The role of G-protein-coupled membrane estrogen receptor in mouse Leydig cell function—in vivo and in vitro evaluation

The role of G-protein-coupled membrane estrogen receptor in mouse Leydig cell function—in vivo... In this study, G-coupled estrogen receptor (GPER) was inactivated, by treatment with antagonist (G-15), in testes of C57BL/6 mice: immature (3 weeks old), mature (3 months old) and aged (1.5 years old) (50 μg/kg bw), as well as MA-10 mouse Leydig cells (10 nM/24 h) alone or in combination with 17β-estradiol or antiestrogen (ICI 182,780). In G-15-treated mice, overgrowth of interstitial tissue was found in both mature and aged testes. Depending on age, differences in structure and distribution of various Leydig cell organelles were observed. Concomitantly, modulation of activity of the mitochondria and tubulin microfibers was revealed. Diverse and complex GPER regulation at the mRNA level and protein of estrogen signaling molecules (estrogen receptor α and β;ERα,ERβ and cytochrome P450 aromatase; P450arom) in G-15 Leydig cells was found in relation to age and the experimental system utilized (in vivo and in vitro). Changes in expression patterns of ERs and P450arom, as well as steroid secretion, reflected Leydig cell heterogeneity to estrogen regulation throughout male life including cell physiological status.We show, for the first time, GPER with ERs and P450arom work in tandem to maintain Leydig cell architecture and supervise its steroidogenic function by estrogen during male life. Full set of estrogen signaling molecules, with involvement of GPER, is crucial for proper Leydig cell function where each molecule acts in a specific and/or complementary manner. Further under- standing of the mechanisms by which GPER controls Leydig cells with special regard to male age, cell of origin and experimental system used is critical for predicting and preventing testis steroidogenic disorders based on perturbations in estrogen signaling. . . . Keywords Leydig cell G-coupled estrogen receptor Estrogen receptors, estrogens Ultrastructure Introduction Estrogen is a lipophilic hormone that easily dissolves in lipids, * M. Kotula-Balak allowing it to diffuse into the plasma membrane, resulting in malgorzata.kotula-balak@uj.edu.pl interactions with hydrophobic surfaces of proteins and other macromolecules. This allows estrogen to associate with recep- Department of Endocrinology, Institute of Zoology and Biomedical tors that may reside at the cell membrane or in the cytoplasm, Research, Jagiellonian University in Kraków, Gronostajowa 9, thereby promoting a diverse array of biochemical actions with 30-387 Krakow, Poland 2 different kinetics, including acute (non-genomic) or long-lasting Department of Developmental Biology and Invertebrate (genomic) actions. To date, estrogen receptors belonging to the Morphology, Institute of Zoology and Biomedical Research, Jagiellonian University in Kraków, Gronostajowa 9, two distinct receptor families have been described: estrogen 30-387 Krakow, Poland receptors ERα and ERβ that are categorized as steroid hormone Department of Genetics and Evolutionism, Institute of Zoology and receptors and G-protein-coupled membrane estrogen receptor Biomedical Research, Jagiellonian University in Kraków, (GPER), a member of the G-protein receptor superfamily Gronostajowa 9, 30-387 Krakow, Poland (Sharma and Prossnitz 2011; Sandner et al. 2014; Acconcia et Department of Cell Biology and Imaging, Institute of Zoology and al. 2016). ERs and GPER each participate in estrogen signaling Biomedical Research, Jagiellonian University in Kraków, and likely act in a coordinate manner. Each estrogen receptor Gronostajowa 9, 30-387 Krakow, Poland type is considered unique and independent based on genetic, Medical Biochemistry, Jagiellonian University Medical College, pharmacological, biological and biochemical evidence (that Kopernika 7, 31-034 Krakow, Poland Cell Tissue Res shows distinct physical and functional properties), as well as and human retinal ganglion cells (for review see Liao et al. displays individual phenotypes in knockout mice (Couse and 2015), while ERs splice variants present on the cell membrane Korach 1999; Carreau et al. 2003;Gaudetetal. 2015). (Irsik et al. 2013) have undiscovered a contribution to this Moreover, these receptors localize to diverse subcellular envi- signaling. ronments, possess a unique binding characteristic and interact Expression and function of GPER occur independently of distinctly with selective ligands promoting specific responses. the two nuclear ERs. GPER has a high affinity for estrogens In males, estrogen is produced by spermatogenic cells (of all but only a limited binding capacity with single estrogen- stages) and somatic cells of the testis. Leydig cells are the major binding sites (Lazari et al. 2009; Carreau and Hess 2010;Li source of estrogen in the adult testis, while Sertoli cells synthe- et al. 2015). Compared to ERs, its binding affinity for 17β- size the majority of estrogen in immature testis (Schulster et al. estradiol is considerably lower and the association and disso- 2016). The production of estrogens from androgens is ciation rates are very rapid. governed by cytochrome P450 aromatase within the endoplas- Using a Gper-lacZ reporter mouse, extensive expression of mic reticulum of cells, which is expressed also under spatio- testicular GPER was demonstrated (Isensee et al. 2009). Until temporal control. P450 aromatase is responsible for catalyzing recently, function of GPER in testicular cells was only partially the series of reactions that lead to the irreversible conversion of known. GPER expression was found in a mouse spermatogo- testosterone and androstenedione into estradiol and estrone, nia cell line GC-1 (Sirianni et al. 2008), in adult rat pachytene respectively (Carreau et al. 2003). A proper balance between spermatocytes and round spermatids (Chimento et al. 2010, androgen and estrogen is fundamental for normal male repro- 2011) highlighting a role for this receptor in spermatogenesis. ductive development and function in both animals and humans. Moreover, GPER expression has been currently demonstrated In various species including humans, a more significant estro- in Sertoli cells, highlighting their multiple function in seminif- gen concentration exists in the male reproductive tract and erous tubule physiology (Lucas et al. 2010, 2011). Sandner et semen than in the serum (Hess 2003). Interestingly, in boars, al. (2014) observed an inverse relationship of GPER the intratesticular estradiol level is higher than that in dams in expression and fertility in peritubular cells of monkey and estrus (Hoffmann et al. 2010). Regulation of testicular cells by human. Using qPCR, Fietz et al. (2014, 2016) showed estrogen shows both an inhibitory and a stimulatory influence, GPER expression in Leydig cells and Sertoli cells of human indicating an intricate symphony of dose-dependent and tem- testis. Expression level in Leydig cells was the highest when porally sensitive modulation. In various tissues, estrogen con- compared to Sertoli cells and human breast cancer (MCF-7) trols growth, differentiation and proliferation/apoptosis migra- cells. Unfortunately, GPER protein was not analyzed (due to tion of both normal and malignant cells (Barakat et al. 2016; problem with antibody). Thus, in primate peritubular cells, Acconcia et al. 2016). Estrogen is also a metabolic hormone GPER mediates estrogen action in both, testis in health and and it supervises the integrated physiology of tissues regulating disease. Our previous studies demonstrated the presence of lipid homeostasis (Shen and Shi 2015). GPER in Leydig cells of bank voles with various sex hor- In the male gonad, inhibition of steroidogenic Leydig cell mones levels; however, receptor expression was not altered regeneration in ethane dimethylsulfonate-treated rats, after in regard to normal or physiologically decreased intratesticular subsequent estradiol exposure, indicates Leydig cells self- estrogen concentration (Zarzycka et al. 2016). The involve- regulate their number via estrogen modulation in a paracrine ment in GPER action second messengers such as protein ki- fashion of fetal Leydig cell quantity (Abney and Myers 1991). nase A and extracellular signals-regulated kinase, as well as Furthermore, there is evidence suggesting that estradiol in- Ca2+, cAMP, cGMP and metalloproteinase 9, was reported hibits effect of lutropin (LH) on Leydig cells and excess es- too. Nonetheless, the role of GPER for Leydig cell morpho- trogen reduces serum testosterone levels (Hess 2003). The functional status needs further detailed attention. subsequent decrease of testosterone in turn inhibits spermato- It has been shown that GPER regulates the proliferative and genic function (Atanassova et al. 1999). Studies have con- apoptotic pathways involved in spermatogenesis (Prossnitz and firmed that, in the above processes, estrogen signaling via Barton 2011) but there are no data on steroidogenic testis func- ERs localized in testicular cells in a species-, age- and physi- tion. No clear developmental or functional defects in the repro- ological status-specific way takes place (for review see Hess ductive organs of GPER knockout male mice were reported 2000; Carreau et al. 2012). Of note, the unique presence of (Mårtensson et al. 2009;Ottoetal. 2009). On the other hand, ERβ in the mitochondria reported since now in cells of human GPER knockouts were moderately obese with larger adipocyte uterus, ovary, cardiomyocytes, rat primary neurons, human size indicating lipid homeostasis disturbances. It should be bone narrow neuroblast (SH-SY5Y) cells, lens epithelial cells, mentioned here that although there are still controversies on sperm, human breast cancer (MCF-7) cells, human non-small ERβ knockout mouse fertility, ERα knockouts exhibit various cell lung cancer (NSCLC) cells, human adenocarcinomic al- reproductive organ defects (Krege et al. 1998; Antal et al. 2008; veolar basal epithelial (A549) cells, human hepatoma Lee et al. 2009). In efferent ducts, fluid absorption is altered due (HepG2) cells, human osteosarcoma (SaOS-2 and 143B) cells to aquaporin 1 and carbonic anhydrase dysfunction (Hess Cell Tissue Res 2000). The role of GPER in the male reproductive system is Ni-U microscope (Nikon, Tokyo, Japan). A tubus setting of complex and regulated at multiple levels, thus requiring further 1.25, a × 10 ocular and a × 10 objective was used for the in-depth investigation. This study aims to better understand the measurements. Detailed morphologic analysis was performed involvement of GPER in Leydig cell function via examination with the use of NIS-Elements software (Nikon, Tokyo, Japan), of the morpho-functional and secretion status of these cells. as previously described (Kotula-Balak et al. 2012). The area of Moreover, the interaction between GPER and ERs together the interstitium occupied by Leydig cells was determined in 40 with P450 aromatase is a crucial goal of the present study. To random fields of vision (which corresponds to 17.7 mm )for our knowledge, this is the first in vitro and in vivo study on the each animal from the control and treated groups. A mean was importance of GPER in testicular Leydig cell biology. determined for control animals and those treated with G-15. Cell culture and treatments Materials and methods The mouse Leydig cell line MA-10 was a generous gift from Animals and treatments Dr. Mario Ascoli (University of Iowa, Iowa City, USA) and was maintained under standard technique (Ascoli 1981). Male mice (C57BL/6) 3 weeks old (n = 10), 3 months old (n = Middle passages (p25-p28) of MA-10 cells were used for 10) and 1.5 years old (n = 10) were obtained from the the study. The cells were grown in Waymouth’smedia Department of Genetics and Evolution, Institute of Zoology (Gibco, Grand Island, NY) supplemented with 12% horse and Biomedical Research, Jagiellonian University, Kraków. serum and 50 mg/l of gentamicin at 37 °C in 5% CO .Cells Animals were maintained on 12 h dark-light (250 lx at cages were plated overnight at a density of 1 × 10 cells/ml per well. level) cycle with stable temperature condition (22 °C), relative Morphological and biochemical properties of MA-10 cells humidity of 55 ± 5% and free access to water and standard were regularly checked by microscopic observation, analysis pelleted diet (LSM diet, Agropol, Motycz, Poland). Animals of proliferation (TC20 Bio-Rad automated cell counter), my- were killed by cervical dislocation. The use of the animals was coplasma detection (MycoFluor™ Mycoplasma Detection approved by the National Commission of Bioethics at the Kit; ThermoFisher Scientific), qRT-PCR analysis of charac- Jagiellonian University in Krakow, Poland (No. 151/2015). teristic genes and ELISA measurements of secretion products Mice from various age groups were allotted into experimental according to cell line authentication recommendations of the groups (each group including 5 animals); and control (Cont.) and Global Bioresource Center (ATCC). treated receiving selective GPER receptor antagonist Twenty-four hours before the experiments, the medium was [(3aS*,4R*,9bR*)-4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b- removed and replaced with a medium without phenol red sup- 3H-cyclopenta[c]quinolone; G-15] (Tocris Bioscience, Bristol, plemented with 5% dextran-coated, charcoal-treated FBS (5% UK). G-15 was dissolved in DMSO and the stock solutions were DC-FBS) to exclude estrogenic effects caused by the medium. kept at − 20 °C. Animals from the experimental groups were Next, cells were treated with selective GPER receptor antago- injected subcutaneously with freshly prepared solutions of G- nist [(3aS*,4R*,9bR*)-4-(6-bromo-1,3-benzodioxol-5-yl)- 15 (50 μg/kg bw) in phosphate buffered saline (six doses each 3a,4,5,9b-3H-cyclopenta[c]quinolone; G-15] (Tocris dose injected every other day). Mice from control groups re- Bioscience, Bristol, UK) freshly prepared 100 μM stock solu- ceived vehicle only. Dose, frequency and time of G-15 adminis- tion in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) stored at tration were based on literature data (Dennis et al. 2009;Anetal. − 20 °C. A stock concentration was subsequently dissolved in 2014;Kangetal. 2015) and it was finally selected upon our Waymouth’s media to final concentration of 10 nM. Cells were preliminary study in mice in vivo (doses range between 5, 50, treated with G-15 alone or together with 17β-estradiol (Sigma- 100, 150, 200 μg/kg bw). Both testes of each individual of con- Aldrich; 10 mM) and ER antagonist ICI 182,780 (ICI; trol and G-15-treated mice were surgically removed and were cut Faslodex, Sigma–Aldrich, St. Louis, MO, USA; 10 μM) fresh- into small fragments. For histology and immunohistochemistry, ly prepared in ethanol, for 24 h. Dose of G-15 was based on tissue samples were fixed in 10% formalin and embedded in literature data (Dennis et al. 2011; Bertrand et al. 2015; paraplast. Small pieces of the testicular tissue were immediately Carnesecchi et al. 2015; Treen et al. 2016) and it was finally fixed in glutaraldehyde for transmission microscopy analysis or selected upon our preliminary study (dose range 1, 10, frozen in a liquid nitrogen and stored at − 80 °C for RNA isola- 100 nM). Doses of E2 and ICI were based on our previous tion and determination of steroid hormones. studies (Kotula-Balak et al. 2013;Pardyaketal. 2016;Milon et al. 2017). Control cells were treated with DMSO or ethanol Histology or both together (final conc. 0.1%). We performed microscopic analysis of ultrastructure, as well as mitochondria activity and For routine histology, hematoxylin-eosin staining was per- cytoskeleton structure of Leydig cells. Culture media were fro- formed. The sections were examined under a Nikon Eclipse zen in − 20 °C for steroid hormone level determination. Cell Tissue Res Ultrastructure assessed using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Samples with a The fixation procedure described below was based on the 260/280 ratio of 1.95 or greater and a 260/230 ratio of 2.0 or protocols proposed by Russell and Burguet (1977). The mod- greater were used for analysis. Total cDNA was prepared ification developed in our labs had important advantages: it using High-Capacity cDNA Reverse Transcription Kit improved the quality of fixation and enhanced the contrast of (Applied Biosystems, Carlsbad, CA, USA) according to the plasma membrane and the organelles. Briefly, Leydig cells in manufacturer’sinstructions. vitro and dissected testes (control and G-15-treated) were im- The purified total RNA was used to generate total cDNA. A mersed in ice-cold pre-fixative containing 2% formaldehyde volume equivalent to 1 μg of total RNAwas reverse transcribed and 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.3. using the High-Capacity cDNA Reverse Transcription Kit The tissues were then rinsed and post-fixed in a mixture of 2% (Applied Biosystems, Carlsbad, CA, USA) according to the osmium tetroxide and 0.8% potassium ferrocyanide in the manufacturer’s instructions. Total cDNA was prepared in a same buffer for 30 min at 4 °C. The material was embedded 20-μL volume using a random primer, dNTP mix, RNase in- in Glycid Ether 100 resin (Serva, Heidelberg, Germany). hibitor and reverse transcriptase (RT). Parallel reactions for Semi-thin sections (0.7 μm thick) were stained with 1% meth- each RNA sample were run in the absence of RT to assess ylene blue and examined under a Leica DMR (Wetzlar, genomic DNA contamination. RNase-free water was added Germany) microscope. Prior to embedding, small (3–5mm) in place of the RT product. pieces of testicular tissue were carefully oriented in the mold to obtain accurate cross-sections of the tubules. Ultrathin sec- Real-time quantitative RT-PCR tions (80 nm thick) were contrasted with uranyl acetate and lead citrate and analyzed with a JEOL 2100 HT (Japan) TEM. Real-time RT-PCR was performed using the StepOne Real- Time PCR system (Applied Biosystems) and optimized stan- Mitochondrial activity and cytoskeleton structure dard conditions as described previously by Kotula-Balak et al. (2012, 2013). Based on the gene sequences in the Ensembl Leydig cells (control, G-15, and estradiol-treated) were grown database, primer sets were designed using Primer3 software on coverslips (Ø12 mm; Menzel Gläser, Germany) and used (Table 1). Selected primers were synthesized by the Institute as live. For mitochondrial activity analysis, MitoTracker™ of Biochemistry and Biophysics, Polish Academy of Science Orange CMTMRos (Thermo Fisher Scientific) was applied. (Warsaw, Poland). Preparation of dye stock solution (1 mM in DMSO) and pre- To calculate the amplification efficiency, serial cDNA di- formation of staining was prepared based on manufacturer’s lution curves were produced for all genes (Pfaffl 2001). A protocol. For tubulin filaments labeling Tubulin Tracker™ graph of threshold cycle (Ct) versus log10 relative copy num- Oregon Green ® (Thermo Fisher Scientific), 500 μMin ber of the sample from a dilution series was produced. The DMSO according to manufacturer’s protocol was used. slope of the curve was used to determine the amplification –1/slope−1 Stained cells were analyzed in a LSM 510 META confocal efficiency: %E = (10 ) × 100. All PCR assays system with a Zeiss Axiovert 200M inverted microscope (Carl displayed efficiency between 94 and 104%. Zeiss GmbH, Jena, Germany). To evaluate the intensity of Detection of amplification products for GPER, ERα, ERβ fluorescence quantitatively, digital images were obtained and and P450arom and for the reference gene Tubulin a1α analyzed using public domain ImageJ software (National (Tuba1α), was performed with 10 ng cDNA, 0.5 μMprimers Institutes of Health, Bethesda, Maryland, USA). The intensity and SYBR Green master mix (Applied Biosystems) in a final of fluorescence was calculated using the formula described by volume of 20 μL. Amplifications were performed as follows: Smolen (1990) and expressed as relative fluorescence in arbi- 55 °C for 2 min, 94 °C for 10 min, followed by annealing trary units. Results of 20–30 separate measurements were temperature for 30 s (Table 1) and 45 s 72 °C to determine expressed as mean ± SD. the cycle threshold (Ct) for quantitative measurement as de- scribed previously (Kotula-Balak et al. 2013). To confirm am- RNA isolation, reverse transcription plification specificity, the PCR products from each primer pair were subjected to melting curve analysis and subsequent aga- Total RNA was extracted from control and G-15-treated rose gel electrophoresis. In all real-time RT-PCR reactions, a mouse testes and Leydig cells using TRIzol® reagent (Life negative control corresponding to RT reaction without the re- Technologies, Gaithersburg, MD, USA) according to the man- verse transcriptase enzyme and a blank sample were carried ufacturer’s instructions. To remove contaminating DNA and out (not shown in all figures). All PCR products stained with DNase from RNA preparations, the RNA samples were incu- Midori Green Stain (Nippon Genetics Europe GmbH, Düren, bated with reagents from the TURBO DNA-free™ Kit Germany) were run on agarose gels. Images were captured (Ambion, Austin, TX). The yield and quality of the RNAwere using a Bio-Rad Gel Doc XR System (Bio-Rad Laboratories, Cell Tissue Res Table 1 Sequences of forward and reverse primers Genes Primers (5′–3′) GCCTCT Product size (bp) Annealing temperature (°C) Cycles References GPER 5′- CTGGACGAGCAGTATTACGATATC - 3′ 295 62 35 http://www.ensembl.org 5′- TGCTGTACATGTTGATCTG - 3′ (ENSMUSG00000053647) P450arom 5′- CCCCTGGACGAAAGTTCTATTG - 3′ 238 62 35 http://www.ensembl.org 5′- CAGCGAAAATCAAATCAGTTGC - 3′ (ENSMUSG00000032274) ERα 5′- GCGCAAGTGTTACGAAGTGG - 3′ 375 60 40 http://www.ensembl.org 5′- AAGCCTGGCACTCTCTTTGC - 3′ (ENSMUSG00000019768) ERβ 5′- TCTGTGTGAAGGCCATGATC - 3′ 237 60 40 http://www.ensembl.org 5′- GCAGATGTTCCATGCCCTTG - 3′ (ENSMUSG00000021055) TUBa1α 5′- CGGAACCAGCTTGGACTTCTTTCCG - 3′ 321 60 40 http://www.ensembl.org 5′- GGAACTGGCTCTGGCTTCACC - 3′ (ENSMUST00000134214) GPER G-coupled membrane estrogen receptor, P450arom cytochrome P450 aromatase, ERα estrogen receptor alpha, ERβ estrogen receptor beta, TUBa1α tubulin a1α Hercules, CA, USA). GPER, ERα, ERβ and P450arom peroxidase complex (ABC/HRP; 1:100; Dako, Glostrup, mRNA expressions were normalized to the Tuba1α mRNA Denmark) were applied in succession. Bound antibody was (tested with other references genes: GAPDH and β-actin in a visualized with 3,3′-diaminobenzidine (DAB) (0.05%; v/v; pilot study) (relative quantification, RQ = 1) with the use of the Sigma-Aldrich) as a chromogenic substrate. Control sections −ΔΔCt 2 method, as previously described by Livak and included omission of primary antibody and substitution by Schmittgen (2001). irrelevant IgG. Thereafter, sections were washed and were Three independent experiments were performed, each in slightly counterstained with Mayer’s hematoxylin and triplicate with tissues prepared from different animals. mounted using DPX mounting media (Sigma–Aldrich). Immunocytochemistry or immunofluorescence labeling Immunohistochemistry, immunocytochemistry was performed on Leydig cells (prepared as previously men- and immunofluorescence tioned). Cells were fixed using 4% paraformaldehyde for 5 min or absolute methanol for 7 min followed by acetone To optimize immunohistochemical staining, testicular sections for 4 min both at − 20 °C respectively. Next, only cells for immunocytochemistry were rinsed in TBS containing 0.1% both control and G-15-treated were immersed in 10 mM citrate buffer (pH 6.0) and heated in a microwave oven (2 × 5 min, Triton X-100. Nonspecific binding sites were blocked with 700 W). Thereafter, sections were immersed sequentially in 5% normal goat serum for 30 min. Thereafter, cells were in- H O (3%; v/v) for 10 min and normal goat serum (5%; v/v) cubated overnight at 4°C in a humidified chamber in the pres- 2 2 for 30 min that were used as blocking solutions. Afterwards, ence of primary antibodies listed in Table 2. On the next day, sections were incubated overnight at 4 °C with primary anti- biotinylated antibody goat anti-rabbit (1:400; Vector bodies listed in Table 2. Next, respective biotinylated antibod- Laboratories) or Alexa Fluor 488 goat anti-rabbit antibody ies (anti-rabbit, anti-goat, and anti-mouse IgGs; 1: 400; Vector, (1:100; Invitrogen, Co., Carlsbad, CA, USA) was applied Burlingame CA, USA) and avidin-biotinylated horseradish for 45 and 60 min, respectively. After each step in these Table 2 Primary antibodies used for immunocyto-, immunohisto- and immunofluorescence Antigen Host species of Vendor Dilution Host species of secondary antibodies Vendor primary antibodies GPER Rabbit Abcam 1:50 (ICC) Biotinylated goat anti-rabbit (ICC, IHC) Vector Laboratories cat.no. ab39742 1:250 (IHC) BA-1000 1:100 (IF) Alexa Fluor 488 goat anti-rabbit (IF) Thermo Fisher Scientific A-11008 P450arom Rabbit Santa Cruz Biotechnology 1:100 (ICC) Goat anti-rabbit Vector Laboratories cat.no. sc-30086 1:500 (IHC) BA-1000 ERα Rabbit Abcam 1:20 (ICC) Goat anti-rabbit Vector Laboratories cat.no. ab75635 1:100 (IHC) BA-1000 ERβ Rabbit Abcam 1:20 (ICC) Goat anti-rabbit Vector Laboratories cat.no. ab3576 1:50 (IHC) BA-1000 GPER G-coupled membrane estrogen receptor, P450arom cytochrome P450 aromatase, ERα estrogen receptor alpha, ERβ estrogen receptor beta Cell Tissue Res procedures, cells were carefully rinsed with TBS; the antibod- Estradiol concentrations were measured using ies were also diluted in TBS buffer. The staining for the light [2,4,6,7- H]-estradiol (specific activity 81 Ci/mmol: microscopy was developed using ABC/HRP complex for American Radiolabeled Chemicals, Inc.) as a tracer and rabbit 30 min followed by DAB. Thereafter, cells were washed and antibody against estradiol-17-O-carboxymethyloxime: BSA were slightly counterstained with Mayer’s hematoxylin and (a gift from Institute of Pharmacology, Polish Academy of mounted using DPX mounting media (Sigma–Aldrich). Sciences, Krakow, Poland). The lower limit of sensitivity of Cells were examined with a Leica DMR microscope (Leica the assays was 5 pg. Cross-reaction was 1% with keto- Microsystems, Wetzlar, Germany). Fluorescent staining was oestradiol-17b, 0.8% with estrone, 0.8% with estriol, 0.01% protected from light and cells were mounted with Vectashield with testosterone and less than 0.1% with major ovarian ste- mounting medium (Vector Labs) with 40,6-diamidino-2- roids. Coefficients of variation within and between assays phenylindole (DAPI) or without DAPI and next examined were below 4 and 7.5%, respectively. Assays were validated with an epifluorescence microscope Leica DMR (Leica by demonstrating parallelism between serial dilutions of cul- Microsystems) equipped with appropriate filters. ture media and standard curve. Coefficients of variation within The whole procedure was described in detail elsewhere and between each assay were 7.6 and 9.8%, respectively. The (Kotula-Balak et al. 2013; Zarzycka et al. 2016; Pawlicki et al. recovery of unlabeled steroids was also assessed (never less 2017). Experiments were repeated three times. than 90%). In addition to monitoring intra-assays and inter- assays, assay quality control was assessed by control samples Radioimmunoassay representing low, medium and high concentrations of mea- sured hormones. Samples (each in triplicate with tissues pre- Culture media (100 μl) of control and G-15, E2, ICI-treated pared from different animals) were counted in a scintillation Leydig cells were analyzed for progesterone content using the counter (LKB 1209 RACKBETA LKB; Turku, Finland). The radioimmunological technique described elsewhere (Abraham concentrations of sex steroids were calculated as pg/10 cells. et al. 1971). Progesterone level was determined using [1,2,6,7- H]-progesterone (Amersham International plc), spe- Statistical analysis cific activity 96 Ci/mmol, as a tracer and an antibody raised in a sheep against 11β-hydroxyprogesterone succinyl-bovine Each variable was tested by using the Shapiro-Wilk W test for serum albumin (BSA), (a generous gift from Prof. Brian normality. Homogeneity of variance was assessed with Cook, University Glasgow, Scotland, UK). Progesterone assay Levene’s test. Since the distribution of the variables was nor- was validated by demonstrating parallelism between serial di- mal and the values were homogeneous in variance, all statis- lutions of culture media and standard curve. It cross-reacted tical analyses were performed using one-way analysis of var- with pregnenolone (1.8%), corticosterone (1.5%), 17α- iance (ANOVA) followed by Tukey’s post hoc comparison hydroxyprogesterone (only 0.8%) and testosterone (only test to determine which values differed significantly from con- 0.12%). Binding of four related steroids such as 20α- trols. The analysis was made using Statistica software dihydroprogesterone, 20β-dihydroprogesterone, 17α- (StatSoft, Tulsa, OK, USA). Data were presented as mean ± hydroxy-20 β-dihydroprogesterone, 17α and 20α- SD. Data were considered statistically significant at p <0.05. hydroxyprogesterone and other steroids was below 0.01%. Coefficients of variation within and between assays were 5.0 and 9.8%, respectively. Results To determine and testosterone and estradiol level in testic- ular homogenates of control and G-15-treated mouse testes, GPER mRNA level and protein localization in mouse the radioimmunological technique described elsewhere testes and Leydig cells (Hotchkiss et al. 1971; Dufau et al. 1972;Pawlicki etal. 2017) was used. Testosterone levels were assessed using Depending on animal age, as well as Leydig cell of origin [1,2,6,7- H]-testosterone (specific activity 110 Ci/mmol; (mouse testis or tumor mouse Leydig cell line), differences American Radiolabeled Chemicals, Inc.) as a tracer and rabbit in mRNA level were found (Fig. 1a, b). G-15 treatment de- antibody against testosterone-3-0-CMO:BSA (a gift from Dr. creased expression of GPER in all treated age groups, with a B. Ričařova, Institute of Radiology, Czech Academy of significant decrease in mature animals (p <0.01). In MA-10 Sciences, Prague, Czech Republic). The lower limit of sensi- Leydig cells treated with G-15, a significant decrease (p < tivity was 5 pg. Cross-reaction of this antibody was 18.3% 0.05) was observed as well. with dihydrotestosterone, 0.1% with androstenedione and less In immature, mature and aged testis sections, membrane- than 0.1% with other major testis steroids. Coefficients of var- cytoplasmic localization of GPER was found (Fig. 1c–e). In iation within and between assays were below 5.0 and 9.7%, MA-10 Leydig cells, GPER was exclusively localized to the respectively. membrane (Fig. 1f). Cell Tissue Res Fig. 1 GPER mRNA level and protein localization in mouse testes and Representative microphotographs of cellular localization of GPER in Leydig cells. (a–f’). a Representative gel electrophoresis of qualitative membrane and cytoplasm of Leydig cells of immature (c), mature (d) expression, (line N1-negative control without complementary DNA tem- and aged (e) mouse testes and in membrane of mouse MA-10 Leydig plate, line N2-negative control without nonreverse transcribed RNA), b cells (f) (arrows). Immunostaining with DAB and counterstaining with and relative quantification (RQ) of mRNA for GPER in mouse testes; hematoxylin (c–e). Scale bars represent 15 μm. Staining was performed immature, mature, aged [control and G-15 (50 μg/kg bw)-treated] and on testicular serial sections from at least three animals from each group. mouse MA-10 Leydig cells [control and G-15 (10 nM)-treated]. RQ is Immunofluorescence with DAPI (f, f’). Scale bars represent 20 μm. expressed as means ± SD. Asterisks show significant differences between Immunoreaction was performed on Leydig cell cultures in triplicate. control and G-15-treated testes/cells. Values are denoted as *p <0.05 **p Inserts in (c–e)and (f’)—negative controls—no immunostaining is visi- < 0.01. From each animal, three mRNA samples were analyzed. (c–f’) ble when the primary antibody is omitted Effect of GPER blockage on mouse testis histology in lumens of tubules when compared to mature animals was and Leydig cells morphology observed (Fig. 2e, f and c, d). In treated males, when compared to controls, a slight increase in the interstitial tissue volume G-15 treatment exerted no effect on immature testis while a was revealed (2.69 ± 0.05* vs 2.06 ± 0.09 mm ). slight effect was observed in mature and aged mouse testis histology (Fig. 2a–f). In control and treated immature males, Effect of GPER blockage on Leydig cell ultrastructure the seminiferous tubules filled up with spermatogenic cells and small clusters of Leydig cells were observed (Fig. 2a, b). In Control immature Leydig cells exhibit normal ultrastructure control and treated mature males, normal seminiferous tubules possessing numerous mitochondria (m) and lipid droplets (ld) with full spermatogenesis were seen (Fig. 2c, d). In addition, (Fig. 3a, b). After G-15 treatment more lipid droplets were overgrowth of interstitial tissue was visible when compared to seen, some surrounded with concentrically located endoplas- control (2.21 ± 0.20 vs 1.97 ± 0.14 mm ). In both control and mic reticulum (er) cisternae, thereby suggesting formation of treated aged animals, a small number of elongated spermatids new lipid droplets (Fig. 3c, d). In control mature Leydig cells, Cell Tissue Res Fig. 2 Effect of GPER blockage on mouse testis histology and Leydig spermatogenesis in seminiferous tubules of both control and G-15 mature cells morphology (a–f). Representative microphotographs of (a, c, e) males (c, d). Leydig cells in small groups in control (c) but enlarged control and (b, d, f) G-15 (50 μg/kg bw)-treated mouse testes. (a, b) interstitial tissue with Leydig cells after exposure to G-15 (d)(arrows) Immature (c, d) mature and (e, f) aged mouse testicular sections. is visible. Full spermatogenesis but not as active as in mature mice is Hematoxylin-eosin staining. Scale bars represent 15 μm. Staining was observed in aged control and G-15 males (compare number of elongated performed on testicular serial sections from at least three animals of each spermatids in lumens of tubules c, d and e, f). Leydig cells surrounding experimental group. Small clusters of Leydig cells and not active semi- seminiferous tubules and located in groups. Subtle differences in niferous tubules but with open lumens in a majority of tubules, in both abundancy of interstitial tissue are seen between control and G-15 aged control and G-15-treated immature males are observed (a, b). Full males (arrows) (e, f) lipid droplets were less numerous than in immature cells cisternae, probably non-active and degenerating, between (Fig. 4a). Golgi complexes (Gc) and rough endoplasmic retic- normal-looking mitochondria were revealed (Fig. 5c–e). ulum (rer) were frequently seen. In cells treated with G-15, large mitochondria and numerous lipid droplets were revealed (Fig. 4b–d). They were localized in relatively large accumula- Effect of GPER blockage on Leydig cell mitochondrial tions, indicating cytoskeleton alternations. In control-aged activity and cytoskeleton structure Leydig cells, the endoplasmic reticulum, mitochondria and lip- id droplets were normally distributed (Fig. 5a, b). After G-15 After Leydig cell treatment with each of the mentioned agents, treatment, concentrically in structure endoplasmic reticulum no morphological alterations were seen (not shown). Cell Tissue Res Fig. 3 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– d Immature Leydig cells ultrathin sections. a Control immature Leydig cells exhibit normal mor- phology. In control immature Leydig cells, numerous mito- chondria (m) and lipid droplets (ld) are seen (a). b–d After G-15 treatment in immature Leydig cells, more lipid droplets (ld) are observed; some of them are surrounded with concentrically located rough reticulum endo- plasmic (er) cisternae (c;arrow) Control Leydig cells were undisturbed, exhibiting high mi- and aged mice, both control and experimental (G-15-treated), tochondrial activity (Fig. 6a–i and j) and a normal tubulin as well as control and experimental Leydig cells (G-15-, E2-, cytoskeleton structure (Fig. 6k–m and n). In cells treated with ICI-treated alone or in combination), revealed changes in the G-15, decrease in mitochondrial (p < 0.05) and tubulin activ- expression level of the studied genes (Fig. 7a–h). No marked ity was revealed. A marked decrease (p < 0.05) in mitochon- differences in TUBa1α levels were revealed either in control dria function and tubulin structure (p < 0.05) was found after and experimental mouse testes of various age or MA-10 treatment with G-15 and E2. After treatment with ICI and E2 Leydig cells (Fig. 7a, e). alone or in combination (ICI + E2 and ICI + G-15), no signif- In treated mice of different ages, a similar trend in expres- icant changes in the mitochondria and tubulin activity were sion of estrogen receptors and aromatase was found. In testes revealed (not shown). with G-15 treatment, significant increase in expressions of ERα (p <0.05; p <0.01), ERβ (p < 0.001) and P450arom (p Effect of GPER blockage on mRNA expression <0.05; p < 0.01) were observed when compared to their re- of aromatase and estrogen receptors α and β spective controls (Fig. 7a–d). in mouse testes and Leydig cells in vitro In in vitro Leydig cells, the same tendency of in vivo ex- pression of the respective genes was revealed (Fig. 7e–h). Electrophoresis revealed PCR-amplified products of the pre- Treatment with E2, ICI, or G-15 alone increased the expres- dicted sizes: 375 bp for ERα, 237 bp for ERβ, 238 bp for sions of ERα (p <0.05; p < 0.01), ERβ (p <0.01) and P450arom and 321 bp for tubulin a1α (TUBa1α; reference P450arom (p <0.05; p < 0.01). Treatment of Leydig cells with gene) in both mouse testes and Leydig cells in vitro (Fig. 7a– E2, ICI, or G-15 in combination increased expression of both h). Real-time RT-PCR analysis in testes of immature, mature estrogen receptors and aromatase in comparison to controls; Cell Tissue Res Fig. 4 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– d Mature Leydig cells ultrathin sections. In control mature Leydig cells, lipid droplets (ld) are less numerous. a, b Mature Leydig cells exhibit normal morphology. Golgi complexes (Gc) and rough ER (rer) are frequently observed (a, b). c, d In G-15 mature Leydig cells, large mitochondria (m) and numerous lipid droplets (ld) lo- calized in large accumulations are visible however, the increase was lower (only significant for aroma- mice (Fig. 8e, f). Immunoexpression of aromatase in both tase p < 0.05) when compared to the individual treatments groups was of moderate intensity. A slight increase in ERα with these agents. expression in the nuclei and in Leydig cell cytoplasm was noted after G-15 treatment of immature mice (Fig. 9a, b). In Effect of GPER blockage on aromatase and estrogen both mature and aged controls and G-15-treated, no change in receptors localization in mouse testes and Leydig cells ERα expression was observed. Increased expression was in vitro seen in mature males while moderate expression was ob- served in the nuclei and cytoplasm of aged Leydig cells When blocked by G-15, immunoexpression of aromatase, (Fig. 9c–f). A slight decrease in ERβ expression was found ERα and ERβ in immature, mature, or aged Leydig cells in the cytoplasm of immature males in comparison to controls was altered (Fig. 8a–f). In testes of immature males, no chang- (Fig. 10a, b). ERβ expression was moderate in controls and es in aromatase expression after G-15 treatment were found weak in G-15-exposed males and found to be exclusively when compared to controls (Fig. 8a, b). Immunostaining was localized in the cytoplasm of Leydig cells of mature mice observed in the cytoplasm of all Leydig cells. Increased aro- (Fig. 10c, d). In control aged males, moderate, cytoplasmic matase expression was found in Leydig cells of G-15-treated expression of ERβ was found partially localized to the nucle- mature males while downregulated expression was observed us in Leydig cells of males treated with G-15 (Fig. 10e, f). In in control ones (Fig. 8c, d). No difference in expression of negative controls, no positive staining was observed aromatase was noted between control and G-15-treated aged (Figs. 8a, 9c,and 10e). Cell Tissue Res Fig. 5 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– e Aged mouse Leydig cells ultra- thin sections. Each testicular sample in the epoxy resin block was cut for at least three ultrathin sections that were analyzed. Bars represent 1 μm. Analysis was performed on testicular blocks from at least three animals of each experimental group. Aged Leydig cells exhibit normal morphology. In control aged Leydig cells, nor- mal number and localization of endoplasmic reticulum (er), mito- chondria (m) and lipid droplets (ld) are seen (a, b). (c–e)Note, in G-15 aged Leydig cells, the con- centric structure of endoplasmic reticulum (er) cisternae (asterisks; c, e) in between normal-looking and normal-distributed mitochon- dria (c, d). (nu) nucleus Weak to moderate aromatase immunoreaction was found in with both E2 and ICI, strong nuclear immunostaining was the cytoplasm of all control Leydig cells (Fig. 11a). Increased present in a minority of cells (Fig. 11j, k). G-15 treatment aromatase expression was observed after E2 treatment revealed weak immunostaining in single Leydig cells (Fig. 11b). Following treatment with ICI, weak staining was (Fig. 11l) but that was not seen in cells treated with ICI to- observed while after G-15 moderate staining was revealed gether with E2 or G-15 (Fig. 11m, n). In cells exposed to G-15 (Fig. 11c, d). Combined treatments of ICI with E2, G-15 with with E2, moderate to strong immunostaining was detected in E2 and G-15 with ICI resulted in strong to moderate aroma- the cytoplasm (Fig. 11o). Expression of ERβ was moderate in tase expression in a majority of treated cells (Fig. 11e–g). the nuclei of control Leydig cells (Fig. 11q). E2 treatment Strong immunoexpression of ERα was observed in the nuclei increased ERβ expression that was still visible in the nuclei, of a majority of control Leydig cells (Fig. 11i). After treatment while some cells exhibited cytoplasmic staining (Fig. 11r). In Cell Tissue Res Cell Tissue Res Fig. 6 Effect of GPER blockage on Leydig cell mitochondrial activity receptors (ERα,ERβ) are present at every stage of gonad and cytoskeleton structure. Representative microphotographs and graphs development (Lemmena et al. 1999; Jefferson et al. 2000; of (a–j) mitochondrial activity and (k–n) cytoskeleton structure in Carreau et al. 2003; Lazari et al. 2009). GPER has been control, G-15- and E2- treated MA-10 Leydig cells. Representative mi- identified in a variety of human and rodent estrogen target crophotographs of cellular localization of MitoTracker (a–i) in cytoplasm of control (a, g), G-15 (b, h) and G-15 with E2 (17β-estradiol) (c, i)- tissues; thus, its important role in estrogen signaling is cur- treated Leydig cells. Immunofluorescence with DAPI (d–f). rently highlighted (Chimento et al. 2010; Sandner et al. Representative microphotographs of cellular localization of 2014;Heubleinetal. 2012;Zarzyckaetal. 2016). GPER TubulinTracker in cytoplasm of control (k), G-15 (l) and G-15 with E2 has been suggested to play a role in multiple systems: skel- (m)-treated Leydig cells. Fluorescence without DAPI. Scale bars repre- sent 20 μm. Samples of cultured Leydig cells were measured in triplicate. etal (under sex-depending manner regulation), immune, Quantitative analysis of fluorescence of MitoTracker (j)and cardiovascular and renal (Prossnitz and Barton 2011). TubulinTracker (n). Histograms of fluorescent intensities expressed as However, little is known about the role of GPER in both relative fluorescence (arbitrary units; a.u.). Data are expressed as means reproductive and nonproductive cell and tissue biology ± SD. Asterisks show significant differences between control and G-15 (50 μg/kg bw) - treated mouse testes and control and G-15 (10 nM), E2 from birth to aging. Interestingly, in frogs, early expression (10 nM) - treated cells for 24 h. Values are denoted as p <0.05 of GPER and aromatase in neuromasts revealed its impor- tance in lateral line system development (Hamilton et al. 2014). Recent, initial studies by Zhang et al. (2015)dem- a majority of ICI-treated cells, ERβ staining was weak onstrated the involvement of GPER in the proper formation (Fig. 11s) while, after treatment with G-15 and ICI, E2 stain- and growth of mouse gubernaculum. In the reproductive ing had strong to moderate intensity and was located in the system, GPER was shown to regulate the proliferative and nuclei of a majority of the cells (Fig. 11t, u). After combined apoptotic pathways involved in spermatogenesis through- treatment of G-15 and E2, cytoplasmic staining of ERβ was out rat reproductive development (Lucas et al. 2014). In observed (Fig. 11v). Moderate to weak nuclear ERβ staining pachytene spermatocytes and round spermatids, GPER ac- was detected after G-15 and ICI exposure (Fig. 11w). In neg- tivated the epidermal growth factor receptor/extracellular ative controls, no positive staining was observed (Fig. 11h, p, signal-regulated kinases (EGFR/ERK) pathway, thereby in- and x). ducing the transcriptional modulation of genes controlling apoptosis and differentiation (Chimento et al. 2014). Effect of GPER on sex steroid concentration in mouse In steroidogenic Leydig cells, estrogen supervises overall testes and secretion by Leydig cells in vitro growth, development and function of these cells acting both as a modulator of precursor populations while also inhibiting The highest androgen concentration was revealed in mature steroidogenesis via the effect on LH (Abney 1999). The action of GPER in estrogen signals requires much mice when compared to immature and aged (Fig. 12a). After treatment with G-15, intratesticular androgen concentration consideration. The results presented here are the first to report significantly increased (p < 0.01) in immature mice while it on the influence of GPER on testicular Leydig cell morphol- decreased (p < 0.001) in mature males. In both aged controls ogy and function. Intratesticular estrogen concentrations, as and G-15-treated animals, no changes in androgen concentra- well as balanced estrogen and androgen concentrations, are tions were found. Intratesticular estrogen concentrations were crucial for undisturbed testis function. Any change in the sex significantly lower in immature and aged males in comparison hormone environment leads to alterations in Leydig cell to those in mature animals (Fig. 12b). Treatment with G-15 physiology that affects the action of seminiferous tubules did not create marked changes in estrogen levels. In mature and vice versa. Our results add to the current knowledge that animals, high amounts of estrogen were decreased pro- individual cells/tissues may modulate estrogen action via nouncedly (p < 0.001) after G-15 exposure. GPER in response to intrinsic factors (e.g., gender, age, genes In Leydig cells, progesterone secretion increased markedly activity) or extrinsic modulators of estrogen (e.g., synthetic (p < 0.001) after treatment with E2 alone or in combination estrogens/environmental estrogens) to determine its function with ICI or G-15 in comparison to controls (Fig. 12c). Neither (Filardo and Thomas 2012;Planteet al. 2012). It is not sur- ICI, G-15 alone, nor in combination decreased progesterone prising that the highest expression of GPER exists in mature secretion when compared to controls. testis as related to a fully developed and functional reproduc- tive system. Herein, histological observations in GPER- blocked testis are in accord with studies in knockout ERβ Discussion where increases in Leydig cells per testis correlate with in- creased steroidogenic capacity (Gould et al. 2007). Based on Estrogens are essential for reproductive tract development, literature data confirming the proliferative nature of estrogen reproductive function and male fertility. Numerous studies via both GPER and ER with a contribution of rapid signaling pathways, this effect can be common and/or shared in a large have confirmed these hormones and canonical estrogen Cell Tissue Res Fig. 7 Effect of GPER blockage on mRNA expression of aromatase and tubulin α1a mRNA level was measured in the samples [(a, e) -qualitative estrogen receptors α and β in mouse testes and Leydig cells in vitro. (a, e) expression]. RQ is expressed as means ± SD. Asterisks show significant Representative gel electrophoresis of qualitative expression of differences between control mice and those treated with G-15 (50 μg/kg P450aromatase, ERα,ERβ in mouse testes (immature, mature and bw) and control MA-10 Leydig cells and treated with G-15 (10 nM), ICI aged) (a) and MA-10 Leydig cells (e). (b–d, f–h) Relative level (relative (ICI 182,780; 10 μM), E2 (17β-estradiol; 10 nM) alone and in combina- ∗ ∗∗ ∗∗∗ quantification; RQ) of mRNA for P450aromatase (b), ERα (c), ERβ (d) tion for 24 h. Values are denoted as p <0.05, p <0.01 and p < in mouse testes (b–d) and MA-10 Leydig cells (f–h), determined using 0.001. From each animal, at least three samples were measured. Samples real-time RT-PCR analysis 2 − ΔCt method. As an intrinsic control, the of cultured Leydig cells were measured in triplicate amount by one receptor (Lucas et al. 2011; Chimento et al. consequence, aromatase overexpression in overgrown 2014;Magruder et al. 2014). On the contrary, in knockout Leydig cells was revealed. In patients with germ cell tumors, ERα,males’ hypertrophy and loss of Leydig cells with no elevated levels of chorionic gonadotropin are one possible disturbances of intratesticular steroid levels were demonstrat- cause of Leydig cell hypertrophy and hyperplasia (Zimmerli ed. Our recent study showed overgrowth of Leydig cells after and Hedinger 1991). There are multiple other potential mech- disturbance of sex hormones milieu, through blockage or anisms where chemicals might induce hyperplasia primarily activation of estrogen-related receptors (ERRs) in seasonal through a disruption in the hypothalamic-pituitary-axis. In rodent, the bank vole (Pawlicki et al. 2017). In addition, sim- most of these mechanisms, various hormones (e.g., estrogen, ilar observations were made in testes of boars treated neona- prolactin) produce an elevation in LH levels that excessively tally with antiandrogen (Kotula-Balak et al. 2013). In stimulate steroidogenic Leydig cell function (Greaves 2012). Cell Tissue Res Fig. 8 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. a–f Localization of P450aromatase; dashed lines (a–f) mark the pe- riphery of seminiferous tubules (ST). Immunostaining with DAB and counterstaining with hema- toxylin. Scale bars represent 15 μm. Immunoreaction was per- formed on testicular serial sec- tions from at least three animals of each experimental group. No changes in expression of aroma- tase in testes of immature males after G-15 treatment in compari- son to control are seen (arrows) (a, b). Increase of aromatase ex- pression is visible in Leydig cells of mature G-15 males while its expression is very weak in control ones (arrows) (c, d). In negative controls, no positive staining is seen (inserts a). No differences between expression of aromatase are visible in control and G-15 aged mice (e, f). In negative con- trols, no positive staining is seen The use of chemical agents that perturb cytoskeletal protein molecules. However, due to changes in gene expression of polarization has shed light on a key role for microfilaments GPER, ERs and aromatase, such effects are compensational and microtubules in regulating the uptake and transport of and/or are directed by one molecule. Of note, robust evidence cholesterol in steroidogenic cells. Sewer and Li (2008)report- indicates the same nuclear ERs are also located at the cell ed that trafficking of the mitochondria is dependent on micro- plasma membrane by palmitoylation and associate with spe- tubules, suggesting cytoskeleton function is necessary in ste- cific membrane proteins, e.g., caveolin 1 (Pietras and Szego roid hormone production, particularly at steps subsequent to 1977; Razandi et al. 1999; Jakacka et al. 2002). Hence, these cholesterol delivery to the mitochondria. Therefore, in ste- receptors cannot be also excluded from considerations. It is roidogenic cells, proper function of both mitochondria and well-known that different ERα and ERβ isoforms have a very cytoskeleton strongly guarantees effective sex steroid produc- diverse influence on estrogen signaling and target gene regu- tion. The lack of GPER signaling in mouse testis and Leydig lation (Chang et al. 2008; Vrtačnik et al. 2014). For example, cells affects the action of the above-mentioned cellular struc- some ERβ isoforms lack the ability to bind ligands or tures. In addition, estrogen signaling that is partially disturbed coactivators and certain isoforms affect ERα/ERβ by GPER inactivation modulates the mitochondria and tubu- heterodimerization, leading to silenced ERα signaling. It has lin fiber activity in Leydig cells by estrogen binding to other also been reported that ERβ has an inhibitory effect on ERα- estrogen receptors and/or via non-receptor estrogen signaling mediated signaling (Murphy 2011). In some instances, Cell Tissue Res Fig. 9 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. (a–f) Localization of ERα. Expression of aromatase in both groups is moderate. Slight increase in ERα expression in nuclei and partially in cytoplasm of Leydig cell is observed in G-15 immature mice (arrows) (a, b). In both mature and aged mice (control and G-15- treated) no changes in expression of ERα is seen (arrows) (c–f). In negative controls, no positive staining is seen (inserts c). The immunoexpression in cytoplasm and nuclei of Leydig cells is strong in mature males while it is moderate in aged ones (arrows) (c–f) opposite roles of ERα and ERβ have been revealed by differ- 2013; Zarzycka et al. 2016) and present results confirm that ences in their expression in various tissues and organs (Girdler ER expression is regulated by different mechanisms and is and Brotherick 2000;Hess 2003; Roa et al. 2008;Wanget al. dependent on tissue type and species studied. Interestingly, 2016). Based on revealed herein GPER, ERs and aromatase cytoplasmic localization of ERs, coupled with their occasional genes expression changes, we suggest the existence of an absence in Leydig cells, can be linked to a dynamic equilib- interaction between these genes in mouse Leydig cells of var- rium between cytoplasm and nucleus. Thus, ERs are not de- ious age. Of note, any change in GPER function results in tected at all times in a single subcellular compartment, partic- estrogen signaling modulation, leading to changes in intracel- ularly when the hormonal milieu is changing (Parikh et al. lular estrogen levels and its action in Leydig cells. 1987). Neonatal diethylstilbestrol (DES) treatment also affects Additionally, ICI affects expression of estrogen signaling ERα immunoexpression in the male rat reproductive tract molecules. The antiestrogen ICI 182,780 is similar to estradiol (Rivas et al. 2002). in its ability to decrease its receptor expression by approxi- Estrogen was found to regulate biogenesis and mitochon- mately 50% (Alarid et al. 1999; Lonard et al. 2000). drial function (Klinge 2008). The localization of ERs in Decreased expression of ERα but not ERβ, in rat efferent nuclear and ERβ in mitochondrial compartments offers a ductules after ICI treatment was demonstrated by Oliveira et potential mechanism for controlling coordinate nuclear and al. (2003). Our prior (Hejmej et al. 2011; Kotula-Balak et al. mitochondrial gene expression and function of the cell. Cell Tissue Res Fig. 10 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. Localization of ERβ (a–f)in tes- tes of control and G-15-treated mice, respectively. Slight de- crease in ERβ expression is ob- served in cytoplasm of immature males when compared to control whose expression is strong (arrows) (a, b). Moderate in con- trol mature and weak in G-15 mature males expression of ERβ is revealed exclusively in cyto- plasm of Leydig cells (arrows) (c, d). In control aged males, moder- ate cytoplasmic expression of ERβ is seen (arrows) (e)but is nuclear in a few Leydig cells of G-15 males (arrows) (f). In nega- tive controls, no positive staining is seen (inserts e). Immunoreaction was performed on testicular serial sections from at least three animals of each ex- perimental group Bopassa et al. (2010) showed involvement of GPER in the inactivation affected Leydig cell steroidogenic activity by mitochondria permeability transition pore opening in human perturbations in various organelle function. cardiovascular cells. In human skin fibroblasts, GPER trans- Estradiol controls the intracellular concentration of both mitted estrogen signaling through the ERK1/2 pathway that ERs in a positive feedback manner. This estrogen-dependent regulated fibroblast cytoskeletal reorganization, leading to modulation appears to be different for each receptor subtype changes in cellular shape (Carnesecchi et al. 2015). since estrogen differentially affects the balance between the Moreover, estrogen- and tamoxifen-induced rearrangement synthesis and breakdown of ERs (Nilsson et al. 2011; Thomas of the cytoskeleton and adhesion of the breast cancer cells and Gustafsson 2011). In turn, the presence or absence of a (MCF-7) (Sapino et al. 1986). In addition, rearrangement of specific ER subtype, as well as its dynamic temporal varia- actin and keratin filaments in the cellular projections and the tions in a cell context co-expressing both receptors (i.e., ERα/ formation of a dense network of keratin fibers took place. The ERβ ratio), is pivotal for the appearance of estrogen signaling effect was independent of the well-known estrogenic effect and dictates the resulting physiological functions. Of note, on cell proliferation that correlates with a previous study there is evidence for a role for methylation-dependent modu- where no proliferation of Leydig cells in vitro and rather lation of ERβ mRNA and the 26S proteasome in regulating volume increase in vivo was observed. Similarly, neither ERβ levels (Pinzone et al. 2004). Estradiol induces ERα blocked nor activated ERRs induced Leydig cell proliferation phosphorylation that protects the receptor from degradation, (Pawlickietal. 2017). However, both GPER and ERRs indicating how the ERα intracellular concentration is required Cell Tissue Res for the estradiol-evoked cellular effects (Marques et al. 2014). expression of estrogen signaling molecules. Either interaction We provided a perspective that addresses mRNA expression of ERs with ICI or GPER with G-15 in Leydig cells resulted changes of estrogen signaling molecules, ERα,ERβ and aro- in comparable and marked estrogen signaling disturbances, matase in mouse Leydig cells with altered GPER activity. In indicating the importance of all receptor types and their inter- in vitro Leydig cells, the absence of GPER led to increase of actions for controlling steroidognic cell function in the testis. Cell Tissue Res Fig. 11 Effect of GPER blockage on localization of aromatase and Milon et al. 2017), cell context-specific autophagy-based reg- estrogen receptors in Leydig cells in vitro. Representative ulation by GPER cannot be excluded. Until today, detailed microphotographs of control MA-10 Leydig cells (a, i, q), E2 (17-β ultrastructure of GPER deficient cells of various organs has estradiol; 10 nM) (b, j, r), ICI (ICI 182,780; 10 μM) (c, k, s), G-15 not been performed. The absence of GPER in pancreatic β- (10 nM) (d, l, t), ICI +E2 (e, m, u), G-15+E2 (f, n, v), G-15+ ICI (g, o, w)-treated Leydig cells for 24 h. (a–g) Localization of P450aromatase; (i– cells did not affect cell morphology, although reduced insulin o) localization of ERα; localization of ERβ (q–w) in control and G-15- secretion from the pancreas was noted (Sharma and Prossnitz treated Leydig cells. Immunostaining with DAB and counterstaining with 2011). Our results showed that estrogen signaling molecules hematoxylin. Scale bars represent 20 μm. Cultures of Leydig cells from control a specific function of various organelles (biogenesis, each experimental group were analyzed in triplicate. Weak to moderate aromatase immunoreaction is seen in the cytoplasm of control Leydig distribution, and degeneration) in Leydig cells in an age- cells (arrows) (a). Increase of its expression is visible after E2 treatment dependent fashion. The coordinated work of lipid droplets, (arrows) (b). After treatment with ICI weak staining while moderate after mitochondria and Golgi apparatus is required for effective G-15 treatment is seen (arrows) (c, d). After combinations of ICI with E2, steroidogenesis (Cheng and Kowal 1997;Shen etal. 2016). G-15 with E2 and G-15 with ICI strong to moderate aromatase expression in a majority of treated cells is seen (arrows) (e–g). Strong We confirmed that the mitochondria are controlled by estro- immunoexpression of ERα is observed in nuclei of control Leydig cells gens via ERβ and estrogen-related receptors (ERRs) (Giguère (arrows) (i). After treatment with both E2 and ICI strong nuclear immu- 2002;Liaoet al. 2015; Milon et al. 2017) and also by GPER nostaining is present in a minority of cells (arrows) (j, k). After G-15 along with other estrogen signaling molecules. Recent studies treatment weak immunostaining in single Leydig cells is visible (arrows), (l) which is not the case in cells treated with ICI together with have revealed new proteins associated with lipid droplets, E2 or G-15 (arrows) (m, o). In cells treated with G-15 together with E2 e.g., GPER, where one of the discovered functions in lipid moderate to strong cytoplasmic immunostaining is seen (arrow) (n). metabolism is upregulation of fatty acids synthesis in cancer Moderate expression of ERβ in a majority of nuclei of control Leydig cells (Santolla et al. 2012). Data from human embryonic kid- cells is observed (arrows) (q). Increased after E2 treatment immunostain- ing of ERβ is visible in nuclei of a majority of cells (r). In a few cells ney cells (HEK-293) showed that GPER is downregulated staining is cytoplasmic (short arrow) (r). In a majority of ICI - treated cells through the trans Golgi-proteasome pathway (Cheng et al. the ERβ staining is weak (arrows) (s) while after exposure to G-15 and 2011), indicating an important GPER role in Golgi complexes ICI with E2 staining is of strong to moderate intensity and located in function. The presence of GPER in endosomes or intracellular nuclei of a majority of cells (arrows) (t, u). After treatment with G-15 and E2 in combination mainly cytoplasmic staining for ERβ is observed membranes and its capacity to activate plasma membrane re- (arrows) (v). Moderate to weak nuclear ERβ staining is visible after G-15 ceptors, indicates a critical role of GPER in physiological and and ICI exposure (arrows) (w). In negative controls, no positive staining pathophysiological processes. G protein-coupled receptors is seen (inserts h, p, x) (GPCRs) are synthesized in the rough endoplasmic reticulum, traffic through the Golgi apparatus and are dynamically shut- While modulation of ERα and ERβ content is a fundamental tled to and from, the plasma membrane by vesicular transport [e.g., small GTPases, (Rab-1 and Arf) and chaperone trans- factor in estrogen signaling to maintenance of cell number, the lack of GPER and/or changes in expression of ERs and port proteins (COPI/II)] (Martínez-Alonso et al. 2013). aromatase does not result in cell proliferation or death. GPCRs actions via the activation of plasma membrane- Inhibition of Leydig cell regeneration in ethane associated enzymes, distinct modes of signal transduction dimethylsulfonate-treated mature rats following estradiol ex- from endosomal membranes, have also been demonstrated posure indicates that Leydig cells self-regulate their number (for review see Irannejad and von Zastrow 2014). Surface via estrogen modulation in a paracrine fashion (Myers and expression of GPCRs besides extrinsic stimuli can be modu- Abney 1991). Due to these results, involvement of various lated posttranslationally. Delimitation of GPCRs expression estrogen receptors in this phenomenon is suggested. or receptors desensitization (including complete termination Additionally, regulation of intracellular ER and aromatase of receptor signaling, Bdownmodulation^ by 26S proteasome) expression by GPER and vice versa represents a future re- affects receptor binding sites and signaling activity (Jean- search direction. Alphonse and Hanyaloglu 2011). A major mechanism by On a new but related point, tamoxifen acting through which GPCRs promote endosome-initiated signaling is by GPER is able to upregulate aromatase expression (Catalano recruitment of arrestins, which are endocytic adaptors during et al. 2014). In the male reproductive system, GPER suppres- receptor desensitization and scaffold for the assembly of sion of ERα expression and its downstream signaling path- mitogen-activated protein kinase (MAPK) signaling modules way was reported (Koong and Watson 2014; Jia et al. 2016). (Shenoy and Lefkowitz 2011). Studies on GPER intracellular localization revealed its GPER signaling is a crucial steroidogenesis regulation by presence in the plasma membrane, endoplasmic reticulum estradiol in rat and human LH-stimulated Leydig cells. The and Golgi complex (Chimento et al. 2014). Observed pertur- detrimental effects of estrogen excess after estradiol or GPER bations in these organelles after G-15 treatment are clearly agonist treatment on steroidogenesis were revealed (Hess 2003; linked. As data are available concerning estrogen ability to Vaucher et al. 2014). Similarly, in fish gonads, the GPER effect activate autophagy, including mitophagy (Lui et al. 2016; on steroidogenesis has been shown (Thomas et al. 2006;Pang Cell Tissue Res and Thomas 2010). Therefore, decreased estrogen concentra- and aromatase genes) confirmed a full set of estrogen signaling tion in mice without GPER (and modulated expression of ERs molecule control of Leydig cell steroidogenic function at the Cell Tissue Res Ethical approval All applicable international, national and/or institu- Fig. 12 Effect of GPER on sex steroid concentration in mouse testes and tional guidelines for the care and use of animals were followed. secretion by Leydig cells in vitro. Androgens and estrogens concentration in testes of immature, mature and aged mice control and G-15-treated (a, b) and progesterone secretion in MA-10 Leydig cells (c) control and G- Informed consent Not applicable. 15, E2 and ICI-treated alone and in combination. Data are expressed as means ± SD. From each animal, at least three samples were measured. Open Access This article is distributed under the terms of the Creative Culture media were measured in triplicate. Asterisks show significant Commons Attribution 4.0 International License (http:// differences in testosterone and estradiol concentrations between control creativecommons.org/licenses/by/4.0/), which permits unrestricted use, and G-15 (50 μg/kg bw)-treated males and in progesterone secretion distribution and reproduction in any medium, provided you give appro- between control MA-10 Leydig cells and those treated with G-15 priate credit to the original author(s) and the source, provide a link to the (10 nM), ICI (ICI 182,780; 10 μM), E2 (17β-estradiol; 10 nM) alone Creative Commons license and indicate if changes were made. and in combination for 24 h. Values are denoted as ∗∗p <0.01 and ∗∗∗p <0.001 ultrastructure (organelle activity) and molecular (hormone pro- References duction and secreting ability) levels. Abney TO (1999) The potential roles of estrogens in regulating Leydig cell development and function: a review. Steroids 64(9):610–617 Abney TO, Myers RB (1991) 17 beta-estradiol inhibition of Leydig cell Conclusion regeneration in the ethane dimethylsulfonate-treated mature rat. J Androl 12(5):295–304 The GPER provides a new basis for understanding the roles Abraham GE, Swerdloff ES, Tulchinsky D, Odell WD (1971) Radioimmunoassay of plasma 17-hydroxyprogesterone. J Clin of estrogen and estrogen signaling molecules in the regula- Endocrinol 33:42–46 tion of Leydig cells function. The data presented here re- Acconcia F, Fiocchetti M, Marino M (2016) Xenoestrogen regulation of vealed that GPER has a regulatory effect on estrogen sig- ERα/ERβ balance in hormone-associated cancers. Mol Cell naling, as well as estrogen concentration and secretion in Endocrinol. https://doi.org/10.1016/j.mce.2016.10.033 mouse Leydig cells (dependent of male age and putative Alarid ET, Bakopoulos N, Solodin N (1999) Proteasome-mediated pro- teolysis of estrogen receptor: a novel component in autologous engagement of various organelle) via its partnership with down-regulation. Mol Endocrinol 13:1522–1534 ERs and aromatase. Thus, the generation of a triple KO An G, Li W, Yan T, Li S (2014) Estrogen rapidly enhances incisional pain murine model (aromatase, ER, and GPER) could be an of ovariectomized rats primarily through the G protein-coupled es- important contribution to further understand the mecha- trogen receptor. Int J Mol Sci 15(6):10479–10491 nisms of estrogen signaling in Leydig cells. Antal MC, Krust A, Chambon P, Mark M (2008) Sterility and absence of histopathological defects in nonreproductive organs of a mouse ERbeta-null mutant. Proc Natl Acad Sci U S A 105(7):2433–2438 Acknowledgments The authors are very grateful to the editor and anon- Ascoli M (1981) Characterization of several clonal lines of cultured ymous reviewers for their constructive suggestions and helpful comments Leydig tumor cells: gonadotropin receptors and steroidogenic re- that allowed to improve this manuscript. We thank Msc. Laura Pardyak, sponses. Endocrinology 108(1):88–95 MSc. Alicja Kaminska and Klaudia Lesniak (Department of Atanassova N, McKinnell C, Walker M, Turner KJ, Fisher JS, Morley M, Endocrinology) for technical help and Wladyslawa Jankowska Millar MR, Groome NP, Sharpe RM (1999) Permanent effects of (Department of Developmental Biology and Invertebrate Morphology) neonatal estrogen exposure in rats on reproductive hormone levels, for her excellent technical support during TEM preparation. The Jeol Sertoli cell number, and the efficiency of spermatogenesis in adult- JEM 2100 transmission electron microscope was available at the hood. Endocrinology 140(11):5364–5373 Laboratory of Microscopy, Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University. Barakat R, Oakley O, Kim H, Jin J, Myong C, Ko J (2016) Extra- gonadal sites of estrogen biosynthesis and function. BMB Rep 49(9):488–496 Author contributions Authors’ contribution to the work described in the Bertrand S, Hu C, Aksenova MV, Mactutus CF, Booze RM (2015) HIV-1 paper: M.K-B., P.P., A.M., W.T., M. S., A.P., E.G-W., B.B., B.P., J.W., Tat and cocaine mediated synaptopathy in cortical and midbrain M.Z. and J.G. performed the research. M.K.-B, W.T., J.W., B.B., B.P. and neurons is prevented by the isoflavone Equol. Front Microbiol J.G analyzed the data. 8(6):894 M.K.-B. designed the research study and wrote the paper. All authors have read and approved the final version of the manuscript. Bopassa JC, Eghbali M, Toro L, Stefani E (2010) A novel estrogen receptor GPER inhibits mitochondria permeability transition pore opening and protects the heart against ischemia-reperfusion injury. Funding This study was funded by the National Science Centre, Poland Am J Physiol Heart Circ Physiol 298(1):H16–H23 (grant number SONATA BIS5 2015/18/E/NZ4/00519). M. Kotula-Balak Carnesecchi J, Malbouyres M, de Mets R, Balland M, Beauchef G, Vié K, received research grants from the Polish Science Centre. Chamot C, Lionnet C, Ruggiero F, Vanacker JM (2015) Estrogens induce rapid cytoskeleton re-organization in human dermal fibro- Compliance with ethical standards blasts via the non-classical receptor GPR30. PLoS One 10(3): e0120672 Conflict of interest The authors declare that they have no conflict of Carreau S, Hess RA (2010) Oestrogens and spermatogenesis. Philos interest. Trans R Soc Lond Ser B Biol Sci 365(1546):1517–15354 Cell Tissue Res Carreau S, Lambard S, Delalande C, Denis-Galeraud I, Bilinska B, Gould ML, Hurst PR, Nicholson HD (2007) The effects of oestrogen Bourguiba S (2003) Aromatase expression and role of estrogens in receptors alpha and beta on testicular cell number and steroidogen- male gonad : a review. Reprod Biol Endocrinol 1:35 esis in mice. Reproduction 134(2):271–279 Carreau S, Bouraima-Lelong H, Delalande C (2012) Role of estrogens in Greaves P (2012) Histopathology of preclinical toxicity studies: interpre- spermatogenesis. Front Biosci (Elite Ed) 4:1–11 tation and relevance in drug safety evaluation, 4th edn. Elsevier AP, Amsterdam, pp 1–867 Catalano S, Giordano C, Panza S, Chemi F, Bonofiglio D, Lanzino M, Rizza P, Romeo F, Fuqua SA, Maggiolini M, Andò S, Barone I Hamilton CK, Navarro-Martin L, Neufeld M, Basak A, Trudeau VL (2014) Tamoxifen through GPER upregulates aromatase expression: (2014) Early expression of aromatase and the membrane estrogen a novel mechanism sustaining tamoxifen-resistant breast cancer cell receptor GPER in neuromasts reveals a role for estrogens in the growth. Breast Cancer Res Treat 146(2):273–285 development of the frog lateral line system. Gen Comp Endocrinol 1(205):242–250 Chang EC, Charn TH, Park S-H, Helferich WG, Komm B, Hejmej A, Kotula-Balak M, Galas J, Bilińska B (2011) Effects of 4-tert- Katzenellenbogen JA, Katzenellenbogen BS (2008) Estrogen recep- octylphenol on the testes and seminal vesicles in adult male bank tors α and β as determinants of gene expression: influence of ligand, voles. Reprod Toxicol 31(1):95–105 dose, and chromatin binding. Mol Endocrinol 22(5):1032–1043 Hess RA (2000) Oestrogen in fluid transport in efferent ducts of the male Cheng B, Kowal J (1997) Role of the Golgi complex in adrenocortical reproductive tract. Rev Reprod 5(2):84–92 steroidogenesis. Microsc Res Tech 36(6):503–509 Hess RA (2003) Estrogen in the adult male reproductive tract: a review. Cheng SB, Quinn JA, Graeber CT, Filardo EJ (2011) Down-modulation Reprod Biol Endocrinol 1:52 of the G-protein-coupled estrogen receptor, GPER, from the cell Heublein S, Lenhard M, Vrekoussis T, Schoepfer J, Kuhn C, Friese K, surface occurs via a trans-Golgi-proteasome pathway. J Biol Chem Makrigiannakis A, Mayr D, Jeschke U (2012) The G-protein- 286(25):22441–22455 coupledestrogenreceptor(GPER)isexpressed innormalhuman Chimento A, Sirianni R, Delalande C, Silandre D, Bois C, Ando S, ovaries and is upregulated in ovarian endometriosis and pelvic Maggiolini M, Carreau S, Pezzi V (2010) 17 beta-estradiol activates inflammatory disease involving the ovary. Reprod Sci 19(11): rapid signaling pathways involved in rat pachytene spermatocytes 1197–1204 apoptosis through GPR30 and ER alpha. Mol Cell Endocrinol Hoffmann B, Rostalski A, Mutembei HM, Goericke-Pesch S (2010) 320(1–2):136–4410 Testicular steroid hormone secretion in the boar and expression of Chimento A, Sirianni R, Zolea F, Bois C, Delalande C, Ando S, testicular and epididymal steroid sulphatase and estrogen Maggiolini M, Aquila S, Carreau S, Gper PV (2011) ESRs are sulphotransferase activity. Exp Clin Endocrinol Diabetes 118(4): expressed in rat round spermatids and mediate oestrogen- 274–280 dependent rapid pathways modulating expression of cyclin B1 and Hotchkiss J, Atkinson LE, Knobil E (1971) Time course of serum estro- Bax. Int J Androl 34(5 Pt 1):420–910 gen and luteinizing hormone concentrations during menstrual cycle Chimento A, Sirianni R, Casaburi I, Pezzi V (2014) GPER signaling of rhesus monkey. Endocrinology 89:177–183 in spermatogenesis and testicular tumors. Front Endocrinol Irannejad R, von Zastrow M (2014) GPCR signaling along the endocytic (Lausanne) 5:30 pathway. Curr Opin Cell Biol 27:109–116 Couse JF, Korach KS (1999) Estrogen receptor null mice: what have we Irsik DL, Carmines PK, Lane PH (2013) Classical estrogen receptors and learned and where will they lead us? Endocr Rev 20(3):358–417 ERα splice variants in the mouse. PLoS One 8(8):e70926 Dennis MK, Burai R, Ramesh C, Petrie WK, Alcon SN, Nayak TK, Isensee J, Meoli L, Zazzu V, Nabzdyk C, Witt H, Soewarto D, Effertz K, Bologa CG, Leitao A, Brailoiu E, Deliu E, Dun NJ, Sklar LA, Fuchs H, Gailus-Durner V, Busch D, Adler T, de Angelis MH, Hathaway HJ, Arterburn JB, Oprea TI, Prossnitz ER (2009) Irgang M, Otto C, Noppinger PR (2009) Expression pattern of G In vivo effects of a GPR30 antagonist. Nat Chem Biol 5(6):421–427 protein-coupled receptor 30 in LacZ reporter mice. Endocrinology Dennis MK, Field AS, Burai R, Ramesh C, Petrie WK, Bologa CG, 150(4):1722–1730 Oprea TI, Yamaguchi Y, Hayashi S, Sklar LA, Hathaway HJ, Jakacka M, Ito M, Martinson F, Ishikawa T, Lee EJ, Jameson JL (2002) Arterburn JB, Prossnitz ER (2011) Identification of a GPER/ An estrogen receptor (ER)alpha deoxyribonucleic acid-binding do- GPR30antagonistwithimprovedestrogenreceptor main knock-in mutation provides evidence for nonclassical ER path- counterselectivity. J Steroid Biochem Mol Biol 127(3–5):358–366 way signaling in vivo. Mol Endocrinol 16(10):2188–2201 Dufau ML, Catt KJ, Tsuruhara T, Ryan D (1972) Radioimmunoassay of Jean-Alphonse F, Hanyaloglu AC (2011) Regulation of GPCR signal plasma testosterone. Clin Chim Acta 37:109–116 networks via membrane trafficking. Mol Cell Endocrinol 331(2): Fietz D, Ratzenböck C, Hartmann K, Raabe O, Kliesch S, Weidner W, 205–214 Klug J, Bergmann M (2014) Expression pattern of estrogen recep- Jefferson WN, Couse JF, Banks EP, Korach KS, Newbold RR (2000) tors α and β and G-protein-coupled estrogen receptor 1 in the hu- Expression of estrogen receptor beta is developmentally regulated man testis. Histochem Cell Biol 142(4):421–432 in reproductive tissues of male and female mice. Biol Reprod 62(2): Fietz D, Bergmann M, Hartmann K (2016) In situ hybridization of estro- 310–317 gen receptors α and β and GPER in the human testis. Methods Mol Jia B, Gao Y, Li M, Shi J, Peng Y, Du X, Klocker H, Sampson N, Shen Y, Biol 1366:189–205 Liu M, Zhang J (2016) GPR30 promotes prostate stromal cell acti- Filardo EJ, Thomas P (2012) Minireview: G protein-coupled estrogen vation via suppression of ERα expression and its downstream sig- receptor-1, GPER-1: its mechanism of action and role in female naling pathway. Endocrinology 157(8):3023–3035 reproductive cancer, renal and vascular physiology. Endocrinology Kang WB, Cong Y, Ru JY, Ying SQ, Zhu T, Wang DS, Liu XW, Liu G, 153(7):2953–2962 Zhao JN (2015) Osteoprotective effect of combination therapy of Gaudet HM, Cheng SB, Christensen EM, Filardo EJ (2015) The G- low-dose oestradiol with G15, a specific antagonist of GPR30/ protein coupled estrogen receptor, GPER: the inside and inside-out GPER in ovariectomy-induced osteoporotic rats. Biosci Rep 35(4) story. Mol Cell Endocrinol 15(418 Pt 3):207–219 Klinge CM (2008) Estrogenic control of mitochondrial function and bio- Giguère V (2002) To ERR in the estrogen pathway. Trends Endocrinol genesis. J Cell Biochem 105(6):1342–1351 Metab 13(5):220–225 Koong LY, Watson CS (2014) Direct estradiol and diethylstilbestrol ac- Girdler F, Brotherick I (2000) The oestrogen receptors (ER alpha and ER tions on early- versus late-stage prostate cancer cells. Prostate beta) and their role in breast cancer: a review. Breast 9(4):194–200 74(16):1589–1603 Cell Tissue Res Kotula-Balak M, Hejmej A, Kopera I, Lydka M, Bilinska B (2012) Martínez-Alonso E, Tomás M, Martínez-Menárguez JA (2013) Golgi tubules: their structure, formation and role in intra-Golgi transport. Prenatal and neonatal exposure to flutamide affects function of Leydig cells in adult boar. Domest Anim Endocrinol 42(3):142–154 Histochem Cell Biol 140(3):327–339 Milon A, Opydo-Chanek M, Tworzydlo W, Galas J, Pardyak L, Kotula-Balak M, Chojnacka K, Hejmej A, Galas J, Satola M, Bilinska B Kaminska A, Ptak A, Kotula-Balak M (2017) Chlorinated biphenyls (2013) Does 4-tert-octylphenol affect estrogen signaling pathways effect on estrogen-related receptor expression, steroid secretion, mi- in bank vole Leydig cells and tumor mouse Leydig cells in vitro? tochondria ultrastructure but not on mitochondrial membrane poten- Reprod Toxicol 39:6–16 tial in Leydig cells. Cell Tissue Res. https://doi.org/10.1007/s00441- Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, 017-2596-x Korach KS, Gustafsson JA, Smithies O (1998) Generation and re- Murphy E (2011) Estrogen signaling and cardiovascular disease. Circ Res productive phenotypes of mice lacking estrogen receptor beta. Proc 109(6):687–696 Natl Acad Sci U S A 95(26):15677–15682 Myers RB, Abney TO (1991) Interstitial cell proliferation in the testis of Lazari MF, Lucas TF, Yasuhara F, Gomes GR, Siu ER, Royer C, the ethylene dimethane sulfonate-treated rat. Steroids 56(2):91–96 Fernandes SA, Porto CS (2009) Estrogen receptors and function in Ni lsson S, Koehler KF, Gustafsson JA (2011) Development of subtype- the male reproductive system. Arq Bras Endocrinol Metabol 53(8): selective oestrogen receptor-based therapeutics. Nat Rev Drug 923–933 Discov 10(10):778–792 Lee KH, Park JH, Bunick D, Lubahn DB, Bahr JM (2009) Morphological Oliveira CA, Nie R, Carnes K, Franca LR, Prins GS, Saunders PT, Hess comparison of the testis and efferent ductules between wild-type and RA (2003) The antiestrogen ICI 182,780 decreases the expression of estrogen receptor alpha knockout mice during postnatal develop- estrogen receptor-alpha but has no effect on estrogen receptor-beta ment. J Anat 214(6):916–925 and androgen receptor in rat efferent ductules. Reprod Biol Lemmena JG, Broekhof JLM, Kuiper GJM, Gustafsson J-A, van der Endocrinol 1:75 Saag PT, van der Burg B (1999) Expression of estrogen recep- Otto C,FuchsI,KauselmannG,KernH,ZevnikB,Andreasen P, tor alpha and beta during mouse embryogenesis. Mech Dev 81: Schwarz G, Altmann H, Klewer M, Schoor M, Vonk R, 163–167 Fritzemeier KH (2009) GPR30 does not mediate estrogenic re- Li X, Li H, Jia L, Li X, Rahman N (2015) Oestrogen action and male sponses in reproductive organs in mice. Biol Reprod 80(1):34–41 fertility: experimental and clinical findings. Cell Mol Life Sci 72: Pang Y, Thomas P (2010) Role of G protein-coupled estrogen receptor 1, 3915–3930 GPER, in inhibition of oocyte maturation by endogenous estrogens Liao TL, Tzeng CR, Yu CL, Wang YP, Kao SH (2015) Estrogen receptor- in zebrafish. Dev Biol 342(2):194–206 β in mitochondria: implications for mitochondrial bioenergetics and Pardyak L, Kaminska A, Galas J, Ptak A, Bilinska B, Kotula-Balak M tumorigenesis. Ann N Y Acad Sci 1350:52–60 Academic Press (2016) Primary and tumor mouse Leydig cells exposed to Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression polychlorinated naphthalenes mixture: effect on estrogen related- data using real-time quantitative PCR and the 2(-Delta Delta C(T)) receptors expression, intracellular calcium level and sex hormones method. Methods 25:402–408 secretion. Tissue Cell 48(5):432–441 Lonard DM, Nawaz Z, Smith CL, O'Malley BW (2000) The 26S protea- Parikh I, Rajendran KG, Su JL, Lopez T, Sar M (1987) Are estrogen some is required for estrogen receptor-alpha and coactivator turn- receptors cytoplasmic or nuclear? Some immunocytochemical and over and for efficient estrogen receptor-alpha transactivation. Mol biochemical studies. J Steroid Biochem 27(1–3):185–192 Cell 5:939–948 Pawlicki P, Milon A, Zarzycka M, Galas J, Tworzydlo W, Kaminska A, Lucas TF, Royer C, Siu ER, Lazari MF, Porto CS (2010) Expression and Pardyak L, Lesniak K, Pacwa A, Bilinska B, Gorowska-Wojtowicz signaling of G protein-coupled estrogen receptor 1 (GPER) in rat E, Kotula-Balak M (2017) Does signaling of estrogen-related recep- Sertoli cells. Biol Reprod 83(2):307–1710 tors affect structure and function of bank vole Leydig cells? J Physiol Pharmacol 68(3):459–476 Lucas TF, Pimenta MT, Pisolato R, Lazari MF, Porto CS (2011) 17Beta- Pfaffl MW (2001) A new mathematical model for relative quantification estradiol signaling and regulation of Sertoli cell function. in real-time RT-PCR. Nucleic Acids Res 29:e45 Spermatogenesis 1(4):318–2410 Pietras RJ, Szego CM (1977) Specific binding sites for oestrogen at the Lucas TF, Nascimento AR, Pisolato R, Pimenta MT, Lazari MF, Porto CS outer surfaces of isolated endometrial cells. Nature 265(5589): (2014) Receptors and signaling pathways involved in proliferation 69–72 and differentiation of Sertoli cells. Spermatogenesis 4:e28138 Pinzone JJ, Stevenson H, Strobl JS, Berg PE (2004) Molecular and cel- Lui A, New J, Ogony J, Thomas S, Lewis-Wambi J (2016) Everolimus lular determinants of estrogen receptor α expression. Mol Cell Biol downregulates estrogen receptor and induces autophagy in aroma- 24(11):4605–4612 tase inhibitor-resistant breast cancer cells. BMC Cancer 16:487 Plante BJ, Lessey BA, Taylor RN, Wang W, Bagchi MK, Yuan L, Magruder HT, Quinn JA, Schwartzbauer JE, Reichner J, Huang A, Scotchie J, Fritz MA, Young SL (2012) G protein-coupled estrogen Filardo EJ (2014) G protein-coupled estrogen receptor-1, GPER-1, receptor (GPER) expression in normal and abnormal endometrium. promotes fibrillogenesis via a shc-dependent pathway resulting in Reprod Sci 19(7):684–693 anchorage-independent growth. Horm Cancer 5(6):390–404 Prossnitz ER, Barton M (2011) The G protein-coupled estrogen receptor Marques M, Laflamme L, Benassou I, Cissokho C, Guillemette B, GPER in health and disease. Nat Rev Endocrinol 7(12):715–726 Gaudreau L (2014) Low levels of 3,3′-diindolylmethane activate Razandi M, Pedram A, Greene GL, Levin ER (1999) Cell membrane and estrogen receptor α and induce proliferation of breast cancer cells nuclear estrogen receptors (ERs) originate from a single transcript: in the absence of estradiol. BMC Cancer 14:524 studies of ERalpha and ERbeta expressed in Chinese hamster ovary Mårtensson UE, Salehi SA, Windahl S, Gomez MF, Swärd K, cells. Mol Endocrinol 13(2):307–319 Daszkiewicz-Nilsson J, Wendt A, AnderssonN,HellstrandP, Rivas A, Fisher JS, McKinnell C, Atanassova N, Sharpe RM (2002) Grände PO, Owman C, Rosen CJ, Adamo ML, Lundquist I, Induction of reproductive tract developmental abnormalities in the Rorsman P, Nilsson BO, Ohlsson C, Olde B, Leeb-Lundberg LM male rat by lowering androgen production or action in combination (2009) Deletion of the G protein-coupled receptor 30 impairs glu- with a low dose of diethylstilbestrol: evidence for importance of the cose tolerance, reduces bone growth, increases blood pressure, and androgen-estrogen balance. Endocrinology 143(12):4797–4808 eliminates estradiol-stimulated insulin release in female mice. Roa J, Vigo E, Castellano JM, Gaytan F, Navarro VM, Aguilar E, Dijcks Endocrinology 150(2):687–698 FA, Ederveen AG, Pinilla L, van Noort PI, Tena-Sempere M (2008) Cell Tissue Res Opposite roles of estrogen receptor (ER) alpha and ERbeta in the induced by 17beta-estradiol on mouse spermatogonial GC-1 cell line. Endocrinology 149(10):5043–5110 modulation of luteinizinghormone responses to kisspeptin in the female rat: implications for the generation of the preovulatory surge. Smolen AJ (1990) Image analytic techniques for quantification of immu- Endocrinology 149(4):1627–1637 nocytochemical staining in the nervous system. In: Conn PM (ed) Russell LD, Burguet S (1977) Ultrastructure of Leydig cells as revealed Methods in neurosciences. Academic Press, San Diego, pp 208–229 by secondary tissue treatment with a ferrocyanide-osmium mixture. Thomas C, Gustafsson JA (2011) The different roles of ER subtypes in Tissue Cell 9:751–766 cancer biology and therapy. Nat Rev Cancer 11(8):597–608 Sandner F, Welter H, Schwarzer JU, Köhn FM, Urbanski HF, Mayerhofer Thomas P, Dressing G, Pang Y, Berg H, Tubbs C, Benninghoff A, A (2014) Expression of the oestrogen receptor GPER by testicular Doughty K (2006) Progestin, estrogen and androgen G-protein peritubular cells is linked to sexual maturation and male fertility. coupled receptors in fish gonads. Steroids 71:310–316 Andrology 2(5):695–701 Treen AK, Luo V, Chalmers JA, Dalvi PS, Tran D, Ye W, Kim GL, Santolla MF,Lappano R, De MarcoP,PupoM,VivacquaA,Sisci D, Friedman Z, Belsham DD (2016) Divergent regulation of ER and Abonante S, Iacopetta D, Cappello AR, Dolce V, Maggiolini M kiss genes by 17β-estradiol in hypothalamic ARC versus AVPV (2012) G protein-coupled estrogen receptor mediates the up- models. Mol Endocrinol 30(2):217–233 regulation of fatty acid synthase induced by 17β-estradiol in can- Vaucher L, Funaro MG, Mehta A, Mielnik A, Bolyakov A, Prossnitz ER, cer cells and cancer-associated fibroblasts. J Biol Chem 287: Schlegel PN, Paduch DA (2014) Activation of GPER-1 estradiol 43234–43245 receptor downregulates production of testosterone in isolated rat Sapino A, Pietribiasi F, Bussolati G, Marchisio PC (1986) Estrogen- Leydig cells and adult human testis. PLoS One 9(4):e92425 and tamoxifen-induced rearrangement of cytoskeletal and adhe- Vrtačnik P, Ostanek B, Mencej-Bedrač S, Marc J (2014) The many faces sion structures in breast cancer MCF-7 cells. Cancer Res 46(5): of estrogen signaling. Biochem Med (Zagreb) 24(3):329–342 2526–2531 Wang YX, Li M, Zhang HQ, Tang MX, Guo CF, Deng A, Chen Y, Xiao Schulster M, Bernie AM, Ramasamy R (2016) The role of estradiol in LG (2016) Opposite function of ERα and ERβ in controlling 17β- male reproductive function. Asian J Androl 18(3):435–440 estradiol-mediated osteogenesis in osteoblasts. Arch Med Res 47(4): Sewer MB, Li D (2008) Regulation of steroid hormone biosynthesis by 255–261 the cytoskeleton. Lipids 43(12):1109–1115 Zarzycka M, Gorowska-Wojtowicz E, Tworzydlo W, Klak A, Kozub K, Sharma G, Prossnitz ER (2011) Mechanisms of estradiol-induced insulin Hejmej A, Bilinska B, Kotula-Balak M (2016) Are aryl hydrocarbon secretion by the G protein-coupled estrogen receptor GPR30/GPER receptor and G-protein-coupled receptor 30 involved in the regula- in pancreatic beta-cells. Endocrinology 152(8):3030–3039 tion of seasonal testis activity in photosensitive rodent-the bank vole Shen M, Shi H (2015) Sex hormones and their receptors regulate liver (Myodes glareolus)? Theriogenology 86(3):674–686 energy homeostasis. Int J Endocrinol 294278 ZhangX,KeS,ChenK-H,LiJ-H,MaL,Jiang X-W(2015) Shen WJ, Azhar S, Kraemer FB (2016) Lipid droplets and steroidogenic Diethylstilbestrol affects the expression of GPER in the cells. Exp Cell Res 340(2):209–214 gubernaculum testis. Int J Clin Exp Pathol 8(6):7217–7222 Shenoy SK, Lefkowitz RJ (2011) β-Arrestin-mediated receptor traffick- ing and signal transduction. Trends Pharmacol Sci 32(9):521–533 Zimmerli UU, Hedinger CE (1991) Hyperplasia and hypertrophy of Sirianni R, Chimento A, Ruggiero C, De Luca A, Lappano R, Ando S, Leydig cells associated with testicular germ cell tumours containing Maggiolini M, Pezzi V (2008) The novel estrogen receptor, G syncytiotrophoblastic giant cells. Virchows Arch A Pathol Anat protein-coupled receptor 30, mediates the proliferative effects Histopathol 419(6):469–474 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell and Tissue Research Springer Journals

The role of G-protein-coupled membrane estrogen receptor in mouse Leydig cell function—in vivo and in vitro evaluation

Free
24 pages
Loading next page...
 
/lp/springer_journal/the-role-of-g-protein-coupled-membrane-estrogen-receptor-in-mouse-YcFGcCiyFo
Publisher
Springer Berlin Heidelberg
Copyright
Copyright © 2018 by The Author(s)
Subject
Biomedicine; Human Genetics; Proteomics; Molecular Medicine
ISSN
0302-766X
eISSN
1432-0878
D.O.I.
10.1007/s00441-018-2861-7
Publisher site
See Article on Publisher Site

Abstract

In this study, G-coupled estrogen receptor (GPER) was inactivated, by treatment with antagonist (G-15), in testes of C57BL/6 mice: immature (3 weeks old), mature (3 months old) and aged (1.5 years old) (50 μg/kg bw), as well as MA-10 mouse Leydig cells (10 nM/24 h) alone or in combination with 17β-estradiol or antiestrogen (ICI 182,780). In G-15-treated mice, overgrowth of interstitial tissue was found in both mature and aged testes. Depending on age, differences in structure and distribution of various Leydig cell organelles were observed. Concomitantly, modulation of activity of the mitochondria and tubulin microfibers was revealed. Diverse and complex GPER regulation at the mRNA level and protein of estrogen signaling molecules (estrogen receptor α and β;ERα,ERβ and cytochrome P450 aromatase; P450arom) in G-15 Leydig cells was found in relation to age and the experimental system utilized (in vivo and in vitro). Changes in expression patterns of ERs and P450arom, as well as steroid secretion, reflected Leydig cell heterogeneity to estrogen regulation throughout male life including cell physiological status.We show, for the first time, GPER with ERs and P450arom work in tandem to maintain Leydig cell architecture and supervise its steroidogenic function by estrogen during male life. Full set of estrogen signaling molecules, with involvement of GPER, is crucial for proper Leydig cell function where each molecule acts in a specific and/or complementary manner. Further under- standing of the mechanisms by which GPER controls Leydig cells with special regard to male age, cell of origin and experimental system used is critical for predicting and preventing testis steroidogenic disorders based on perturbations in estrogen signaling. . . . Keywords Leydig cell G-coupled estrogen receptor Estrogen receptors, estrogens Ultrastructure Introduction Estrogen is a lipophilic hormone that easily dissolves in lipids, * M. Kotula-Balak allowing it to diffuse into the plasma membrane, resulting in malgorzata.kotula-balak@uj.edu.pl interactions with hydrophobic surfaces of proteins and other macromolecules. This allows estrogen to associate with recep- Department of Endocrinology, Institute of Zoology and Biomedical tors that may reside at the cell membrane or in the cytoplasm, Research, Jagiellonian University in Kraków, Gronostajowa 9, thereby promoting a diverse array of biochemical actions with 30-387 Krakow, Poland 2 different kinetics, including acute (non-genomic) or long-lasting Department of Developmental Biology and Invertebrate (genomic) actions. To date, estrogen receptors belonging to the Morphology, Institute of Zoology and Biomedical Research, Jagiellonian University in Kraków, Gronostajowa 9, two distinct receptor families have been described: estrogen 30-387 Krakow, Poland receptors ERα and ERβ that are categorized as steroid hormone Department of Genetics and Evolutionism, Institute of Zoology and receptors and G-protein-coupled membrane estrogen receptor Biomedical Research, Jagiellonian University in Kraków, (GPER), a member of the G-protein receptor superfamily Gronostajowa 9, 30-387 Krakow, Poland (Sharma and Prossnitz 2011; Sandner et al. 2014; Acconcia et Department of Cell Biology and Imaging, Institute of Zoology and al. 2016). ERs and GPER each participate in estrogen signaling Biomedical Research, Jagiellonian University in Kraków, and likely act in a coordinate manner. Each estrogen receptor Gronostajowa 9, 30-387 Krakow, Poland type is considered unique and independent based on genetic, Medical Biochemistry, Jagiellonian University Medical College, pharmacological, biological and biochemical evidence (that Kopernika 7, 31-034 Krakow, Poland Cell Tissue Res shows distinct physical and functional properties), as well as and human retinal ganglion cells (for review see Liao et al. displays individual phenotypes in knockout mice (Couse and 2015), while ERs splice variants present on the cell membrane Korach 1999; Carreau et al. 2003;Gaudetetal. 2015). (Irsik et al. 2013) have undiscovered a contribution to this Moreover, these receptors localize to diverse subcellular envi- signaling. ronments, possess a unique binding characteristic and interact Expression and function of GPER occur independently of distinctly with selective ligands promoting specific responses. the two nuclear ERs. GPER has a high affinity for estrogens In males, estrogen is produced by spermatogenic cells (of all but only a limited binding capacity with single estrogen- stages) and somatic cells of the testis. Leydig cells are the major binding sites (Lazari et al. 2009; Carreau and Hess 2010;Li source of estrogen in the adult testis, while Sertoli cells synthe- et al. 2015). Compared to ERs, its binding affinity for 17β- size the majority of estrogen in immature testis (Schulster et al. estradiol is considerably lower and the association and disso- 2016). The production of estrogens from androgens is ciation rates are very rapid. governed by cytochrome P450 aromatase within the endoplas- Using a Gper-lacZ reporter mouse, extensive expression of mic reticulum of cells, which is expressed also under spatio- testicular GPER was demonstrated (Isensee et al. 2009). Until temporal control. P450 aromatase is responsible for catalyzing recently, function of GPER in testicular cells was only partially the series of reactions that lead to the irreversible conversion of known. GPER expression was found in a mouse spermatogo- testosterone and androstenedione into estradiol and estrone, nia cell line GC-1 (Sirianni et al. 2008), in adult rat pachytene respectively (Carreau et al. 2003). A proper balance between spermatocytes and round spermatids (Chimento et al. 2010, androgen and estrogen is fundamental for normal male repro- 2011) highlighting a role for this receptor in spermatogenesis. ductive development and function in both animals and humans. Moreover, GPER expression has been currently demonstrated In various species including humans, a more significant estro- in Sertoli cells, highlighting their multiple function in seminif- gen concentration exists in the male reproductive tract and erous tubule physiology (Lucas et al. 2010, 2011). Sandner et semen than in the serum (Hess 2003). Interestingly, in boars, al. (2014) observed an inverse relationship of GPER the intratesticular estradiol level is higher than that in dams in expression and fertility in peritubular cells of monkey and estrus (Hoffmann et al. 2010). Regulation of testicular cells by human. Using qPCR, Fietz et al. (2014, 2016) showed estrogen shows both an inhibitory and a stimulatory influence, GPER expression in Leydig cells and Sertoli cells of human indicating an intricate symphony of dose-dependent and tem- testis. Expression level in Leydig cells was the highest when porally sensitive modulation. In various tissues, estrogen con- compared to Sertoli cells and human breast cancer (MCF-7) trols growth, differentiation and proliferation/apoptosis migra- cells. Unfortunately, GPER protein was not analyzed (due to tion of both normal and malignant cells (Barakat et al. 2016; problem with antibody). Thus, in primate peritubular cells, Acconcia et al. 2016). Estrogen is also a metabolic hormone GPER mediates estrogen action in both, testis in health and and it supervises the integrated physiology of tissues regulating disease. Our previous studies demonstrated the presence of lipid homeostasis (Shen and Shi 2015). GPER in Leydig cells of bank voles with various sex hor- In the male gonad, inhibition of steroidogenic Leydig cell mones levels; however, receptor expression was not altered regeneration in ethane dimethylsulfonate-treated rats, after in regard to normal or physiologically decreased intratesticular subsequent estradiol exposure, indicates Leydig cells self- estrogen concentration (Zarzycka et al. 2016). The involve- regulate their number via estrogen modulation in a paracrine ment in GPER action second messengers such as protein ki- fashion of fetal Leydig cell quantity (Abney and Myers 1991). nase A and extracellular signals-regulated kinase, as well as Furthermore, there is evidence suggesting that estradiol in- Ca2+, cAMP, cGMP and metalloproteinase 9, was reported hibits effect of lutropin (LH) on Leydig cells and excess es- too. Nonetheless, the role of GPER for Leydig cell morpho- trogen reduces serum testosterone levels (Hess 2003). The functional status needs further detailed attention. subsequent decrease of testosterone in turn inhibits spermato- It has been shown that GPER regulates the proliferative and genic function (Atanassova et al. 1999). Studies have con- apoptotic pathways involved in spermatogenesis (Prossnitz and firmed that, in the above processes, estrogen signaling via Barton 2011) but there are no data on steroidogenic testis func- ERs localized in testicular cells in a species-, age- and physi- tion. No clear developmental or functional defects in the repro- ological status-specific way takes place (for review see Hess ductive organs of GPER knockout male mice were reported 2000; Carreau et al. 2012). Of note, the unique presence of (Mårtensson et al. 2009;Ottoetal. 2009). On the other hand, ERβ in the mitochondria reported since now in cells of human GPER knockouts were moderately obese with larger adipocyte uterus, ovary, cardiomyocytes, rat primary neurons, human size indicating lipid homeostasis disturbances. It should be bone narrow neuroblast (SH-SY5Y) cells, lens epithelial cells, mentioned here that although there are still controversies on sperm, human breast cancer (MCF-7) cells, human non-small ERβ knockout mouse fertility, ERα knockouts exhibit various cell lung cancer (NSCLC) cells, human adenocarcinomic al- reproductive organ defects (Krege et al. 1998; Antal et al. 2008; veolar basal epithelial (A549) cells, human hepatoma Lee et al. 2009). In efferent ducts, fluid absorption is altered due (HepG2) cells, human osteosarcoma (SaOS-2 and 143B) cells to aquaporin 1 and carbonic anhydrase dysfunction (Hess Cell Tissue Res 2000). The role of GPER in the male reproductive system is Ni-U microscope (Nikon, Tokyo, Japan). A tubus setting of complex and regulated at multiple levels, thus requiring further 1.25, a × 10 ocular and a × 10 objective was used for the in-depth investigation. This study aims to better understand the measurements. Detailed morphologic analysis was performed involvement of GPER in Leydig cell function via examination with the use of NIS-Elements software (Nikon, Tokyo, Japan), of the morpho-functional and secretion status of these cells. as previously described (Kotula-Balak et al. 2012). The area of Moreover, the interaction between GPER and ERs together the interstitium occupied by Leydig cells was determined in 40 with P450 aromatase is a crucial goal of the present study. To random fields of vision (which corresponds to 17.7 mm )for our knowledge, this is the first in vitro and in vivo study on the each animal from the control and treated groups. A mean was importance of GPER in testicular Leydig cell biology. determined for control animals and those treated with G-15. Cell culture and treatments Materials and methods The mouse Leydig cell line MA-10 was a generous gift from Animals and treatments Dr. Mario Ascoli (University of Iowa, Iowa City, USA) and was maintained under standard technique (Ascoli 1981). Male mice (C57BL/6) 3 weeks old (n = 10), 3 months old (n = Middle passages (p25-p28) of MA-10 cells were used for 10) and 1.5 years old (n = 10) were obtained from the the study. The cells were grown in Waymouth’smedia Department of Genetics and Evolution, Institute of Zoology (Gibco, Grand Island, NY) supplemented with 12% horse and Biomedical Research, Jagiellonian University, Kraków. serum and 50 mg/l of gentamicin at 37 °C in 5% CO .Cells Animals were maintained on 12 h dark-light (250 lx at cages were plated overnight at a density of 1 × 10 cells/ml per well. level) cycle with stable temperature condition (22 °C), relative Morphological and biochemical properties of MA-10 cells humidity of 55 ± 5% and free access to water and standard were regularly checked by microscopic observation, analysis pelleted diet (LSM diet, Agropol, Motycz, Poland). Animals of proliferation (TC20 Bio-Rad automated cell counter), my- were killed by cervical dislocation. The use of the animals was coplasma detection (MycoFluor™ Mycoplasma Detection approved by the National Commission of Bioethics at the Kit; ThermoFisher Scientific), qRT-PCR analysis of charac- Jagiellonian University in Krakow, Poland (No. 151/2015). teristic genes and ELISA measurements of secretion products Mice from various age groups were allotted into experimental according to cell line authentication recommendations of the groups (each group including 5 animals); and control (Cont.) and Global Bioresource Center (ATCC). treated receiving selective GPER receptor antagonist Twenty-four hours before the experiments, the medium was [(3aS*,4R*,9bR*)-4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b- removed and replaced with a medium without phenol red sup- 3H-cyclopenta[c]quinolone; G-15] (Tocris Bioscience, Bristol, plemented with 5% dextran-coated, charcoal-treated FBS (5% UK). G-15 was dissolved in DMSO and the stock solutions were DC-FBS) to exclude estrogenic effects caused by the medium. kept at − 20 °C. Animals from the experimental groups were Next, cells were treated with selective GPER receptor antago- injected subcutaneously with freshly prepared solutions of G- nist [(3aS*,4R*,9bR*)-4-(6-bromo-1,3-benzodioxol-5-yl)- 15 (50 μg/kg bw) in phosphate buffered saline (six doses each 3a,4,5,9b-3H-cyclopenta[c]quinolone; G-15] (Tocris dose injected every other day). Mice from control groups re- Bioscience, Bristol, UK) freshly prepared 100 μM stock solu- ceived vehicle only. Dose, frequency and time of G-15 adminis- tion in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) stored at tration were based on literature data (Dennis et al. 2009;Anetal. − 20 °C. A stock concentration was subsequently dissolved in 2014;Kangetal. 2015) and it was finally selected upon our Waymouth’s media to final concentration of 10 nM. Cells were preliminary study in mice in vivo (doses range between 5, 50, treated with G-15 alone or together with 17β-estradiol (Sigma- 100, 150, 200 μg/kg bw). Both testes of each individual of con- Aldrich; 10 mM) and ER antagonist ICI 182,780 (ICI; trol and G-15-treated mice were surgically removed and were cut Faslodex, Sigma–Aldrich, St. Louis, MO, USA; 10 μM) fresh- into small fragments. For histology and immunohistochemistry, ly prepared in ethanol, for 24 h. Dose of G-15 was based on tissue samples were fixed in 10% formalin and embedded in literature data (Dennis et al. 2011; Bertrand et al. 2015; paraplast. Small pieces of the testicular tissue were immediately Carnesecchi et al. 2015; Treen et al. 2016) and it was finally fixed in glutaraldehyde for transmission microscopy analysis or selected upon our preliminary study (dose range 1, 10, frozen in a liquid nitrogen and stored at − 80 °C for RNA isola- 100 nM). Doses of E2 and ICI were based on our previous tion and determination of steroid hormones. studies (Kotula-Balak et al. 2013;Pardyaketal. 2016;Milon et al. 2017). Control cells were treated with DMSO or ethanol Histology or both together (final conc. 0.1%). We performed microscopic analysis of ultrastructure, as well as mitochondria activity and For routine histology, hematoxylin-eosin staining was per- cytoskeleton structure of Leydig cells. Culture media were fro- formed. The sections were examined under a Nikon Eclipse zen in − 20 °C for steroid hormone level determination. Cell Tissue Res Ultrastructure assessed using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Samples with a The fixation procedure described below was based on the 260/280 ratio of 1.95 or greater and a 260/230 ratio of 2.0 or protocols proposed by Russell and Burguet (1977). The mod- greater were used for analysis. Total cDNA was prepared ification developed in our labs had important advantages: it using High-Capacity cDNA Reverse Transcription Kit improved the quality of fixation and enhanced the contrast of (Applied Biosystems, Carlsbad, CA, USA) according to the plasma membrane and the organelles. Briefly, Leydig cells in manufacturer’sinstructions. vitro and dissected testes (control and G-15-treated) were im- The purified total RNA was used to generate total cDNA. A mersed in ice-cold pre-fixative containing 2% formaldehyde volume equivalent to 1 μg of total RNAwas reverse transcribed and 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.3. using the High-Capacity cDNA Reverse Transcription Kit The tissues were then rinsed and post-fixed in a mixture of 2% (Applied Biosystems, Carlsbad, CA, USA) according to the osmium tetroxide and 0.8% potassium ferrocyanide in the manufacturer’s instructions. Total cDNA was prepared in a same buffer for 30 min at 4 °C. The material was embedded 20-μL volume using a random primer, dNTP mix, RNase in- in Glycid Ether 100 resin (Serva, Heidelberg, Germany). hibitor and reverse transcriptase (RT). Parallel reactions for Semi-thin sections (0.7 μm thick) were stained with 1% meth- each RNA sample were run in the absence of RT to assess ylene blue and examined under a Leica DMR (Wetzlar, genomic DNA contamination. RNase-free water was added Germany) microscope. Prior to embedding, small (3–5mm) in place of the RT product. pieces of testicular tissue were carefully oriented in the mold to obtain accurate cross-sections of the tubules. Ultrathin sec- Real-time quantitative RT-PCR tions (80 nm thick) were contrasted with uranyl acetate and lead citrate and analyzed with a JEOL 2100 HT (Japan) TEM. Real-time RT-PCR was performed using the StepOne Real- Time PCR system (Applied Biosystems) and optimized stan- Mitochondrial activity and cytoskeleton structure dard conditions as described previously by Kotula-Balak et al. (2012, 2013). Based on the gene sequences in the Ensembl Leydig cells (control, G-15, and estradiol-treated) were grown database, primer sets were designed using Primer3 software on coverslips (Ø12 mm; Menzel Gläser, Germany) and used (Table 1). Selected primers were synthesized by the Institute as live. For mitochondrial activity analysis, MitoTracker™ of Biochemistry and Biophysics, Polish Academy of Science Orange CMTMRos (Thermo Fisher Scientific) was applied. (Warsaw, Poland). Preparation of dye stock solution (1 mM in DMSO) and pre- To calculate the amplification efficiency, serial cDNA di- formation of staining was prepared based on manufacturer’s lution curves were produced for all genes (Pfaffl 2001). A protocol. For tubulin filaments labeling Tubulin Tracker™ graph of threshold cycle (Ct) versus log10 relative copy num- Oregon Green ® (Thermo Fisher Scientific), 500 μMin ber of the sample from a dilution series was produced. The DMSO according to manufacturer’s protocol was used. slope of the curve was used to determine the amplification –1/slope−1 Stained cells were analyzed in a LSM 510 META confocal efficiency: %E = (10 ) × 100. All PCR assays system with a Zeiss Axiovert 200M inverted microscope (Carl displayed efficiency between 94 and 104%. Zeiss GmbH, Jena, Germany). To evaluate the intensity of Detection of amplification products for GPER, ERα, ERβ fluorescence quantitatively, digital images were obtained and and P450arom and for the reference gene Tubulin a1α analyzed using public domain ImageJ software (National (Tuba1α), was performed with 10 ng cDNA, 0.5 μMprimers Institutes of Health, Bethesda, Maryland, USA). The intensity and SYBR Green master mix (Applied Biosystems) in a final of fluorescence was calculated using the formula described by volume of 20 μL. Amplifications were performed as follows: Smolen (1990) and expressed as relative fluorescence in arbi- 55 °C for 2 min, 94 °C for 10 min, followed by annealing trary units. Results of 20–30 separate measurements were temperature for 30 s (Table 1) and 45 s 72 °C to determine expressed as mean ± SD. the cycle threshold (Ct) for quantitative measurement as de- scribed previously (Kotula-Balak et al. 2013). To confirm am- RNA isolation, reverse transcription plification specificity, the PCR products from each primer pair were subjected to melting curve analysis and subsequent aga- Total RNA was extracted from control and G-15-treated rose gel electrophoresis. In all real-time RT-PCR reactions, a mouse testes and Leydig cells using TRIzol® reagent (Life negative control corresponding to RT reaction without the re- Technologies, Gaithersburg, MD, USA) according to the man- verse transcriptase enzyme and a blank sample were carried ufacturer’s instructions. To remove contaminating DNA and out (not shown in all figures). All PCR products stained with DNase from RNA preparations, the RNA samples were incu- Midori Green Stain (Nippon Genetics Europe GmbH, Düren, bated with reagents from the TURBO DNA-free™ Kit Germany) were run on agarose gels. Images were captured (Ambion, Austin, TX). The yield and quality of the RNAwere using a Bio-Rad Gel Doc XR System (Bio-Rad Laboratories, Cell Tissue Res Table 1 Sequences of forward and reverse primers Genes Primers (5′–3′) GCCTCT Product size (bp) Annealing temperature (°C) Cycles References GPER 5′- CTGGACGAGCAGTATTACGATATC - 3′ 295 62 35 http://www.ensembl.org 5′- TGCTGTACATGTTGATCTG - 3′ (ENSMUSG00000053647) P450arom 5′- CCCCTGGACGAAAGTTCTATTG - 3′ 238 62 35 http://www.ensembl.org 5′- CAGCGAAAATCAAATCAGTTGC - 3′ (ENSMUSG00000032274) ERα 5′- GCGCAAGTGTTACGAAGTGG - 3′ 375 60 40 http://www.ensembl.org 5′- AAGCCTGGCACTCTCTTTGC - 3′ (ENSMUSG00000019768) ERβ 5′- TCTGTGTGAAGGCCATGATC - 3′ 237 60 40 http://www.ensembl.org 5′- GCAGATGTTCCATGCCCTTG - 3′ (ENSMUSG00000021055) TUBa1α 5′- CGGAACCAGCTTGGACTTCTTTCCG - 3′ 321 60 40 http://www.ensembl.org 5′- GGAACTGGCTCTGGCTTCACC - 3′ (ENSMUST00000134214) GPER G-coupled membrane estrogen receptor, P450arom cytochrome P450 aromatase, ERα estrogen receptor alpha, ERβ estrogen receptor beta, TUBa1α tubulin a1α Hercules, CA, USA). GPER, ERα, ERβ and P450arom peroxidase complex (ABC/HRP; 1:100; Dako, Glostrup, mRNA expressions were normalized to the Tuba1α mRNA Denmark) were applied in succession. Bound antibody was (tested with other references genes: GAPDH and β-actin in a visualized with 3,3′-diaminobenzidine (DAB) (0.05%; v/v; pilot study) (relative quantification, RQ = 1) with the use of the Sigma-Aldrich) as a chromogenic substrate. Control sections −ΔΔCt 2 method, as previously described by Livak and included omission of primary antibody and substitution by Schmittgen (2001). irrelevant IgG. Thereafter, sections were washed and were Three independent experiments were performed, each in slightly counterstained with Mayer’s hematoxylin and triplicate with tissues prepared from different animals. mounted using DPX mounting media (Sigma–Aldrich). Immunocytochemistry or immunofluorescence labeling Immunohistochemistry, immunocytochemistry was performed on Leydig cells (prepared as previously men- and immunofluorescence tioned). Cells were fixed using 4% paraformaldehyde for 5 min or absolute methanol for 7 min followed by acetone To optimize immunohistochemical staining, testicular sections for 4 min both at − 20 °C respectively. Next, only cells for immunocytochemistry were rinsed in TBS containing 0.1% both control and G-15-treated were immersed in 10 mM citrate buffer (pH 6.0) and heated in a microwave oven (2 × 5 min, Triton X-100. Nonspecific binding sites were blocked with 700 W). Thereafter, sections were immersed sequentially in 5% normal goat serum for 30 min. Thereafter, cells were in- H O (3%; v/v) for 10 min and normal goat serum (5%; v/v) cubated overnight at 4°C in a humidified chamber in the pres- 2 2 for 30 min that were used as blocking solutions. Afterwards, ence of primary antibodies listed in Table 2. On the next day, sections were incubated overnight at 4 °C with primary anti- biotinylated antibody goat anti-rabbit (1:400; Vector bodies listed in Table 2. Next, respective biotinylated antibod- Laboratories) or Alexa Fluor 488 goat anti-rabbit antibody ies (anti-rabbit, anti-goat, and anti-mouse IgGs; 1: 400; Vector, (1:100; Invitrogen, Co., Carlsbad, CA, USA) was applied Burlingame CA, USA) and avidin-biotinylated horseradish for 45 and 60 min, respectively. After each step in these Table 2 Primary antibodies used for immunocyto-, immunohisto- and immunofluorescence Antigen Host species of Vendor Dilution Host species of secondary antibodies Vendor primary antibodies GPER Rabbit Abcam 1:50 (ICC) Biotinylated goat anti-rabbit (ICC, IHC) Vector Laboratories cat.no. ab39742 1:250 (IHC) BA-1000 1:100 (IF) Alexa Fluor 488 goat anti-rabbit (IF) Thermo Fisher Scientific A-11008 P450arom Rabbit Santa Cruz Biotechnology 1:100 (ICC) Goat anti-rabbit Vector Laboratories cat.no. sc-30086 1:500 (IHC) BA-1000 ERα Rabbit Abcam 1:20 (ICC) Goat anti-rabbit Vector Laboratories cat.no. ab75635 1:100 (IHC) BA-1000 ERβ Rabbit Abcam 1:20 (ICC) Goat anti-rabbit Vector Laboratories cat.no. ab3576 1:50 (IHC) BA-1000 GPER G-coupled membrane estrogen receptor, P450arom cytochrome P450 aromatase, ERα estrogen receptor alpha, ERβ estrogen receptor beta Cell Tissue Res procedures, cells were carefully rinsed with TBS; the antibod- Estradiol concentrations were measured using ies were also diluted in TBS buffer. The staining for the light [2,4,6,7- H]-estradiol (specific activity 81 Ci/mmol: microscopy was developed using ABC/HRP complex for American Radiolabeled Chemicals, Inc.) as a tracer and rabbit 30 min followed by DAB. Thereafter, cells were washed and antibody against estradiol-17-O-carboxymethyloxime: BSA were slightly counterstained with Mayer’s hematoxylin and (a gift from Institute of Pharmacology, Polish Academy of mounted using DPX mounting media (Sigma–Aldrich). Sciences, Krakow, Poland). The lower limit of sensitivity of Cells were examined with a Leica DMR microscope (Leica the assays was 5 pg. Cross-reaction was 1% with keto- Microsystems, Wetzlar, Germany). Fluorescent staining was oestradiol-17b, 0.8% with estrone, 0.8% with estriol, 0.01% protected from light and cells were mounted with Vectashield with testosterone and less than 0.1% with major ovarian ste- mounting medium (Vector Labs) with 40,6-diamidino-2- roids. Coefficients of variation within and between assays phenylindole (DAPI) or without DAPI and next examined were below 4 and 7.5%, respectively. Assays were validated with an epifluorescence microscope Leica DMR (Leica by demonstrating parallelism between serial dilutions of cul- Microsystems) equipped with appropriate filters. ture media and standard curve. Coefficients of variation within The whole procedure was described in detail elsewhere and between each assay were 7.6 and 9.8%, respectively. The (Kotula-Balak et al. 2013; Zarzycka et al. 2016; Pawlicki et al. recovery of unlabeled steroids was also assessed (never less 2017). Experiments were repeated three times. than 90%). In addition to monitoring intra-assays and inter- assays, assay quality control was assessed by control samples Radioimmunoassay representing low, medium and high concentrations of mea- sured hormones. Samples (each in triplicate with tissues pre- Culture media (100 μl) of control and G-15, E2, ICI-treated pared from different animals) were counted in a scintillation Leydig cells were analyzed for progesterone content using the counter (LKB 1209 RACKBETA LKB; Turku, Finland). The radioimmunological technique described elsewhere (Abraham concentrations of sex steroids were calculated as pg/10 cells. et al. 1971). Progesterone level was determined using [1,2,6,7- H]-progesterone (Amersham International plc), spe- Statistical analysis cific activity 96 Ci/mmol, as a tracer and an antibody raised in a sheep against 11β-hydroxyprogesterone succinyl-bovine Each variable was tested by using the Shapiro-Wilk W test for serum albumin (BSA), (a generous gift from Prof. Brian normality. Homogeneity of variance was assessed with Cook, University Glasgow, Scotland, UK). Progesterone assay Levene’s test. Since the distribution of the variables was nor- was validated by demonstrating parallelism between serial di- mal and the values were homogeneous in variance, all statis- lutions of culture media and standard curve. It cross-reacted tical analyses were performed using one-way analysis of var- with pregnenolone (1.8%), corticosterone (1.5%), 17α- iance (ANOVA) followed by Tukey’s post hoc comparison hydroxyprogesterone (only 0.8%) and testosterone (only test to determine which values differed significantly from con- 0.12%). Binding of four related steroids such as 20α- trols. The analysis was made using Statistica software dihydroprogesterone, 20β-dihydroprogesterone, 17α- (StatSoft, Tulsa, OK, USA). Data were presented as mean ± hydroxy-20 β-dihydroprogesterone, 17α and 20α- SD. Data were considered statistically significant at p <0.05. hydroxyprogesterone and other steroids was below 0.01%. Coefficients of variation within and between assays were 5.0 and 9.8%, respectively. Results To determine and testosterone and estradiol level in testic- ular homogenates of control and G-15-treated mouse testes, GPER mRNA level and protein localization in mouse the radioimmunological technique described elsewhere testes and Leydig cells (Hotchkiss et al. 1971; Dufau et al. 1972;Pawlicki etal. 2017) was used. Testosterone levels were assessed using Depending on animal age, as well as Leydig cell of origin [1,2,6,7- H]-testosterone (specific activity 110 Ci/mmol; (mouse testis or tumor mouse Leydig cell line), differences American Radiolabeled Chemicals, Inc.) as a tracer and rabbit in mRNA level were found (Fig. 1a, b). G-15 treatment de- antibody against testosterone-3-0-CMO:BSA (a gift from Dr. creased expression of GPER in all treated age groups, with a B. Ričařova, Institute of Radiology, Czech Academy of significant decrease in mature animals (p <0.01). In MA-10 Sciences, Prague, Czech Republic). The lower limit of sensi- Leydig cells treated with G-15, a significant decrease (p < tivity was 5 pg. Cross-reaction of this antibody was 18.3% 0.05) was observed as well. with dihydrotestosterone, 0.1% with androstenedione and less In immature, mature and aged testis sections, membrane- than 0.1% with other major testis steroids. Coefficients of var- cytoplasmic localization of GPER was found (Fig. 1c–e). In iation within and between assays were below 5.0 and 9.7%, MA-10 Leydig cells, GPER was exclusively localized to the respectively. membrane (Fig. 1f). Cell Tissue Res Fig. 1 GPER mRNA level and protein localization in mouse testes and Representative microphotographs of cellular localization of GPER in Leydig cells. (a–f’). a Representative gel electrophoresis of qualitative membrane and cytoplasm of Leydig cells of immature (c), mature (d) expression, (line N1-negative control without complementary DNA tem- and aged (e) mouse testes and in membrane of mouse MA-10 Leydig plate, line N2-negative control without nonreverse transcribed RNA), b cells (f) (arrows). Immunostaining with DAB and counterstaining with and relative quantification (RQ) of mRNA for GPER in mouse testes; hematoxylin (c–e). Scale bars represent 15 μm. Staining was performed immature, mature, aged [control and G-15 (50 μg/kg bw)-treated] and on testicular serial sections from at least three animals from each group. mouse MA-10 Leydig cells [control and G-15 (10 nM)-treated]. RQ is Immunofluorescence with DAPI (f, f’). Scale bars represent 20 μm. expressed as means ± SD. Asterisks show significant differences between Immunoreaction was performed on Leydig cell cultures in triplicate. control and G-15-treated testes/cells. Values are denoted as *p <0.05 **p Inserts in (c–e)and (f’)—negative controls—no immunostaining is visi- < 0.01. From each animal, three mRNA samples were analyzed. (c–f’) ble when the primary antibody is omitted Effect of GPER blockage on mouse testis histology in lumens of tubules when compared to mature animals was and Leydig cells morphology observed (Fig. 2e, f and c, d). In treated males, when compared to controls, a slight increase in the interstitial tissue volume G-15 treatment exerted no effect on immature testis while a was revealed (2.69 ± 0.05* vs 2.06 ± 0.09 mm ). slight effect was observed in mature and aged mouse testis histology (Fig. 2a–f). In control and treated immature males, Effect of GPER blockage on Leydig cell ultrastructure the seminiferous tubules filled up with spermatogenic cells and small clusters of Leydig cells were observed (Fig. 2a, b). In Control immature Leydig cells exhibit normal ultrastructure control and treated mature males, normal seminiferous tubules possessing numerous mitochondria (m) and lipid droplets (ld) with full spermatogenesis were seen (Fig. 2c, d). In addition, (Fig. 3a, b). After G-15 treatment more lipid droplets were overgrowth of interstitial tissue was visible when compared to seen, some surrounded with concentrically located endoplas- control (2.21 ± 0.20 vs 1.97 ± 0.14 mm ). In both control and mic reticulum (er) cisternae, thereby suggesting formation of treated aged animals, a small number of elongated spermatids new lipid droplets (Fig. 3c, d). In control mature Leydig cells, Cell Tissue Res Fig. 2 Effect of GPER blockage on mouse testis histology and Leydig spermatogenesis in seminiferous tubules of both control and G-15 mature cells morphology (a–f). Representative microphotographs of (a, c, e) males (c, d). Leydig cells in small groups in control (c) but enlarged control and (b, d, f) G-15 (50 μg/kg bw)-treated mouse testes. (a, b) interstitial tissue with Leydig cells after exposure to G-15 (d)(arrows) Immature (c, d) mature and (e, f) aged mouse testicular sections. is visible. Full spermatogenesis but not as active as in mature mice is Hematoxylin-eosin staining. Scale bars represent 15 μm. Staining was observed in aged control and G-15 males (compare number of elongated performed on testicular serial sections from at least three animals of each spermatids in lumens of tubules c, d and e, f). Leydig cells surrounding experimental group. Small clusters of Leydig cells and not active semi- seminiferous tubules and located in groups. Subtle differences in niferous tubules but with open lumens in a majority of tubules, in both abundancy of interstitial tissue are seen between control and G-15 aged control and G-15-treated immature males are observed (a, b). Full males (arrows) (e, f) lipid droplets were less numerous than in immature cells cisternae, probably non-active and degenerating, between (Fig. 4a). Golgi complexes (Gc) and rough endoplasmic retic- normal-looking mitochondria were revealed (Fig. 5c–e). ulum (rer) were frequently seen. In cells treated with G-15, large mitochondria and numerous lipid droplets were revealed (Fig. 4b–d). They were localized in relatively large accumula- Effect of GPER blockage on Leydig cell mitochondrial tions, indicating cytoskeleton alternations. In control-aged activity and cytoskeleton structure Leydig cells, the endoplasmic reticulum, mitochondria and lip- id droplets were normally distributed (Fig. 5a, b). After G-15 After Leydig cell treatment with each of the mentioned agents, treatment, concentrically in structure endoplasmic reticulum no morphological alterations were seen (not shown). Cell Tissue Res Fig. 3 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– d Immature Leydig cells ultrathin sections. a Control immature Leydig cells exhibit normal mor- phology. In control immature Leydig cells, numerous mito- chondria (m) and lipid droplets (ld) are seen (a). b–d After G-15 treatment in immature Leydig cells, more lipid droplets (ld) are observed; some of them are surrounded with concentrically located rough reticulum endo- plasmic (er) cisternae (c;arrow) Control Leydig cells were undisturbed, exhibiting high mi- and aged mice, both control and experimental (G-15-treated), tochondrial activity (Fig. 6a–i and j) and a normal tubulin as well as control and experimental Leydig cells (G-15-, E2-, cytoskeleton structure (Fig. 6k–m and n). In cells treated with ICI-treated alone or in combination), revealed changes in the G-15, decrease in mitochondrial (p < 0.05) and tubulin activ- expression level of the studied genes (Fig. 7a–h). No marked ity was revealed. A marked decrease (p < 0.05) in mitochon- differences in TUBa1α levels were revealed either in control dria function and tubulin structure (p < 0.05) was found after and experimental mouse testes of various age or MA-10 treatment with G-15 and E2. After treatment with ICI and E2 Leydig cells (Fig. 7a, e). alone or in combination (ICI + E2 and ICI + G-15), no signif- In treated mice of different ages, a similar trend in expres- icant changes in the mitochondria and tubulin activity were sion of estrogen receptors and aromatase was found. In testes revealed (not shown). with G-15 treatment, significant increase in expressions of ERα (p <0.05; p <0.01), ERβ (p < 0.001) and P450arom (p Effect of GPER blockage on mRNA expression <0.05; p < 0.01) were observed when compared to their re- of aromatase and estrogen receptors α and β spective controls (Fig. 7a–d). in mouse testes and Leydig cells in vitro In in vitro Leydig cells, the same tendency of in vivo ex- pression of the respective genes was revealed (Fig. 7e–h). Electrophoresis revealed PCR-amplified products of the pre- Treatment with E2, ICI, or G-15 alone increased the expres- dicted sizes: 375 bp for ERα, 237 bp for ERβ, 238 bp for sions of ERα (p <0.05; p < 0.01), ERβ (p <0.01) and P450arom and 321 bp for tubulin a1α (TUBa1α; reference P450arom (p <0.05; p < 0.01). Treatment of Leydig cells with gene) in both mouse testes and Leydig cells in vitro (Fig. 7a– E2, ICI, or G-15 in combination increased expression of both h). Real-time RT-PCR analysis in testes of immature, mature estrogen receptors and aromatase in comparison to controls; Cell Tissue Res Fig. 4 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– d Mature Leydig cells ultrathin sections. In control mature Leydig cells, lipid droplets (ld) are less numerous. a, b Mature Leydig cells exhibit normal morphology. Golgi complexes (Gc) and rough ER (rer) are frequently observed (a, b). c, d In G-15 mature Leydig cells, large mitochondria (m) and numerous lipid droplets (ld) lo- calized in large accumulations are visible however, the increase was lower (only significant for aroma- mice (Fig. 8e, f). Immunoexpression of aromatase in both tase p < 0.05) when compared to the individual treatments groups was of moderate intensity. A slight increase in ERα with these agents. expression in the nuclei and in Leydig cell cytoplasm was noted after G-15 treatment of immature mice (Fig. 9a, b). In Effect of GPER blockage on aromatase and estrogen both mature and aged controls and G-15-treated, no change in receptors localization in mouse testes and Leydig cells ERα expression was observed. Increased expression was in vitro seen in mature males while moderate expression was ob- served in the nuclei and cytoplasm of aged Leydig cells When blocked by G-15, immunoexpression of aromatase, (Fig. 9c–f). A slight decrease in ERβ expression was found ERα and ERβ in immature, mature, or aged Leydig cells in the cytoplasm of immature males in comparison to controls was altered (Fig. 8a–f). In testes of immature males, no chang- (Fig. 10a, b). ERβ expression was moderate in controls and es in aromatase expression after G-15 treatment were found weak in G-15-exposed males and found to be exclusively when compared to controls (Fig. 8a, b). Immunostaining was localized in the cytoplasm of Leydig cells of mature mice observed in the cytoplasm of all Leydig cells. Increased aro- (Fig. 10c, d). In control aged males, moderate, cytoplasmic matase expression was found in Leydig cells of G-15-treated expression of ERβ was found partially localized to the nucle- mature males while downregulated expression was observed us in Leydig cells of males treated with G-15 (Fig. 10e, f). In in control ones (Fig. 8c, d). No difference in expression of negative controls, no positive staining was observed aromatase was noted between control and G-15-treated aged (Figs. 8a, 9c,and 10e). Cell Tissue Res Fig. 5 Effect of GPER blockage on Leydig cell ultrastructure. Representative microphotographs of Leydig cells of control and G- 15 (50 μg/kg bw)-treated mice. a– e Aged mouse Leydig cells ultra- thin sections. Each testicular sample in the epoxy resin block was cut for at least three ultrathin sections that were analyzed. Bars represent 1 μm. Analysis was performed on testicular blocks from at least three animals of each experimental group. Aged Leydig cells exhibit normal morphology. In control aged Leydig cells, nor- mal number and localization of endoplasmic reticulum (er), mito- chondria (m) and lipid droplets (ld) are seen (a, b). (c–e)Note, in G-15 aged Leydig cells, the con- centric structure of endoplasmic reticulum (er) cisternae (asterisks; c, e) in between normal-looking and normal-distributed mitochon- dria (c, d). (nu) nucleus Weak to moderate aromatase immunoreaction was found in with both E2 and ICI, strong nuclear immunostaining was the cytoplasm of all control Leydig cells (Fig. 11a). Increased present in a minority of cells (Fig. 11j, k). G-15 treatment aromatase expression was observed after E2 treatment revealed weak immunostaining in single Leydig cells (Fig. 11b). Following treatment with ICI, weak staining was (Fig. 11l) but that was not seen in cells treated with ICI to- observed while after G-15 moderate staining was revealed gether with E2 or G-15 (Fig. 11m, n). In cells exposed to G-15 (Fig. 11c, d). Combined treatments of ICI with E2, G-15 with with E2, moderate to strong immunostaining was detected in E2 and G-15 with ICI resulted in strong to moderate aroma- the cytoplasm (Fig. 11o). Expression of ERβ was moderate in tase expression in a majority of treated cells (Fig. 11e–g). the nuclei of control Leydig cells (Fig. 11q). E2 treatment Strong immunoexpression of ERα was observed in the nuclei increased ERβ expression that was still visible in the nuclei, of a majority of control Leydig cells (Fig. 11i). After treatment while some cells exhibited cytoplasmic staining (Fig. 11r). In Cell Tissue Res Cell Tissue Res Fig. 6 Effect of GPER blockage on Leydig cell mitochondrial activity receptors (ERα,ERβ) are present at every stage of gonad and cytoskeleton structure. Representative microphotographs and graphs development (Lemmena et al. 1999; Jefferson et al. 2000; of (a–j) mitochondrial activity and (k–n) cytoskeleton structure in Carreau et al. 2003; Lazari et al. 2009). GPER has been control, G-15- and E2- treated MA-10 Leydig cells. Representative mi- identified in a variety of human and rodent estrogen target crophotographs of cellular localization of MitoTracker (a–i) in cytoplasm of control (a, g), G-15 (b, h) and G-15 with E2 (17β-estradiol) (c, i)- tissues; thus, its important role in estrogen signaling is cur- treated Leydig cells. Immunofluorescence with DAPI (d–f). rently highlighted (Chimento et al. 2010; Sandner et al. Representative microphotographs of cellular localization of 2014;Heubleinetal. 2012;Zarzyckaetal. 2016). GPER TubulinTracker in cytoplasm of control (k), G-15 (l) and G-15 with E2 has been suggested to play a role in multiple systems: skel- (m)-treated Leydig cells. Fluorescence without DAPI. Scale bars repre- sent 20 μm. Samples of cultured Leydig cells were measured in triplicate. etal (under sex-depending manner regulation), immune, Quantitative analysis of fluorescence of MitoTracker (j)and cardiovascular and renal (Prossnitz and Barton 2011). TubulinTracker (n). Histograms of fluorescent intensities expressed as However, little is known about the role of GPER in both relative fluorescence (arbitrary units; a.u.). Data are expressed as means reproductive and nonproductive cell and tissue biology ± SD. Asterisks show significant differences between control and G-15 (50 μg/kg bw) - treated mouse testes and control and G-15 (10 nM), E2 from birth to aging. Interestingly, in frogs, early expression (10 nM) - treated cells for 24 h. Values are denoted as p <0.05 of GPER and aromatase in neuromasts revealed its impor- tance in lateral line system development (Hamilton et al. 2014). Recent, initial studies by Zhang et al. (2015)dem- a majority of ICI-treated cells, ERβ staining was weak onstrated the involvement of GPER in the proper formation (Fig. 11s) while, after treatment with G-15 and ICI, E2 stain- and growth of mouse gubernaculum. In the reproductive ing had strong to moderate intensity and was located in the system, GPER was shown to regulate the proliferative and nuclei of a majority of the cells (Fig. 11t, u). After combined apoptotic pathways involved in spermatogenesis through- treatment of G-15 and E2, cytoplasmic staining of ERβ was out rat reproductive development (Lucas et al. 2014). In observed (Fig. 11v). Moderate to weak nuclear ERβ staining pachytene spermatocytes and round spermatids, GPER ac- was detected after G-15 and ICI exposure (Fig. 11w). In neg- tivated the epidermal growth factor receptor/extracellular ative controls, no positive staining was observed (Fig. 11h, p, signal-regulated kinases (EGFR/ERK) pathway, thereby in- and x). ducing the transcriptional modulation of genes controlling apoptosis and differentiation (Chimento et al. 2014). Effect of GPER on sex steroid concentration in mouse In steroidogenic Leydig cells, estrogen supervises overall testes and secretion by Leydig cells in vitro growth, development and function of these cells acting both as a modulator of precursor populations while also inhibiting The highest androgen concentration was revealed in mature steroidogenesis via the effect on LH (Abney 1999). The action of GPER in estrogen signals requires much mice when compared to immature and aged (Fig. 12a). After treatment with G-15, intratesticular androgen concentration consideration. The results presented here are the first to report significantly increased (p < 0.01) in immature mice while it on the influence of GPER on testicular Leydig cell morphol- decreased (p < 0.001) in mature males. In both aged controls ogy and function. Intratesticular estrogen concentrations, as and G-15-treated animals, no changes in androgen concentra- well as balanced estrogen and androgen concentrations, are tions were found. Intratesticular estrogen concentrations were crucial for undisturbed testis function. Any change in the sex significantly lower in immature and aged males in comparison hormone environment leads to alterations in Leydig cell to those in mature animals (Fig. 12b). Treatment with G-15 physiology that affects the action of seminiferous tubules did not create marked changes in estrogen levels. In mature and vice versa. Our results add to the current knowledge that animals, high amounts of estrogen were decreased pro- individual cells/tissues may modulate estrogen action via nouncedly (p < 0.001) after G-15 exposure. GPER in response to intrinsic factors (e.g., gender, age, genes In Leydig cells, progesterone secretion increased markedly activity) or extrinsic modulators of estrogen (e.g., synthetic (p < 0.001) after treatment with E2 alone or in combination estrogens/environmental estrogens) to determine its function with ICI or G-15 in comparison to controls (Fig. 12c). Neither (Filardo and Thomas 2012;Planteet al. 2012). It is not sur- ICI, G-15 alone, nor in combination decreased progesterone prising that the highest expression of GPER exists in mature secretion when compared to controls. testis as related to a fully developed and functional reproduc- tive system. Herein, histological observations in GPER- blocked testis are in accord with studies in knockout ERβ Discussion where increases in Leydig cells per testis correlate with in- creased steroidogenic capacity (Gould et al. 2007). Based on Estrogens are essential for reproductive tract development, literature data confirming the proliferative nature of estrogen reproductive function and male fertility. Numerous studies via both GPER and ER with a contribution of rapid signaling pathways, this effect can be common and/or shared in a large have confirmed these hormones and canonical estrogen Cell Tissue Res Fig. 7 Effect of GPER blockage on mRNA expression of aromatase and tubulin α1a mRNA level was measured in the samples [(a, e) -qualitative estrogen receptors α and β in mouse testes and Leydig cells in vitro. (a, e) expression]. RQ is expressed as means ± SD. Asterisks show significant Representative gel electrophoresis of qualitative expression of differences between control mice and those treated with G-15 (50 μg/kg P450aromatase, ERα,ERβ in mouse testes (immature, mature and bw) and control MA-10 Leydig cells and treated with G-15 (10 nM), ICI aged) (a) and MA-10 Leydig cells (e). (b–d, f–h) Relative level (relative (ICI 182,780; 10 μM), E2 (17β-estradiol; 10 nM) alone and in combina- ∗ ∗∗ ∗∗∗ quantification; RQ) of mRNA for P450aromatase (b), ERα (c), ERβ (d) tion for 24 h. Values are denoted as p <0.05, p <0.01 and p < in mouse testes (b–d) and MA-10 Leydig cells (f–h), determined using 0.001. From each animal, at least three samples were measured. Samples real-time RT-PCR analysis 2 − ΔCt method. As an intrinsic control, the of cultured Leydig cells were measured in triplicate amount by one receptor (Lucas et al. 2011; Chimento et al. consequence, aromatase overexpression in overgrown 2014;Magruder et al. 2014). On the contrary, in knockout Leydig cells was revealed. In patients with germ cell tumors, ERα,males’ hypertrophy and loss of Leydig cells with no elevated levels of chorionic gonadotropin are one possible disturbances of intratesticular steroid levels were demonstrat- cause of Leydig cell hypertrophy and hyperplasia (Zimmerli ed. Our recent study showed overgrowth of Leydig cells after and Hedinger 1991). There are multiple other potential mech- disturbance of sex hormones milieu, through blockage or anisms where chemicals might induce hyperplasia primarily activation of estrogen-related receptors (ERRs) in seasonal through a disruption in the hypothalamic-pituitary-axis. In rodent, the bank vole (Pawlicki et al. 2017). In addition, sim- most of these mechanisms, various hormones (e.g., estrogen, ilar observations were made in testes of boars treated neona- prolactin) produce an elevation in LH levels that excessively tally with antiandrogen (Kotula-Balak et al. 2013). In stimulate steroidogenic Leydig cell function (Greaves 2012). Cell Tissue Res Fig. 8 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. a–f Localization of P450aromatase; dashed lines (a–f) mark the pe- riphery of seminiferous tubules (ST). Immunostaining with DAB and counterstaining with hema- toxylin. Scale bars represent 15 μm. Immunoreaction was per- formed on testicular serial sec- tions from at least three animals of each experimental group. No changes in expression of aroma- tase in testes of immature males after G-15 treatment in compari- son to control are seen (arrows) (a, b). Increase of aromatase ex- pression is visible in Leydig cells of mature G-15 males while its expression is very weak in control ones (arrows) (c, d). In negative controls, no positive staining is seen (inserts a). No differences between expression of aromatase are visible in control and G-15 aged mice (e, f). In negative con- trols, no positive staining is seen The use of chemical agents that perturb cytoskeletal protein molecules. However, due to changes in gene expression of polarization has shed light on a key role for microfilaments GPER, ERs and aromatase, such effects are compensational and microtubules in regulating the uptake and transport of and/or are directed by one molecule. Of note, robust evidence cholesterol in steroidogenic cells. Sewer and Li (2008)report- indicates the same nuclear ERs are also located at the cell ed that trafficking of the mitochondria is dependent on micro- plasma membrane by palmitoylation and associate with spe- tubules, suggesting cytoskeleton function is necessary in ste- cific membrane proteins, e.g., caveolin 1 (Pietras and Szego roid hormone production, particularly at steps subsequent to 1977; Razandi et al. 1999; Jakacka et al. 2002). Hence, these cholesterol delivery to the mitochondria. Therefore, in ste- receptors cannot be also excluded from considerations. It is roidogenic cells, proper function of both mitochondria and well-known that different ERα and ERβ isoforms have a very cytoskeleton strongly guarantees effective sex steroid produc- diverse influence on estrogen signaling and target gene regu- tion. The lack of GPER signaling in mouse testis and Leydig lation (Chang et al. 2008; Vrtačnik et al. 2014). For example, cells affects the action of the above-mentioned cellular struc- some ERβ isoforms lack the ability to bind ligands or tures. In addition, estrogen signaling that is partially disturbed coactivators and certain isoforms affect ERα/ERβ by GPER inactivation modulates the mitochondria and tubu- heterodimerization, leading to silenced ERα signaling. It has lin fiber activity in Leydig cells by estrogen binding to other also been reported that ERβ has an inhibitory effect on ERα- estrogen receptors and/or via non-receptor estrogen signaling mediated signaling (Murphy 2011). In some instances, Cell Tissue Res Fig. 9 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. (a–f) Localization of ERα. Expression of aromatase in both groups is moderate. Slight increase in ERα expression in nuclei and partially in cytoplasm of Leydig cell is observed in G-15 immature mice (arrows) (a, b). In both mature and aged mice (control and G-15- treated) no changes in expression of ERα is seen (arrows) (c–f). In negative controls, no positive staining is seen (inserts c). The immunoexpression in cytoplasm and nuclei of Leydig cells is strong in mature males while it is moderate in aged ones (arrows) (c–f) opposite roles of ERα and ERβ have been revealed by differ- 2013; Zarzycka et al. 2016) and present results confirm that ences in their expression in various tissues and organs (Girdler ER expression is regulated by different mechanisms and is and Brotherick 2000;Hess 2003; Roa et al. 2008;Wanget al. dependent on tissue type and species studied. Interestingly, 2016). Based on revealed herein GPER, ERs and aromatase cytoplasmic localization of ERs, coupled with their occasional genes expression changes, we suggest the existence of an absence in Leydig cells, can be linked to a dynamic equilib- interaction between these genes in mouse Leydig cells of var- rium between cytoplasm and nucleus. Thus, ERs are not de- ious age. Of note, any change in GPER function results in tected at all times in a single subcellular compartment, partic- estrogen signaling modulation, leading to changes in intracel- ularly when the hormonal milieu is changing (Parikh et al. lular estrogen levels and its action in Leydig cells. 1987). Neonatal diethylstilbestrol (DES) treatment also affects Additionally, ICI affects expression of estrogen signaling ERα immunoexpression in the male rat reproductive tract molecules. The antiestrogen ICI 182,780 is similar to estradiol (Rivas et al. 2002). in its ability to decrease its receptor expression by approxi- Estrogen was found to regulate biogenesis and mitochon- mately 50% (Alarid et al. 1999; Lonard et al. 2000). drial function (Klinge 2008). The localization of ERs in Decreased expression of ERα but not ERβ, in rat efferent nuclear and ERβ in mitochondrial compartments offers a ductules after ICI treatment was demonstrated by Oliveira et potential mechanism for controlling coordinate nuclear and al. (2003). Our prior (Hejmej et al. 2011; Kotula-Balak et al. mitochondrial gene expression and function of the cell. Cell Tissue Res Fig. 10 Effect of GPER blockage on aromatase and estrogen receptors localization in mouse testes. Representative microphotographs of testicular sections of control and G-15 (50 μg/kg bw)-treated immature, mature and aged mice. Localization of ERβ (a–f)in tes- tes of control and G-15-treated mice, respectively. Slight de- crease in ERβ expression is ob- served in cytoplasm of immature males when compared to control whose expression is strong (arrows) (a, b). Moderate in con- trol mature and weak in G-15 mature males expression of ERβ is revealed exclusively in cyto- plasm of Leydig cells (arrows) (c, d). In control aged males, moder- ate cytoplasmic expression of ERβ is seen (arrows) (e)but is nuclear in a few Leydig cells of G-15 males (arrows) (f). In nega- tive controls, no positive staining is seen (inserts e). Immunoreaction was performed on testicular serial sections from at least three animals of each ex- perimental group Bopassa et al. (2010) showed involvement of GPER in the inactivation affected Leydig cell steroidogenic activity by mitochondria permeability transition pore opening in human perturbations in various organelle function. cardiovascular cells. In human skin fibroblasts, GPER trans- Estradiol controls the intracellular concentration of both mitted estrogen signaling through the ERK1/2 pathway that ERs in a positive feedback manner. This estrogen-dependent regulated fibroblast cytoskeletal reorganization, leading to modulation appears to be different for each receptor subtype changes in cellular shape (Carnesecchi et al. 2015). since estrogen differentially affects the balance between the Moreover, estrogen- and tamoxifen-induced rearrangement synthesis and breakdown of ERs (Nilsson et al. 2011; Thomas of the cytoskeleton and adhesion of the breast cancer cells and Gustafsson 2011). In turn, the presence or absence of a (MCF-7) (Sapino et al. 1986). In addition, rearrangement of specific ER subtype, as well as its dynamic temporal varia- actin and keratin filaments in the cellular projections and the tions in a cell context co-expressing both receptors (i.e., ERα/ formation of a dense network of keratin fibers took place. The ERβ ratio), is pivotal for the appearance of estrogen signaling effect was independent of the well-known estrogenic effect and dictates the resulting physiological functions. Of note, on cell proliferation that correlates with a previous study there is evidence for a role for methylation-dependent modu- where no proliferation of Leydig cells in vitro and rather lation of ERβ mRNA and the 26S proteasome in regulating volume increase in vivo was observed. Similarly, neither ERβ levels (Pinzone et al. 2004). Estradiol induces ERα blocked nor activated ERRs induced Leydig cell proliferation phosphorylation that protects the receptor from degradation, (Pawlickietal. 2017). However, both GPER and ERRs indicating how the ERα intracellular concentration is required Cell Tissue Res for the estradiol-evoked cellular effects (Marques et al. 2014). expression of estrogen signaling molecules. Either interaction We provided a perspective that addresses mRNA expression of ERs with ICI or GPER with G-15 in Leydig cells resulted changes of estrogen signaling molecules, ERα,ERβ and aro- in comparable and marked estrogen signaling disturbances, matase in mouse Leydig cells with altered GPER activity. In indicating the importance of all receptor types and their inter- in vitro Leydig cells, the absence of GPER led to increase of actions for controlling steroidognic cell function in the testis. Cell Tissue Res Fig. 11 Effect of GPER blockage on localization of aromatase and Milon et al. 2017), cell context-specific autophagy-based reg- estrogen receptors in Leydig cells in vitro. Representative ulation by GPER cannot be excluded. Until today, detailed microphotographs of control MA-10 Leydig cells (a, i, q), E2 (17-β ultrastructure of GPER deficient cells of various organs has estradiol; 10 nM) (b, j, r), ICI (ICI 182,780; 10 μM) (c, k, s), G-15 not been performed. The absence of GPER in pancreatic β- (10 nM) (d, l, t), ICI +E2 (e, m, u), G-15+E2 (f, n, v), G-15+ ICI (g, o, w)-treated Leydig cells for 24 h. (a–g) Localization of P450aromatase; (i– cells did not affect cell morphology, although reduced insulin o) localization of ERα; localization of ERβ (q–w) in control and G-15- secretion from the pancreas was noted (Sharma and Prossnitz treated Leydig cells. Immunostaining with DAB and counterstaining with 2011). Our results showed that estrogen signaling molecules hematoxylin. Scale bars represent 20 μm. Cultures of Leydig cells from control a specific function of various organelles (biogenesis, each experimental group were analyzed in triplicate. Weak to moderate aromatase immunoreaction is seen in the cytoplasm of control Leydig distribution, and degeneration) in Leydig cells in an age- cells (arrows) (a). Increase of its expression is visible after E2 treatment dependent fashion. The coordinated work of lipid droplets, (arrows) (b). After treatment with ICI weak staining while moderate after mitochondria and Golgi apparatus is required for effective G-15 treatment is seen (arrows) (c, d). After combinations of ICI with E2, steroidogenesis (Cheng and Kowal 1997;Shen etal. 2016). G-15 with E2 and G-15 with ICI strong to moderate aromatase expression in a majority of treated cells is seen (arrows) (e–g). Strong We confirmed that the mitochondria are controlled by estro- immunoexpression of ERα is observed in nuclei of control Leydig cells gens via ERβ and estrogen-related receptors (ERRs) (Giguère (arrows) (i). After treatment with both E2 and ICI strong nuclear immu- 2002;Liaoet al. 2015; Milon et al. 2017) and also by GPER nostaining is present in a minority of cells (arrows) (j, k). After G-15 along with other estrogen signaling molecules. Recent studies treatment weak immunostaining in single Leydig cells is visible (arrows), (l) which is not the case in cells treated with ICI together with have revealed new proteins associated with lipid droplets, E2 or G-15 (arrows) (m, o). In cells treated with G-15 together with E2 e.g., GPER, where one of the discovered functions in lipid moderate to strong cytoplasmic immunostaining is seen (arrow) (n). metabolism is upregulation of fatty acids synthesis in cancer Moderate expression of ERβ in a majority of nuclei of control Leydig cells (Santolla et al. 2012). Data from human embryonic kid- cells is observed (arrows) (q). Increased after E2 treatment immunostain- ing of ERβ is visible in nuclei of a majority of cells (r). In a few cells ney cells (HEK-293) showed that GPER is downregulated staining is cytoplasmic (short arrow) (r). In a majority of ICI - treated cells through the trans Golgi-proteasome pathway (Cheng et al. the ERβ staining is weak (arrows) (s) while after exposure to G-15 and 2011), indicating an important GPER role in Golgi complexes ICI with E2 staining is of strong to moderate intensity and located in function. The presence of GPER in endosomes or intracellular nuclei of a majority of cells (arrows) (t, u). After treatment with G-15 and E2 in combination mainly cytoplasmic staining for ERβ is observed membranes and its capacity to activate plasma membrane re- (arrows) (v). Moderate to weak nuclear ERβ staining is visible after G-15 ceptors, indicates a critical role of GPER in physiological and and ICI exposure (arrows) (w). In negative controls, no positive staining pathophysiological processes. G protein-coupled receptors is seen (inserts h, p, x) (GPCRs) are synthesized in the rough endoplasmic reticulum, traffic through the Golgi apparatus and are dynamically shut- While modulation of ERα and ERβ content is a fundamental tled to and from, the plasma membrane by vesicular transport [e.g., small GTPases, (Rab-1 and Arf) and chaperone trans- factor in estrogen signaling to maintenance of cell number, the lack of GPER and/or changes in expression of ERs and port proteins (COPI/II)] (Martínez-Alonso et al. 2013). aromatase does not result in cell proliferation or death. GPCRs actions via the activation of plasma membrane- Inhibition of Leydig cell regeneration in ethane associated enzymes, distinct modes of signal transduction dimethylsulfonate-treated mature rats following estradiol ex- from endosomal membranes, have also been demonstrated posure indicates that Leydig cells self-regulate their number (for review see Irannejad and von Zastrow 2014). Surface via estrogen modulation in a paracrine fashion (Myers and expression of GPCRs besides extrinsic stimuli can be modu- Abney 1991). Due to these results, involvement of various lated posttranslationally. Delimitation of GPCRs expression estrogen receptors in this phenomenon is suggested. or receptors desensitization (including complete termination Additionally, regulation of intracellular ER and aromatase of receptor signaling, Bdownmodulation^ by 26S proteasome) expression by GPER and vice versa represents a future re- affects receptor binding sites and signaling activity (Jean- search direction. Alphonse and Hanyaloglu 2011). A major mechanism by On a new but related point, tamoxifen acting through which GPCRs promote endosome-initiated signaling is by GPER is able to upregulate aromatase expression (Catalano recruitment of arrestins, which are endocytic adaptors during et al. 2014). In the male reproductive system, GPER suppres- receptor desensitization and scaffold for the assembly of sion of ERα expression and its downstream signaling path- mitogen-activated protein kinase (MAPK) signaling modules way was reported (Koong and Watson 2014; Jia et al. 2016). (Shenoy and Lefkowitz 2011). Studies on GPER intracellular localization revealed its GPER signaling is a crucial steroidogenesis regulation by presence in the plasma membrane, endoplasmic reticulum estradiol in rat and human LH-stimulated Leydig cells. The and Golgi complex (Chimento et al. 2014). Observed pertur- detrimental effects of estrogen excess after estradiol or GPER bations in these organelles after G-15 treatment are clearly agonist treatment on steroidogenesis were revealed (Hess 2003; linked. As data are available concerning estrogen ability to Vaucher et al. 2014). Similarly, in fish gonads, the GPER effect activate autophagy, including mitophagy (Lui et al. 2016; on steroidogenesis has been shown (Thomas et al. 2006;Pang Cell Tissue Res and Thomas 2010). Therefore, decreased estrogen concentra- and aromatase genes) confirmed a full set of estrogen signaling tion in mice without GPER (and modulated expression of ERs molecule control of Leydig cell steroidogenic function at the Cell Tissue Res Ethical approval All applicable international, national and/or institu- Fig. 12 Effect of GPER on sex steroid concentration in mouse testes and tional guidelines for the care and use of animals were followed. secretion by Leydig cells in vitro. Androgens and estrogens concentration in testes of immature, mature and aged mice control and G-15-treated (a, b) and progesterone secretion in MA-10 Leydig cells (c) control and G- Informed consent Not applicable. 15, E2 and ICI-treated alone and in combination. Data are expressed as means ± SD. From each animal, at least three samples were measured. Open Access This article is distributed under the terms of the Creative Culture media were measured in triplicate. Asterisks show significant Commons Attribution 4.0 International License (http:// differences in testosterone and estradiol concentrations between control creativecommons.org/licenses/by/4.0/), which permits unrestricted use, and G-15 (50 μg/kg bw)-treated males and in progesterone secretion distribution and reproduction in any medium, provided you give appro- between control MA-10 Leydig cells and those treated with G-15 priate credit to the original author(s) and the source, provide a link to the (10 nM), ICI (ICI 182,780; 10 μM), E2 (17β-estradiol; 10 nM) alone Creative Commons license and indicate if changes were made. and in combination for 24 h. Values are denoted as ∗∗p <0.01 and ∗∗∗p <0.001 ultrastructure (organelle activity) and molecular (hormone pro- References duction and secreting ability) levels. Abney TO (1999) The potential roles of estrogens in regulating Leydig cell development and function: a review. Steroids 64(9):610–617 Abney TO, Myers RB (1991) 17 beta-estradiol inhibition of Leydig cell Conclusion regeneration in the ethane dimethylsulfonate-treated mature rat. J Androl 12(5):295–304 The GPER provides a new basis for understanding the roles Abraham GE, Swerdloff ES, Tulchinsky D, Odell WD (1971) Radioimmunoassay of plasma 17-hydroxyprogesterone. J Clin of estrogen and estrogen signaling molecules in the regula- Endocrinol 33:42–46 tion of Leydig cells function. The data presented here re- Acconcia F, Fiocchetti M, Marino M (2016) Xenoestrogen regulation of vealed that GPER has a regulatory effect on estrogen sig- ERα/ERβ balance in hormone-associated cancers. Mol Cell naling, as well as estrogen concentration and secretion in Endocrinol. https://doi.org/10.1016/j.mce.2016.10.033 mouse Leydig cells (dependent of male age and putative Alarid ET, Bakopoulos N, Solodin N (1999) Proteasome-mediated pro- teolysis of estrogen receptor: a novel component in autologous engagement of various organelle) via its partnership with down-regulation. Mol Endocrinol 13:1522–1534 ERs and aromatase. Thus, the generation of a triple KO An G, Li W, Yan T, Li S (2014) Estrogen rapidly enhances incisional pain murine model (aromatase, ER, and GPER) could be an of ovariectomized rats primarily through the G protein-coupled es- important contribution to further understand the mecha- trogen receptor. Int J Mol Sci 15(6):10479–10491 nisms of estrogen signaling in Leydig cells. Antal MC, Krust A, Chambon P, Mark M (2008) Sterility and absence of histopathological defects in nonreproductive organs of a mouse ERbeta-null mutant. Proc Natl Acad Sci U S A 105(7):2433–2438 Acknowledgments The authors are very grateful to the editor and anon- Ascoli M (1981) Characterization of several clonal lines of cultured ymous reviewers for their constructive suggestions and helpful comments Leydig tumor cells: gonadotropin receptors and steroidogenic re- that allowed to improve this manuscript. We thank Msc. Laura Pardyak, sponses. Endocrinology 108(1):88–95 MSc. Alicja Kaminska and Klaudia Lesniak (Department of Atanassova N, McKinnell C, Walker M, Turner KJ, Fisher JS, Morley M, Endocrinology) for technical help and Wladyslawa Jankowska Millar MR, Groome NP, Sharpe RM (1999) Permanent effects of (Department of Developmental Biology and Invertebrate Morphology) neonatal estrogen exposure in rats on reproductive hormone levels, for her excellent technical support during TEM preparation. The Jeol Sertoli cell number, and the efficiency of spermatogenesis in adult- JEM 2100 transmission electron microscope was available at the hood. Endocrinology 140(11):5364–5373 Laboratory of Microscopy, Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University. Barakat R, Oakley O, Kim H, Jin J, Myong C, Ko J (2016) Extra- gonadal sites of estrogen biosynthesis and function. BMB Rep 49(9):488–496 Author contributions Authors’ contribution to the work described in the Bertrand S, Hu C, Aksenova MV, Mactutus CF, Booze RM (2015) HIV-1 paper: M.K-B., P.P., A.M., W.T., M. S., A.P., E.G-W., B.B., B.P., J.W., Tat and cocaine mediated synaptopathy in cortical and midbrain M.Z. and J.G. performed the research. M.K.-B, W.T., J.W., B.B., B.P. and neurons is prevented by the isoflavone Equol. Front Microbiol J.G analyzed the data. 8(6):894 M.K.-B. designed the research study and wrote the paper. All authors have read and approved the final version of the manuscript. Bopassa JC, Eghbali M, Toro L, Stefani E (2010) A novel estrogen receptor GPER inhibits mitochondria permeability transition pore opening and protects the heart against ischemia-reperfusion injury. Funding This study was funded by the National Science Centre, Poland Am J Physiol Heart Circ Physiol 298(1):H16–H23 (grant number SONATA BIS5 2015/18/E/NZ4/00519). M. Kotula-Balak Carnesecchi J, Malbouyres M, de Mets R, Balland M, Beauchef G, Vié K, received research grants from the Polish Science Centre. Chamot C, Lionnet C, Ruggiero F, Vanacker JM (2015) Estrogens induce rapid cytoskeleton re-organization in human dermal fibro- Compliance with ethical standards blasts via the non-classical receptor GPR30. PLoS One 10(3): e0120672 Conflict of interest The authors declare that they have no conflict of Carreau S, Hess RA (2010) Oestrogens and spermatogenesis. Philos interest. Trans R Soc Lond Ser B Biol Sci 365(1546):1517–15354 Cell Tissue Res Carreau S, Lambard S, Delalande C, Denis-Galeraud I, Bilinska B, Gould ML, Hurst PR, Nicholson HD (2007) The effects of oestrogen Bourguiba S (2003) Aromatase expression and role of estrogens in receptors alpha and beta on testicular cell number and steroidogen- male gonad : a review. Reprod Biol Endocrinol 1:35 esis in mice. Reproduction 134(2):271–279 Carreau S, Bouraima-Lelong H, Delalande C (2012) Role of estrogens in Greaves P (2012) Histopathology of preclinical toxicity studies: interpre- spermatogenesis. Front Biosci (Elite Ed) 4:1–11 tation and relevance in drug safety evaluation, 4th edn. Elsevier AP, Amsterdam, pp 1–867 Catalano S, Giordano C, Panza S, Chemi F, Bonofiglio D, Lanzino M, Rizza P, Romeo F, Fuqua SA, Maggiolini M, Andò S, Barone I Hamilton CK, Navarro-Martin L, Neufeld M, Basak A, Trudeau VL (2014) Tamoxifen through GPER upregulates aromatase expression: (2014) Early expression of aromatase and the membrane estrogen a novel mechanism sustaining tamoxifen-resistant breast cancer cell receptor GPER in neuromasts reveals a role for estrogens in the growth. Breast Cancer Res Treat 146(2):273–285 development of the frog lateral line system. Gen Comp Endocrinol 1(205):242–250 Chang EC, Charn TH, Park S-H, Helferich WG, Komm B, Hejmej A, Kotula-Balak M, Galas J, Bilińska B (2011) Effects of 4-tert- Katzenellenbogen JA, Katzenellenbogen BS (2008) Estrogen recep- octylphenol on the testes and seminal vesicles in adult male bank tors α and β as determinants of gene expression: influence of ligand, voles. Reprod Toxicol 31(1):95–105 dose, and chromatin binding. Mol Endocrinol 22(5):1032–1043 Hess RA (2000) Oestrogen in fluid transport in efferent ducts of the male Cheng B, Kowal J (1997) Role of the Golgi complex in adrenocortical reproductive tract. Rev Reprod 5(2):84–92 steroidogenesis. Microsc Res Tech 36(6):503–509 Hess RA (2003) Estrogen in the adult male reproductive tract: a review. Cheng SB, Quinn JA, Graeber CT, Filardo EJ (2011) Down-modulation Reprod Biol Endocrinol 1:52 of the G-protein-coupled estrogen receptor, GPER, from the cell Heublein S, Lenhard M, Vrekoussis T, Schoepfer J, Kuhn C, Friese K, surface occurs via a trans-Golgi-proteasome pathway. J Biol Chem Makrigiannakis A, Mayr D, Jeschke U (2012) The G-protein- 286(25):22441–22455 coupledestrogenreceptor(GPER)isexpressed innormalhuman Chimento A, Sirianni R, Delalande C, Silandre D, Bois C, Ando S, ovaries and is upregulated in ovarian endometriosis and pelvic Maggiolini M, Carreau S, Pezzi V (2010) 17 beta-estradiol activates inflammatory disease involving the ovary. Reprod Sci 19(11): rapid signaling pathways involved in rat pachytene spermatocytes 1197–1204 apoptosis through GPR30 and ER alpha. Mol Cell Endocrinol Hoffmann B, Rostalski A, Mutembei HM, Goericke-Pesch S (2010) 320(1–2):136–4410 Testicular steroid hormone secretion in the boar and expression of Chimento A, Sirianni R, Zolea F, Bois C, Delalande C, Ando S, testicular and epididymal steroid sulphatase and estrogen Maggiolini M, Aquila S, Carreau S, Gper PV (2011) ESRs are sulphotransferase activity. Exp Clin Endocrinol Diabetes 118(4): expressed in rat round spermatids and mediate oestrogen- 274–280 dependent rapid pathways modulating expression of cyclin B1 and Hotchkiss J, Atkinson LE, Knobil E (1971) Time course of serum estro- Bax. Int J Androl 34(5 Pt 1):420–910 gen and luteinizing hormone concentrations during menstrual cycle Chimento A, Sirianni R, Casaburi I, Pezzi V (2014) GPER signaling of rhesus monkey. Endocrinology 89:177–183 in spermatogenesis and testicular tumors. Front Endocrinol Irannejad R, von Zastrow M (2014) GPCR signaling along the endocytic (Lausanne) 5:30 pathway. Curr Opin Cell Biol 27:109–116 Couse JF, Korach KS (1999) Estrogen receptor null mice: what have we Irsik DL, Carmines PK, Lane PH (2013) Classical estrogen receptors and learned and where will they lead us? Endocr Rev 20(3):358–417 ERα splice variants in the mouse. PLoS One 8(8):e70926 Dennis MK, Burai R, Ramesh C, Petrie WK, Alcon SN, Nayak TK, Isensee J, Meoli L, Zazzu V, Nabzdyk C, Witt H, Soewarto D, Effertz K, Bologa CG, Leitao A, Brailoiu E, Deliu E, Dun NJ, Sklar LA, Fuchs H, Gailus-Durner V, Busch D, Adler T, de Angelis MH, Hathaway HJ, Arterburn JB, Oprea TI, Prossnitz ER (2009) Irgang M, Otto C, Noppinger PR (2009) Expression pattern of G In vivo effects of a GPR30 antagonist. Nat Chem Biol 5(6):421–427 protein-coupled receptor 30 in LacZ reporter mice. Endocrinology Dennis MK, Field AS, Burai R, Ramesh C, Petrie WK, Bologa CG, 150(4):1722–1730 Oprea TI, Yamaguchi Y, Hayashi S, Sklar LA, Hathaway HJ, Jakacka M, Ito M, Martinson F, Ishikawa T, Lee EJ, Jameson JL (2002) Arterburn JB, Prossnitz ER (2011) Identification of a GPER/ An estrogen receptor (ER)alpha deoxyribonucleic acid-binding do- GPR30antagonistwithimprovedestrogenreceptor main knock-in mutation provides evidence for nonclassical ER path- counterselectivity. J Steroid Biochem Mol Biol 127(3–5):358–366 way signaling in vivo. Mol Endocrinol 16(10):2188–2201 Dufau ML, Catt KJ, Tsuruhara T, Ryan D (1972) Radioimmunoassay of Jean-Alphonse F, Hanyaloglu AC (2011) Regulation of GPCR signal plasma testosterone. Clin Chim Acta 37:109–116 networks via membrane trafficking. Mol Cell Endocrinol 331(2): Fietz D, Ratzenböck C, Hartmann K, Raabe O, Kliesch S, Weidner W, 205–214 Klug J, Bergmann M (2014) Expression pattern of estrogen recep- Jefferson WN, Couse JF, Banks EP, Korach KS, Newbold RR (2000) tors α and β and G-protein-coupled estrogen receptor 1 in the hu- Expression of estrogen receptor beta is developmentally regulated man testis. Histochem Cell Biol 142(4):421–432 in reproductive tissues of male and female mice. Biol Reprod 62(2): Fietz D, Bergmann M, Hartmann K (2016) In situ hybridization of estro- 310–317 gen receptors α and β and GPER in the human testis. Methods Mol Jia B, Gao Y, Li M, Shi J, Peng Y, Du X, Klocker H, Sampson N, Shen Y, Biol 1366:189–205 Liu M, Zhang J (2016) GPR30 promotes prostate stromal cell acti- Filardo EJ, Thomas P (2012) Minireview: G protein-coupled estrogen vation via suppression of ERα expression and its downstream sig- receptor-1, GPER-1: its mechanism of action and role in female naling pathway. Endocrinology 157(8):3023–3035 reproductive cancer, renal and vascular physiology. Endocrinology Kang WB, Cong Y, Ru JY, Ying SQ, Zhu T, Wang DS, Liu XW, Liu G, 153(7):2953–2962 Zhao JN (2015) Osteoprotective effect of combination therapy of Gaudet HM, Cheng SB, Christensen EM, Filardo EJ (2015) The G- low-dose oestradiol with G15, a specific antagonist of GPR30/ protein coupled estrogen receptor, GPER: the inside and inside-out GPER in ovariectomy-induced osteoporotic rats. Biosci Rep 35(4) story. Mol Cell Endocrinol 15(418 Pt 3):207–219 Klinge CM (2008) Estrogenic control of mitochondrial function and bio- Giguère V (2002) To ERR in the estrogen pathway. Trends Endocrinol genesis. J Cell Biochem 105(6):1342–1351 Metab 13(5):220–225 Koong LY, Watson CS (2014) Direct estradiol and diethylstilbestrol ac- Girdler F, Brotherick I (2000) The oestrogen receptors (ER alpha and ER tions on early- versus late-stage prostate cancer cells. Prostate beta) and their role in breast cancer: a review. Breast 9(4):194–200 74(16):1589–1603 Cell Tissue Res Kotula-Balak M, Hejmej A, Kopera I, Lydka M, Bilinska B (2012) Martínez-Alonso E, Tomás M, Martínez-Menárguez JA (2013) Golgi tubules: their structure, formation and role in intra-Golgi transport. Prenatal and neonatal exposure to flutamide affects function of Leydig cells in adult boar. Domest Anim Endocrinol 42(3):142–154 Histochem Cell Biol 140(3):327–339 Milon A, Opydo-Chanek M, Tworzydlo W, Galas J, Pardyak L, Kotula-Balak M, Chojnacka K, Hejmej A, Galas J, Satola M, Bilinska B Kaminska A, Ptak A, Kotula-Balak M (2017) Chlorinated biphenyls (2013) Does 4-tert-octylphenol affect estrogen signaling pathways effect on estrogen-related receptor expression, steroid secretion, mi- in bank vole Leydig cells and tumor mouse Leydig cells in vitro? tochondria ultrastructure but not on mitochondrial membrane poten- Reprod Toxicol 39:6–16 tial in Leydig cells. Cell Tissue Res. https://doi.org/10.1007/s00441- Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, 017-2596-x Korach KS, Gustafsson JA, Smithies O (1998) Generation and re- Murphy E (2011) Estrogen signaling and cardiovascular disease. Circ Res productive phenotypes of mice lacking estrogen receptor beta. Proc 109(6):687–696 Natl Acad Sci U S A 95(26):15677–15682 Myers RB, Abney TO (1991) Interstitial cell proliferation in the testis of Lazari MF, Lucas TF, Yasuhara F, Gomes GR, Siu ER, Royer C, the ethylene dimethane sulfonate-treated rat. Steroids 56(2):91–96 Fernandes SA, Porto CS (2009) Estrogen receptors and function in Ni lsson S, Koehler KF, Gustafsson JA (2011) Development of subtype- the male reproductive system. Arq Bras Endocrinol Metabol 53(8): selective oestrogen receptor-based therapeutics. Nat Rev Drug 923–933 Discov 10(10):778–792 Lee KH, Park JH, Bunick D, Lubahn DB, Bahr JM (2009) Morphological Oliveira CA, Nie R, Carnes K, Franca LR, Prins GS, Saunders PT, Hess comparison of the testis and efferent ductules between wild-type and RA (2003) The antiestrogen ICI 182,780 decreases the expression of estrogen receptor alpha knockout mice during postnatal develop- estrogen receptor-alpha but has no effect on estrogen receptor-beta ment. J Anat 214(6):916–925 and androgen receptor in rat efferent ductules. Reprod Biol Lemmena JG, Broekhof JLM, Kuiper GJM, Gustafsson J-A, van der Endocrinol 1:75 Saag PT, van der Burg B (1999) Expression of estrogen recep- Otto C,FuchsI,KauselmannG,KernH,ZevnikB,Andreasen P, tor alpha and beta during mouse embryogenesis. Mech Dev 81: Schwarz G, Altmann H, Klewer M, Schoor M, Vonk R, 163–167 Fritzemeier KH (2009) GPR30 does not mediate estrogenic re- Li X, Li H, Jia L, Li X, Rahman N (2015) Oestrogen action and male sponses in reproductive organs in mice. Biol Reprod 80(1):34–41 fertility: experimental and clinical findings. Cell Mol Life Sci 72: Pang Y, Thomas P (2010) Role of G protein-coupled estrogen receptor 1, 3915–3930 GPER, in inhibition of oocyte maturation by endogenous estrogens Liao TL, Tzeng CR, Yu CL, Wang YP, Kao SH (2015) Estrogen receptor- in zebrafish. Dev Biol 342(2):194–206 β in mitochondria: implications for mitochondrial bioenergetics and Pardyak L, Kaminska A, Galas J, Ptak A, Bilinska B, Kotula-Balak M tumorigenesis. Ann N Y Acad Sci 1350:52–60 Academic Press (2016) Primary and tumor mouse Leydig cells exposed to Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression polychlorinated naphthalenes mixture: effect on estrogen related- data using real-time quantitative PCR and the 2(-Delta Delta C(T)) receptors expression, intracellular calcium level and sex hormones method. Methods 25:402–408 secretion. Tissue Cell 48(5):432–441 Lonard DM, Nawaz Z, Smith CL, O'Malley BW (2000) The 26S protea- Parikh I, Rajendran KG, Su JL, Lopez T, Sar M (1987) Are estrogen some is required for estrogen receptor-alpha and coactivator turn- receptors cytoplasmic or nuclear? Some immunocytochemical and over and for efficient estrogen receptor-alpha transactivation. Mol biochemical studies. J Steroid Biochem 27(1–3):185–192 Cell 5:939–948 Pawlicki P, Milon A, Zarzycka M, Galas J, Tworzydlo W, Kaminska A, Lucas TF, Royer C, Siu ER, Lazari MF, Porto CS (2010) Expression and Pardyak L, Lesniak K, Pacwa A, Bilinska B, Gorowska-Wojtowicz signaling of G protein-coupled estrogen receptor 1 (GPER) in rat E, Kotula-Balak M (2017) Does signaling of estrogen-related recep- Sertoli cells. Biol Reprod 83(2):307–1710 tors affect structure and function of bank vole Leydig cells? J Physiol Pharmacol 68(3):459–476 Lucas TF, Pimenta MT, Pisolato R, Lazari MF, Porto CS (2011) 17Beta- Pfaffl MW (2001) A new mathematical model for relative quantification estradiol signaling and regulation of Sertoli cell function. in real-time RT-PCR. Nucleic Acids Res 29:e45 Spermatogenesis 1(4):318–2410 Pietras RJ, Szego CM (1977) Specific binding sites for oestrogen at the Lucas TF, Nascimento AR, Pisolato R, Pimenta MT, Lazari MF, Porto CS outer surfaces of isolated endometrial cells. Nature 265(5589): (2014) Receptors and signaling pathways involved in proliferation 69–72 and differentiation of Sertoli cells. Spermatogenesis 4:e28138 Pinzone JJ, Stevenson H, Strobl JS, Berg PE (2004) Molecular and cel- Lui A, New J, Ogony J, Thomas S, Lewis-Wambi J (2016) Everolimus lular determinants of estrogen receptor α expression. Mol Cell Biol downregulates estrogen receptor and induces autophagy in aroma- 24(11):4605–4612 tase inhibitor-resistant breast cancer cells. BMC Cancer 16:487 Plante BJ, Lessey BA, Taylor RN, Wang W, Bagchi MK, Yuan L, Magruder HT, Quinn JA, Schwartzbauer JE, Reichner J, Huang A, Scotchie J, Fritz MA, Young SL (2012) G protein-coupled estrogen Filardo EJ (2014) G protein-coupled estrogen receptor-1, GPER-1, receptor (GPER) expression in normal and abnormal endometrium. promotes fibrillogenesis via a shc-dependent pathway resulting in Reprod Sci 19(7):684–693 anchorage-independent growth. Horm Cancer 5(6):390–404 Prossnitz ER, Barton M (2011) The G protein-coupled estrogen receptor Marques M, Laflamme L, Benassou I, Cissokho C, Guillemette B, GPER in health and disease. Nat Rev Endocrinol 7(12):715–726 Gaudreau L (2014) Low levels of 3,3′-diindolylmethane activate Razandi M, Pedram A, Greene GL, Levin ER (1999) Cell membrane and estrogen receptor α and induce proliferation of breast cancer cells nuclear estrogen receptors (ERs) originate from a single transcript: in the absence of estradiol. BMC Cancer 14:524 studies of ERalpha and ERbeta expressed in Chinese hamster ovary Mårtensson UE, Salehi SA, Windahl S, Gomez MF, Swärd K, cells. Mol Endocrinol 13(2):307–319 Daszkiewicz-Nilsson J, Wendt A, AnderssonN,HellstrandP, Rivas A, Fisher JS, McKinnell C, Atanassova N, Sharpe RM (2002) Grände PO, Owman C, Rosen CJ, Adamo ML, Lundquist I, Induction of reproductive tract developmental abnormalities in the Rorsman P, Nilsson BO, Ohlsson C, Olde B, Leeb-Lundberg LM male rat by lowering androgen production or action in combination (2009) Deletion of the G protein-coupled receptor 30 impairs glu- with a low dose of diethylstilbestrol: evidence for importance of the cose tolerance, reduces bone growth, increases blood pressure, and androgen-estrogen balance. Endocrinology 143(12):4797–4808 eliminates estradiol-stimulated insulin release in female mice. Roa J, Vigo E, Castellano JM, Gaytan F, Navarro VM, Aguilar E, Dijcks Endocrinology 150(2):687–698 FA, Ederveen AG, Pinilla L, van Noort PI, Tena-Sempere M (2008) Cell Tissue Res Opposite roles of estrogen receptor (ER) alpha and ERbeta in the induced by 17beta-estradiol on mouse spermatogonial GC-1 cell line. Endocrinology 149(10):5043–5110 modulation of luteinizinghormone responses to kisspeptin in the female rat: implications for the generation of the preovulatory surge. Smolen AJ (1990) Image analytic techniques for quantification of immu- Endocrinology 149(4):1627–1637 nocytochemical staining in the nervous system. In: Conn PM (ed) Russell LD, Burguet S (1977) Ultrastructure of Leydig cells as revealed Methods in neurosciences. Academic Press, San Diego, pp 208–229 by secondary tissue treatment with a ferrocyanide-osmium mixture. Thomas C, Gustafsson JA (2011) The different roles of ER subtypes in Tissue Cell 9:751–766 cancer biology and therapy. Nat Rev Cancer 11(8):597–608 Sandner F, Welter H, Schwarzer JU, Köhn FM, Urbanski HF, Mayerhofer Thomas P, Dressing G, Pang Y, Berg H, Tubbs C, Benninghoff A, A (2014) Expression of the oestrogen receptor GPER by testicular Doughty K (2006) Progestin, estrogen and androgen G-protein peritubular cells is linked to sexual maturation and male fertility. coupled receptors in fish gonads. Steroids 71:310–316 Andrology 2(5):695–701 Treen AK, Luo V, Chalmers JA, Dalvi PS, Tran D, Ye W, Kim GL, Santolla MF,Lappano R, De MarcoP,PupoM,VivacquaA,Sisci D, Friedman Z, Belsham DD (2016) Divergent regulation of ER and Abonante S, Iacopetta D, Cappello AR, Dolce V, Maggiolini M kiss genes by 17β-estradiol in hypothalamic ARC versus AVPV (2012) G protein-coupled estrogen receptor mediates the up- models. Mol Endocrinol 30(2):217–233 regulation of fatty acid synthase induced by 17β-estradiol in can- Vaucher L, Funaro MG, Mehta A, Mielnik A, Bolyakov A, Prossnitz ER, cer cells and cancer-associated fibroblasts. J Biol Chem 287: Schlegel PN, Paduch DA (2014) Activation of GPER-1 estradiol 43234–43245 receptor downregulates production of testosterone in isolated rat Sapino A, Pietribiasi F, Bussolati G, Marchisio PC (1986) Estrogen- Leydig cells and adult human testis. PLoS One 9(4):e92425 and tamoxifen-induced rearrangement of cytoskeletal and adhe- Vrtačnik P, Ostanek B, Mencej-Bedrač S, Marc J (2014) The many faces sion structures in breast cancer MCF-7 cells. Cancer Res 46(5): of estrogen signaling. Biochem Med (Zagreb) 24(3):329–342 2526–2531 Wang YX, Li M, Zhang HQ, Tang MX, Guo CF, Deng A, Chen Y, Xiao Schulster M, Bernie AM, Ramasamy R (2016) The role of estradiol in LG (2016) Opposite function of ERα and ERβ in controlling 17β- male reproductive function. Asian J Androl 18(3):435–440 estradiol-mediated osteogenesis in osteoblasts. Arch Med Res 47(4): Sewer MB, Li D (2008) Regulation of steroid hormone biosynthesis by 255–261 the cytoskeleton. Lipids 43(12):1109–1115 Zarzycka M, Gorowska-Wojtowicz E, Tworzydlo W, Klak A, Kozub K, Sharma G, Prossnitz ER (2011) Mechanisms of estradiol-induced insulin Hejmej A, Bilinska B, Kotula-Balak M (2016) Are aryl hydrocarbon secretion by the G protein-coupled estrogen receptor GPR30/GPER receptor and G-protein-coupled receptor 30 involved in the regula- in pancreatic beta-cells. Endocrinology 152(8):3030–3039 tion of seasonal testis activity in photosensitive rodent-the bank vole Shen M, Shi H (2015) Sex hormones and their receptors regulate liver (Myodes glareolus)? Theriogenology 86(3):674–686 energy homeostasis. Int J Endocrinol 294278 ZhangX,KeS,ChenK-H,LiJ-H,MaL,Jiang X-W(2015) Shen WJ, Azhar S, Kraemer FB (2016) Lipid droplets and steroidogenic Diethylstilbestrol affects the expression of GPER in the cells. Exp Cell Res 340(2):209–214 gubernaculum testis. Int J Clin Exp Pathol 8(6):7217–7222 Shenoy SK, Lefkowitz RJ (2011) β-Arrestin-mediated receptor traffick- ing and signal transduction. Trends Pharmacol Sci 32(9):521–533 Zimmerli UU, Hedinger CE (1991) Hyperplasia and hypertrophy of Sirianni R, Chimento A, Ruggiero C, De Luca A, Lappano R, Ando S, Leydig cells associated with testicular germ cell tumours containing Maggiolini M, Pezzi V (2008) The novel estrogen receptor, G syncytiotrophoblastic giant cells. Virchows Arch A Pathol Anat protein-coupled receptor 30, mediates the proliferative effects Histopathol 419(6):469–474

Journal

Cell and Tissue ResearchSpringer Journals

Published: Jun 6, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off