Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese soft-shell turtle (Pelodiscus sinensis)

Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese... OPEN Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese soft- Received: 26 January 2018 shell turtle (Pelodiscus sinensis) Accepted: 11 May 2018 Published: xx xx xxxx 1 1,2,3 1 1 1 1 Jun Zhang , Peng Yu , Qinyan Zhou , Xilei Li , Shuquan Ding , Shiping Su , Xiaohua 1 1 1 1 2,3 Zhang , Xiaoli Yang , Weishang Zhou , Quan Wan & Jian-Fang Gui Long non-coding RNAs (lncRNAs) perform distinct functions in various biological processes in mammals, including sex differentiation. However, the roles of lncRNAs in other vertebrates, especially in the Chinese soft-shell turtle (Pelodiscus sinensis), remain to be clarified. In this study, we performed genome-wide analysis of the lncRNA expression profiles in gonad tissues and screened numerous sex-specific lncRNAs in the Chinese soft-shell turtle. Of the 363,310,650 clean reads obtained, 5,994 sequences were typed as lncRNAs, of which 4,463 were novel. A selection of sex-specific lncRNAs (♀ 932, ♂ 449) from female ovaries and male testis were shown to act on target genes in cis and in trans, and most were involved in gonad differentiation based on Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. Furthermore, interactions among the differentially expressed lncRNA-mRNAs and protein coding genes were identified by construction of correlation networks. Overall, our systematic analysis of lncRNA expression profiles in gonad tissues revealed numerous sex-specific lncRNAs in P. sinensis. Thereby, these findings provide new insights into the function of lncRNAs in sex differentiation and highlight a group of candidate lncRNAs for future studies. 1–3 e m Th echanisms underlying sex determination are an important focus of biological research . Most vertebrates are gonochoristic, with sexual morphology determined genetically by different alleles or genes . In single gene systems, sex chromosomes contribute to sex determination, with the XX/XY male and ZZ/ZW female heteroga- metic systems present in the majority of species, although variant systems have been identified in a few species . Sex determination, which results in the formation of testes and ovaries from undie ff rentiated gonads, is generally thought to be genetically controlled but can also be influenced by environmental factors (such as temperature) 5–7 or social variables (e.g. the relative size of an organism in its population) . The sex-determining (SD) genes that control this process are expressed transiently in undifferentiated gonads. The first SD to be discovered in verte- brates was the Sry gene, which is located on the Y-chromosome and initiates testicular differentiation . Other SD 9,10 11 12 13,14 13 15,16 genes or candidates include dmy , amhr2 , amhy , gsdf , sox3 and dmrt1 . LncRNAs have been implicated in many biological processes and function through the regulation of transcrip- 17–20 tional and post-transcriptional gene expression . Accumulating evidence suggests that lncRNAs play a role in 21,22 23 21,24,25 26 sex determination and gonadogenesis , meiosis , gametogenesis , cell die ff rentiation and organogenesis 18,27 and sexual reproduction . Of note, Xist lncRNAs mediates transcriptional silencing of one X-chromosome during female sex determination in mammals . In mice, the lncRNA Dmr has been shown to participate in trans splicing of the Dmrt1 transcript that encodes a protein with an altered carboxyl terminus . Furthermore, a complex network of numerous lncRNAs regulate Sxl expression . All of these observations indicate that lncRNAs play important roles in sex differentiation. Reptiles exhibit an extraordinary variation in the mechanisms of sex determination including temperature-dependent and genetic sex determination (TSD and GSD, respectively) mediated by the male (XY) 1 2 College of Animal Science and Technology, Anhui Agricultural University, Hefei, 230036, China. State Key laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China. University of Chinese Academy of Sciences, Beijing, 100049, China. Jun Zhang and Peng Yu contributed equally to this work. Correspondence and requests for materials should be addressed to Q.W. (email: or J.-F.G. (email: SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 1 31,32 or female (ZW) heterogametic systems . However, the potential roles of lncRNAs in sex differentiation of rep- tiles remain to be elucidated. e C Th hinese soft-shell turtle (P. sinensis) is a member of the turtle family (Reptilia; Testudines) and is an important aquaculture species in southern China. This species has heteromorphic ZW-type 31,33,34 micro-sex chromosomes and, as with most vertebrates, sex determination controls the development of testes or ovaries from the bipotential gonad . Sex differentiation-related genes, such as Dmrt1 , Amh, Sox9, Cyp19a1 and Foxl2 were discovered in Chinese soft-shell turtle. Furthermore, Dmrt1 appeared early male gonads specific expression, which was knockdown in ZZ embryos by RNA interference resulted in male to female sex reversal . Although a series of sex-differentiation-related genes were discovered in Chinese soft-shell turtle, the potential involvement of lncRNAs in sex determination of this species remains to be clarified. Chinese soft-shell turtles have a sex-dependent dimorphic growth pattern, with males exhibiting more rapid growth and larger body size, with a thicker and wider calipash, and lower levels of fat . This pattern of sex-related differences in growth rate is also observed in many species of farmed teleost fish, such as yellow cats fi h, and strat- 36,37 egies for sex control have been used to produce all-male populations . Similar approaches have been investi- gated in turtles. Therefore, a comprehensive understanding of the mechanisms responsible for sex determination in Chinese soft-shell turtles will be of significant benefit for improved aquaculture of this species. Here, we sys- tematically analysed the lncRNA expression profiles in gonad tissues and screened numerous sex-specific lncR - NAs in Chinese soft-shell turtles. This information may provide a better understanding of the sex differentiation processes in Chinese soft-shell turtle and also highlight the functions of lncRNAs in this process in all reptiles. Results Overview of lncRNA sequencing. For genome-wide analysis of lncRNAs of P. sinensis, gonad tissues col- lected at 30 days post-hatching were subjected to RNA-seq using the Illumina HiSeq. 4000 platform. In total, 363,310,650 clean reads were produced and 354,585,240 high quality (HQ) clean reads were obtained by remov- ing low quality reads and reads mapped with rRNA. Between 63.66% and 67.98% of the HQ reads were efficiently mapped against the P. sinensis reference genome (PelSin_1.0, NCBI) in each library, thus validating our RNA- sequencing data (see Supplementary File S1). Identification of lncRNAs and mRNAs. A high stringency filtering process was used to remove low quality lncRNA transcripts (see Supplementary Fig. S1). Of the remaining 5,994 lncRNA transcripts, only 1,531 (25.54%) were previously identified, while 4,463 (74.46%) were novel. In contrast, the Illumina RNA-seq analysis produced a much higher number of mRNAs (39,262), comprising 27,429 known transcripts and 11,833 novel transcripts (Fig. 1A). The mean length of lncRNAs in our dataset was 1,717 bp and the mean mRNA length was 3,555 bp (Fig. 1B). Furthermore, the lncRNAs contained fewer exons than the mRNAs (Fig. 1C). Sex-specific expression of lncRNAs and mRNAs. Analysis of sex-specic fi gene expression revealed 932 lncRNAs expressed specifically in the female gonad tissues and 449 in the male samples (Fig.  2A). We also identi- fied 3,383 mRNAs expressed specifically in female gonad tissues and 3,272 in male gonad tissues (Fig.  2B). These lncRNAs and mRNAs may play a pivotal role in P. sinensis gonad formation and provide crucial information regarding the regulation of sex differentiation in this species. Analysis of differentially expressed lncRNAs and mRNAs. e RN Th A-seq data were analysed to fur - ther clarify the differential expression of transcripts in female and male gonad tissues. A total of 1,369 lncRNA transcripts were differentially expressed in male tissues compared with the levels detected in female tissues. Of these, 278 were up-regulated and 1,091 were down-regulated (fold change ≥2.0 and FDR <0.05; Fig. 3A). Volcano plots also revealed a similar trend (Fig. 3B). Of these, the 15 sex differentiation-related lncRNAs showing the most significant differential expression were selected for construction of a heatmap (Fig.  3C). Among the dysregu- lated sex differentiation-related lncRNAs, TCONS_00092301 was the most down-regulated (log2(FC) -5.73649) and TCONS_00068006 was the most up-regulated (log2(FC) 3.760947) (details are presented in Supplementary File S2 and S3). In further analysis, we identified 4,374 mRNAs showing significant differential expression in male tissues compared with the levels detected in female tissues (1,907 up-regulated and 2,467 down-regulated (Fig. 3D and Supplementary File S2). A similar differential expression trend of mRNAs was observed in the volcano plot (fold change ≥2.0, FDR <0.05) (Fig. 3E). Of these, the 15 sex differentiation-related mRNAs showing the most significant differential expression were selected for construction of a heatmap (Fig.  3F). Among the dysregu- lated sex differentiation-related mRNAs, XM_01 4578590.1 was the most up-regulated (log2(FC) -9.5411) and XM_006133089.2 was the most down-regulated log2(FC) 9.41996) (see Supplementary File S4). Putative target genes of lncRNAs. LncRNAs regulate target gene expression by acting in cis on neigh- bouring loci or in trans on distant loci . To investigate the effects of differences in lncRNAs on the functional regulation of turtle sex differentiation, we predicted the target genes of lncRNA using the cis and trans model. The cis role of lncRNAs was investigated by screening the protein coding (PC) genes as potential targets in the regions located 10-kb upstream and downstream of all the identified lncRNAs for prediction of their functional roles. In total, 933 lncRNAs were predicted to correspond with 1,179 target genes in cis and 5,990 lncRNAs were predicted to correspond with 6,609 target genes in trans (see Supplementary File S5 and S6). Interestingly, many lncRNAs were predicted to target sex differentiation-related genes; these included TCONS_00099273, TCONS_00068006, TCONS_00088824, TCONS_00019214, and TCONS_00019442, which targeted the PC genes dmrt1, sox9, cyp19a, sox3, and sox8. These findings indicated that the on-set of sexual differentiation is regulated by the lncRNA-target genes. Regarding the trans role of lncRNA, our results indicated that the lncRNA, TCONS_00071083, acted on ZFX in trans (Table 1). Furthermore, KEGG pathway analysis of the top 20 enriched lncRNAs may be acting on target genes that regulate the onset of sex differentiation (Fig.  4 and Supplementary File S7). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 2 Figure 1. Comparison of features of predicted lncRNAs and mRNAs. (A) Expression of lncRNAs and mRNAs. (B) Length distribution of predicted lncRNAs and mRNAs. (C) Exon number distribution of lncRNAs and mRNAs. Figure 2. Analyses of differentially expressed lncRNAs and mRNAs. (A) Venn diagram showing the differentially expressed lncRNAs in female and male gonad tissues. (B) Venn diagram showing the differentially expressed coding transcripts in female and male gonads. Network of lncRNA and mRNA interactions. To identity more important genes related to sex differen- tiation, we constructed a correlation network of the interactions between the die ff rentially expressed lncRNAs and mRNAs (P > 0.99999 in Pearson correlation analysis) based on cis or in trans regulation (Fig. 5). The cor - relation network was constructed from 63 lncRNAs and 185 mRNAs associated with sex die ff rentiation-related dysregulated genes. A review of the network showed that lncRNAs regulated target genes either in cis or in trans. For instance, the PC gene XM_006112508.2 was targeted by lncRNA TCONS_00071083 in cis, while the PC gene XM_014572620.1 was targeted by lncRNA TCONS_00039123 and TCONS_00039122 in trans. Interestingly, the PC gene XM_006139628.2 was regulated by lncRNA TCONS_00002327 and TCONS_00019442 in cis- and trans SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 3 Figure 3. Differentially expressed transcripts in the RNA-seq libraries. (A ) and (D) Numbers of up-regulated (red) and down-regulated transcripts (green). (B) and (E) Volcano plots of differentially expressed transcripts. X-axis represents fold change (log 2) and Y-axis represents P (−log 10). Red points indicate up-regulated (X-axis >0) transcripts; green points indicate down-regulated (X-axis <0) transcripts. (C) and (F) Heatmaps showing 15 sex differentiation-related lncRNAs and mRNAs. The data are depicted as a matrix, in which each row represents one lncRNA (mRNA) and each column represents one group. The relative expression of lncRNA (mRNA) expression is depicted according the colour scale shown on the right. Red represents high relative expression, and blue represents low relative expression; −0.6, −0.4, −0.2, 0 and 0.2, 0.4, and 0.6 are fold changes in the corresponding spectrum. The magnitude of deviation from the median is represented by the colour saturation. simultaneously. Furthermore, the lncRNAs correlated with PC genes adopted multiple pathways, including one lncRNA correlated with one PC gene, one lncRNA correlated with several PC genes and several lncRNA corre- lated with one PC gene. Dmrt1 (XM_006137866.2), gata4 (XM_014569886.1) and cyp19a (XM_006135075.2) have been identified as key sex differentiation-related genes and were shown to be regulated by several lncRNAs actin in cis or in trans in the network. Therefore, the correlation network of lncRNAs and mRNAs indicated that lncRNAs act on PC genes both in cis and in trans in the process of sex die ff rentiation in Chinese so- ft shell turtles. Validation of differentially expressed lncRNAs and mRNAs. The differentially expressed lncRNA transcripts TCONS_00088824 and TCONS_00068006 and the PC genes XM_006135075.2 (Cyp19a) and XM_014576568.1 (Sox9) identified in the RNA-seq data were obtained according to gene expression, the lncRNA and mRNA regulatory network, and gene function to validate their expression patterns in female and male gonad tissues by qRT-PCR. The results confirmed consistent expression patterns of the two lncRNA transcripts and coding transcripts (Fig. 6), suggesting that the process used to identify putative lncRNAs was sufficiently stringent SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 4 Target genes cis trans DMRT1 (XM_006137866.2) TCONS_00099273 CYP19a (XM_006135075.2) TCONS_00088824 TCONS_00057541 TCONS_00039813 TCONS_00056149 TCONS_00005326 TCONS_00037784 TCONS_00015014 GATA4 (XM_014569886.1) TCONS_00023612 TCONS_00004539 TCONS_00092301 TCONS_00086098 TCONS_00029984 TCONS_00058012 SOX3 (XM_006115453.2) TCONS_00019214 SOX8 (XM_006139628.2) TCONS_00019442 SOX9 (XM_014576568.1) TCONS_00068006 HOXD1 (XM_006119463.2) TCONS_00032150 TCONS_00042242 HOXB13 (XM_014572204.1) TCONS_00035891 ZFX (XM_006112508.2) TCONS_00071083 TCONS_00039122 SOX5 (XM_014572620.1) TCONS_00039123 RSPO1 (XM_006134251.2) TCONS_00094168 Table 1. LncRNAs and their potential target genes associated with sex differentiation. Figure 4. Top 20 KEGG pathway annotation categories for target gene functions of predicted lncRNAs. to correlate with most of the identified lncRNAs expressed in vivo . Interestingly, we identified a positive correla- tion between the expression of two lncRNA transcripts with target PC genes. e Th regulatory mechanism of these lncRNA-regulated targets requires further investigation. SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 5 Figure 5. Correlation network of lncRNAs and mRNAs. Green and pink nodes represent dysregulated lncRNAs and dysregulated mRNAs, respectively. Blue and red lines between lncRNAs and mRNAs indicate cis and trans actions, respectively. Yellow lines represent Pearson correlation coefficients >0.99999. Figure 6. Validation of RNA-seq results by quantitative RT-PCR. Two lncRNAs and their target genes were * ** *** analysed by quantitative RT-PCR. Data represent the mean ± 1 SD (n = 3). P < 0.05, P < 0.01, P < 0.001. SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 6 Discussion LncRNAs have a disproportionately large impact on sex determination and sex differentiation processes that have been widely studied in humans and other mammals. Since the Chinese soft-shell turtle exhibits a sex-dependent dimorphic growth pattern , the mechanisms underlying sex determination and sex differentiation in this species are of considerable interest. In this study, we performed genome wide analysis of lncRNAs from early-stage female and male gonads of Chinese soft-shell turtle to explore the sex differentiation-related candidate lncRNAs, thereby clarifying the sex die ff rentiation processes in this species and also providing further elucidation of the functions of lncRNAs in this process in all reptiles. In the present study, our systematic analysis of the RNA expression profiles in gonad tissues using RNA-seq revealed 5,994 putative lncRNA transcripts and 39,262 putative protein coding transcripts. In accordance with similar studies in different organisms, the identified lncRNA transcripts had fewer exons, shorter transcripts, and lower expressions than the identified protein coding transcripts . We also found that the lncRNA transcripts in Chinese soft-shell turtle were longer than that the mean length of those in zebrafish (1,113 nt), goat (1,180 nt), 40–42 43 human (1,000 nt) and mouse (550 nt) , but shorter than those in chicken (2,941 nt) . Furthermore, on aver- age, lncRNA transcripts in Chinese so- ft shell turtle contained fewer exons than those in zebras fi h (2.8), goat (2.2), 40–42 human (2.9) and mouse (3.7) . Validation of two key deferentially expressed lncRNA transcripts by qRT-PCR yielded results were consistent those of the RNA-seq analysis, thus confirming the high quality of the identified lncRNAs. LncRNAs do not encode proteins, which represents a major challenge in determining their function. Gene expression analyses are important in clarifying the potential function of these lncRNAs . In this study, we screened out 932 specific-expression lncRNA transcripts in female gonad tissues and 449 specific-expression lncRNA transcripts in male gonad tissues (Fig. 2A). Furthermore, a large number of lncRNAs were found to be dif- ferentially expressed in female gonad tissues (Fig. 3A). Interestingly, we screened out 15 sex die ff rentiation-related lncRNAs that were significantly different expressed in gonad tissues (Fig.  3C). These results indicated that lncR - NAs may participate in the process of bipotential gonad differentiation into testis or ovary in Chinese soft-shell turtles. LncRNAs have been reported to regulate PC gene expression either in cis or in trans . Cis-acting lncRNAs act regulate the expression of a neighbouring gene on the same allele at the transcriptional or post-transcriptional 46 38 level . Trans-acting lncRNAs regulate the expression of genes that are located on other chromosomes . Thus, in this study, we sought to identify potential regulatory targets of lncRNAs using the cis and trans model, which has 47,48 been employed successfully to identify candidate regulatory targets of lncRNAs in animals and plants . Using this strategy, we identified 933 cis-acting lncRNAs corresponding to 1,179 target and 5,990 trans-acting lncRNAs corresponding to 6,609 target genes. As previous shown in previous research, the functions of lncRNAs were mediated by their action on the PC genes. The Xist lncRNA interacts directly with SHARP to silence transcription of one X-chromosome during development in female mammals . The lncRNA Dmr functions in trans splicing 29 30 the Dmrt1 transcript . Sxl expression is regulated by a complex interaction network involving many lncRNAs . In this study, we identified numerous lncRNAs associated with regulation of sex differentiation-related genes, including dmrt1, sox9, cyp19a, sox3 and sox8, indicating that the initiation of sexual differentiation is regulated by the interaction between lncRNA and target genes. Most notably, we discovered a positive correlation between the expression of lncRNAs TCONS_00088824 and TCONS_00068006 and their respective target PC genes XM_006135075.2 (Cyp19a) and XM_014576568.1 (Sox9) (Fig. 6). This correlation may be the result of common regulation of local chromatin and further investigations are required to confirm the existence of authentic rela- tionships between an lncRNA and its neighbouring targets in the regulation of sex differentiation in the Chinese soft-shell turtle. LncRNA-mRNA correlation network analysis was performed to identify the most important sex differentiation-related genes as previously described . Our analysis suggested potential lncRNAs candidates par- ticipate in sex differentiation through a complex lncRNA-mRNA regulation network (Fig.  5) by acting both in cis and in trans via multiple correlation pathways. e fin Th dings of the present study provide evidence for the role of lncRNAs in sex differentiation in the Chinese soft-shell turtle. Furthermore, identification and annotation of the putative lncRNAs provides a basis for further clarification of the mechanisms underlying the regulation ofmRNA expression by lncRNA in sex determination in this species. Materials and Methods Animals and tissue preparation. Fertilised Chinese soft-shell turtle eggs were obtained from a fishery in Anhui Province, China. The eggs were placed with the animal pole upwards in sterilized and hatched at room temperature in our laboratory. At 30 days post-hatching, gonads were collected from turtles and immediately frozen in liquid nitrogen for storage at −80 °C prior to RNA extraction. All experiments in this research were performed according to the permit guidelines established by Anhui Agricultural University, and the experimental protocols were approved by the Animal Care and Use Committee of Anhui Agricultural University. RNA extraction, library construction, and sequencing. Total RNA was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA purity and concentration were then evalu- ated using the NanoDrop 2000 (NanoDrop 2000/2000c, Thermo), RNA integrity was determined by 1% agarose gel electrophoresis and RNA quality was verified using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa 49–51 Clara, CA, USA) as well as RNase free agarose gel electrophoresis . Following removal of rRNA using the Ribo-Zero Magnetic Gold Kit, the isolated mRNA was fragmented (200–500 nt) by adding fragmentation buffer. First-strand cDNA was then generated by reverse transcription using the isolated mRNA as a template and random hexamer primers. Second-strand cDNA was generated SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 7 Gene ID Forward primer Reverse primer XM_014576568.1 TTCCGACCGCTAAAACGA CACCGTTTAGCCATTGTTGTT TCONS_00068006 CCCACCCCCTTTTTGACT AAAGTTTTGCCTGGTCGCT XM_006135075.2 GGAAGCAAACTTGGATTACAG ATGTTTTCCAGTCCAGCAGTA TCONS_00088824 GTATCCATTAGGTAACGCTGAC AAATCCCACTGGAAGTCAATAG GAPDH CCGTGTTCCAACTCCCAATG GGCAGCCTTCATCACCTTCTT Table 2. List of primers used in the qRT-PCR validation of RNA-seq. using RNase H and DNA polymerase I with specific dUTPs. After washing with EB buffer for the addition of poly(A) tails, the dsDNA fragments were ligated to the strand-marker adapters. The second-strand cDNA was degraded using uracil N-glycosylase. Following PCR and ligation of the sequencing adapters, the final cDNA library was constructed and sequenced in a single run on the Illumina platform (Illumina HiSeq 4000) using the paired-end technology. Base-calling and quality value calculations were performed by the Illumina HiSeq. 4000 to obtain 150 bp paired-end reads . Transcriptome assembly and expression analysis. Clean data were obtained from the raw data by removing reads containing the following: adapters, >10% of poly(N), and low-quality (>50% of the bases had Phred quality scores ≤10). The Phred score (Q20) and GC content of the clean data were then calculated to identify the high quality clean data for all further analyses. The Pelodiscus sinensis reference genome and gene model annotation files were downloaded from the NCBI database (CHIR_1.0, NCBI). The reference genome was built using Bowtie v2.0.6 and paired-end clean reads were aligned using TopHat v2.0.14. The mapped reads from each library were assembled with Cufflinks v2.2.1 using default parameters, with the exception of 53,54 ‘min-frags-per-transfrag = 0’ and ‘-library-type fr-firststrand’ . Following assembly of the novel transcripts from the different libraries, putative lncRNAs were obtained by removal of the following: (1) Single exon transcripts and transcripts <200 bp; (2) The remaining transcripts that overlapped (>1 bp) with P. sinensis protein coding genes; (3) Transcripts likely to be assembly artefacts or PCR run-on fragments according to the class code annotated by cuff-compare. Transcripts with cuff-compare class- codes “u, i, j, x, c, e, o” were defined as novel transcripts. (4) Transcripts with Coding Potential Calculator (CPC) scores >0 and Coding-Non-Coding-Index (CNCI) scores >0. The details of this process are shown in Fig.  1. For each library, the FPKM scores for the lncRNAs and coding genes were calculated using RSEM and differentially expressed lncRNAs between any two libraries were identified by edgeR (release 3.2). The thresholds used to evaluate the statistical significance of differences in lncRNA expression were defined as FDR <0.05 and an absolute value of the log (fold change) >1. The clusters obtained in this systematic analysis of differentially expressed lncRNAs in the four libraries were analysed using the Heatmaps software 55,56 package in R . Target gene prediction and functional enrichment analysis. Cis-acting lncRNAs function by target- 57,58 ing neighbouring genes . In this study, we searched for coding genes in the regions located 10-kb upstream and downstream of all the identified lncRNAs for prediction of their functional roles. e RN Th Aplex software (http:// was used to predict the complementary correlation of antisense lncRNA and mRNA to reveal their interactions. This program contains the ViennaRNA package, which predicts the best base pairing through calculation of the minimum free energy of the thermodynamic structure. LncRNAs also mediate trans-regulation of distant genes. LncRNAs and coding genes were identified as those with Pearson’s correlation coefficients ≥ ± 0.9. KEGG pathway analysis according to KEGG ( pathway analysis was performed 40,59 to investigate the roles of all differentially expressed mRNAs . Validation of differentially expressed lncRNAs and mRNAs by quantitative RT-PCR. Two dif- ferentially expressed lncRNAs and two target genes were selected to validate the RNA-seq data by qRT-PCR using previously described methods . Primers were designed using Primer3 (sequences are shown in Table 2) and evaluated using BLAST at NCBI. GAPDH was used as the internal control. Each sample was analysed in three independent experiments. Construction of lncRNA and target gene network. Correlation analysis of the differentially expressed lncRNAs and mRNAs was performed to identify interactions. This information was then used to construct a co-expression network using Cytoscape software (The Cytoscape Consortium, San Diego, CA, USA). Statistical analyses. Statistical analyses were performed using SAS software version 9.0 (SAS, Cary, North Carolina, USA). All data were analysed using one-way analysis of variance (ANOVA). Homogeneity of vari- ances was evaluated using Levene’s test followed by Student’s t-test. P < 0.05 was considered to indicate statistical significance. Accession numbers. e s Th equencing data were submitted to the Sequence Read Archive in the NCBI (acces- sion No.: SRP125617). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 8 References 1. Li, X. Y. et al. Extra microchromosomes play male determination role in polyploid gibel carp. Genetics. 203, 1415–1424 (2016). 2. Mei, J. & Gui, J. F. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. China Life Sci. 58, 124–136 (2015). 3. Graves, J. A. The epigenetic sole of sex and dosage compensation. Nat Genet. 46, 215–217 (2014). 4. Bachtrog, D. et al. Sex determination: Why so many ways of doing it? Plos Biol. 12, e1001899 (2014). 5. Matsumoto, Y., Buemio, A., Chu, R., Vafaee, M. & Crews, D. Epigenetic control of gonadal aromatase (cyp19a1) in temperature- dependent sex determination of red-eared slider turtles. Plos One. 8, e63599 (2013). 6. Brian, M. V. Social control over sex and caste in bees, wasps and ants. Biol Rev. 55, 379–415 (2010). 7. Kobayashi, Y., Nagahama, Y. & Nakamura, M. Diversity and plasticity of sex determination and differentiation in fishes. Sex Dev. 7, 115–125 (2013). 8. Hiramatsu, R. et al. A critical time window of sry action in gonadal sex determination in mice. Development. 136, 129–138 (2009). 9. Matsuda, M. et al. Dmy is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 417, 559–563 (2002). 10. Chakraborty, T., Lin, Y. Z., Chaudhari, A., Taisen, L. & Nagahama, Y. Dmy initiates masculinity by altering gsdf/sox9a2/ rspo1expression in medaka (oryzias latipes). Sci Rep. 6, 19480 (2016). 11. Kamiya, T., Kai, W. & Tasumi, S. A trans-species missense snp in amhr2 is associated with sex determination in the tiger puffers fi h, takifugu rubripes (fugu). Plos Genet. 8, e1002798 (2012). 12. Hattori, R. S. et al. A Y-linked anti-mullerian hormone duplication takes over a critical role in sex determination. P Natl Acad Sci USA 109, 2955–2959 (2012). 13. Myosho, T. et al. Tracing the emergence of a novel sex-determining gene in medaka. oryzias luzonensis. Genetics. 191, 163–170 (2012). 14. Jiang, D. N. et al. Gsdf is a downstream gene of dmrt1 that functions in the male sex determination pathway of the nile tilapia. Mol Reprod Dev. 83, 497–508 (2016). 15. Smith, C. A. et al. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature. 461, 267–271 (2009). 16. Lin, Q. et al. Distinct and cooperative roles of amh and dmrt1 in self-renewal and differentiation of male germ cells in zebrafish. Genetics. 207, 1007–1022 (2017). 17. Lv, L. et al. Integrated mRNA and lncRNA expression profiling for exploring metastatic biomarkers of human intrahepatic cholangiocarcinoma. Am J Cancer Res. 7, 688 (2017). 18. Wang, M., Wu, H. J., Fang, J., Chu, C. & Wang, X. J. A long noncoding RNA involved in rice reproductive development by negatively regulating osa-miR160. Sci Bull. 62, 470–475 (2017). 19. Liu, C. J. et al. LncRInter: A database of experimentally validated long non-coding RNA interaction. J Genet Genomics. 44, 265–268 (2017). 20. Yang, G., Lu, X. & Yuan, L. LncRNA: A link between RNA and cancer. BBA-Gene Regul Mech. 1839, 1097–1109 (2014). 21. McFarlane, L. & Wilhelm, D. Non-coding RNAs in mammalian sexual development. Sex Dev. 3, 302–316 (2009). 22. Taylor, D. H., Chu, E. T., Spektor, R. & Soloway, P. D. Long non-coding RNA regulation of reproduction and development. Mol Reprod Dev. 82, 932–956 (2015). 23. van Werven, F. J. et al. Transcription of two long noncoding RNAs mediates mating-type control of gametogenesis in budding yeast. Cell. 150, 1170–1181 (2012). 24. Herrera, L. et al. Mouse ovary developmental RNA and protein markers from gene expression profiling. Dev biol. 279, 271–290 (2005). 25. Laiho, A., Kotaja, N., Gyenesei, A. & Sironen, A. Transcriptome profiling of the murine testis during the first wave of spermatogenesis. Plos One. 8, e61558 (2013). 26. Fatica, A. & Bozzoni, I. Long non-coding RNAs: New players in cell differentiation and development. Nat Rev Genet. 15, 7–21 (2014). 27. Zhang, Y. C. et al. Genome-wide screening and functional analysis identify a large number of long noncoding RNAs involved in the sexual reproduction of rice. Genome Biol. 15, 512 (2014). 28. McHugh, C. A. et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, 232–236 (2015). 29. Zhang, L., Lu, H., Xin, D., Cheng, H. & Zhou, R. A novel ncRNA gene from mouse chromosome 5 trans-splices with dmrt1 on chromosome 19. Biochem Bioph Res Co. 400, 696–700 (2010). 30. Mulvey, B. B., Olcese, U., Cabrera, J. R. & Horabin, J. I. An interactive network of long non-coding RNAs facilitates the drosophila sex determination decision. BBA-Gene Regul Mech. 1839, 773–784 (2014). 31. Kawagoshi, T., Uno, Y., Matsubara, K., Matsuda, Y. & Nishida, C. The zw micro-sex chromosomes of the chinese soft-shelled turtle (pelodiscus sinensis, trionychidae, testudines) have the same origin as chicken chromosome 15. Cytogenet Genome Res. 125, 125–131 (2009). 32. Badenhorst, D., Stanyon, R., Engstrom, T. & Valenzuela, N. A ZZ/ZW microchromosome system in the spiny softshell turtle, Apalone spinifera, reveals an intriguing sex chromosome conservation in Trionychidae. Chromosome Res. 21, 137–147 (2013). 33. Sun, W. et al. Dmrt1 is required for primary male sexual differentiation in Chinese soft-shelled turtle Pelodiscus sinensis. Sci Rep. 7, 4433 (2017). 34. Kawai, A. et al. Different origins of bird and reptile sex chromosomes inferred from comparative mapping of chicken Z-linked genes. Cytogenet Genome Res. 117, 92–102 (2007). 35. Yao, H. H. C., DiNapoli, L. & Capel, B. Cellular mechanisms of sex determination in the red-eared slider turtle. Trachemys scripta. Mech Develop. 121, 1393–1401 (2004). 36. Kocour, M., Linhart, O. & Gela, D. Results of comparative growing test of all-female and bisexual population in two-year-old common carp (Cyprinus carpio L.). Aquacult Int. 11, 369–378 (2003). 37. Wang, D., Mao, H. L., Chen, H. X., Liu, H. Q. & Gui, J. F. Isolation of Y- and X-linked SCAR markers in yellow cats fi h and application in the production of all-male populations. Anim Genet. 40, 978–981 (2009). 38. Wang, K. C. & Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904–914 (2011). 39. Ponting, C. P., Oliver, P. L. & Reik, W. Evolution and functions of long noncoding RNAs. Cell. 136, 629–641 (2009). 40. Gao, X. et al. Screening and evaluating of long noncoding rnas in the puberty of goats. Bmc Genomics. 18, 164 (2017). 41. Pauli, A. et al. Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis. Genome Res. 22, 577–591 (2012). 42. Cabili, M. N. et al. Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. Gene Dev. 25, 1915–1927 (2011). 43. Li, Z. H. et al. Integrated analysis of long non-coding RNAs (lncRNAs) and mRNA expression profiles reveals the potential role of lncRNAs in skeletal muscle development of the chicken. Front physiol. 7, 687–687 (2016). 44. Kang, C. & Liu, Z. Global identification and analysis of long non-coding RNAs in diploid strawberry fragaria vesca during flower and fruit development. Bmc Genomics. 16, 815 (2015). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 9 45. Huarte, M. et al. A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell. 142, 409–419 (2010). 46. Dykes, I. & Emanueli, C. Transcriptional and post-transcriptional gene regulation by long non-codingRNA. Genomic Prot Bioinfor. 15, 177–186 (2017). 47. Wierzbicki, A. T., Haag, J. R. & Pikaard, C. S. Noncoding transcription by RNA polymerase pol ivb/pol v mediates transcriptional silencing of overlapping and adjacent genes. Cell. 135, 635–648 (2008). 48. Ariel, F. et al. Noncoding transcription by alternative RNA polymerases dynamically regulates an auxin-driven chromatin loop. Mol Cell. 55, 383–396 (2014). 49. Zhao, Y. et al. An alternative strategy for targeted gene replacement in plants using a dual-sgRNA/Cas9 design. Sci Rep. 6, 23890 (2016). 50. Chen, F. F. et al. Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule. Fish Shellfish Immu. 63, 1 (2017). 51. Xiong, S. et al. Loss ofstat3 function leads to spine malformation and immune disorder in zebras fi h. Sci Bull 62, 185–196 (2017). 52. Ren, H. et al. Genome-wide analysis of long non-coding RNAs at early stage of skin pigmentation in goats (Capra hircus). Bmc Genomics. 17, 67 (2016). 53. Trapnell, C., Pachter, L. & Salzberg, S. L. Tophat: Discovering splice junctions with RNA-seq. Bioinformatics. 25, 1105–1111 (2009). 54. Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with Tophat and Cufflinks. Nat Protoc. 7, 562–578 (2012). 55. Flegel, C., Manteniotis, S., Osthold, S., Hatt, H. & Gisselmann, G. Expression profile of ectopic olfactory receptors determined by deep sequencing. Plos One. 8, e55368 (2013). 56. Sun, L. et al. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 41, e166–e166 (2013). 57. Gomez, J. A. et al. The nest long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus. Cell. 152, 743–754 (2013). 58. Lai, F. et al. Activating RNAs associate with mediator to enhance chromatin architecture and transcription. Nature. 494, 497–501 (2013). 59. Han, Y. et al. Single-cell transcriptome analysis reveals widespread monoallelic gene expression in individual rice mesophyll cells. Sci Bull. 62, 1304–1314 (2017). 60. Yang, Y. J., Wang, Y., Zhou, L. & Gui, J. F. Sequential, divergent, and cooperative requirements of foxl2a and foxl2b in ovary development and maintenance of zebras fi h. Genetics. 205, 1551–1572 (2017). Acknowledgements This work was supported by the Anhui Provincial Higher Education Natural Science Foundation (KJ2016A241), the Open Project of State Key Laboratory of Freshwater Ecology and Biotechnology (2016FB16), the Anhui Agricultural University Youth Fund (2015ZD05), the Anhui Agricultural University Bringing in and Stabilize Talent Fund (yj2016-12) and the Natural Science Foundation of Anhui Province (1508085MC54). We are grateful to Guangzhou Genedenovo Biotechnology Co., Ltd for their assistance with sequencing. We also thank Guangzhou Sagene Biotech Co., Ltd. for bioinformatics analysis. Author Contributions J.Z. and P.Y. carried out the experiments and drae ft d the manuscript. Q.Y.Z. and X.L.L. prepared the experimental materials. S.Q.D., S.P.S., X.H.Z., X.L.Y. and W.S.Z. associated to collect the experimental materials. Q.W. and J.F.G. conceived of this study and wrote the manuscript. All authors read and approved the final manuscript. Additional Information Supplementary information accompanies this paper at Competing Interests: The authors declare no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit © The Author(s) 2018 SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 10 Scientific Reports Springer Journals

Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese soft-shell turtle (Pelodiscus sinensis)

10 pages

Loading next page...
Springer Journals
Copyright © 2018 by The Author(s)
Science, Humanities and Social Sciences, multidisciplinary; Science, Humanities and Social Sciences, multidisciplinary; Science, multidisciplinary
Publisher site
See Article on Publisher Site

Abstract OPEN Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese soft- Received: 26 January 2018 shell turtle (Pelodiscus sinensis) Accepted: 11 May 2018 Published: xx xx xxxx 1 1,2,3 1 1 1 1 Jun Zhang , Peng Yu , Qinyan Zhou , Xilei Li , Shuquan Ding , Shiping Su , Xiaohua 1 1 1 1 2,3 Zhang , Xiaoli Yang , Weishang Zhou , Quan Wan & Jian-Fang Gui Long non-coding RNAs (lncRNAs) perform distinct functions in various biological processes in mammals, including sex differentiation. However, the roles of lncRNAs in other vertebrates, especially in the Chinese soft-shell turtle (Pelodiscus sinensis), remain to be clarified. In this study, we performed genome-wide analysis of the lncRNA expression profiles in gonad tissues and screened numerous sex-specific lncRNAs in the Chinese soft-shell turtle. Of the 363,310,650 clean reads obtained, 5,994 sequences were typed as lncRNAs, of which 4,463 were novel. A selection of sex-specific lncRNAs (♀ 932, ♂ 449) from female ovaries and male testis were shown to act on target genes in cis and in trans, and most were involved in gonad differentiation based on Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. Furthermore, interactions among the differentially expressed lncRNA-mRNAs and protein coding genes were identified by construction of correlation networks. Overall, our systematic analysis of lncRNA expression profiles in gonad tissues revealed numerous sex-specific lncRNAs in P. sinensis. Thereby, these findings provide new insights into the function of lncRNAs in sex differentiation and highlight a group of candidate lncRNAs for future studies. 1–3 e m Th echanisms underlying sex determination are an important focus of biological research . Most vertebrates are gonochoristic, with sexual morphology determined genetically by different alleles or genes . In single gene systems, sex chromosomes contribute to sex determination, with the XX/XY male and ZZ/ZW female heteroga- metic systems present in the majority of species, although variant systems have been identified in a few species . Sex determination, which results in the formation of testes and ovaries from undie ff rentiated gonads, is generally thought to be genetically controlled but can also be influenced by environmental factors (such as temperature) 5–7 or social variables (e.g. the relative size of an organism in its population) . The sex-determining (SD) genes that control this process are expressed transiently in undifferentiated gonads. The first SD to be discovered in verte- brates was the Sry gene, which is located on the Y-chromosome and initiates testicular differentiation . Other SD 9,10 11 12 13,14 13 15,16 genes or candidates include dmy , amhr2 , amhy , gsdf , sox3 and dmrt1 . LncRNAs have been implicated in many biological processes and function through the regulation of transcrip- 17–20 tional and post-transcriptional gene expression . Accumulating evidence suggests that lncRNAs play a role in 21,22 23 21,24,25 26 sex determination and gonadogenesis , meiosis , gametogenesis , cell die ff rentiation and organogenesis 18,27 and sexual reproduction . Of note, Xist lncRNAs mediates transcriptional silencing of one X-chromosome during female sex determination in mammals . In mice, the lncRNA Dmr has been shown to participate in trans splicing of the Dmrt1 transcript that encodes a protein with an altered carboxyl terminus . Furthermore, a complex network of numerous lncRNAs regulate Sxl expression . All of these observations indicate that lncRNAs play important roles in sex differentiation. Reptiles exhibit an extraordinary variation in the mechanisms of sex determination including temperature-dependent and genetic sex determination (TSD and GSD, respectively) mediated by the male (XY) 1 2 College of Animal Science and Technology, Anhui Agricultural University, Hefei, 230036, China. State Key laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China. University of Chinese Academy of Sciences, Beijing, 100049, China. Jun Zhang and Peng Yu contributed equally to this work. Correspondence and requests for materials should be addressed to Q.W. (email: or J.-F.G. (email: SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 1 31,32 or female (ZW) heterogametic systems . However, the potential roles of lncRNAs in sex differentiation of rep- tiles remain to be elucidated. e C Th hinese soft-shell turtle (P. sinensis) is a member of the turtle family (Reptilia; Testudines) and is an important aquaculture species in southern China. This species has heteromorphic ZW-type 31,33,34 micro-sex chromosomes and, as with most vertebrates, sex determination controls the development of testes or ovaries from the bipotential gonad . Sex differentiation-related genes, such as Dmrt1 , Amh, Sox9, Cyp19a1 and Foxl2 were discovered in Chinese soft-shell turtle. Furthermore, Dmrt1 appeared early male gonads specific expression, which was knockdown in ZZ embryos by RNA interference resulted in male to female sex reversal . Although a series of sex-differentiation-related genes were discovered in Chinese soft-shell turtle, the potential involvement of lncRNAs in sex determination of this species remains to be clarified. Chinese soft-shell turtles have a sex-dependent dimorphic growth pattern, with males exhibiting more rapid growth and larger body size, with a thicker and wider calipash, and lower levels of fat . This pattern of sex-related differences in growth rate is also observed in many species of farmed teleost fish, such as yellow cats fi h, and strat- 36,37 egies for sex control have been used to produce all-male populations . Similar approaches have been investi- gated in turtles. Therefore, a comprehensive understanding of the mechanisms responsible for sex determination in Chinese soft-shell turtles will be of significant benefit for improved aquaculture of this species. Here, we sys- tematically analysed the lncRNA expression profiles in gonad tissues and screened numerous sex-specific lncR - NAs in Chinese soft-shell turtles. This information may provide a better understanding of the sex differentiation processes in Chinese soft-shell turtle and also highlight the functions of lncRNAs in this process in all reptiles. Results Overview of lncRNA sequencing. For genome-wide analysis of lncRNAs of P. sinensis, gonad tissues col- lected at 30 days post-hatching were subjected to RNA-seq using the Illumina HiSeq. 4000 platform. In total, 363,310,650 clean reads were produced and 354,585,240 high quality (HQ) clean reads were obtained by remov- ing low quality reads and reads mapped with rRNA. Between 63.66% and 67.98% of the HQ reads were efficiently mapped against the P. sinensis reference genome (PelSin_1.0, NCBI) in each library, thus validating our RNA- sequencing data (see Supplementary File S1). Identification of lncRNAs and mRNAs. A high stringency filtering process was used to remove low quality lncRNA transcripts (see Supplementary Fig. S1). Of the remaining 5,994 lncRNA transcripts, only 1,531 (25.54%) were previously identified, while 4,463 (74.46%) were novel. In contrast, the Illumina RNA-seq analysis produced a much higher number of mRNAs (39,262), comprising 27,429 known transcripts and 11,833 novel transcripts (Fig. 1A). The mean length of lncRNAs in our dataset was 1,717 bp and the mean mRNA length was 3,555 bp (Fig. 1B). Furthermore, the lncRNAs contained fewer exons than the mRNAs (Fig. 1C). Sex-specific expression of lncRNAs and mRNAs. Analysis of sex-specic fi gene expression revealed 932 lncRNAs expressed specifically in the female gonad tissues and 449 in the male samples (Fig.  2A). We also identi- fied 3,383 mRNAs expressed specifically in female gonad tissues and 3,272 in male gonad tissues (Fig.  2B). These lncRNAs and mRNAs may play a pivotal role in P. sinensis gonad formation and provide crucial information regarding the regulation of sex differentiation in this species. Analysis of differentially expressed lncRNAs and mRNAs. e RN Th A-seq data were analysed to fur - ther clarify the differential expression of transcripts in female and male gonad tissues. A total of 1,369 lncRNA transcripts were differentially expressed in male tissues compared with the levels detected in female tissues. Of these, 278 were up-regulated and 1,091 were down-regulated (fold change ≥2.0 and FDR <0.05; Fig. 3A). Volcano plots also revealed a similar trend (Fig. 3B). Of these, the 15 sex differentiation-related lncRNAs showing the most significant differential expression were selected for construction of a heatmap (Fig.  3C). Among the dysregu- lated sex differentiation-related lncRNAs, TCONS_00092301 was the most down-regulated (log2(FC) -5.73649) and TCONS_00068006 was the most up-regulated (log2(FC) 3.760947) (details are presented in Supplementary File S2 and S3). In further analysis, we identified 4,374 mRNAs showing significant differential expression in male tissues compared with the levels detected in female tissues (1,907 up-regulated and 2,467 down-regulated (Fig. 3D and Supplementary File S2). A similar differential expression trend of mRNAs was observed in the volcano plot (fold change ≥2.0, FDR <0.05) (Fig. 3E). Of these, the 15 sex differentiation-related mRNAs showing the most significant differential expression were selected for construction of a heatmap (Fig.  3F). Among the dysregu- lated sex differentiation-related mRNAs, XM_01 4578590.1 was the most up-regulated (log2(FC) -9.5411) and XM_006133089.2 was the most down-regulated log2(FC) 9.41996) (see Supplementary File S4). Putative target genes of lncRNAs. LncRNAs regulate target gene expression by acting in cis on neigh- bouring loci or in trans on distant loci . To investigate the effects of differences in lncRNAs on the functional regulation of turtle sex differentiation, we predicted the target genes of lncRNA using the cis and trans model. The cis role of lncRNAs was investigated by screening the protein coding (PC) genes as potential targets in the regions located 10-kb upstream and downstream of all the identified lncRNAs for prediction of their functional roles. In total, 933 lncRNAs were predicted to correspond with 1,179 target genes in cis and 5,990 lncRNAs were predicted to correspond with 6,609 target genes in trans (see Supplementary File S5 and S6). Interestingly, many lncRNAs were predicted to target sex differentiation-related genes; these included TCONS_00099273, TCONS_00068006, TCONS_00088824, TCONS_00019214, and TCONS_00019442, which targeted the PC genes dmrt1, sox9, cyp19a, sox3, and sox8. These findings indicated that the on-set of sexual differentiation is regulated by the lncRNA-target genes. Regarding the trans role of lncRNA, our results indicated that the lncRNA, TCONS_00071083, acted on ZFX in trans (Table 1). Furthermore, KEGG pathway analysis of the top 20 enriched lncRNAs may be acting on target genes that regulate the onset of sex differentiation (Fig.  4 and Supplementary File S7). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 2 Figure 1. Comparison of features of predicted lncRNAs and mRNAs. (A) Expression of lncRNAs and mRNAs. (B) Length distribution of predicted lncRNAs and mRNAs. (C) Exon number distribution of lncRNAs and mRNAs. Figure 2. Analyses of differentially expressed lncRNAs and mRNAs. (A) Venn diagram showing the differentially expressed lncRNAs in female and male gonad tissues. (B) Venn diagram showing the differentially expressed coding transcripts in female and male gonads. Network of lncRNA and mRNA interactions. To identity more important genes related to sex differen- tiation, we constructed a correlation network of the interactions between the die ff rentially expressed lncRNAs and mRNAs (P > 0.99999 in Pearson correlation analysis) based on cis or in trans regulation (Fig. 5). The cor - relation network was constructed from 63 lncRNAs and 185 mRNAs associated with sex die ff rentiation-related dysregulated genes. A review of the network showed that lncRNAs regulated target genes either in cis or in trans. For instance, the PC gene XM_006112508.2 was targeted by lncRNA TCONS_00071083 in cis, while the PC gene XM_014572620.1 was targeted by lncRNA TCONS_00039123 and TCONS_00039122 in trans. Interestingly, the PC gene XM_006139628.2 was regulated by lncRNA TCONS_00002327 and TCONS_00019442 in cis- and trans SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 3 Figure 3. Differentially expressed transcripts in the RNA-seq libraries. (A ) and (D) Numbers of up-regulated (red) and down-regulated transcripts (green). (B) and (E) Volcano plots of differentially expressed transcripts. X-axis represents fold change (log 2) and Y-axis represents P (−log 10). Red points indicate up-regulated (X-axis >0) transcripts; green points indicate down-regulated (X-axis <0) transcripts. (C) and (F) Heatmaps showing 15 sex differentiation-related lncRNAs and mRNAs. The data are depicted as a matrix, in which each row represents one lncRNA (mRNA) and each column represents one group. The relative expression of lncRNA (mRNA) expression is depicted according the colour scale shown on the right. Red represents high relative expression, and blue represents low relative expression; −0.6, −0.4, −0.2, 0 and 0.2, 0.4, and 0.6 are fold changes in the corresponding spectrum. The magnitude of deviation from the median is represented by the colour saturation. simultaneously. Furthermore, the lncRNAs correlated with PC genes adopted multiple pathways, including one lncRNA correlated with one PC gene, one lncRNA correlated with several PC genes and several lncRNA corre- lated with one PC gene. Dmrt1 (XM_006137866.2), gata4 (XM_014569886.1) and cyp19a (XM_006135075.2) have been identified as key sex differentiation-related genes and were shown to be regulated by several lncRNAs actin in cis or in trans in the network. Therefore, the correlation network of lncRNAs and mRNAs indicated that lncRNAs act on PC genes both in cis and in trans in the process of sex die ff rentiation in Chinese so- ft shell turtles. Validation of differentially expressed lncRNAs and mRNAs. The differentially expressed lncRNA transcripts TCONS_00088824 and TCONS_00068006 and the PC genes XM_006135075.2 (Cyp19a) and XM_014576568.1 (Sox9) identified in the RNA-seq data were obtained according to gene expression, the lncRNA and mRNA regulatory network, and gene function to validate their expression patterns in female and male gonad tissues by qRT-PCR. The results confirmed consistent expression patterns of the two lncRNA transcripts and coding transcripts (Fig. 6), suggesting that the process used to identify putative lncRNAs was sufficiently stringent SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 4 Target genes cis trans DMRT1 (XM_006137866.2) TCONS_00099273 CYP19a (XM_006135075.2) TCONS_00088824 TCONS_00057541 TCONS_00039813 TCONS_00056149 TCONS_00005326 TCONS_00037784 TCONS_00015014 GATA4 (XM_014569886.1) TCONS_00023612 TCONS_00004539 TCONS_00092301 TCONS_00086098 TCONS_00029984 TCONS_00058012 SOX3 (XM_006115453.2) TCONS_00019214 SOX8 (XM_006139628.2) TCONS_00019442 SOX9 (XM_014576568.1) TCONS_00068006 HOXD1 (XM_006119463.2) TCONS_00032150 TCONS_00042242 HOXB13 (XM_014572204.1) TCONS_00035891 ZFX (XM_006112508.2) TCONS_00071083 TCONS_00039122 SOX5 (XM_014572620.1) TCONS_00039123 RSPO1 (XM_006134251.2) TCONS_00094168 Table 1. LncRNAs and their potential target genes associated with sex differentiation. Figure 4. Top 20 KEGG pathway annotation categories for target gene functions of predicted lncRNAs. to correlate with most of the identified lncRNAs expressed in vivo . Interestingly, we identified a positive correla- tion between the expression of two lncRNA transcripts with target PC genes. e Th regulatory mechanism of these lncRNA-regulated targets requires further investigation. SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 5 Figure 5. Correlation network of lncRNAs and mRNAs. Green and pink nodes represent dysregulated lncRNAs and dysregulated mRNAs, respectively. Blue and red lines between lncRNAs and mRNAs indicate cis and trans actions, respectively. Yellow lines represent Pearson correlation coefficients >0.99999. Figure 6. Validation of RNA-seq results by quantitative RT-PCR. Two lncRNAs and their target genes were * ** *** analysed by quantitative RT-PCR. Data represent the mean ± 1 SD (n = 3). P < 0.05, P < 0.01, P < 0.001. SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 6 Discussion LncRNAs have a disproportionately large impact on sex determination and sex differentiation processes that have been widely studied in humans and other mammals. Since the Chinese soft-shell turtle exhibits a sex-dependent dimorphic growth pattern , the mechanisms underlying sex determination and sex differentiation in this species are of considerable interest. In this study, we performed genome wide analysis of lncRNAs from early-stage female and male gonads of Chinese soft-shell turtle to explore the sex differentiation-related candidate lncRNAs, thereby clarifying the sex die ff rentiation processes in this species and also providing further elucidation of the functions of lncRNAs in this process in all reptiles. In the present study, our systematic analysis of the RNA expression profiles in gonad tissues using RNA-seq revealed 5,994 putative lncRNA transcripts and 39,262 putative protein coding transcripts. In accordance with similar studies in different organisms, the identified lncRNA transcripts had fewer exons, shorter transcripts, and lower expressions than the identified protein coding transcripts . We also found that the lncRNA transcripts in Chinese soft-shell turtle were longer than that the mean length of those in zebrafish (1,113 nt), goat (1,180 nt), 40–42 43 human (1,000 nt) and mouse (550 nt) , but shorter than those in chicken (2,941 nt) . Furthermore, on aver- age, lncRNA transcripts in Chinese so- ft shell turtle contained fewer exons than those in zebras fi h (2.8), goat (2.2), 40–42 human (2.9) and mouse (3.7) . Validation of two key deferentially expressed lncRNA transcripts by qRT-PCR yielded results were consistent those of the RNA-seq analysis, thus confirming the high quality of the identified lncRNAs. LncRNAs do not encode proteins, which represents a major challenge in determining their function. Gene expression analyses are important in clarifying the potential function of these lncRNAs . In this study, we screened out 932 specific-expression lncRNA transcripts in female gonad tissues and 449 specific-expression lncRNA transcripts in male gonad tissues (Fig. 2A). Furthermore, a large number of lncRNAs were found to be dif- ferentially expressed in female gonad tissues (Fig. 3A). Interestingly, we screened out 15 sex die ff rentiation-related lncRNAs that were significantly different expressed in gonad tissues (Fig.  3C). These results indicated that lncR - NAs may participate in the process of bipotential gonad differentiation into testis or ovary in Chinese soft-shell turtles. LncRNAs have been reported to regulate PC gene expression either in cis or in trans . Cis-acting lncRNAs act regulate the expression of a neighbouring gene on the same allele at the transcriptional or post-transcriptional 46 38 level . Trans-acting lncRNAs regulate the expression of genes that are located on other chromosomes . Thus, in this study, we sought to identify potential regulatory targets of lncRNAs using the cis and trans model, which has 47,48 been employed successfully to identify candidate regulatory targets of lncRNAs in animals and plants . Using this strategy, we identified 933 cis-acting lncRNAs corresponding to 1,179 target and 5,990 trans-acting lncRNAs corresponding to 6,609 target genes. As previous shown in previous research, the functions of lncRNAs were mediated by their action on the PC genes. The Xist lncRNA interacts directly with SHARP to silence transcription of one X-chromosome during development in female mammals . The lncRNA Dmr functions in trans splicing 29 30 the Dmrt1 transcript . Sxl expression is regulated by a complex interaction network involving many lncRNAs . In this study, we identified numerous lncRNAs associated with regulation of sex differentiation-related genes, including dmrt1, sox9, cyp19a, sox3 and sox8, indicating that the initiation of sexual differentiation is regulated by the interaction between lncRNA and target genes. Most notably, we discovered a positive correlation between the expression of lncRNAs TCONS_00088824 and TCONS_00068006 and their respective target PC genes XM_006135075.2 (Cyp19a) and XM_014576568.1 (Sox9) (Fig. 6). This correlation may be the result of common regulation of local chromatin and further investigations are required to confirm the existence of authentic rela- tionships between an lncRNA and its neighbouring targets in the regulation of sex differentiation in the Chinese soft-shell turtle. LncRNA-mRNA correlation network analysis was performed to identify the most important sex differentiation-related genes as previously described . Our analysis suggested potential lncRNAs candidates par- ticipate in sex differentiation through a complex lncRNA-mRNA regulation network (Fig.  5) by acting both in cis and in trans via multiple correlation pathways. e fin Th dings of the present study provide evidence for the role of lncRNAs in sex differentiation in the Chinese soft-shell turtle. Furthermore, identification and annotation of the putative lncRNAs provides a basis for further clarification of the mechanisms underlying the regulation ofmRNA expression by lncRNA in sex determination in this species. Materials and Methods Animals and tissue preparation. Fertilised Chinese soft-shell turtle eggs were obtained from a fishery in Anhui Province, China. The eggs were placed with the animal pole upwards in sterilized and hatched at room temperature in our laboratory. At 30 days post-hatching, gonads were collected from turtles and immediately frozen in liquid nitrogen for storage at −80 °C prior to RNA extraction. All experiments in this research were performed according to the permit guidelines established by Anhui Agricultural University, and the experimental protocols were approved by the Animal Care and Use Committee of Anhui Agricultural University. RNA extraction, library construction, and sequencing. Total RNA was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA purity and concentration were then evalu- ated using the NanoDrop 2000 (NanoDrop 2000/2000c, Thermo), RNA integrity was determined by 1% agarose gel electrophoresis and RNA quality was verified using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa 49–51 Clara, CA, USA) as well as RNase free agarose gel electrophoresis . Following removal of rRNA using the Ribo-Zero Magnetic Gold Kit, the isolated mRNA was fragmented (200–500 nt) by adding fragmentation buffer. First-strand cDNA was then generated by reverse transcription using the isolated mRNA as a template and random hexamer primers. Second-strand cDNA was generated SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 7 Gene ID Forward primer Reverse primer XM_014576568.1 TTCCGACCGCTAAAACGA CACCGTTTAGCCATTGTTGTT TCONS_00068006 CCCACCCCCTTTTTGACT AAAGTTTTGCCTGGTCGCT XM_006135075.2 GGAAGCAAACTTGGATTACAG ATGTTTTCCAGTCCAGCAGTA TCONS_00088824 GTATCCATTAGGTAACGCTGAC AAATCCCACTGGAAGTCAATAG GAPDH CCGTGTTCCAACTCCCAATG GGCAGCCTTCATCACCTTCTT Table 2. List of primers used in the qRT-PCR validation of RNA-seq. using RNase H and DNA polymerase I with specific dUTPs. After washing with EB buffer for the addition of poly(A) tails, the dsDNA fragments were ligated to the strand-marker adapters. The second-strand cDNA was degraded using uracil N-glycosylase. Following PCR and ligation of the sequencing adapters, the final cDNA library was constructed and sequenced in a single run on the Illumina platform (Illumina HiSeq 4000) using the paired-end technology. Base-calling and quality value calculations were performed by the Illumina HiSeq. 4000 to obtain 150 bp paired-end reads . Transcriptome assembly and expression analysis. Clean data were obtained from the raw data by removing reads containing the following: adapters, >10% of poly(N), and low-quality (>50% of the bases had Phred quality scores ≤10). The Phred score (Q20) and GC content of the clean data were then calculated to identify the high quality clean data for all further analyses. The Pelodiscus sinensis reference genome and gene model annotation files were downloaded from the NCBI database (CHIR_1.0, NCBI). The reference genome was built using Bowtie v2.0.6 and paired-end clean reads were aligned using TopHat v2.0.14. The mapped reads from each library were assembled with Cufflinks v2.2.1 using default parameters, with the exception of 53,54 ‘min-frags-per-transfrag = 0’ and ‘-library-type fr-firststrand’ . Following assembly of the novel transcripts from the different libraries, putative lncRNAs were obtained by removal of the following: (1) Single exon transcripts and transcripts <200 bp; (2) The remaining transcripts that overlapped (>1 bp) with P. sinensis protein coding genes; (3) Transcripts likely to be assembly artefacts or PCR run-on fragments according to the class code annotated by cuff-compare. Transcripts with cuff-compare class- codes “u, i, j, x, c, e, o” were defined as novel transcripts. (4) Transcripts with Coding Potential Calculator (CPC) scores >0 and Coding-Non-Coding-Index (CNCI) scores >0. The details of this process are shown in Fig.  1. For each library, the FPKM scores for the lncRNAs and coding genes were calculated using RSEM and differentially expressed lncRNAs between any two libraries were identified by edgeR (release 3.2). The thresholds used to evaluate the statistical significance of differences in lncRNA expression were defined as FDR <0.05 and an absolute value of the log (fold change) >1. The clusters obtained in this systematic analysis of differentially expressed lncRNAs in the four libraries were analysed using the Heatmaps software 55,56 package in R . Target gene prediction and functional enrichment analysis. Cis-acting lncRNAs function by target- 57,58 ing neighbouring genes . In this study, we searched for coding genes in the regions located 10-kb upstream and downstream of all the identified lncRNAs for prediction of their functional roles. e RN Th Aplex software (http:// was used to predict the complementary correlation of antisense lncRNA and mRNA to reveal their interactions. This program contains the ViennaRNA package, which predicts the best base pairing through calculation of the minimum free energy of the thermodynamic structure. LncRNAs also mediate trans-regulation of distant genes. LncRNAs and coding genes were identified as those with Pearson’s correlation coefficients ≥ ± 0.9. KEGG pathway analysis according to KEGG ( pathway analysis was performed 40,59 to investigate the roles of all differentially expressed mRNAs . Validation of differentially expressed lncRNAs and mRNAs by quantitative RT-PCR. Two dif- ferentially expressed lncRNAs and two target genes were selected to validate the RNA-seq data by qRT-PCR using previously described methods . Primers were designed using Primer3 (sequences are shown in Table 2) and evaluated using BLAST at NCBI. GAPDH was used as the internal control. Each sample was analysed in three independent experiments. Construction of lncRNA and target gene network. Correlation analysis of the differentially expressed lncRNAs and mRNAs was performed to identify interactions. This information was then used to construct a co-expression network using Cytoscape software (The Cytoscape Consortium, San Diego, CA, USA). Statistical analyses. Statistical analyses were performed using SAS software version 9.0 (SAS, Cary, North Carolina, USA). All data were analysed using one-way analysis of variance (ANOVA). Homogeneity of vari- ances was evaluated using Levene’s test followed by Student’s t-test. P < 0.05 was considered to indicate statistical significance. Accession numbers. e s Th equencing data were submitted to the Sequence Read Archive in the NCBI (acces- sion No.: SRP125617). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 8 References 1. Li, X. Y. et al. Extra microchromosomes play male determination role in polyploid gibel carp. Genetics. 203, 1415–1424 (2016). 2. Mei, J. & Gui, J. F. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. China Life Sci. 58, 124–136 (2015). 3. Graves, J. A. The epigenetic sole of sex and dosage compensation. Nat Genet. 46, 215–217 (2014). 4. Bachtrog, D. et al. Sex determination: Why so many ways of doing it? Plos Biol. 12, e1001899 (2014). 5. Matsumoto, Y., Buemio, A., Chu, R., Vafaee, M. & Crews, D. Epigenetic control of gonadal aromatase (cyp19a1) in temperature- dependent sex determination of red-eared slider turtles. Plos One. 8, e63599 (2013). 6. Brian, M. V. Social control over sex and caste in bees, wasps and ants. Biol Rev. 55, 379–415 (2010). 7. Kobayashi, Y., Nagahama, Y. & Nakamura, M. Diversity and plasticity of sex determination and differentiation in fishes. Sex Dev. 7, 115–125 (2013). 8. Hiramatsu, R. et al. A critical time window of sry action in gonadal sex determination in mice. Development. 136, 129–138 (2009). 9. Matsuda, M. et al. Dmy is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 417, 559–563 (2002). 10. Chakraborty, T., Lin, Y. Z., Chaudhari, A., Taisen, L. & Nagahama, Y. Dmy initiates masculinity by altering gsdf/sox9a2/ rspo1expression in medaka (oryzias latipes). Sci Rep. 6, 19480 (2016). 11. Kamiya, T., Kai, W. & Tasumi, S. A trans-species missense snp in amhr2 is associated with sex determination in the tiger puffers fi h, takifugu rubripes (fugu). Plos Genet. 8, e1002798 (2012). 12. Hattori, R. S. et al. A Y-linked anti-mullerian hormone duplication takes over a critical role in sex determination. P Natl Acad Sci USA 109, 2955–2959 (2012). 13. Myosho, T. et al. Tracing the emergence of a novel sex-determining gene in medaka. oryzias luzonensis. Genetics. 191, 163–170 (2012). 14. Jiang, D. N. et al. Gsdf is a downstream gene of dmrt1 that functions in the male sex determination pathway of the nile tilapia. Mol Reprod Dev. 83, 497–508 (2016). 15. Smith, C. A. et al. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature. 461, 267–271 (2009). 16. Lin, Q. et al. Distinct and cooperative roles of amh and dmrt1 in self-renewal and differentiation of male germ cells in zebrafish. Genetics. 207, 1007–1022 (2017). 17. Lv, L. et al. Integrated mRNA and lncRNA expression profiling for exploring metastatic biomarkers of human intrahepatic cholangiocarcinoma. Am J Cancer Res. 7, 688 (2017). 18. Wang, M., Wu, H. J., Fang, J., Chu, C. & Wang, X. J. A long noncoding RNA involved in rice reproductive development by negatively regulating osa-miR160. Sci Bull. 62, 470–475 (2017). 19. Liu, C. J. et al. LncRInter: A database of experimentally validated long non-coding RNA interaction. J Genet Genomics. 44, 265–268 (2017). 20. Yang, G., Lu, X. & Yuan, L. LncRNA: A link between RNA and cancer. BBA-Gene Regul Mech. 1839, 1097–1109 (2014). 21. McFarlane, L. & Wilhelm, D. Non-coding RNAs in mammalian sexual development. Sex Dev. 3, 302–316 (2009). 22. Taylor, D. H., Chu, E. T., Spektor, R. & Soloway, P. D. Long non-coding RNA regulation of reproduction and development. Mol Reprod Dev. 82, 932–956 (2015). 23. van Werven, F. J. et al. Transcription of two long noncoding RNAs mediates mating-type control of gametogenesis in budding yeast. Cell. 150, 1170–1181 (2012). 24. Herrera, L. et al. Mouse ovary developmental RNA and protein markers from gene expression profiling. Dev biol. 279, 271–290 (2005). 25. Laiho, A., Kotaja, N., Gyenesei, A. & Sironen, A. Transcriptome profiling of the murine testis during the first wave of spermatogenesis. Plos One. 8, e61558 (2013). 26. Fatica, A. & Bozzoni, I. Long non-coding RNAs: New players in cell differentiation and development. Nat Rev Genet. 15, 7–21 (2014). 27. Zhang, Y. C. et al. Genome-wide screening and functional analysis identify a large number of long noncoding RNAs involved in the sexual reproduction of rice. Genome Biol. 15, 512 (2014). 28. McHugh, C. A. et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, 232–236 (2015). 29. Zhang, L., Lu, H., Xin, D., Cheng, H. & Zhou, R. A novel ncRNA gene from mouse chromosome 5 trans-splices with dmrt1 on chromosome 19. Biochem Bioph Res Co. 400, 696–700 (2010). 30. Mulvey, B. B., Olcese, U., Cabrera, J. R. & Horabin, J. I. An interactive network of long non-coding RNAs facilitates the drosophila sex determination decision. BBA-Gene Regul Mech. 1839, 773–784 (2014). 31. Kawagoshi, T., Uno, Y., Matsubara, K., Matsuda, Y. & Nishida, C. The zw micro-sex chromosomes of the chinese soft-shelled turtle (pelodiscus sinensis, trionychidae, testudines) have the same origin as chicken chromosome 15. Cytogenet Genome Res. 125, 125–131 (2009). 32. Badenhorst, D., Stanyon, R., Engstrom, T. & Valenzuela, N. A ZZ/ZW microchromosome system in the spiny softshell turtle, Apalone spinifera, reveals an intriguing sex chromosome conservation in Trionychidae. Chromosome Res. 21, 137–147 (2013). 33. Sun, W. et al. Dmrt1 is required for primary male sexual differentiation in Chinese soft-shelled turtle Pelodiscus sinensis. Sci Rep. 7, 4433 (2017). 34. Kawai, A. et al. Different origins of bird and reptile sex chromosomes inferred from comparative mapping of chicken Z-linked genes. Cytogenet Genome Res. 117, 92–102 (2007). 35. Yao, H. H. C., DiNapoli, L. & Capel, B. Cellular mechanisms of sex determination in the red-eared slider turtle. Trachemys scripta. Mech Develop. 121, 1393–1401 (2004). 36. Kocour, M., Linhart, O. & Gela, D. Results of comparative growing test of all-female and bisexual population in two-year-old common carp (Cyprinus carpio L.). Aquacult Int. 11, 369–378 (2003). 37. Wang, D., Mao, H. L., Chen, H. X., Liu, H. Q. & Gui, J. F. Isolation of Y- and X-linked SCAR markers in yellow cats fi h and application in the production of all-male populations. Anim Genet. 40, 978–981 (2009). 38. Wang, K. C. & Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904–914 (2011). 39. Ponting, C. P., Oliver, P. L. & Reik, W. Evolution and functions of long noncoding RNAs. Cell. 136, 629–641 (2009). 40. Gao, X. et al. Screening and evaluating of long noncoding rnas in the puberty of goats. Bmc Genomics. 18, 164 (2017). 41. Pauli, A. et al. Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis. Genome Res. 22, 577–591 (2012). 42. Cabili, M. N. et al. Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. Gene Dev. 25, 1915–1927 (2011). 43. Li, Z. H. et al. Integrated analysis of long non-coding RNAs (lncRNAs) and mRNA expression profiles reveals the potential role of lncRNAs in skeletal muscle development of the chicken. Front physiol. 7, 687–687 (2016). 44. Kang, C. & Liu, Z. Global identification and analysis of long non-coding RNAs in diploid strawberry fragaria vesca during flower and fruit development. Bmc Genomics. 16, 815 (2015). SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 9 45. Huarte, M. et al. A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell. 142, 409–419 (2010). 46. Dykes, I. & Emanueli, C. Transcriptional and post-transcriptional gene regulation by long non-codingRNA. Genomic Prot Bioinfor. 15, 177–186 (2017). 47. Wierzbicki, A. T., Haag, J. R. & Pikaard, C. S. Noncoding transcription by RNA polymerase pol ivb/pol v mediates transcriptional silencing of overlapping and adjacent genes. Cell. 135, 635–648 (2008). 48. Ariel, F. et al. Noncoding transcription by alternative RNA polymerases dynamically regulates an auxin-driven chromatin loop. Mol Cell. 55, 383–396 (2014). 49. Zhao, Y. et al. An alternative strategy for targeted gene replacement in plants using a dual-sgRNA/Cas9 design. Sci Rep. 6, 23890 (2016). 50. Chen, F. F. et al. Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule. Fish Shellfish Immu. 63, 1 (2017). 51. Xiong, S. et al. Loss ofstat3 function leads to spine malformation and immune disorder in zebras fi h. Sci Bull 62, 185–196 (2017). 52. Ren, H. et al. Genome-wide analysis of long non-coding RNAs at early stage of skin pigmentation in goats (Capra hircus). Bmc Genomics. 17, 67 (2016). 53. Trapnell, C., Pachter, L. & Salzberg, S. L. Tophat: Discovering splice junctions with RNA-seq. Bioinformatics. 25, 1105–1111 (2009). 54. Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with Tophat and Cufflinks. Nat Protoc. 7, 562–578 (2012). 55. Flegel, C., Manteniotis, S., Osthold, S., Hatt, H. & Gisselmann, G. Expression profile of ectopic olfactory receptors determined by deep sequencing. Plos One. 8, e55368 (2013). 56. Sun, L. et al. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 41, e166–e166 (2013). 57. Gomez, J. A. et al. The nest long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus. Cell. 152, 743–754 (2013). 58. Lai, F. et al. Activating RNAs associate with mediator to enhance chromatin architecture and transcription. Nature. 494, 497–501 (2013). 59. Han, Y. et al. Single-cell transcriptome analysis reveals widespread monoallelic gene expression in individual rice mesophyll cells. Sci Bull. 62, 1304–1314 (2017). 60. Yang, Y. J., Wang, Y., Zhou, L. & Gui, J. F. Sequential, divergent, and cooperative requirements of foxl2a and foxl2b in ovary development and maintenance of zebras fi h. Genetics. 205, 1551–1572 (2017). Acknowledgements This work was supported by the Anhui Provincial Higher Education Natural Science Foundation (KJ2016A241), the Open Project of State Key Laboratory of Freshwater Ecology and Biotechnology (2016FB16), the Anhui Agricultural University Youth Fund (2015ZD05), the Anhui Agricultural University Bringing in and Stabilize Talent Fund (yj2016-12) and the Natural Science Foundation of Anhui Province (1508085MC54). We are grateful to Guangzhou Genedenovo Biotechnology Co., Ltd for their assistance with sequencing. We also thank Guangzhou Sagene Biotech Co., Ltd. for bioinformatics analysis. Author Contributions J.Z. and P.Y. carried out the experiments and drae ft d the manuscript. Q.Y.Z. and X.L.L. prepared the experimental materials. S.Q.D., S.P.S., X.H.Z., X.L.Y. and W.S.Z. associated to collect the experimental materials. Q.W. and J.F.G. conceived of this study and wrote the manuscript. All authors read and approved the final manuscript. Additional Information Supplementary information accompanies this paper at Competing Interests: The authors declare no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit © The Author(s) 2018 SCIEntIFIC RePo R tS | (2018) 8:8630 | DOI:10.1038/s41598-018-26841-3 10


Scientific ReportsSpringer Journals

Published: Jun 5, 2018


You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library


Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly


Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.


Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area








Save searches from
Google Scholar,

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles


20 pages / month

PDF Discount

20% off