Sequence Announcements

Sequence Announcements CH-8903 Birmensdorf, Switzerland, phone: +41 1 7392597, fax: +41 1 7392215, E-mail: sperisen@wsl.ch Source of sequence: Norway spruce (Picea abies K.). Trivial name: Norway spruce chloroplast tandem repeat sequence (A) . Description: Chloroplast sequence of a Norway spruce fragment amplified using the primer pair TTCATTGGAAATACACTAGCCC/AAAACCGTACATGAGATTCCC (Pt71936, Mol Ecol 5 (1996) 595–598, Vendramin et al.) which displays a perfect (A/T) mi- crosatellite. Mononucleotide microsatellites are frequent in chloroplast genome of conifers. The sequence shows high sequence similarity with ORF 169 intron 1 of trnT gene of Pinus thunbergii chloroplast genome (dbj|D17510|PINCPTRPG). This SSR shows a high degree of length polymorphisms among and within populations of Norway spruce as well as of many other species of the genera Pinus and Abies (Genome 40 (1997) 857–864, Vendramin and Ziegenhagen). http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Molecular Biology Springer Journals

Sequence Announcements

Loading next page...
 
/lp/springer_journal/sequence-announcements-gIXnjGWHD0
Publisher
Kluwer Academic Publishers
Copyright
Copyright © 1998 by Kluwer Academic Publishers
Subject
Life Sciences; Biochemistry, general; Plant Sciences; Plant Pathology
ISSN
0167-4412
eISSN
1573-5028
D.O.I.
10.1023/A:1017156828059
Publisher site
See Article on Publisher Site

Abstract

CH-8903 Birmensdorf, Switzerland, phone: +41 1 7392597, fax: +41 1 7392215, E-mail: sperisen@wsl.ch Source of sequence: Norway spruce (Picea abies K.). Trivial name: Norway spruce chloroplast tandem repeat sequence (A) . Description: Chloroplast sequence of a Norway spruce fragment amplified using the primer pair TTCATTGGAAATACACTAGCCC/AAAACCGTACATGAGATTCCC (Pt71936, Mol Ecol 5 (1996) 595–598, Vendramin et al.) which displays a perfect (A/T) mi- crosatellite. Mononucleotide microsatellites are frequent in chloroplast genome of conifers. The sequence shows high sequence similarity with ORF 169 intron 1 of trnT gene of Pinus thunbergii chloroplast genome (dbj|D17510|PINCPTRPG). This SSR shows a high degree of length polymorphisms among and within populations of Norway spruce as well as of many other species of the genera Pinus and Abies (Genome 40 (1997) 857–864, Vendramin and Ziegenhagen).

Journal

Plant Molecular BiologySpringer Journals

Published: Oct 6, 2004

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from Google Scholar, PubMed
Create lists to organize your research
Export lists, citations
Access to DeepDyve database
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off