.

Journal

Reproductive Biology and EndocrinologySpringer Journals

Published: Jun 2, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off