Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles

Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different... Short Communications Incorporating Mouse Genome Mammalian Genome 9, 1056–1058 (1998). © Springer-Verlag New York Inc. 1998 Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles Ryo-ichi Tanabe, Susumu Muroya, Koichi Chikuni Meat Science Laboratory, Department of Animal Products, National Institute of Animal Industry, Norin-Kenkyu-Danchi, P.O. Box 5, Tsukuba, Ibaraki, 305-0901, Japan Received: 15 July 1998 / Accepted: 24 August 1998 Table 1. Sequences of the primers used in this study. Myosin is a major structural protein of the thick filament of the sarcomere. It constitutes 40% of myofibrillar protein. Each myosin Name Primer sequences (58 38) molecule consists of two identical heavy chains (MyHC, 220 kDa each) and two pairs of non-identical myosin light chains (20 kDa A MYO1 TCTGAGTTCAGCAGCCATGAGTTCCGACCAGG MYO103 GCTCCAAGAACTGTTTCACTTCCAGGCTGCATCTT each; Warrick and Spudich 1987). There are four major sarcomeric MYO201 CTTTGATTGGGCTGCCATCAATAAACTGCAG MyHC isoforms in adult mammalian skeletal muscle, MyHC-2a, MYO203 CAAGTTCTGACCCACTTCAAGGTTGCATCT -2b, -2x (also referred to as -2d), and ‘‘-slow’’. Each MyHC iso- MYO401 TCTCCCGTGCTCCGTCTTCTTTCCT form is encoded by a distinct gene (Schiaffino and Reggiani 1996). 58PCR TACGGCTGCGAGAAGACGACAGAA Individual muscle fibers are characterized according to their B MYO2 ATCCAGGCTGCGTAACGCTCTTTGAGGTTGTA MyHC content: type II A http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles

Loading next page...
 
/lp/springer_journal/sequencing-of-the-2a-2x-and-slow-isoforms-of-the-bovine-myosin-heavy-qth9KLn3t8
Publisher
Springer-Verlag
Copyright
Copyright © 1998 by Springer-Verlag New York Inc.
Subject
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900924
Publisher site
See Article on Publisher Site

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial