Testing of therapies in a novel nebulin nemaline myopathy model demonstrate a lack of efficacy

Testing of therapies in a novel nebulin nemaline myopathy model demonstrate a lack of efficacy Sztal et al. Acta Neuropathologica Communications (2018) 6:40 https://doi.org/10.1186/s40478-018-0546-9 RESEARCH Open Access Testing of therapies in a novel nebulin nemaline myopathy model demonstrate a lack of efficacy 1 1 1 2 2,3,4 Tamar E. Sztal , Emily A. McKaige , Caitlin Williams , Viola Oorschot , Georg Ramm 1* and Robert J. Bryson-Richardson Abstract: Nemaline myopathies are heterogeneous congenital muscle disorders causing skeletal muscle weakness and, in some cases, death soon after birth. Mutations in nebulin, encoding a large sarcomeric protein required for thin filament function, are responsible for approximately 50% of nemaline myopathy cases. Despite the severity of the disease there is no effective treatment for nemaline myopathy with limited research to develop potential therapies. Several supplements, including L-tyrosine, have been suggested to be beneficial and consequently self- administered by nemaline myopathy patients without any knowledge of their efficacy. We have characterized a zebrafish model for nemaline myopathy caused by a mutation in nebulin. These fish form electron-dense nemaline bodies and display reduced muscle function akin to the phenotypes observed in nemaline myopathy patients. We have utilized our zebrafish model to test and evaluate four treatments currently self-administered by nemaline myopathy patients to determine their ability to increase skeletal muscle function. Analysis of muscle pathology and locomotion following treatment with L-tyrosine, L-carnitine, taurine, or creatine revealed no significant improvement in skeletal muscle function emphasizing the urgency to develop effective therapies for nemaline myopathy. Keywords: Nebulin, Nemaline myopathy, Zebrafish, Treatment Introduction nemaline bodies throughout the muscle combined with Nemaline myopathies are congenital muscle diseases diminished contractile strength and force generation [21, characterized by the presence of nemaline (rod-like) 31]. Deletion of exon 55, causing a common form of bodies that form within the skeletal muscles. The disease autosomal recessive nemaline myopathy [19], results in presents with clinically heterogeneous phenotypes, ran- shortened thin filaments, alterations in crossbridge cyc- ging from adult onset mild muscle weakness to, in se- ling kinetics, and reduced calcium-sensitivity following vere cases, death in utero or just after birth [43]. loss of NEB [28, 30]. Similarly, a reduction in Nebulin in Causative mutations have now been identified in 11 dif- zebrafish recapitulates many of the clinical and patho- ferent genes, encoding components that form or regulate logical aspects of nemaline myopathy observed in pa- the thin filament (ACTA1 [27], NEB [31], α-tropomyosin tients [38, 39]. [18], β-tropomyosin [8], troponin T1 [14], cofilin [1], The lack of an effective treatment for nemaline myop- KBTBD13 [34], KLHL40 [32], KLHL41 [11], leiomodin-3 athy has resulted in many patients and their families [45], and MYPN [24]). testing compounds on an ad-hoc basis, with a number Nebulin (NEB) plays an important role in regulating of compounds listed on patient support websites (http:// thin filament length and is the most frequently affected www.nemaline.org/resources/drugs.html). Perhaps the gene in nemaline myopathy, accounting for approxi- most promising of these is L-tyrosine, a non-essential mately 50% of all cases [2]. Mutations in NEB result in amino acid, either derived from the diet or synthesised in the liver from phenylalanine, which functions as a pre- cursor to several neurotransmitters and hormones includ- * Correspondence: robert.bryson-richardson@monash.edu ing adrenaline and dopamine [5]. Kalita (1989) reported School of Biological Sciences, Monash University, Melbourne, Australia Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 2 of 10 improvements in muscle strength and appetite and reduc- GAACCTTTGAGGCCA TTTTG, βActF: GCAT tions in pharyngeal secretions after he and his son re- TGCTGACCGTATGCAG, βActR: GA TCCACA TCTG ceived daily supplementations of L-tyrosine. Within CTGGAAGGTGG). 10 days of L-tyrosine withdrawal there was a decrease in muscle strength suggesting that the improvement ob- Histology and antibody staining served resulted from L-tyrosine treatment and was not For Gomori trichrome staining, 6 dpf zebrafish were anes- sustained [15]. In a small-scale trial, five patients received thetized and heads were cut for genotyping. Tails were L-tyrosine doses from 250 to 3000 mg/day for a period of snap frozen and sections (10 μm) were cut using a Leica 2 months to 5 years [33]. Following L-tyrosine treatment, CM 1850 cryostat. Sections were then stained with modi- all patients reported varying short-term improvements in fied Gomori trichrome and imaged using a 63× 1.4 nu- muscle strength and ‘energy’ levels, however due to vari- merical aperture oil immersion objective. Fiber area was ous limitations (no placebo group, large age variability, measured using Fiji [35]. Antibody staining was performed and variable disease mutations), no firm conclusions could as described in [38]. Antibodies used were anti-α-Actinin2 be made as to efficacy [33]. L-tyrosine doses were also ad- (Sigma clone A7811, 1:100), rhodamine tagged phalloidin ministered to a mouse model of nemaline myopathy (Molecular Probes, 1:200), and AlexaFlour-488-labelled H40Y (ACTA1 ) for 4 weeks, and although treatment was re- secondary antibody (Molecular Probes, 1:200). ported to partially alleviate mobility deficits and decrease nemaline bodies [26], the long-term benefits of L-tyrosine Electron microscopy supplementation were not determined. Zebrafish were fixed according standard procedures in We have established a zebrafish model of NEB nema- 2.5% glutaraldehyde, 2% paraformaldehyde in 0.1 M so- line myopathy to test the ability of existing supplements, dium cacodylate buffer. Post-fixed with 1% OsO , 1.5% currently self-administered by patients, to improve skel- K Fe(III)(CN) . Samples were dehydrated in ethanol and 3 6 −/− etal muscle function. We show that zebrafish neb mu- the zebrafish were flat embedded in Epon 812. Ultrathin tants exhibit a reduction in birefringence, resulting from sections of 70 nm were cut on a Leica Ultracut UCT7 disruption of muscle structure, the formation of electron and stained with uranyl acetate and lead citrate. Large dense nemaline bodies, as well as Actinin2 and F-actin area EM tile sets were taken on a FEI NovaNanoSEM positive aggregates throughout their muscle fibres, 450 equipped with an ETD secondary electrons in-lens analogous to patient biopsies. The NEB nemaline myop- detector set at 10 kV and a STEM II (HAADF) detector athy model display decreased muscle function which set at 30 kV. MAPS 2.1 software was used to create the cannot be improved by treatment by L-tyrosine, taurine, tile sets. High resolution EM imaging was done on a L-carnitine, or creatine. This suggests that existing treat- Hitachi 7500 TEM and a FEI Tecnai 12 TEM. ments are ineffective in improving skeletal muscle per- formance in NEB nemaline myopathy, highlights the Muscle function assays need for further research into novel therapies, and pro- Touch evoke and locomotion assays were performed on vides a model to assist in their identification. 2 and 6 dpf zebrafish respectively as per [37]. For dosage analyses on wildtype zebrafish, an inactivity threshold of Methods 6 mm/s, detection threshold of 25 mm/s and maximum Fish strains and maintenance burst threshold of 30 mm/s were used. For the NEB Zebrafish were maintained according to standard proto- nemaline myopathy zebrafish model, an inactivity +/− cols [44]. Zebrafish strains used were Tg(neb ; threshold of 1 mm/s, detection threshold of 30 mm/s Lifeact-eGFP)[4] and an ENU-generated neb mutant and maximum burst threshold of 30 mm/s were used. line (sa906), obtained from the Zebrafish International The total distance swum above the inactivity threshold Resource Centre. Allele specific PCR KASP technology and below maximum burst threshold in a 10-min period (Geneworks) was used for neb genotyping. were extracted using the ZebraLab software (ViewPoint Life Sciences). Blinding of treatments groups was used cDNA synthesis and RT-PCR in combination with randomization of both the pos- Total RNA was extracted using TRIzol reagent (Invitro- ition of the fish within the plates and screening order gen Life Technologies). RNA samples were treated with of plates to remove any bias. Once the testing and RQ1 RNase-free DNase (Promega). cDNA was synthe- genotyping was completed the treatments groups were sized from 1 μg of each RNA sample in a 20 μl reaction uncovered. using Protoscript first strand cDNA synthesis kit (New England Biosciences) and oligo(dT)20 primer following Toxicology analyses the supplier’s instructions. Primers used for RT-PCR For dosage analyses, L-tyrosine disodium salt hydrate were (nebF: TGAGCACAACTACCGCACTC, nebR: (T1145, Sigma), taurine (T0625, Sigma), L-carnitine inner Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 3 of 10 salt (C0158, Sigma), and creatine monohydrate (C3630, was performed and correction for multiple comparisons Sigma) were all dissolved in water at a concentration of conducted using Dunn’s test. For swimming analyses 250 mM and diluted appropriately to ensure that 1 ml of and fiber area quantification on the NEB nemaline my- each chemical was added to 24 ml of embryo medium in a opathy model, all values were normalized to the average +/+ 90 cm petri dish. Thirty wildtype Tübingen embryos aged water supplemented neb siblings. Normality of data 28 h post fertilization (hpf) were dechorionated and was determined using a D’Agostino and Pearson test for placed in the petri dish. For control treatments, 1 ml of normality and normal data (Fig. 1e, g and 2b) was ana- water alone was added to 24 ml of embryo medium. Zeb- lysed using an unpaired t-test or one-way ANOVA using rafish were treated from 28 hpf until 6 dpf. Treatments Dunnett’s correction for multiple comparisons. For data were changed daily and zebrafish were monitored for sur- failing the normality test (Fig. 1f, Fig. 4, Additional file 1: vival, heart rate, and swimming performance as indicators Figures S5 and S6), the test was repeated after the out- of toxicity. Four independent treatments were performed liers were removed by the ROUT method (Q = 1%) or for tyrosine and three independent treatments were per- the data was logtransformed. In neither case did this re- formed for taurine, L-carnitine, and creatine. The resting sult in a normal distribution of data. Therefore, in these heart rates were measured at 2 dpf by counting the num- cases the data from the three replicates was pooled and ber of heart beats in 10 s. Heart rate measurements were a Kruskal-Wallis test was performed and correction for performed in triplicate with 10 fish per experiment. For multiple comparisons conducted using Dunn’s test. For heart rate and swimming assays all treatments were phenotypic analyses (Fig. 5b, c and Additional file 1: blinded and randomized to avoid experimental bias. Once Figure S7), the results of the three replicates were used to the testing and analyses were completed the treatments determine the mean percentage of each phenotype and to groups were revealed. plot the graphs. The proportion of the phenotypes was de- termined by pooling the data from all three replicates and Chemical treatments conducting a Chi-square test for each treatment against For treatment of the NEB nemaline myopathy zebrafish its respective control. All statistical analyses were con- +/− +/− model, Tg(neb ; Lifeact-eGFP)or neb adult fish were ducted using GraphPad Prism 7. incrossed and the resultant progeny were dechorinated at 24 hpf and 30 embryos were placed in either chem- Results ically or water treated embryo at 28 hpf. Treatments neb mutants display a reduction in muscle function were changed daily from 28 hpf water until 6 dpf at We obtained a zebrafish mutant strain (sa906) which which time wildtype embryos were transferred to contains a point mutation in neb causing a nonsense 24-well plates and NEB nemaline myopathy zebrafish mutation in exon 30 (of 134) of the transcript. We have were transferred into 48-well plates for locomotion as- verified the mutation in this strain and show, using says. For distance assays, based on the SD (0.178±0.146) RT-PCR, that this leads to a reduction in neb mRNA in −/− −/− of the untreated neb mutant and the smallest n for neb fish compared to their wildtype siblings (Fig. 1c). −/− the drug treated mutant fish groups (206) fish this gave Morphologically, neb mutants are smaller than their us 0.80 power at 0.05 significance to detect an improve- wildtype siblings and display a thinner trunk region (Fig. −/− ment of 20%. For speed assays, based on the SD (0.496 1a). neb mutants also show a loss of birefringence at −/− ±0.176) of the untreated neb mutant fish this gave us 4 days post fertilization (dpf) compared to wildtype sib- 0.80 power at 0.05 significance to detect an improve- lings indicating that their sarcomeric muscle structure is ment of 9%. disrupted (Fig. 1b). To determine whether loss of Neb results in impaired skeletal muscle function, we per- Statistics formed touch evoke and locomotion analyses to measure −/− For toxicology analyses on wildtype fish, all values were swimming performance. neb mutants display a sig- normalized to water supplemented wildtype fish in the nificant reduction in maximum acceleration (propor- −/− same replicate. Normality of data was determined using tional to muscle force) at 2 dpf (neb = 0.66±0.32 +/− +/+ aD’Agostino and Pearson test for normality. For toxicol- SEM, neb = 0.92±0.49 SEM, neb =1.0±0.49 SEM; −/− ogy analyses on wildtype fish, normal data (Additional Fig. 1e), in distance travelled at 6 dpf (neb =0.16 +/− +/+ file 1: Figures S2, S3, and S4a and b) was analysed by ±0.08 SEM, neb = 0.84±0.17 SEM, neb =1.0±0.17 −/− one-way ANOVA using Dunnett’s correction for mul- SEM; Fig. 1f) and speed at 6 dpf (neb = 0.49±0.10 +/− +/+ tiple comparisons. For data failing the normality test SEM, neb = 0.94±0.19 SEM, neb =1.0±0.14 SEM; (Additional file 1: Figure S4C), the test was repeated Fig. 1g) compared to wildtype siblings. Interestingly, −/− after the data was logtransformed which did not result we observe that neb mutants fail to inflate their in a normal distribution of data. Therefore, data from swim bladder by 4 dpf (Fig. 1a&d), another indicator the three replicates was pooled and a Kruskal-Wallis test of impaired muscle function. Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 4 of 10 −/− Fig. 1 Characterization of the neb (sa906) mutant zebrafish strain. a & b) At 4 dpf neb zebrafish (aii) appear smaller in size and (bii) display a −/− loss of birefringence compared to their wildtype siblings (ai & bi). c) RT-PCR analysis in and neb mutant embryos at 2 dpf shows a reduction in −/− neb mRNA levels compared to wildtype siblings (sibling). βAct was used as a positive control. d) ii) neb mutants display a smaller eye, brain region (B) and deflated swim bladder (SB) compared to their i) wildtype siblings. e) Quantification of the maximum acceleration recorded from −/− touch-evoked response assays of neb fish compared to wildtype siblings at 2 dpf. Error bars represent mean±SEM for three independent −/− +/− +/+ experiments (n = 11,9,12 neb , 55,25,32 neb , 18,13,12 neb zebrafish per experiment), **p < 0.01. f & g) Quantification of the normalized (f) −/− distance and (g) speed travelled by neb mutants compared to wildtype siblings at 6 dpf. For f) error bars represent median±interquartile range −/− +/− +/+ for three independent experiments (for n = 19,23,19 neb , 41,42,36 neb , 31,20,21 neb zebrafish). For g) error bars represent mean±SEM −/− +/− +/+ range (for n = 19,23,14 neb , 41,42,36 neb , 30,20,21 neb zebrafish per experiment). *p < 0.5, **** p < 0.001 −/− neb mutants display nemaline bodies and actin disorganization, which have been observed in both pa- accumulation tient muscle biopsies [21, 30] and mice models carrying NEB nemaline myopathy is characterized by the pres- mutations in Neb [3, 29]. To test whether these are −/− ence of electron-dense nemaline bodies and myofibrillar present in neb zebrafish, we first stained sections of Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 5 of 10 −/− −/− Fig. 2 Characterisation of skeletal muscle pathology in neb fish. a Gomori trichome staining of neb skeletal muscle sections reveal the +/+ presence of dark regions (arrows) throughout the muscle indicative of nemaline bodies not observed in neb fish. Nuclei (arrowhead) are evenly +/+ −/− organized in neb , however, appear disorganized in neb fish. b Quantification of normalized fiber area from Gomori trichome stained −/− +/+ −/− sections in neb (n = 23 fibers) compared to neb fish (n = 21 fibers). Error bars represent mean±SD, *** p < 0.001. c neb mutants exhibit F- actin (red) and Actinin2 (green) positive aggregates at the myosepta (arrowheads) (and zoomed inset) compared to wildtype siblings at 2 dpf −/− skeletal muscle at 6 dpf with Gomori trichome. We ob- siblings, Tg(neb ; Lifeact-eGFP) zebrafish show an ac- served large darkly stained patches throughout the cumulation of actin at the myosepta from 2 dpf and by 6 muscle fibers, indicative of nemaline bodies which were dpf, exhibit broken fibers greatly disrupting skeletal +/+ not present in stained sections from neb siblings muscle structure (Additional file 1: Figure S1). −/− (Fig. 2a). We also determined that neb fish have a much smaller skeletal muscle fiber cross-sectional area Evaluation of nemaline myopathy treatments on neb +/+ than neb siblings, reflecting a severe reduction in the mutants −/− +/+ −/− diameter of muscle fibers (neb = 0.73±0.20 SD, neb We have established that the neb mutant zebrafish = 1.0±0.29 SD) (Fig. 2b). We performed electron micros- closely mimics nemaline myopathy phenotypes observed copy to analyze the muscle ultrastructure. As shown in in patients validating its use as a NEB nemaline myop- Fig. 3a, we observed thickened Z-disks (Fig. 3ai) and an athy model. We next wanted to use the model to deter- accumulation of electron dense nemaline bodies (Fig. mine the efficacy of a number of suggested treatments −/− 3aiii) in neb zebrafish at 6 dpf which were not present which are currently self-administered by patients to im- −/− in wildtype siblings (Fig. 3b). neb mutant fibers also prove skeletal muscle function. We selected four treat- appeared disorganized and in many cases, there was a ments (L-tyrosine, L-carnitine, creatine, and taurine) complete loss of structure with remnants of sarcomeric based on anecdotal reports from the nemaline myopathy material (Fig. 3aii, aiv), suggesting a complete loss of patient support website (http://www.nemaline.org/re- muscle integrity. sources/drugs.html) and published studies on nemaline We have previously shown that knockdown of Neb myopathy patients and mice models [15, 33]. using two different antisense morpholinos produced Given that none of these compounds have been previ- Actinin2 and F-actin positive aggregates in the skeletal ously tested in zebrafish, we first determined a maximal muscle [38]. We performed antibody staining for Acti- dose to investigate therapeutic potential without affect- nin2 and F-actin and observed Actinin2 and F-actin ing the health and viability of the fish. We chose six positive aggregates along the vertical myosepta and scat- doses ranging from 0.1 μM to 10 mM, dissolved in water −/− tered throughout neb skeletal muscle fibers at 2 dpf, and added these to zebrafish embryo medium. For con- similar to those identified in Neb morphants [38], which trol treatments, we added the equivalent volume of +/+ are not present in neb siblings (Fig. 2c). These actin water, which was used as the vehicle, to the zebrafish accumulations do not result from broken fibers since the embryo medium instead of the compound. For each of fibers in the same cell are intact (Fig. 2c inset). We also the treatments, we recorded the survival from 24 hpf to crossed our neb mutant strain to the Tg(Lifeact-eGFP) 6 dpf as well as the resting heart rate of the embryos at transgenic line, which labels actin in all of the thin fila- 2 dpf. We also quantified the swimming performance at ments within the skeletal muscle. Unlike their wildtype 6 dpf and, combined with the survival and heart rate Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 6 of 10 −/− −/− Fig. 3 Examination of neb skeletal muscle by electron microscopy. a) neb mutant skeletal muscles display (i, iv) thickened Z-disks (arrows), +/+ (ii) fiber breakage (asterisks), (iii) accumulations of nemaline bodies and (iv) disruption of sarcomeric structures that are not observed in b) neb wildtype siblings −/− results, determined that a L-tyrosine and L-carnitine by neb mutants treated with the chemical supple- −/− concentration of 10 μM (for L-tyrosine: [23], for ments compared to water treated neb fish (Fig. 4). −/− L-carnitine: Additional file 1: Figure S3), a taurine con- To assess pathology in treated neb zebrafish as well centration of 1 mM (Additional file 1: Figure S2), and a as their wildtype siblings, we categorized the phenotypic creatine concentration of 100 μM(Additional file 1: severity of the skeletal muscle as wildtype, mild (less Figure S4) are the maximal non-toxic doses for treatment. than five aggregates at the myosepta) and severe (fiber To determine whether any of the treatments improved breakage and more than five aggregates at the myosepta skeletal muscle function or pathology we quantified both and throughout the muscle fibers; Fig. 5a) and then ge- the locomotion and phenotypic severity of the skeletal notyped the scored the embryos. We found no signifi- muscle in the treated NEB nemaline model fish at 6 dpf. cant difference in the severity of the skeletal muscle −/− We observed a significant decrease in swimming per- phenotype of neb mutants, nor for their wildtype sib- −/− formance for neb mutants compared to their wildtype lings for all treatments tested (Fig. 5b+c), showing these +/+ +/− siblings (neb and neb ) (Additional file 1: Figure S5 therapies do not improve skeletal muscle function in our and S6). However, for all chemicals tested there was no nemaline myopathy model. There was also no obvious significant difference in the distance or speed travelled difference in the appearance of facial muscles between −/− −/− Fig. 4 Quantification of muscle function in neb mutants at 6 dpf. Quantification of the a) normalized distance and b) speed travelled by neb mutants at 6 dpf supplemented with either L-tyrosine, taurine, L-carnitine, creatine, or water (H O). Error bars represent median±interquartile −/− −/− −/− range for three independent experiments (for a; n = 81,79,51 neb for L-tyrosine; n = 82,89,59 neb for taurine; n = 82,82,42 neb for L- −/− −/− −/− −/− carnitine; n = 87,79,46 neb for creatine, and n = 87,96,42 neb for water and for b; n = 81,79,51 neb for L-tyrosine; n = 82,89,59 neb for −/− −/− −/− taurine; n = 82,82,42 neb for L-carnitine; n = 92,79,46 neb for creatine, and n = 87,96,42 neb for water per experiment). ns = not significant Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 7 of 10 −/− −/− Fig. 5 Quantification of the phenotypic severity of neb mutants at 6 dpf. Quantification of the phenotypic severity of Tg(neb ; Lifeact-eGFP) fish at 6 dpf supplemented with either L-tyrosine, taurine, L-carnitine, creatine, or water (H O). a Phenotypes were scored as either wildtype, mild (less than five Lifeact-eGFP positive aggregates at the myosepta or a mild disruption of muscle fibres), or severe (severely disorganised fibres or −/ an accumulation of five or more Lifeact-eGFP positive aggregates within the muscle cell). b Quantification of the phenotypic severity of Tg(neb − −/− ; Lifeact-eGFP) fish supplemented with either L-tyrosine, taurine, or water. c Quantification of the phenotypic severity of Tg(neb ; Lifeact-eGFP) fish supplemented with either L-carnitine, creatine, or water (H O). b & c Error bars represent mean±SEM for three independent experiments. For −/− −/− −/− b) n = 6,8,7 Tg(neb ; Lifeact-eGFP) for L-tyrosine, n = 11,5,11 Tg(neb ; Lifeact-eGFP) for taurine and n = 9,8,10 Tg(neb ; Lifeact-eGFP) for water. −/− −/− −/− For c) n = 8,10,4 Tg(neb ; Lifeact-eGFP) for L-carnitine, n = 6,8,3 Tg(neb ; Lifeact-eGFP) for creatine, and n = 10,9,5 Tg(neb ; Lifeact-eGFP) for water per experiment). ns = not significant +/+ −/− neb siblings and neb mutants. (Additional file 1: of muscle in Gomori trichome stained sections corre- Figure S8). sponding to nemaline bodies. Electron microscopy re- vealed the presence of electron dense nemaline bodies Discussion and thickened Z-disks consistent with those observed in At present, there is no effective therapy for nemaline patient biopsies [10, 21] which are not present in the myopathies with limited research into treatments in vivo previously published zebrafish neb mutant [39]. These using animal systems. For individuals surviving through pathological defects lead to a disruption in fiber integ- childhood, nemaline myopathy is a chronic condition re- rity, indicated by the absence of sarcomeric structures quiring continued therapy throughout life to manage by EM and loss of birefringence, resulting in reduced symptoms. Our main goal is to develop zebrafish nema- skeletal muscle function. −/− line myopathy models to find effective treatments that Akin to Neb KO mice models [3], neb mutant zeb- can improve skeletal muscle function. rafish are indistinguishable from their wildtype siblings Here, we have characterized and validated a new NEB prior to 2 dpf, however, as development proceeds their nemaline myopathy model containing a mutation within growth is reduced. The reduced growth in Neb KO and ΔExon55 the super repeat region of the nebulin protein [9], caus- Neb mice [20, 29] results from a significant re- ing nonsense mediating decay of the resulting transcript. duction in thin filament length and fiber cross sectional Unlike the previously published model containing a mis- area leading to a reduction in maximal force generating sense mutation in the super repeat region, also predicted capacity [3, 20, 29] causing muscle weakness [30]. Simi- −/− to cause a loss of nebulin protein function, we show that larly, sectioning of neb zebrafish larvae at 6 dpf −/− neb zebrafish mutants display darkly stained patches revealed significantly smaller fiber cross-sectional area Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 8 of 10 compared to wildtype siblings, indicating a reduction in screens and find an effective treatment for nemaline −/− fiber size. Both our Neb morphant model [38]and neb myopathy. genetic mutants show an accumulation of actin at the myosepta suggesting that this may be an important patho- Additional file logical hallmark of nemaline myopathy. Thus, it is likely Additional file 1: Supplementary data for Testing of therapies in a that the depletion of actin from the sarcomere, in addition novel nebulin nemaline myopathy model demonstrates and lack of to the loss of nebulin from the thin filament, may contrib- efficacy. Figure S1: Characterisation of Tg(neb-/-; Lifeact-eGFP) fish. ute to the reduction in myofiber size and the observed Figure S2-S4: Toxicity analyses for treatment of wildtype zebrafish with taurine, L-carnitine and creatine. Figure S5-S6: Quantification of muscle weakness. distance travelled and average speed at 6 dpf. Figure S7: Quantification We evaluated a number of existing treatments for of the phenotypic severity at 6 dpf. Figure S8: Characterisation of facial nemaline myopathy by quantifying their ability to reduce muscles at 6 dpf. (PDF 7847 kb) actin aggregation or improve skeletal muscle perform- −/− ance in our neb zebrafish. Of the four treatments we Acknowledgements H40Y We would like to thank Dr. Angela Finch (UNSW) for her advice. examined, L-tyrosine has been tested in ACTA1 mouse models [26] and in a limited patient study [15, Funding 33] however no firm conclusions had been made as to The work was supported by an Australian National Health and Medical its effectiveness to increase skeletal muscle function. Research Council (NHMRC) Project Grant (APP1010110). TS is supported by −/− an MDA Development Grant (APP381325) and an AFM Postdoctoral Our results suggest that L-tyrosine treatment of neb Fellowship (APP19853). D286G mutant zebrafish, as reported for ACTA1 zebrafish and mouse models [23], does not improve skeletal Availability of data and materials The data is made available on Figshare using the following https://figshare.com/ muscle performance. It is noted that L-tyrosine treat- projects/Testing_of_therapies_in_a_novel_nebulin_nemaline_myopathy_ ment may be beneficial to increase weight gain, appetite, model_demonstrate_a_lack_of_efficacy/26497. and reduce pharyngeal secretions in nemaline myopathy Authors’ contributions patients [15, 33], however, this was not examined in the TES conceptualized, performed and analyzed the data as well as wrote, current study. We did however, examine the facial reviewed and edited the manuscript. EAM assisted with the neb Zebrabox −/− muscle structure in neb zebrafish, and observed no screen and the Gomori trichome staining, as well as reviewed the manuscript. CW assisted with the neb Zebrabox screen and reviewed the difference in appearance compared to their wild type manuscript. VO and GR performed the electron microscopy and edited the siblings preventing an assessment of the effect of treat- manuscript. RBR conceptualized the methodology, wrote, reviewed and ments on facial musculature. edited the manuscript as well as supervised the project. TES and RBR −/− obtained funding for the research. All authors read and approved the final We also treated neb mutants with either taurine, manuscript. creatine, or L-carnitine, which are all naturally occurring compounds, present in many tissues including skeletal Ethics approval muscle, and are involved in modulating ion channel Fish maintenance and handling was carried out as per the standard operating procedures approved by the Monash Animal Services Animal function, membrane stability, calcium homeostasis and Ethics Committee under breeding colony license MARP/2015/004/BC. Fish energy metabolism [6, 7, 12, 13, 17, 22, 25, 42]. Taurine were anaesthetized using Tricaine methanesulfonate. has been previously shown to improve muscle strength Competing interests and reduce inflammation in mdx mice [40, 41] and in an The authors declare that they have no competing interests. analysis of six clinical trials for muscular dystrophy, 192 participants reported an increase in muscle strength Publisher’sNote when treated with creatine compared to the placebo Springer Nature remains neutral with regard to jurisdictional claims in group [16]. Unfortunately, chemical supplementation of published maps and institutional affiliations. −/− neb mutants with creatine, L-carnitine, or taurine also Author details failed to restore skeletal muscle function or improve School of Biological Sciences, Monash University, Melbourne, Australia. skeletal muscle pathology. Interestingly, of the four com- Monash Ramaciotti Centre for Cryo Electron Microscopy, Monash University, Melbourne, VIC 3800, Australia. Department of Biochemistry and Molecular pounds tested, taurine showed the least toxicity at high Biology, Monash University, Melbourne, Australia. Biomedicine Discovery concentrations, which is in line with previous reports Institute, Monash University, Melbourne, Australia. from clinical trials [36]. However, toxic effects observed Received: 11 May 2018 Accepted: 12 May 2018 in wildtype zebrafish treated with high doses of creatine, and L-carnitine suggest caution when administering high doses to patients. Importantly, our study has highlighted References the inadequacies of existing nemaline myopathy treat- 1. Agrawal PB, Greenleaf RS, Tomczak KK, Lehtokari V-L, Wallgren-Pettersson C, Wallefeld W, Laing NG, Darras BT, Maciver SK, Dormitzer PR, Beggs AH ments. Nevertheless, the zebrafish NEB nemaline myop- (2006) Nemaline myopathy with minicores caused by mutation of the CFL2 athy model we have characterized provides an excellent gene encoding the skeletal muscle actin-binding protein, cofilin-2. Am J system in which to perform high-throughput chemical Hum Genet 80:162–167. https://doi.org/10.1086/510402 Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 9 of 10 2. Agrawal PB, Strickland CD, Midgett C, Morales A, Newburger DE, Poulos MA, nebulin-related nemaline myopathy: ultrastrastructural findings correlated to Tomczak KK, Ryan MM, Iannaccone ST, Crawford TO, Laing NG, Beggs AH disease severity and genotype. Acta Neuropathol Commun 2:44. https://doi. (2004) Heterogeneity of nemaline myopathy cases with skeletal muscle α-actin org/10.1016/j.spen.2011.10.006 gene mutations. Ann Neurol 56:86–96. doi: https://doi.org/10.1002/ana.20157 22. McGarry JD, Brown NF (1997) The mitochondrial carnitine palmitoyltransferase 3. Bang M-L, Li X, Littlefield R, Bremner S, Thor A, Knowlton KU, Lieber RL, system. From concept to molecular analysis. Eur J Biochem 244:1–14 Chen J (2006) Nebulin-deficient mice exhibit shorter thin filament lengths 23. Messineo AM, Gineste C, Sztal TE, McNamara EL, Vilmen C, Ogier AC, Hahne and reduced contractile function in skeletal muscle. J Muscle Res Cell Motil D, Bendahan D, Laing NG, Bryson-Richardson RJ, Gondin J, Nowak KJ (2017) 173:905–916. https://doi.org/10.1083/jcb.200603119 L-tyrosine supplementation is not therapeutic for skeletal muscle 4. Berger J, Hall TE, Currie PD (2015) Novel transgenic lines to label dysfunction in zebrafish and mouse models of dominant skeletal muscle α- sarcolemma and myofibrils of the musculature. Zebrafish 12:124–125. actin nemaline myopathy. bioRxiv. https://doi.org/10.1101/218016 https://doi.org/10.1089/zeb.2014.1065 24. Miyatake S, Mitsuhashi S, Hayashi YK, Purevjav E, Nishikawa A, Koshimizu E, 5. Daubner SC, Le T, Wang S (2011) Tyrosine hydroxylase and regulation of Suzuki M, Yatabe K, Tanaka Y, Ogata K, Kuru S, Shiina M, Tsurusaki Y, dopamine synthesis. Arch Biochem Biophys 508:1–12. https://doi.org/10. Nakashima M, Mizuguchi T, Miyake N, Saitsu H, Ogata K, Kawai M, Towbin J, 1016/j.abb.2010.12.017 Nonaka I, Nishino I, Matsumoto N (2017) Biallelic mutations in MYPN, 6. De Luca A, Pierno S, Camerino DC (2015) Taurine: the appeal of a safe encoding Myopalladin, are associated with childhood-Onset,Slowly amino acid for skeletal muscle disorders. J Transl Med:1–18. https://doi.org/ progressive Nemaline myopathy. Am J Hum Genet 100:169–178. https://doi. 10.1186/s12967-015-0610-1 org/10.1016/j.ajhg.2016.11.017 7. De Luca A, Pierno S, Huxtable RJ, Falli P, Franconi F, Giotti A, Camerino DC 25. Montesano A, Senesi P, Luzi L, Benedini S, Terruzzi I (2015) Research ArticlePotential therapeutic role of L-carnitine in skeletal muscle oxidative (1992) Effects of taurine depletion on membrane electrical properties of rat skeletal muscle. Adv Exp Med Biol 315:199–205 stress and atrophy conditions. Oxidative Med Cell Longev:1–13. https://doi. org/10.1155/2015/646171 8. Donner K, Ollikainen M, Ridanpää M, Christen H-J, Goebel HH, de Visser M, 26. Nguyen MAT, Joya JE, Kee AJ, Domazetovska A, Yang N, Hook JW, Lemckert Pelin K, Wallgren-Pettersson C (2001) Mutations in the β-tropomyosin (TPM2) gene – a rare cause of nemaline myopathy. Neuromuscul Disord 12:151– FA, Kettle E, Valova VA, Robinson PJ, North KN, Gunning PW, Mitchell CA, Hardeman EC (2011) Hypertrophy and dietary tyrosine ameliorate the 158. doi: https://doi.org/10.1016/S0960-8966(01)00252-8 phenotypes of a mouse model of severe nemaline myopathy. Brain 134: 9. Donner K, Sandbacka M, Lehtokari V-L, Wallgren-Pettersson C, Pelin K (2004) 3516–3529. https://doi.org/10.1093/brain/awr274 Complete genomic structure of the human nebulin gene and identification of alternatively spliced transcripts. Eur J Hum Genet 12:744–751. https://doi. 27. Nowak KJK, Wattanasirichaigoon DD, Goebel HHH, Wilce MM, Pelin KK, Donner org/10.1038/sj.ejhg.5201242 KK, Jacob RLR, Hübner CC, Oexle KK, Anderson JRJ, Verity CMC, North KNK, 10. Gajda A, Horvath E, Hortobagyi T, Gergev G, Szabo H, Farkas K, Nagy N, Szell Iannaccone STS, Müller CRC, Nürnberg PP, Muntoni FF, Sewry CC, Hughes II, M, Sztriha L (2013) Nemaline myopathy type 2 (NEM2): two novel mutations Sutphen RR, Lacson AGA, Swoboda KJK, Vigneron JJ, Wallgren-Pettersson CC, in the Nebulin (NEB) gene. J Child Neurol. https://doi.org/10.1177/ Beggs AHA, Laing NGN (1999) Mutations in the skeletal muscle alpha-actin 0883073813494476 gene in patients with actin myopathy and nemaline myopathy. Nat Genet 23: 208–212. https://doi.org/10.1038/13837 11. Gupta VA, Ravenscroft G, Shaheen R, Todd EJ, Swanson LC, Shiina M, Ogata 28. Ottenheijm CAC, Granzier H (2010) New insights into the structural roles of K, Hsu C, Clarke NF, Darras BT, Farrar MA, Hashem A, Manton ND, Muntoni F, Nebulin in skeletal muscle. J Biomed Biotechnol 2010:1–6. https://doi.org/10. North KN, Sandaradura SA, Nishino I, Hayashi YK, Sewry CA, Thompson EM, 1091/mbc.E07-07-0690 Yau KS, Brownstein CA, Yu TW, Allcock RJN, Davis MR, Wallgren-Pettersson C, Matsumoto N, Alkuraya FS, Laing NG, Beggs AH (2013) Identification of 29. Ottenheijm CAC, Buck D, de Winter JM, Ferrara C, Piroddi N, Tesi C, Jasper KLHL41 mutations implicates BTB-Kelch-mediated ubiquitination as an JR, Malik FI, Meng H, Stienen GJM, Beggs AH, Labeit S, Poggesi C, Lawlor alternate pathway to Myofibrillar disruption in Nemaline myopathy. Am J MW, Granzier H (2013) Deleting exon 55 from the nebulin gene induces Hum Genet 93:1108–1117. https://doi.org/10.1016/j.ajhg.2013.10.020 severe muscle weakness in a mouse model for nemaline myopathy. Brain 12. Huxtable RJ (1992) Physiological actions of taurine. Physiol Rev 72:101–163 136:1718–1731. https://doi.org/10.1093/brain/awt113 13. J Jang J, Park J, Chang H, Lim K (2016) L-carnitine supplement reduces skeletal 30. Ottenheijm CAC, Witt CC, Stienen GJ, Labeit S, Beggs AH, Granzier H (2009) muscle atrophy induced by prolonged hindlimb suspension in rats. Appl Thin filament length dysregulation contributes to muscle weakness in Physiol Nutr Metab 41:1240–1247. doi: https://doi.org/10.1139/apnm-2016-0094 nemaline myopathy patients with nebulin deficiency. Hum Mol Gen 18: 14. Johnston JJ, Kelley RI, Crawford TO, Morton DH, Agarwala R, Koch T, 2359–2369. https://doi.org/10.1093/hmg/ddp168 Schäffer AA, Francomano CA, Biesecker LG (2000) A novel nemaline 31. Pelin KK, Hilpelä PP, Donner KK, Sewry CC, Akkari PAP, Wilton SDS, myopathy in the Amish caused by a mutation in troponin T1. Am J Hum Wattanasirichaigoon DD, Bang MLM, Centner TT, Hanefeld FF, Odent SS, Genet 67:814–821. https://doi.org/10.1086/303089 Fardeau MM, Urtizberea JAJ, Muntoni FF, Dubowitz VV, Beggs AHA, Laing NGN, 15. Kalita D (1989) A new treatment for congenital nonprogressive nemaline Labeit SS, la Chapelle de AA, Wallgren-Pettersson CC (1999) Mutations in the myopathy. J Orthomol Med nebulin gene associated with autosomal recessive nemaline myopathy. Proc 16. Kley RA, Tarnopolsky MA, Vorgerd M (1996) Creatine for treating muscle Natl Acad Sci U S A 96:2305–2310. https://doi.org/10.2307/47056 disorders. https://doi.org/10.1002/14651858.CD004760.pub4 32. Ravenscroft G, Miyatake S, Lehtokari V-L, Todd EJ, Vornanen P, Yau KS, 17. Koons S, Cooke R (1986) Function of creatine kinase localization in muscle Hayashi YK, Miyake N, Tsurusaki Y, Doi H, Saitsu H, Osaka H, Yamashita Adv Exp Med Biol 194:129–137 S, Ohya T, Sakamoto Y, Koshimizu E, Imamura S, Yamashita M, Ogata K, contraction. Shiina M, Bryson-Richardson RJ, Vaz R, Ceyhan O, Brownstein CA, 18. Laing NG, Wilton SD, Akkari PA, Dorosz S, Boundy K, Kneebone C, Swanson LC, Monnot S, Romero NB, Amthor H, Kresoje N, Sivadorai P, Blumbergs P, White S, Watkins H, Love DR (1995) A mutation in the alpha Kiraly-Borri C, Haliloglu G, Talim B, Orhan D, Kale G, Charles AK, Fabian tropomyosin gene TPM3 associated with autosomal dominant nemaline VA, Davis MR, Lammens M, Sewry CA, Manzur A, Muntoni F, Clarke NF, myopathy NEM1. Nat Genet 10:249–249. https://doi.org/10.1038/ng0695-249 North KN, Bertini E, Nevo Y, Willichowski E, Silberg IE, Topaloglu H, 19. Lehtokari V-L, Greenleaf RS, DeChene ET, Kellinsalmi M, Pelin K, Laing NG, Beggs AH, Allcock RJN, Nishino I, Wallgren-Pettersson C, Matsumoto N, Beggs AH, Wallgren-Pettersson C (2009) The exon 55 deletion in the nebulin Laing NG (2013) Mutations in KLHL40 are a frequent cause of severe gene–one single founder mutation with world-wide occurrence. autosomal-recessive nemaline myopathy. Am J Hum Genet 93:6–18. Neuromuscul Disord 19:179–181. https://doi.org/10.1016/j.nmd.2008.12.001 https://doi.org/10.1016/j.ajhg.2013.05.004 20. Li F, Buck D, De Winter J, Kolb J, Meng H, Birch C, Slater R, Escobar YN, Smith JE III, Yang L, Konhilas J, Lawlor MW, Ottenheijm C, Granzier HL (2015) Nebulin 33. Ryan MM, Sy C, Rudge S, Ellaway C, Ketteridge D, Roddick LG, Iannaccone deficiency in adult muscle causes sarcomere defects and muscle-type- ST, Kornberg AJ, North KN (2007) Dietary L-tyrosine supplementation in dependent changes in trophicity: novel insights in nemaline myopathy. Hum Nemaline myopathy. J Child Neurol 23:609–613. https://doi.org/10.1177/ Mol Genet 24:5219–5233. https://doi.org/10.1093/hmg/ddv243 0883073807309794 21. Malfatti E, Lehtokari V-L, Böhm J, De Winter JM, Schäffer U, Estournet B, 34. Sambuughin N, Swietnicki W, Techtmann S, Matrosova V, Wallace T, Quijano-Roy S, Monges S, Lubieniecki F, Bellance R, Viou M, Madelaine A, Goldfarb L, Maynard E (2012) KBTBD13 interacts with Cullin 3 to form a Wu B, Taratuto A, Eymard B, Pelin K, Fardeau M, Ottenheijm CA, Wallgren- functional ubiquitin ligase. Biochem Biophys Res Commun:1–7. https://doi. Pettersson C, Laporte J, Romero NB (2014) Muscle histopathology in org/10.1016/j.bbrc.2012.04.074 Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 10 of 10 35. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–682. https://doi. org/10.1038/nmeth.2019 36. Shao A, Hathcock JN (2008) Risk assessment for the amino acids taurine, L-glutamine and L-arginine. Regul Toxicol Pharmacol 50:376–399. https://doi.org/10.1016/j.yrtph.2008.01.004 37. Sztal TE, Ruparelia AA, Williams C, Bryson-Richardson RJ (2016) Using Touch- evoked Response and Locomotion Assays to Assess Muscle Performance and Function in Zebrafish. J Vis Exp 116:e54431. 38. Sztal TE, Zhao M, Williams C, Oorschot V, Parslow AC, Giousoh A, Yuen M, Hall TE, Costin A, Ramm G, Bird PI, Busch-Nentwich EM, Stemple DL, Currie PD, Cooper ST, Laing NG, Nowak KJ, Bryson-Richardson RJ (2015) Zebrafish models for nemaline myopathy reveal a spectrum of nemaline bodies contributing to reduced muscle function. Acta Neuropathol 130:389–406. https://doi.org/10.1007/s00401-015-1430-3 39. Telfer WR, Nelson DD, Waugh T, Brooks SV, Dowling JJ (2012) Neb: a zebrafish model of nemaline myopathy due to nebulin mutation. Dev Biol 5: 389–396. https://doi.org/10.1242/dmm.008631 40. Terrill JR, Grounds MD, Arthur PG (2015) Taurine deficiency, synthesis and transport in the mdx mouse model for Duchenne muscular dystrophy. Int J Biochem Cell Biol 66:141–148. https://doi.org/10.1016/j.biocel.2015.07.016 41. Terrill JR, Pinniger GJ, Graves JA, Grounds MD, Arthur PG (2016) Increasing taurine intake and taurine synthesis improves skeletal muscle function in the mdx mouse model for Duchenne muscular dystrophy. J Physiol 594: 3095–3110. https://doi.org/10.1113/JP271418 42. Thompson CH, Kemp GJ, Sanderson AL, Dixon RM, Styles P, Taylor DJ, Radda GK (1996) Effect of creatine on aerobic and anaerobic metabolism in skeletal muscle in swimmers. Br J Sports Med 30:222–225 43. Wallgren-Pettersson C, Wallgren-Pettersson C, Sewry CA, Sewry CA, Nowak KJ, Nowak KJ, Laing NG, Laing NG (2011) Nemaline myopathies. YSPEN 18: 230–238. https://doi.org/10.1016/j.spen.2011.10.004 44. Westerfield M (2007) The Zebrafish Book. 45. Yuen M, Sandaradura SA, Dowling JJ, Kostyukova AS, Moroz N, Quinlan KG, Lehtokari V-L, Ravenscroft G, Todd EJ, Ceyhan-Birsoy O, Gokhin DS, Maluenda J, Lek M, Nolent F, Pappas CT, Novak SM, D'Amico A, Malfatti E, Thomas BP, Gabriel SB, Gupta N, Daly MJ, Ilkovski B, Houweling PJ, Davidson AE, Swanson LC, Brownstein CA, Gupta VA, Medne L, Shannon P, Martin N, Bick DP, Flisberg A, Holmberg E, Van den Bergh P, Lapunzina P, Waddell LB, Sloboda DD, Bertini E, Chitayat D, Telfer WR, Laquerrière A, Gregorio CC, Ottenheijm CAC, Bönnemann CG, Pelin K, Beggs AH, Hayashi YK, Romero NB, Laing NG, Nishino I, Wallgren-Pettersson C, Melki J, Fowler VM, MacArthur DG, North KN, Clarke NF (2014) Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy. J Clin Invest 124: 4693–4708. https://doi.org/10.1172/JCI75199 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Acta Neuropathologica Communications Springer Journals

Testing of therapies in a novel nebulin nemaline myopathy model demonstrate a lack of efficacy

Free
10 pages

Loading next page...
 
/lp/springer_journal/testing-of-therapies-in-a-novel-nebulin-nemaline-myopathy-model-i4iiHUfrU2
Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Biomedicine; Neurosciences; Pathology; Neurology
eISSN
2051-5960
D.O.I.
10.1186/s40478-018-0546-9
Publisher site
See Article on Publisher Site

Abstract

Sztal et al. Acta Neuropathologica Communications (2018) 6:40 https://doi.org/10.1186/s40478-018-0546-9 RESEARCH Open Access Testing of therapies in a novel nebulin nemaline myopathy model demonstrate a lack of efficacy 1 1 1 2 2,3,4 Tamar E. Sztal , Emily A. McKaige , Caitlin Williams , Viola Oorschot , Georg Ramm 1* and Robert J. Bryson-Richardson Abstract: Nemaline myopathies are heterogeneous congenital muscle disorders causing skeletal muscle weakness and, in some cases, death soon after birth. Mutations in nebulin, encoding a large sarcomeric protein required for thin filament function, are responsible for approximately 50% of nemaline myopathy cases. Despite the severity of the disease there is no effective treatment for nemaline myopathy with limited research to develop potential therapies. Several supplements, including L-tyrosine, have been suggested to be beneficial and consequently self- administered by nemaline myopathy patients without any knowledge of their efficacy. We have characterized a zebrafish model for nemaline myopathy caused by a mutation in nebulin. These fish form electron-dense nemaline bodies and display reduced muscle function akin to the phenotypes observed in nemaline myopathy patients. We have utilized our zebrafish model to test and evaluate four treatments currently self-administered by nemaline myopathy patients to determine their ability to increase skeletal muscle function. Analysis of muscle pathology and locomotion following treatment with L-tyrosine, L-carnitine, taurine, or creatine revealed no significant improvement in skeletal muscle function emphasizing the urgency to develop effective therapies for nemaline myopathy. Keywords: Nebulin, Nemaline myopathy, Zebrafish, Treatment Introduction nemaline bodies throughout the muscle combined with Nemaline myopathies are congenital muscle diseases diminished contractile strength and force generation [21, characterized by the presence of nemaline (rod-like) 31]. Deletion of exon 55, causing a common form of bodies that form within the skeletal muscles. The disease autosomal recessive nemaline myopathy [19], results in presents with clinically heterogeneous phenotypes, ran- shortened thin filaments, alterations in crossbridge cyc- ging from adult onset mild muscle weakness to, in se- ling kinetics, and reduced calcium-sensitivity following vere cases, death in utero or just after birth [43]. loss of NEB [28, 30]. Similarly, a reduction in Nebulin in Causative mutations have now been identified in 11 dif- zebrafish recapitulates many of the clinical and patho- ferent genes, encoding components that form or regulate logical aspects of nemaline myopathy observed in pa- the thin filament (ACTA1 [27], NEB [31], α-tropomyosin tients [38, 39]. [18], β-tropomyosin [8], troponin T1 [14], cofilin [1], The lack of an effective treatment for nemaline myop- KBTBD13 [34], KLHL40 [32], KLHL41 [11], leiomodin-3 athy has resulted in many patients and their families [45], and MYPN [24]). testing compounds on an ad-hoc basis, with a number Nebulin (NEB) plays an important role in regulating of compounds listed on patient support websites (http:// thin filament length and is the most frequently affected www.nemaline.org/resources/drugs.html). Perhaps the gene in nemaline myopathy, accounting for approxi- most promising of these is L-tyrosine, a non-essential mately 50% of all cases [2]. Mutations in NEB result in amino acid, either derived from the diet or synthesised in the liver from phenylalanine, which functions as a pre- cursor to several neurotransmitters and hormones includ- * Correspondence: robert.bryson-richardson@monash.edu ing adrenaline and dopamine [5]. Kalita (1989) reported School of Biological Sciences, Monash University, Melbourne, Australia Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 2 of 10 improvements in muscle strength and appetite and reduc- GAACCTTTGAGGCCA TTTTG, βActF: GCAT tions in pharyngeal secretions after he and his son re- TGCTGACCGTATGCAG, βActR: GA TCCACA TCTG ceived daily supplementations of L-tyrosine. Within CTGGAAGGTGG). 10 days of L-tyrosine withdrawal there was a decrease in muscle strength suggesting that the improvement ob- Histology and antibody staining served resulted from L-tyrosine treatment and was not For Gomori trichrome staining, 6 dpf zebrafish were anes- sustained [15]. In a small-scale trial, five patients received thetized and heads were cut for genotyping. Tails were L-tyrosine doses from 250 to 3000 mg/day for a period of snap frozen and sections (10 μm) were cut using a Leica 2 months to 5 years [33]. Following L-tyrosine treatment, CM 1850 cryostat. Sections were then stained with modi- all patients reported varying short-term improvements in fied Gomori trichrome and imaged using a 63× 1.4 nu- muscle strength and ‘energy’ levels, however due to vari- merical aperture oil immersion objective. Fiber area was ous limitations (no placebo group, large age variability, measured using Fiji [35]. Antibody staining was performed and variable disease mutations), no firm conclusions could as described in [38]. Antibodies used were anti-α-Actinin2 be made as to efficacy [33]. L-tyrosine doses were also ad- (Sigma clone A7811, 1:100), rhodamine tagged phalloidin ministered to a mouse model of nemaline myopathy (Molecular Probes, 1:200), and AlexaFlour-488-labelled H40Y (ACTA1 ) for 4 weeks, and although treatment was re- secondary antibody (Molecular Probes, 1:200). ported to partially alleviate mobility deficits and decrease nemaline bodies [26], the long-term benefits of L-tyrosine Electron microscopy supplementation were not determined. Zebrafish were fixed according standard procedures in We have established a zebrafish model of NEB nema- 2.5% glutaraldehyde, 2% paraformaldehyde in 0.1 M so- line myopathy to test the ability of existing supplements, dium cacodylate buffer. Post-fixed with 1% OsO , 1.5% currently self-administered by patients, to improve skel- K Fe(III)(CN) . Samples were dehydrated in ethanol and 3 6 −/− etal muscle function. We show that zebrafish neb mu- the zebrafish were flat embedded in Epon 812. Ultrathin tants exhibit a reduction in birefringence, resulting from sections of 70 nm were cut on a Leica Ultracut UCT7 disruption of muscle structure, the formation of electron and stained with uranyl acetate and lead citrate. Large dense nemaline bodies, as well as Actinin2 and F-actin area EM tile sets were taken on a FEI NovaNanoSEM positive aggregates throughout their muscle fibres, 450 equipped with an ETD secondary electrons in-lens analogous to patient biopsies. The NEB nemaline myop- detector set at 10 kV and a STEM II (HAADF) detector athy model display decreased muscle function which set at 30 kV. MAPS 2.1 software was used to create the cannot be improved by treatment by L-tyrosine, taurine, tile sets. High resolution EM imaging was done on a L-carnitine, or creatine. This suggests that existing treat- Hitachi 7500 TEM and a FEI Tecnai 12 TEM. ments are ineffective in improving skeletal muscle per- formance in NEB nemaline myopathy, highlights the Muscle function assays need for further research into novel therapies, and pro- Touch evoke and locomotion assays were performed on vides a model to assist in their identification. 2 and 6 dpf zebrafish respectively as per [37]. For dosage analyses on wildtype zebrafish, an inactivity threshold of Methods 6 mm/s, detection threshold of 25 mm/s and maximum Fish strains and maintenance burst threshold of 30 mm/s were used. For the NEB Zebrafish were maintained according to standard proto- nemaline myopathy zebrafish model, an inactivity +/− cols [44]. Zebrafish strains used were Tg(neb ; threshold of 1 mm/s, detection threshold of 30 mm/s Lifeact-eGFP)[4] and an ENU-generated neb mutant and maximum burst threshold of 30 mm/s were used. line (sa906), obtained from the Zebrafish International The total distance swum above the inactivity threshold Resource Centre. Allele specific PCR KASP technology and below maximum burst threshold in a 10-min period (Geneworks) was used for neb genotyping. were extracted using the ZebraLab software (ViewPoint Life Sciences). Blinding of treatments groups was used cDNA synthesis and RT-PCR in combination with randomization of both the pos- Total RNA was extracted using TRIzol reagent (Invitro- ition of the fish within the plates and screening order gen Life Technologies). RNA samples were treated with of plates to remove any bias. Once the testing and RQ1 RNase-free DNase (Promega). cDNA was synthe- genotyping was completed the treatments groups were sized from 1 μg of each RNA sample in a 20 μl reaction uncovered. using Protoscript first strand cDNA synthesis kit (New England Biosciences) and oligo(dT)20 primer following Toxicology analyses the supplier’s instructions. Primers used for RT-PCR For dosage analyses, L-tyrosine disodium salt hydrate were (nebF: TGAGCACAACTACCGCACTC, nebR: (T1145, Sigma), taurine (T0625, Sigma), L-carnitine inner Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 3 of 10 salt (C0158, Sigma), and creatine monohydrate (C3630, was performed and correction for multiple comparisons Sigma) were all dissolved in water at a concentration of conducted using Dunn’s test. For swimming analyses 250 mM and diluted appropriately to ensure that 1 ml of and fiber area quantification on the NEB nemaline my- each chemical was added to 24 ml of embryo medium in a opathy model, all values were normalized to the average +/+ 90 cm petri dish. Thirty wildtype Tübingen embryos aged water supplemented neb siblings. Normality of data 28 h post fertilization (hpf) were dechorionated and was determined using a D’Agostino and Pearson test for placed in the petri dish. For control treatments, 1 ml of normality and normal data (Fig. 1e, g and 2b) was ana- water alone was added to 24 ml of embryo medium. Zeb- lysed using an unpaired t-test or one-way ANOVA using rafish were treated from 28 hpf until 6 dpf. Treatments Dunnett’s correction for multiple comparisons. For data were changed daily and zebrafish were monitored for sur- failing the normality test (Fig. 1f, Fig. 4, Additional file 1: vival, heart rate, and swimming performance as indicators Figures S5 and S6), the test was repeated after the out- of toxicity. Four independent treatments were performed liers were removed by the ROUT method (Q = 1%) or for tyrosine and three independent treatments were per- the data was logtransformed. In neither case did this re- formed for taurine, L-carnitine, and creatine. The resting sult in a normal distribution of data. Therefore, in these heart rates were measured at 2 dpf by counting the num- cases the data from the three replicates was pooled and ber of heart beats in 10 s. Heart rate measurements were a Kruskal-Wallis test was performed and correction for performed in triplicate with 10 fish per experiment. For multiple comparisons conducted using Dunn’s test. For heart rate and swimming assays all treatments were phenotypic analyses (Fig. 5b, c and Additional file 1: blinded and randomized to avoid experimental bias. Once Figure S7), the results of the three replicates were used to the testing and analyses were completed the treatments determine the mean percentage of each phenotype and to groups were revealed. plot the graphs. The proportion of the phenotypes was de- termined by pooling the data from all three replicates and Chemical treatments conducting a Chi-square test for each treatment against For treatment of the NEB nemaline myopathy zebrafish its respective control. All statistical analyses were con- +/− +/− model, Tg(neb ; Lifeact-eGFP)or neb adult fish were ducted using GraphPad Prism 7. incrossed and the resultant progeny were dechorinated at 24 hpf and 30 embryos were placed in either chem- Results ically or water treated embryo at 28 hpf. Treatments neb mutants display a reduction in muscle function were changed daily from 28 hpf water until 6 dpf at We obtained a zebrafish mutant strain (sa906) which which time wildtype embryos were transferred to contains a point mutation in neb causing a nonsense 24-well plates and NEB nemaline myopathy zebrafish mutation in exon 30 (of 134) of the transcript. We have were transferred into 48-well plates for locomotion as- verified the mutation in this strain and show, using says. For distance assays, based on the SD (0.178±0.146) RT-PCR, that this leads to a reduction in neb mRNA in −/− −/− of the untreated neb mutant and the smallest n for neb fish compared to their wildtype siblings (Fig. 1c). −/− the drug treated mutant fish groups (206) fish this gave Morphologically, neb mutants are smaller than their us 0.80 power at 0.05 significance to detect an improve- wildtype siblings and display a thinner trunk region (Fig. −/− ment of 20%. For speed assays, based on the SD (0.496 1a). neb mutants also show a loss of birefringence at −/− ±0.176) of the untreated neb mutant fish this gave us 4 days post fertilization (dpf) compared to wildtype sib- 0.80 power at 0.05 significance to detect an improve- lings indicating that their sarcomeric muscle structure is ment of 9%. disrupted (Fig. 1b). To determine whether loss of Neb results in impaired skeletal muscle function, we per- Statistics formed touch evoke and locomotion analyses to measure −/− For toxicology analyses on wildtype fish, all values were swimming performance. neb mutants display a sig- normalized to water supplemented wildtype fish in the nificant reduction in maximum acceleration (propor- −/− same replicate. Normality of data was determined using tional to muscle force) at 2 dpf (neb = 0.66±0.32 +/− +/+ aD’Agostino and Pearson test for normality. For toxicol- SEM, neb = 0.92±0.49 SEM, neb =1.0±0.49 SEM; −/− ogy analyses on wildtype fish, normal data (Additional Fig. 1e), in distance travelled at 6 dpf (neb =0.16 +/− +/+ file 1: Figures S2, S3, and S4a and b) was analysed by ±0.08 SEM, neb = 0.84±0.17 SEM, neb =1.0±0.17 −/− one-way ANOVA using Dunnett’s correction for mul- SEM; Fig. 1f) and speed at 6 dpf (neb = 0.49±0.10 +/− +/+ tiple comparisons. For data failing the normality test SEM, neb = 0.94±0.19 SEM, neb =1.0±0.14 SEM; (Additional file 1: Figure S4C), the test was repeated Fig. 1g) compared to wildtype siblings. Interestingly, −/− after the data was logtransformed which did not result we observe that neb mutants fail to inflate their in a normal distribution of data. Therefore, data from swim bladder by 4 dpf (Fig. 1a&d), another indicator the three replicates was pooled and a Kruskal-Wallis test of impaired muscle function. Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 4 of 10 −/− Fig. 1 Characterization of the neb (sa906) mutant zebrafish strain. a & b) At 4 dpf neb zebrafish (aii) appear smaller in size and (bii) display a −/− loss of birefringence compared to their wildtype siblings (ai & bi). c) RT-PCR analysis in and neb mutant embryos at 2 dpf shows a reduction in −/− neb mRNA levels compared to wildtype siblings (sibling). βAct was used as a positive control. d) ii) neb mutants display a smaller eye, brain region (B) and deflated swim bladder (SB) compared to their i) wildtype siblings. e) Quantification of the maximum acceleration recorded from −/− touch-evoked response assays of neb fish compared to wildtype siblings at 2 dpf. Error bars represent mean±SEM for three independent −/− +/− +/+ experiments (n = 11,9,12 neb , 55,25,32 neb , 18,13,12 neb zebrafish per experiment), **p < 0.01. f & g) Quantification of the normalized (f) −/− distance and (g) speed travelled by neb mutants compared to wildtype siblings at 6 dpf. For f) error bars represent median±interquartile range −/− +/− +/+ for three independent experiments (for n = 19,23,19 neb , 41,42,36 neb , 31,20,21 neb zebrafish). For g) error bars represent mean±SEM −/− +/− +/+ range (for n = 19,23,14 neb , 41,42,36 neb , 30,20,21 neb zebrafish per experiment). *p < 0.5, **** p < 0.001 −/− neb mutants display nemaline bodies and actin disorganization, which have been observed in both pa- accumulation tient muscle biopsies [21, 30] and mice models carrying NEB nemaline myopathy is characterized by the pres- mutations in Neb [3, 29]. To test whether these are −/− ence of electron-dense nemaline bodies and myofibrillar present in neb zebrafish, we first stained sections of Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 5 of 10 −/− −/− Fig. 2 Characterisation of skeletal muscle pathology in neb fish. a Gomori trichome staining of neb skeletal muscle sections reveal the +/+ presence of dark regions (arrows) throughout the muscle indicative of nemaline bodies not observed in neb fish. Nuclei (arrowhead) are evenly +/+ −/− organized in neb , however, appear disorganized in neb fish. b Quantification of normalized fiber area from Gomori trichome stained −/− +/+ −/− sections in neb (n = 23 fibers) compared to neb fish (n = 21 fibers). Error bars represent mean±SD, *** p < 0.001. c neb mutants exhibit F- actin (red) and Actinin2 (green) positive aggregates at the myosepta (arrowheads) (and zoomed inset) compared to wildtype siblings at 2 dpf −/− skeletal muscle at 6 dpf with Gomori trichome. We ob- siblings, Tg(neb ; Lifeact-eGFP) zebrafish show an ac- served large darkly stained patches throughout the cumulation of actin at the myosepta from 2 dpf and by 6 muscle fibers, indicative of nemaline bodies which were dpf, exhibit broken fibers greatly disrupting skeletal +/+ not present in stained sections from neb siblings muscle structure (Additional file 1: Figure S1). −/− (Fig. 2a). We also determined that neb fish have a much smaller skeletal muscle fiber cross-sectional area Evaluation of nemaline myopathy treatments on neb +/+ than neb siblings, reflecting a severe reduction in the mutants −/− +/+ −/− diameter of muscle fibers (neb = 0.73±0.20 SD, neb We have established that the neb mutant zebrafish = 1.0±0.29 SD) (Fig. 2b). We performed electron micros- closely mimics nemaline myopathy phenotypes observed copy to analyze the muscle ultrastructure. As shown in in patients validating its use as a NEB nemaline myop- Fig. 3a, we observed thickened Z-disks (Fig. 3ai) and an athy model. We next wanted to use the model to deter- accumulation of electron dense nemaline bodies (Fig. mine the efficacy of a number of suggested treatments −/− 3aiii) in neb zebrafish at 6 dpf which were not present which are currently self-administered by patients to im- −/− in wildtype siblings (Fig. 3b). neb mutant fibers also prove skeletal muscle function. We selected four treat- appeared disorganized and in many cases, there was a ments (L-tyrosine, L-carnitine, creatine, and taurine) complete loss of structure with remnants of sarcomeric based on anecdotal reports from the nemaline myopathy material (Fig. 3aii, aiv), suggesting a complete loss of patient support website (http://www.nemaline.org/re- muscle integrity. sources/drugs.html) and published studies on nemaline We have previously shown that knockdown of Neb myopathy patients and mice models [15, 33]. using two different antisense morpholinos produced Given that none of these compounds have been previ- Actinin2 and F-actin positive aggregates in the skeletal ously tested in zebrafish, we first determined a maximal muscle [38]. We performed antibody staining for Acti- dose to investigate therapeutic potential without affect- nin2 and F-actin and observed Actinin2 and F-actin ing the health and viability of the fish. We chose six positive aggregates along the vertical myosepta and scat- doses ranging from 0.1 μM to 10 mM, dissolved in water −/− tered throughout neb skeletal muscle fibers at 2 dpf, and added these to zebrafish embryo medium. For con- similar to those identified in Neb morphants [38], which trol treatments, we added the equivalent volume of +/+ are not present in neb siblings (Fig. 2c). These actin water, which was used as the vehicle, to the zebrafish accumulations do not result from broken fibers since the embryo medium instead of the compound. For each of fibers in the same cell are intact (Fig. 2c inset). We also the treatments, we recorded the survival from 24 hpf to crossed our neb mutant strain to the Tg(Lifeact-eGFP) 6 dpf as well as the resting heart rate of the embryos at transgenic line, which labels actin in all of the thin fila- 2 dpf. We also quantified the swimming performance at ments within the skeletal muscle. Unlike their wildtype 6 dpf and, combined with the survival and heart rate Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 6 of 10 −/− −/− Fig. 3 Examination of neb skeletal muscle by electron microscopy. a) neb mutant skeletal muscles display (i, iv) thickened Z-disks (arrows), +/+ (ii) fiber breakage (asterisks), (iii) accumulations of nemaline bodies and (iv) disruption of sarcomeric structures that are not observed in b) neb wildtype siblings −/− results, determined that a L-tyrosine and L-carnitine by neb mutants treated with the chemical supple- −/− concentration of 10 μM (for L-tyrosine: [23], for ments compared to water treated neb fish (Fig. 4). −/− L-carnitine: Additional file 1: Figure S3), a taurine con- To assess pathology in treated neb zebrafish as well centration of 1 mM (Additional file 1: Figure S2), and a as their wildtype siblings, we categorized the phenotypic creatine concentration of 100 μM(Additional file 1: severity of the skeletal muscle as wildtype, mild (less Figure S4) are the maximal non-toxic doses for treatment. than five aggregates at the myosepta) and severe (fiber To determine whether any of the treatments improved breakage and more than five aggregates at the myosepta skeletal muscle function or pathology we quantified both and throughout the muscle fibers; Fig. 5a) and then ge- the locomotion and phenotypic severity of the skeletal notyped the scored the embryos. We found no signifi- muscle in the treated NEB nemaline model fish at 6 dpf. cant difference in the severity of the skeletal muscle −/− We observed a significant decrease in swimming per- phenotype of neb mutants, nor for their wildtype sib- −/− formance for neb mutants compared to their wildtype lings for all treatments tested (Fig. 5b+c), showing these +/+ +/− siblings (neb and neb ) (Additional file 1: Figure S5 therapies do not improve skeletal muscle function in our and S6). However, for all chemicals tested there was no nemaline myopathy model. There was also no obvious significant difference in the distance or speed travelled difference in the appearance of facial muscles between −/− −/− Fig. 4 Quantification of muscle function in neb mutants at 6 dpf. Quantification of the a) normalized distance and b) speed travelled by neb mutants at 6 dpf supplemented with either L-tyrosine, taurine, L-carnitine, creatine, or water (H O). Error bars represent median±interquartile −/− −/− −/− range for three independent experiments (for a; n = 81,79,51 neb for L-tyrosine; n = 82,89,59 neb for taurine; n = 82,82,42 neb for L- −/− −/− −/− −/− carnitine; n = 87,79,46 neb for creatine, and n = 87,96,42 neb for water and for b; n = 81,79,51 neb for L-tyrosine; n = 82,89,59 neb for −/− −/− −/− taurine; n = 82,82,42 neb for L-carnitine; n = 92,79,46 neb for creatine, and n = 87,96,42 neb for water per experiment). ns = not significant Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 7 of 10 −/− −/− Fig. 5 Quantification of the phenotypic severity of neb mutants at 6 dpf. Quantification of the phenotypic severity of Tg(neb ; Lifeact-eGFP) fish at 6 dpf supplemented with either L-tyrosine, taurine, L-carnitine, creatine, or water (H O). a Phenotypes were scored as either wildtype, mild (less than five Lifeact-eGFP positive aggregates at the myosepta or a mild disruption of muscle fibres), or severe (severely disorganised fibres or −/ an accumulation of five or more Lifeact-eGFP positive aggregates within the muscle cell). b Quantification of the phenotypic severity of Tg(neb − −/− ; Lifeact-eGFP) fish supplemented with either L-tyrosine, taurine, or water. c Quantification of the phenotypic severity of Tg(neb ; Lifeact-eGFP) fish supplemented with either L-carnitine, creatine, or water (H O). b & c Error bars represent mean±SEM for three independent experiments. For −/− −/− −/− b) n = 6,8,7 Tg(neb ; Lifeact-eGFP) for L-tyrosine, n = 11,5,11 Tg(neb ; Lifeact-eGFP) for taurine and n = 9,8,10 Tg(neb ; Lifeact-eGFP) for water. −/− −/− −/− For c) n = 8,10,4 Tg(neb ; Lifeact-eGFP) for L-carnitine, n = 6,8,3 Tg(neb ; Lifeact-eGFP) for creatine, and n = 10,9,5 Tg(neb ; Lifeact-eGFP) for water per experiment). ns = not significant +/+ −/− neb siblings and neb mutants. (Additional file 1: of muscle in Gomori trichome stained sections corre- Figure S8). sponding to nemaline bodies. Electron microscopy re- vealed the presence of electron dense nemaline bodies Discussion and thickened Z-disks consistent with those observed in At present, there is no effective therapy for nemaline patient biopsies [10, 21] which are not present in the myopathies with limited research into treatments in vivo previously published zebrafish neb mutant [39]. These using animal systems. For individuals surviving through pathological defects lead to a disruption in fiber integ- childhood, nemaline myopathy is a chronic condition re- rity, indicated by the absence of sarcomeric structures quiring continued therapy throughout life to manage by EM and loss of birefringence, resulting in reduced symptoms. Our main goal is to develop zebrafish nema- skeletal muscle function. −/− line myopathy models to find effective treatments that Akin to Neb KO mice models [3], neb mutant zeb- can improve skeletal muscle function. rafish are indistinguishable from their wildtype siblings Here, we have characterized and validated a new NEB prior to 2 dpf, however, as development proceeds their nemaline myopathy model containing a mutation within growth is reduced. The reduced growth in Neb KO and ΔExon55 the super repeat region of the nebulin protein [9], caus- Neb mice [20, 29] results from a significant re- ing nonsense mediating decay of the resulting transcript. duction in thin filament length and fiber cross sectional Unlike the previously published model containing a mis- area leading to a reduction in maximal force generating sense mutation in the super repeat region, also predicted capacity [3, 20, 29] causing muscle weakness [30]. Simi- −/− to cause a loss of nebulin protein function, we show that larly, sectioning of neb zebrafish larvae at 6 dpf −/− neb zebrafish mutants display darkly stained patches revealed significantly smaller fiber cross-sectional area Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 8 of 10 compared to wildtype siblings, indicating a reduction in screens and find an effective treatment for nemaline −/− fiber size. Both our Neb morphant model [38]and neb myopathy. genetic mutants show an accumulation of actin at the myosepta suggesting that this may be an important patho- Additional file logical hallmark of nemaline myopathy. Thus, it is likely Additional file 1: Supplementary data for Testing of therapies in a that the depletion of actin from the sarcomere, in addition novel nebulin nemaline myopathy model demonstrates and lack of to the loss of nebulin from the thin filament, may contrib- efficacy. Figure S1: Characterisation of Tg(neb-/-; Lifeact-eGFP) fish. ute to the reduction in myofiber size and the observed Figure S2-S4: Toxicity analyses for treatment of wildtype zebrafish with taurine, L-carnitine and creatine. Figure S5-S6: Quantification of muscle weakness. distance travelled and average speed at 6 dpf. Figure S7: Quantification We evaluated a number of existing treatments for of the phenotypic severity at 6 dpf. Figure S8: Characterisation of facial nemaline myopathy by quantifying their ability to reduce muscles at 6 dpf. (PDF 7847 kb) actin aggregation or improve skeletal muscle perform- −/− ance in our neb zebrafish. Of the four treatments we Acknowledgements H40Y We would like to thank Dr. Angela Finch (UNSW) for her advice. examined, L-tyrosine has been tested in ACTA1 mouse models [26] and in a limited patient study [15, Funding 33] however no firm conclusions had been made as to The work was supported by an Australian National Health and Medical its effectiveness to increase skeletal muscle function. Research Council (NHMRC) Project Grant (APP1010110). TS is supported by −/− an MDA Development Grant (APP381325) and an AFM Postdoctoral Our results suggest that L-tyrosine treatment of neb Fellowship (APP19853). D286G mutant zebrafish, as reported for ACTA1 zebrafish and mouse models [23], does not improve skeletal Availability of data and materials The data is made available on Figshare using the following https://figshare.com/ muscle performance. It is noted that L-tyrosine treat- projects/Testing_of_therapies_in_a_novel_nebulin_nemaline_myopathy_ ment may be beneficial to increase weight gain, appetite, model_demonstrate_a_lack_of_efficacy/26497. and reduce pharyngeal secretions in nemaline myopathy Authors’ contributions patients [15, 33], however, this was not examined in the TES conceptualized, performed and analyzed the data as well as wrote, current study. We did however, examine the facial reviewed and edited the manuscript. EAM assisted with the neb Zebrabox −/− muscle structure in neb zebrafish, and observed no screen and the Gomori trichome staining, as well as reviewed the manuscript. CW assisted with the neb Zebrabox screen and reviewed the difference in appearance compared to their wild type manuscript. VO and GR performed the electron microscopy and edited the siblings preventing an assessment of the effect of treat- manuscript. RBR conceptualized the methodology, wrote, reviewed and ments on facial musculature. edited the manuscript as well as supervised the project. TES and RBR −/− obtained funding for the research. All authors read and approved the final We also treated neb mutants with either taurine, manuscript. creatine, or L-carnitine, which are all naturally occurring compounds, present in many tissues including skeletal Ethics approval muscle, and are involved in modulating ion channel Fish maintenance and handling was carried out as per the standard operating procedures approved by the Monash Animal Services Animal function, membrane stability, calcium homeostasis and Ethics Committee under breeding colony license MARP/2015/004/BC. Fish energy metabolism [6, 7, 12, 13, 17, 22, 25, 42]. Taurine were anaesthetized using Tricaine methanesulfonate. has been previously shown to improve muscle strength Competing interests and reduce inflammation in mdx mice [40, 41] and in an The authors declare that they have no competing interests. analysis of six clinical trials for muscular dystrophy, 192 participants reported an increase in muscle strength Publisher’sNote when treated with creatine compared to the placebo Springer Nature remains neutral with regard to jurisdictional claims in group [16]. Unfortunately, chemical supplementation of published maps and institutional affiliations. −/− neb mutants with creatine, L-carnitine, or taurine also Author details failed to restore skeletal muscle function or improve School of Biological Sciences, Monash University, Melbourne, Australia. skeletal muscle pathology. Interestingly, of the four com- Monash Ramaciotti Centre for Cryo Electron Microscopy, Monash University, Melbourne, VIC 3800, Australia. Department of Biochemistry and Molecular pounds tested, taurine showed the least toxicity at high Biology, Monash University, Melbourne, Australia. Biomedicine Discovery concentrations, which is in line with previous reports Institute, Monash University, Melbourne, Australia. from clinical trials [36]. However, toxic effects observed Received: 11 May 2018 Accepted: 12 May 2018 in wildtype zebrafish treated with high doses of creatine, and L-carnitine suggest caution when administering high doses to patients. Importantly, our study has highlighted References the inadequacies of existing nemaline myopathy treat- 1. Agrawal PB, Greenleaf RS, Tomczak KK, Lehtokari V-L, Wallgren-Pettersson C, Wallefeld W, Laing NG, Darras BT, Maciver SK, Dormitzer PR, Beggs AH ments. Nevertheless, the zebrafish NEB nemaline myop- (2006) Nemaline myopathy with minicores caused by mutation of the CFL2 athy model we have characterized provides an excellent gene encoding the skeletal muscle actin-binding protein, cofilin-2. Am J system in which to perform high-throughput chemical Hum Genet 80:162–167. https://doi.org/10.1086/510402 Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 9 of 10 2. Agrawal PB, Strickland CD, Midgett C, Morales A, Newburger DE, Poulos MA, nebulin-related nemaline myopathy: ultrastrastructural findings correlated to Tomczak KK, Ryan MM, Iannaccone ST, Crawford TO, Laing NG, Beggs AH disease severity and genotype. Acta Neuropathol Commun 2:44. https://doi. (2004) Heterogeneity of nemaline myopathy cases with skeletal muscle α-actin org/10.1016/j.spen.2011.10.006 gene mutations. Ann Neurol 56:86–96. doi: https://doi.org/10.1002/ana.20157 22. McGarry JD, Brown NF (1997) The mitochondrial carnitine palmitoyltransferase 3. Bang M-L, Li X, Littlefield R, Bremner S, Thor A, Knowlton KU, Lieber RL, system. From concept to molecular analysis. Eur J Biochem 244:1–14 Chen J (2006) Nebulin-deficient mice exhibit shorter thin filament lengths 23. Messineo AM, Gineste C, Sztal TE, McNamara EL, Vilmen C, Ogier AC, Hahne and reduced contractile function in skeletal muscle. J Muscle Res Cell Motil D, Bendahan D, Laing NG, Bryson-Richardson RJ, Gondin J, Nowak KJ (2017) 173:905–916. https://doi.org/10.1083/jcb.200603119 L-tyrosine supplementation is not therapeutic for skeletal muscle 4. Berger J, Hall TE, Currie PD (2015) Novel transgenic lines to label dysfunction in zebrafish and mouse models of dominant skeletal muscle α- sarcolemma and myofibrils of the musculature. Zebrafish 12:124–125. actin nemaline myopathy. bioRxiv. https://doi.org/10.1101/218016 https://doi.org/10.1089/zeb.2014.1065 24. Miyatake S, Mitsuhashi S, Hayashi YK, Purevjav E, Nishikawa A, Koshimizu E, 5. Daubner SC, Le T, Wang S (2011) Tyrosine hydroxylase and regulation of Suzuki M, Yatabe K, Tanaka Y, Ogata K, Kuru S, Shiina M, Tsurusaki Y, dopamine synthesis. Arch Biochem Biophys 508:1–12. https://doi.org/10. Nakashima M, Mizuguchi T, Miyake N, Saitsu H, Ogata K, Kawai M, Towbin J, 1016/j.abb.2010.12.017 Nonaka I, Nishino I, Matsumoto N (2017) Biallelic mutations in MYPN, 6. De Luca A, Pierno S, Camerino DC (2015) Taurine: the appeal of a safe encoding Myopalladin, are associated with childhood-Onset,Slowly amino acid for skeletal muscle disorders. J Transl Med:1–18. https://doi.org/ progressive Nemaline myopathy. Am J Hum Genet 100:169–178. https://doi. 10.1186/s12967-015-0610-1 org/10.1016/j.ajhg.2016.11.017 7. De Luca A, Pierno S, Huxtable RJ, Falli P, Franconi F, Giotti A, Camerino DC 25. Montesano A, Senesi P, Luzi L, Benedini S, Terruzzi I (2015) Research ArticlePotential therapeutic role of L-carnitine in skeletal muscle oxidative (1992) Effects of taurine depletion on membrane electrical properties of rat skeletal muscle. Adv Exp Med Biol 315:199–205 stress and atrophy conditions. Oxidative Med Cell Longev:1–13. https://doi. org/10.1155/2015/646171 8. Donner K, Ollikainen M, Ridanpää M, Christen H-J, Goebel HH, de Visser M, 26. Nguyen MAT, Joya JE, Kee AJ, Domazetovska A, Yang N, Hook JW, Lemckert Pelin K, Wallgren-Pettersson C (2001) Mutations in the β-tropomyosin (TPM2) gene – a rare cause of nemaline myopathy. Neuromuscul Disord 12:151– FA, Kettle E, Valova VA, Robinson PJ, North KN, Gunning PW, Mitchell CA, Hardeman EC (2011) Hypertrophy and dietary tyrosine ameliorate the 158. doi: https://doi.org/10.1016/S0960-8966(01)00252-8 phenotypes of a mouse model of severe nemaline myopathy. Brain 134: 9. Donner K, Sandbacka M, Lehtokari V-L, Wallgren-Pettersson C, Pelin K (2004) 3516–3529. https://doi.org/10.1093/brain/awr274 Complete genomic structure of the human nebulin gene and identification of alternatively spliced transcripts. Eur J Hum Genet 12:744–751. https://doi. 27. Nowak KJK, Wattanasirichaigoon DD, Goebel HHH, Wilce MM, Pelin KK, Donner org/10.1038/sj.ejhg.5201242 KK, Jacob RLR, Hübner CC, Oexle KK, Anderson JRJ, Verity CMC, North KNK, 10. Gajda A, Horvath E, Hortobagyi T, Gergev G, Szabo H, Farkas K, Nagy N, Szell Iannaccone STS, Müller CRC, Nürnberg PP, Muntoni FF, Sewry CC, Hughes II, M, Sztriha L (2013) Nemaline myopathy type 2 (NEM2): two novel mutations Sutphen RR, Lacson AGA, Swoboda KJK, Vigneron JJ, Wallgren-Pettersson CC, in the Nebulin (NEB) gene. J Child Neurol. https://doi.org/10.1177/ Beggs AHA, Laing NGN (1999) Mutations in the skeletal muscle alpha-actin 0883073813494476 gene in patients with actin myopathy and nemaline myopathy. Nat Genet 23: 208–212. https://doi.org/10.1038/13837 11. Gupta VA, Ravenscroft G, Shaheen R, Todd EJ, Swanson LC, Shiina M, Ogata 28. Ottenheijm CAC, Granzier H (2010) New insights into the structural roles of K, Hsu C, Clarke NF, Darras BT, Farrar MA, Hashem A, Manton ND, Muntoni F, Nebulin in skeletal muscle. J Biomed Biotechnol 2010:1–6. https://doi.org/10. North KN, Sandaradura SA, Nishino I, Hayashi YK, Sewry CA, Thompson EM, 1091/mbc.E07-07-0690 Yau KS, Brownstein CA, Yu TW, Allcock RJN, Davis MR, Wallgren-Pettersson C, Matsumoto N, Alkuraya FS, Laing NG, Beggs AH (2013) Identification of 29. Ottenheijm CAC, Buck D, de Winter JM, Ferrara C, Piroddi N, Tesi C, Jasper KLHL41 mutations implicates BTB-Kelch-mediated ubiquitination as an JR, Malik FI, Meng H, Stienen GJM, Beggs AH, Labeit S, Poggesi C, Lawlor alternate pathway to Myofibrillar disruption in Nemaline myopathy. Am J MW, Granzier H (2013) Deleting exon 55 from the nebulin gene induces Hum Genet 93:1108–1117. https://doi.org/10.1016/j.ajhg.2013.10.020 severe muscle weakness in a mouse model for nemaline myopathy. Brain 12. Huxtable RJ (1992) Physiological actions of taurine. Physiol Rev 72:101–163 136:1718–1731. https://doi.org/10.1093/brain/awt113 13. J Jang J, Park J, Chang H, Lim K (2016) L-carnitine supplement reduces skeletal 30. Ottenheijm CAC, Witt CC, Stienen GJ, Labeit S, Beggs AH, Granzier H (2009) muscle atrophy induced by prolonged hindlimb suspension in rats. Appl Thin filament length dysregulation contributes to muscle weakness in Physiol Nutr Metab 41:1240–1247. doi: https://doi.org/10.1139/apnm-2016-0094 nemaline myopathy patients with nebulin deficiency. Hum Mol Gen 18: 14. Johnston JJ, Kelley RI, Crawford TO, Morton DH, Agarwala R, Koch T, 2359–2369. https://doi.org/10.1093/hmg/ddp168 Schäffer AA, Francomano CA, Biesecker LG (2000) A novel nemaline 31. Pelin KK, Hilpelä PP, Donner KK, Sewry CC, Akkari PAP, Wilton SDS, myopathy in the Amish caused by a mutation in troponin T1. Am J Hum Wattanasirichaigoon DD, Bang MLM, Centner TT, Hanefeld FF, Odent SS, Genet 67:814–821. https://doi.org/10.1086/303089 Fardeau MM, Urtizberea JAJ, Muntoni FF, Dubowitz VV, Beggs AHA, Laing NGN, 15. Kalita D (1989) A new treatment for congenital nonprogressive nemaline Labeit SS, la Chapelle de AA, Wallgren-Pettersson CC (1999) Mutations in the myopathy. J Orthomol Med nebulin gene associated with autosomal recessive nemaline myopathy. Proc 16. Kley RA, Tarnopolsky MA, Vorgerd M (1996) Creatine for treating muscle Natl Acad Sci U S A 96:2305–2310. https://doi.org/10.2307/47056 disorders. https://doi.org/10.1002/14651858.CD004760.pub4 32. Ravenscroft G, Miyatake S, Lehtokari V-L, Todd EJ, Vornanen P, Yau KS, 17. Koons S, Cooke R (1986) Function of creatine kinase localization in muscle Hayashi YK, Miyake N, Tsurusaki Y, Doi H, Saitsu H, Osaka H, Yamashita Adv Exp Med Biol 194:129–137 S, Ohya T, Sakamoto Y, Koshimizu E, Imamura S, Yamashita M, Ogata K, contraction. Shiina M, Bryson-Richardson RJ, Vaz R, Ceyhan O, Brownstein CA, 18. Laing NG, Wilton SD, Akkari PA, Dorosz S, Boundy K, Kneebone C, Swanson LC, Monnot S, Romero NB, Amthor H, Kresoje N, Sivadorai P, Blumbergs P, White S, Watkins H, Love DR (1995) A mutation in the alpha Kiraly-Borri C, Haliloglu G, Talim B, Orhan D, Kale G, Charles AK, Fabian tropomyosin gene TPM3 associated with autosomal dominant nemaline VA, Davis MR, Lammens M, Sewry CA, Manzur A, Muntoni F, Clarke NF, myopathy NEM1. Nat Genet 10:249–249. https://doi.org/10.1038/ng0695-249 North KN, Bertini E, Nevo Y, Willichowski E, Silberg IE, Topaloglu H, 19. Lehtokari V-L, Greenleaf RS, DeChene ET, Kellinsalmi M, Pelin K, Laing NG, Beggs AH, Allcock RJN, Nishino I, Wallgren-Pettersson C, Matsumoto N, Beggs AH, Wallgren-Pettersson C (2009) The exon 55 deletion in the nebulin Laing NG (2013) Mutations in KLHL40 are a frequent cause of severe gene–one single founder mutation with world-wide occurrence. autosomal-recessive nemaline myopathy. Am J Hum Genet 93:6–18. Neuromuscul Disord 19:179–181. https://doi.org/10.1016/j.nmd.2008.12.001 https://doi.org/10.1016/j.ajhg.2013.05.004 20. Li F, Buck D, De Winter J, Kolb J, Meng H, Birch C, Slater R, Escobar YN, Smith JE III, Yang L, Konhilas J, Lawlor MW, Ottenheijm C, Granzier HL (2015) Nebulin 33. Ryan MM, Sy C, Rudge S, Ellaway C, Ketteridge D, Roddick LG, Iannaccone deficiency in adult muscle causes sarcomere defects and muscle-type- ST, Kornberg AJ, North KN (2007) Dietary L-tyrosine supplementation in dependent changes in trophicity: novel insights in nemaline myopathy. Hum Nemaline myopathy. J Child Neurol 23:609–613. https://doi.org/10.1177/ Mol Genet 24:5219–5233. https://doi.org/10.1093/hmg/ddv243 0883073807309794 21. Malfatti E, Lehtokari V-L, Böhm J, De Winter JM, Schäffer U, Estournet B, 34. Sambuughin N, Swietnicki W, Techtmann S, Matrosova V, Wallace T, Quijano-Roy S, Monges S, Lubieniecki F, Bellance R, Viou M, Madelaine A, Goldfarb L, Maynard E (2012) KBTBD13 interacts with Cullin 3 to form a Wu B, Taratuto A, Eymard B, Pelin K, Fardeau M, Ottenheijm CA, Wallgren- functional ubiquitin ligase. Biochem Biophys Res Commun:1–7. https://doi. Pettersson C, Laporte J, Romero NB (2014) Muscle histopathology in org/10.1016/j.bbrc.2012.04.074 Sztal et al. Acta Neuropathologica Communications (2018) 6:40 Page 10 of 10 35. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–682. https://doi. org/10.1038/nmeth.2019 36. Shao A, Hathcock JN (2008) Risk assessment for the amino acids taurine, L-glutamine and L-arginine. Regul Toxicol Pharmacol 50:376–399. https://doi.org/10.1016/j.yrtph.2008.01.004 37. Sztal TE, Ruparelia AA, Williams C, Bryson-Richardson RJ (2016) Using Touch- evoked Response and Locomotion Assays to Assess Muscle Performance and Function in Zebrafish. J Vis Exp 116:e54431. 38. Sztal TE, Zhao M, Williams C, Oorschot V, Parslow AC, Giousoh A, Yuen M, Hall TE, Costin A, Ramm G, Bird PI, Busch-Nentwich EM, Stemple DL, Currie PD, Cooper ST, Laing NG, Nowak KJ, Bryson-Richardson RJ (2015) Zebrafish models for nemaline myopathy reveal a spectrum of nemaline bodies contributing to reduced muscle function. Acta Neuropathol 130:389–406. https://doi.org/10.1007/s00401-015-1430-3 39. Telfer WR, Nelson DD, Waugh T, Brooks SV, Dowling JJ (2012) Neb: a zebrafish model of nemaline myopathy due to nebulin mutation. Dev Biol 5: 389–396. https://doi.org/10.1242/dmm.008631 40. Terrill JR, Grounds MD, Arthur PG (2015) Taurine deficiency, synthesis and transport in the mdx mouse model for Duchenne muscular dystrophy. Int J Biochem Cell Biol 66:141–148. https://doi.org/10.1016/j.biocel.2015.07.016 41. Terrill JR, Pinniger GJ, Graves JA, Grounds MD, Arthur PG (2016) Increasing taurine intake and taurine synthesis improves skeletal muscle function in the mdx mouse model for Duchenne muscular dystrophy. J Physiol 594: 3095–3110. https://doi.org/10.1113/JP271418 42. Thompson CH, Kemp GJ, Sanderson AL, Dixon RM, Styles P, Taylor DJ, Radda GK (1996) Effect of creatine on aerobic and anaerobic metabolism in skeletal muscle in swimmers. Br J Sports Med 30:222–225 43. Wallgren-Pettersson C, Wallgren-Pettersson C, Sewry CA, Sewry CA, Nowak KJ, Nowak KJ, Laing NG, Laing NG (2011) Nemaline myopathies. YSPEN 18: 230–238. https://doi.org/10.1016/j.spen.2011.10.004 44. Westerfield M (2007) The Zebrafish Book. 45. Yuen M, Sandaradura SA, Dowling JJ, Kostyukova AS, Moroz N, Quinlan KG, Lehtokari V-L, Ravenscroft G, Todd EJ, Ceyhan-Birsoy O, Gokhin DS, Maluenda J, Lek M, Nolent F, Pappas CT, Novak SM, D'Amico A, Malfatti E, Thomas BP, Gabriel SB, Gupta N, Daly MJ, Ilkovski B, Houweling PJ, Davidson AE, Swanson LC, Brownstein CA, Gupta VA, Medne L, Shannon P, Martin N, Bick DP, Flisberg A, Holmberg E, Van den Bergh P, Lapunzina P, Waddell LB, Sloboda DD, Bertini E, Chitayat D, Telfer WR, Laquerrière A, Gregorio CC, Ottenheijm CAC, Bönnemann CG, Pelin K, Beggs AH, Hayashi YK, Romero NB, Laing NG, Nishino I, Wallgren-Pettersson C, Melki J, Fowler VM, MacArthur DG, North KN, Clarke NF (2014) Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy. J Clin Invest 124: 4693–4708. https://doi.org/10.1172/JCI75199

Journal

Acta Neuropathologica CommunicationsSpringer Journals

Published: May 30, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off