The cryptic enhancer elements of the tCUP promoter

The cryptic enhancer elements of the tCUP promoter Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5′ deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions −350 and −161 bp relative to the transcription start site. 5′ deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides −150 to −130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Molecular Biology Springer Journals

The cryptic enhancer elements of the tCUP promoter

Loading next page...
 
/lp/springer_journal/the-cryptic-enhancer-elements-of-the-tcup-promoter-0BqXiv4SfT
Publisher
Kluwer Academic Publishers
Copyright
Copyright © 2003 by Kluwer Academic Publishers
Subject
Life Sciences; Biochemistry, general; Plant Sciences; Plant Pathology
ISSN
0167-4412
eISSN
1573-5028
D.O.I.
10.1023/A:1022087112152
Publisher site
See Article on Publisher Site

Abstract

Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5′ deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions −350 and −161 bp relative to the transcription start site. 5′ deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides −150 to −130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter.

Journal

Plant Molecular BiologySpringer Journals

Published: Oct 7, 2004

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial