Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles

Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different... Short Communications Incorporating Mouse Genome Mammalian Genome 9, 1056–1058 (1998). © Springer-Verlag New York Inc. 1998 Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles Ryo-ichi Tanabe, Susumu Muroya, Koichi Chikuni Meat Science Laboratory, Department of Animal Products, National Institute of Animal Industry, Norin-Kenkyu-Danchi, P.O. Box 5, Tsukuba, Ibaraki, 305-0901, Japan Received: 15 July 1998 / Accepted: 24 August 1998 Table 1. Sequences of the primers used in this study. Myosin is a major structural protein of the thick filament of the sarcomere. It constitutes 40% of myofibrillar protein. Each myosin Name Primer sequences (58 38) molecule consists of two identical heavy chains (MyHC, 220 kDa each) and two pairs of non-identical myosin light chains (20 kDa A MYO1 TCTGAGTTCAGCAGCCATGAGTTCCGACCAGG MYO103 GCTCCAAGAACTGTTTCACTTCCAGGCTGCATCTT each; Warrick and Spudich 1987). There are four major sarcomeric MYO201 CTTTGATTGGGCTGCCATCAATAAACTGCAG MyHC isoforms in adult mammalian skeletal muscle, MyHC-2a, MYO203 CAAGTTCTGACCCACTTCAAGGTTGCATCT -2b, -2x (also referred to as -2d), and ‘‘-slow’’. Each MyHC iso- MYO401 TCTCCCGTGCTCCGTCTTCTTTCCT form is encoded by a distinct gene (Schiaffino and Reggiani 1996). 58PCR TACGGCTGCGAGAAGACGACAGAA Individual muscle fibers are characterized according to their B MYO2 ATCCAGGCTGCGTAACGCTCTTTGAGGTTGTA MyHC content: type II A http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles

Loading next page...
 
/lp/springer_journal/sequencing-of-the-2a-2x-and-slow-isoforms-of-the-bovine-myosin-heavy-qth9KLn3t8
Publisher
Springer-Verlag
Copyright
Copyright © 1998 by Springer-Verlag New York Inc.
Subject
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900924
Publisher site
See Article on Publisher Site

Abstract

Short Communications Incorporating Mouse Genome Mammalian Genome 9, 1056–1058 (1998). © Springer-Verlag New York Inc. 1998 Sequencing of the 2a, 2x, and slow isoforms of the bovine myosin heavy chain and the different expression among muscles Ryo-ichi Tanabe, Susumu Muroya, Koichi Chikuni Meat Science Laboratory, Department of Animal Products, National Institute of Animal Industry, Norin-Kenkyu-Danchi, P.O. Box 5, Tsukuba, Ibaraki, 305-0901, Japan Received: 15 July 1998 / Accepted: 24 August 1998 Table 1. Sequences of the primers used in this study. Myosin is a major structural protein of the thick filament of the sarcomere. It constitutes 40% of myofibrillar protein. Each myosin Name Primer sequences (58 38) molecule consists of two identical heavy chains (MyHC, 220 kDa each) and two pairs of non-identical myosin light chains (20 kDa A MYO1 TCTGAGTTCAGCAGCCATGAGTTCCGACCAGG MYO103 GCTCCAAGAACTGTTTCACTTCCAGGCTGCATCTT each; Warrick and Spudich 1987). There are four major sarcomeric MYO201 CTTTGATTGGGCTGCCATCAATAAACTGCAG MyHC isoforms in adult mammalian skeletal muscle, MyHC-2a, MYO203 CAAGTTCTGACCCACTTCAAGGTTGCATCT -2b, -2x (also referred to as -2d), and ‘‘-slow’’. Each MyHC iso- MYO401 TCTCCCGTGCTCCGTCTTCTTTCCT form is encoded by a distinct gene (Schiaffino and Reggiani 1996). 58PCR TACGGCTGCGAGAAGACGACAGAA Individual muscle fibers are characterized according to their B MYO2 ATCCAGGCTGCGTAACGCTCTTTGAGGTTGTA MyHC content: type II A

Journal

Mammalian GenomeSpringer Journals

Published: Dec 1, 1998

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off