The C1 inhibitor encoding gene (C1nh) maps to mouse Chromosome 2

The C1 inhibitor encoding gene (C1nh) maps to mouse Chromosome 2 Mammalian Genome 9, Brief Data Reports The Cl inhibitor encoding gene (Clnh) maps to mouse Chromosome 1 Marie Fernandes, 2 Christophe Poirier, Matteo Lener, 3 Hernandez, ) Catherine Bazzali - Mario Tosi, 1 Tommaso Meo''* 'Unite d'Immunogenetique, 25 rue du docteur Roux, Institut Pasteur, 75724 Paris cedex 15, France ZLaboratoire d'Etude du Genome Murin, CNRS/UNSA UMR 6549, Faculte de Medecine, 06107 Nice cedex 2, France 3Unite de Genetique des Mammiferes, 25 rue du docteur Roux, Institut Pasteur, 75724 Paris cedex 15, France Received: 28 July 1997 / Accepted: 10 September 1997 Species: Mouse Locus name: Cl inhibitor gene Locus symbol: C1nh Map position: mapping data were analyzed with RI Manager soft- ware [1]. Distances are expressed in cM with 95% confidence interval. AKXL: Mpmv14-11.11 [3.1-26.1] —Clnh-17.65 [6.8- 34.5]—Rapla-ps2 BXD: D2Ncvs2-5 [0.6-16.91— Clnh-4 [0.5- 13.7] —Mdk of Method mapping: AKXL and BXD Recombinant Inbred Strains sets. Two-color FISH with a human YAC yRP-8B9 (green signal) containing the human homolog of C1nh [2] and a mouse YAC specific for Chr 2 (red signal) [3]. Database deposition information: MGD accession number MGD- Fig. 1. (A) Assignment of the Clnh gene to mouse Chr 2 by fluorescence JNUM-41338. in situ hybridization. (B) Location of Clnh on mouse Chr 2 with BXD Molecular reagents used for mapping: from the cDNA sequence (right) and AKXL (left) RIS sets. (AF010254) we selected a pair of primers allowing amplification References of 440 bp from exon 8 of Clnh: forward 5' GAATTCTT- 1. Manly KF (1993) Mamm Genome 4, 303-313 GACTTCACTTA 3' reverse 5' ATTTGTAGAGTTTGATAGGT 2. Qin S, Nowak NJ, Zhang J, Sait SN, Mayers PG, Higgins MJ, Cheng Y, 3'. Li L, Munroe DJ, Gerhard DS, Weber BH, Brie E, Housman DE, Evans Method of allele detection: polymorphisms between AKR and GA, Shows TB (1996) Proc Natl Acad Sci USA 93, 3149-3154 C57L and between DBA/2 and C57BL/6 were searched by using 3. Mongelard F, Poras I, Usson Y, Batteux B, Robert-Nicoud M, Avner P. FAMA [4]. The forward and reverse primers were end labeled with Vourc'h C (1996) Genomics 38, 432-434 4. Verpy E, Biasotto M, Meo T, Tosi M (1994) Proc Natl Acad Sci USA dyes phosphoramidites 6-FAM and HEX respectively for a second 91, 1873-1877 round of amplification. Heteroduplexes were formed and an A/T 5. Bock SC, Skriver K, Nielsen E, Thogersen HC, Wiman B, Donaldson polymorphism was revealed by mismatch cleavage with the os- VH, Eddy RL, Marrinan J, Radziejewska E, Huber R, et al. (1986) mium tetroxide/piperidine reaction [4]. This polymorphism is a Biochemistry 25, 4292-4301 conservative change within codon Arg 498 at position 1560 of the 6. Kaupmann K, Sendtner M, Jockusch H (1991) Mouse Genome 89, 246 cDNA sequence deposited (A for C57BL/6 and C57L; T for DBA/2 and AKR). Previously identified homologs: human C1NH [5]. Regional localization of Flicl, a Discussion: the human homolog of C1nh has been mapped to calcyclin/S100A6-like gene, to rat 11g13 [5], its location has been refined about 3.5 Mb centromeric to CNTF [21, whose murine homolog has been mapped to Chr 19 Chromosome 7q22-31 by means of FISH [6]. The human 11g12-q 13 genomic region shares conserved syn- teny (from centromere to telomere) with mouse Chrs 2, 19, and 7 F. Prols,' ,* T. Liehr,2,* B. Loser,' B. Rautenstrauss 2 respectively. Our data suggest that the breakpoint of homology between human 11g12-q13 genomic region and mouse Chrs 2 and 'Nephrological Research Department, Medical Clinics IV, Loschgestr. 8, 19 is located between C1NH and CNTF. To date no genes have D-91054 Erlangen, Germany 2Institute of Human Genetics, Schwabachanlage 10, been mapped within this interval, which spans approximately 3.5 D-91054 Erlangen, Germany megabases. Further characterization of this human genomic region should help to understand the evolution of this region. Received: 3 April 1997 / Accepted: 5 September 1997 Species: Rattus norvegicus Acknowledgments: M. Fernandes and C. Poirier are recipients of fellow- Locus name: Flicl ships from the Association pour la Recherche contre le Cancer (ARC) and Locus symbol: Flicl Association Francaise contre les Myopathies (AFM) respectively. M. Lener has been a recipient of an INSERM "poste vert" fellowship. Map position: Chromosome (Chr) 7g22-31 Method mapping: of Fluorescence in situ hybridization (FISH) as * Deceased April 19, 1997 "These authors contributed equally Correspondence to: M. Tosi Correspondence to: B. Rautenstrauss http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

The C1 inhibitor encoding gene (C1nh) maps to mouse Chromosome 2

Free
1 page

Loading next page...
1 Page
 
/lp/springer_journal/the-c1-inhibitor-encoding-gene-c1nh-maps-to-mouse-chromosome-2-BCWe5fPedn
Publisher
Springer-Verlag
Copyright
Copyright © 1998 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900930
Publisher site
See Article on Publisher Site

Abstract

Mammalian Genome 9, Brief Data Reports The Cl inhibitor encoding gene (Clnh) maps to mouse Chromosome 1 Marie Fernandes, 2 Christophe Poirier, Matteo Lener, 3 Hernandez, ) Catherine Bazzali - Mario Tosi, 1 Tommaso Meo''* 'Unite d'Immunogenetique, 25 rue du docteur Roux, Institut Pasteur, 75724 Paris cedex 15, France ZLaboratoire d'Etude du Genome Murin, CNRS/UNSA UMR 6549, Faculte de Medecine, 06107 Nice cedex 2, France 3Unite de Genetique des Mammiferes, 25 rue du docteur Roux, Institut Pasteur, 75724 Paris cedex 15, France Received: 28 July 1997 / Accepted: 10 September 1997 Species: Mouse Locus name: Cl inhibitor gene Locus symbol: C1nh Map position: mapping data were analyzed with RI Manager soft- ware [1]. Distances are expressed in cM with 95% confidence interval. AKXL: Mpmv14-11.11 [3.1-26.1] —Clnh-17.65 [6.8- 34.5]—Rapla-ps2 BXD: D2Ncvs2-5 [0.6-16.91— Clnh-4 [0.5- 13.7] —Mdk of Method mapping: AKXL and BXD Recombinant Inbred Strains sets. Two-color FISH with a human YAC yRP-8B9 (green signal) containing the human homolog of C1nh [2] and a mouse YAC specific for Chr 2 (red signal) [3]. Database deposition information: MGD accession number MGD- Fig. 1. (A) Assignment of the Clnh gene to mouse Chr 2 by fluorescence JNUM-41338. in situ hybridization. (B) Location of Clnh on mouse Chr 2 with BXD Molecular reagents used for mapping: from the cDNA sequence (right) and AKXL (left) RIS sets. (AF010254) we selected a pair of primers allowing amplification References of 440 bp from exon 8 of Clnh: forward 5' GAATTCTT- 1. Manly KF (1993) Mamm Genome 4, 303-313 GACTTCACTTA 3' reverse 5' ATTTGTAGAGTTTGATAGGT 2. Qin S, Nowak NJ, Zhang J, Sait SN, Mayers PG, Higgins MJ, Cheng Y, 3'. Li L, Munroe DJ, Gerhard DS, Weber BH, Brie E, Housman DE, Evans Method of allele detection: polymorphisms between AKR and GA, Shows TB (1996) Proc Natl Acad Sci USA 93, 3149-3154 C57L and between DBA/2 and C57BL/6 were searched by using 3. Mongelard F, Poras I, Usson Y, Batteux B, Robert-Nicoud M, Avner P. FAMA [4]. The forward and reverse primers were end labeled with Vourc'h C (1996) Genomics 38, 432-434 4. Verpy E, Biasotto M, Meo T, Tosi M (1994) Proc Natl Acad Sci USA dyes phosphoramidites 6-FAM and HEX respectively for a second 91, 1873-1877 round of amplification. Heteroduplexes were formed and an A/T 5. Bock SC, Skriver K, Nielsen E, Thogersen HC, Wiman B, Donaldson polymorphism was revealed by mismatch cleavage with the os- VH, Eddy RL, Marrinan J, Radziejewska E, Huber R, et al. (1986) mium tetroxide/piperidine reaction [4]. This polymorphism is a Biochemistry 25, 4292-4301 conservative change within codon Arg 498 at position 1560 of the 6. Kaupmann K, Sendtner M, Jockusch H (1991) Mouse Genome 89, 246 cDNA sequence deposited (A for C57BL/6 and C57L; T for DBA/2 and AKR). Previously identified homologs: human C1NH [5]. Regional localization of Flicl, a Discussion: the human homolog of C1nh has been mapped to calcyclin/S100A6-like gene, to rat 11g13 [5], its location has been refined about 3.5 Mb centromeric to CNTF [21, whose murine homolog has been mapped to Chr 19 Chromosome 7q22-31 by means of FISH [6]. The human 11g12-q 13 genomic region shares conserved syn- teny (from centromere to telomere) with mouse Chrs 2, 19, and 7 F. Prols,' ,* T. Liehr,2,* B. Loser,' B. Rautenstrauss 2 respectively. Our data suggest that the breakpoint of homology between human 11g12-q13 genomic region and mouse Chrs 2 and 'Nephrological Research Department, Medical Clinics IV, Loschgestr. 8, 19 is located between C1NH and CNTF. To date no genes have D-91054 Erlangen, Germany 2Institute of Human Genetics, Schwabachanlage 10, been mapped within this interval, which spans approximately 3.5 D-91054 Erlangen, Germany megabases. Further characterization of this human genomic region should help to understand the evolution of this region. Received: 3 April 1997 / Accepted: 5 September 1997 Species: Rattus norvegicus Acknowledgments: M. Fernandes and C. Poirier are recipients of fellow- Locus name: Flicl ships from the Association pour la Recherche contre le Cancer (ARC) and Locus symbol: Flicl Association Francaise contre les Myopathies (AFM) respectively. M. Lener has been a recipient of an INSERM "poste vert" fellowship. Map position: Chromosome (Chr) 7g22-31 Method mapping: of Fluorescence in situ hybridization (FISH) as * Deceased April 19, 1997 "These authors contributed equally Correspondence to: M. Tosi Correspondence to: B. Rautenstrauss

Journal

Mammalian GenomeSpringer Journals

Published: Mar 28, 2009

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off