Requirement of GSK-3 for PUMA induction upon loss of pro-survival PI3K signaling

Requirement of GSK-3 for PUMA induction upon loss of pro-survival PI3K signaling Growth factor withdrawal induces rapid apoptosis via mitochondrial outer membrane permeabilization. We had previously observed that cell death of IL-3-dependent Ba/F3 cells, induced by removal of the growth factor, required the activity of the kinase GSK-3. Employing CRISPR/Cas9-mediated gene knockout, we aimed to identify pro-apoptotic GSK-3 regulated factors in this process. Knockout of either Puma or Bim demonstrated that the induction of Puma, but not Bim, was crucial for apoptosis induced by IL-3 deprivation. Thus, we aimed at identifying the GSK-3-dependent PUMA regulator. Loss of FOXO3A reduced the induction of Puma, while additional loss of p53 completely repressed induction upon growth factor withdrawal. A constitutively active mutant of FOXO3A, which cannot be controlled by AKT directly, still required active GSK-3 for the full transcriptional induction of Puma and cell death upon IL-3 withdrawal. Thus, the suppression of GSK-3 is the key function of PI3K signaling in order to prevent the induction of Puma by FOXO3A and p53 and thereby apoptosis upon growth factor withdrawal. Introduction MOMP is controlled by growth factor availability, Growth factor signaling supports cell survival through which induces various pathways promoting cell survival. A key pro-survival pathway is the PI3K/AKT various pathways. Thus, deprivation of growth factor ultimately results in apoptosis. The decisive step for the signaling pathway, which can prevent MOMP and induction of intrinsic apoptosis is the mitochondrial outer apoptosis through regulating a number of substrates. membrane permeabilization (MOMP). This results in the For instance, AKT was shown to phosphorylate and release of cytochrome c and other proteins from the inactivate the transcription factor FOXO3A as well as mitochondrial intermembrane space into the cytosol, glycogen synthase kinase-3 (GSK-3). The inactivation of leading to apoptosome formation, caspase activation, and both FOXO3A and GSK-3 was shown to play an impor- apoptosis. MOMP is controlled by proteins of the BCL-2 tant role for the pro-survival activity of PI3K/AKT sig- 2–4 family. While the pro-apoptotic BCL-2 proteins BAX and naling . More specifically, it was shown that the BAK are required for the formation of a mitochondrial suppression of FOXO3A plays an essential role for the outer membrane pore, their activity is induced by BH3- suppression of Puma induction and cell death by PI3K only proteins (PUMA, BIM, Bid, and others). MOMP is signaling . prevented by related proteins with anti-apoptotic function The death promoting role of GSK-3 is instrumental for (like BCL-2, MCL-1, BCL-xL) . p53-mediated Puma induction and apoptosis: GSK-3 phosphorylates the histone acetyl transferase Tip60 (also known as KAT5), which stimulates Tip60 to acetylate p53 Correspondence: Ulrich Maurer (ulrich.maurer@mol-med.uni-freiburg.de) at K120, resulting in the transcriptional induction of Institute of Molecular Medicine and Cell Research, Faculty of Medicine, Albert- Ludwigs-University of Freiburg, Freiburg, Germany Puma and apoptosis upon induction of p53 . Interest- Spemann Graduate School of Biology and Medicine (SGBM), Albert-Ludwigs- ingly, GSK-3 was also shown to modulate the transcrip- University of Freiburg, Freiburg, Germany 7,8 tional activity of FOXO3A . Full list of author information is available at the end of the article Edited by G. Raschellà. © The Author(s) 2018 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; Schubert et al. Cell Death and Disease (2018) 9:470 Page 2 of 13 In the present study, employing knockout by CRISPR/ mRNA up to 2-fold after 7.5 h while Puma mRNA was Cas9, we systematically investigated the role of GSK-3- reduced upon treatment with CT98014 in the absence of dependent factors required for apoptosis induction by IL- IL-3 (Fig. 1e). This effect was reflected by the protein 3 deprivation. We show that PUMA is the main pro- levels of PUMA in Ba/F3 wt cells: PUMA was induced apoptotic protein responsible for apoptosis in this con- upon IL-3 withdrawal, but this upregulation was com- text, and that the induction of Puma is mediated by a pletely blocked by addition of CT98014 (Fig. 1f). Loss of PI3K is permitting GSK-3 activity by relieving the sup- FOXO3A-, p53-, and GSK-3-dependent mechanism. pression of GSK-3 by AKT-mediated phosphorylation. Results Consistently, we found that the pharmacological inhibi- Apoptosis induced by growth factor withdrawal requires tion of PI3K resulted in strong induction of PUMA GSK-3-dependent PUMA induction (Fig. S1D). When IL-3-dependent cells such as Ba/F3 or FL5.12 We next generated IL-2-dependent murine primary cells (two murine pro B cell lines) are deprived of the lymphocytes, which were deprived of the growth factor. growth factor, they undergo rapid apoptosis. Additional Consistent with the results obtained with IL-3-dependent treatment with the highly selective GSK-3 inhibitor cell lines, removal of IL-2 induced PUMA and apoptosis, CT98014 completely blocked IL-3-withdrawal-induced while this was abrogated in presence of the GSK-3 inhi- apoptosis of Ba/F3 cells as observed previously (Fig. 1a). bitor (Fig. S1E, Fig. S1F). We aimed at systematically defining the pro-apoptotic We therefore conclude that PUMA represents the main factors involved in IL-3 withdrawal-induced apoptosis and BH3-only protein mediating IL-3 and IL-2 withdrawal- at investigating their link to GSK-3. To address the role of induced apoptosis induction and that the transcriptional pro-apoptotic BH3-only proteins for growth factor- induction of Puma is dependent on GSK-3 activity. withdrawal-induced apoptosis, we transduced Ba/F3 cells with the lentiCRISPRv2 system targeting either p53 has a minor role for GSK-3-dependent PUMA induction Puma or Bim. As shown in Fig. 1b, apoptosis by IL-3 We next investigated the identity of the transcription deprivation was substantially reduced in Ba/F3 cells factor, which mediates the GSK-3-dependent transcrip- expressing CRISPR/Cas9 targeting Puma, while loss of tional induction of Puma upon loss of growth-factor- Bim conferred only moderate protection from cell death. induced PI3K signaling. Puma is a crucial pro-apoptotic 10,11 This effect was even more pronounced in the IL-3- target of p53 . While p53 is not stabilized upon growth dependent cell line FL5.12 (Fig. S1A). To further verify the factor withdrawal, p53 is nevertheless able to induce some role of PUMA in this system, clones derived from indi- of its target genes (such as Mdm2) when present at very vidual cells (single-cell clones) were generated from the low levels. Thus, even in the absence of DNA damage, we CRISPR/Cas9-transduced cultures and cells with frame- considered p53 as a candidate for GSK-3-dependent shift mutations on both Puma alleles or both Bim alleles Puma induction upon loss of pro-survival signaling dur- −/− were selected. Almost all Puma single-cell clones were ing IL-3 withdrawal. To address the role of p53 in this strongly protected from IL-3 withdrawal-induced apop- context, we inhibited PI3K by GDC-0941 in HCT116 −/− +/+ −/− tosis (Fig. 1c) while Bim single-cell clones exhibited no p53 and p53 cells in order to induce PUMA, as statistically significant survival advantage (Fig. 1d). The described before (see Fig. S1D). As shown in Fig. 2a, +/+ protective effect of Puma depletion lasted at least 24 h, inhibition of PI3K-induced PUMA in p53 as well as −/− however, the cells committed to apoptosis at later time p53 cells, indicating that p53 is not a major tran- −/− points. Puma Ba/F3 cells additionally treated with the scription factor responsible for Puma induction in this GSK-3 inhibitor CT98014 showed a similar kinetic but setting. Consistent with the data shown before, the the protective effect was more pronounced even after 40 h induction of PUMA was prevented by pharmacological (Fig. S1B). Thus, the kinase activity of GSK-3 as well as inhibition of GSK-3. To further investigate the role of p53, the induction of Puma are rate-limiting for apoptosis we knocked out p53 by CRISPR/Cas9 in Ba/F3 cells, induced by IL-3 withdrawal. The stronger anti-apoptotic which have an intact p53 signaling pathway . Upon IL-3 effect achieved by inhibition of GSK-3 than by the loss of withdrawal, Ba/F3 cells lacking p53 exhibited some pro- PUMA alone is consistent with other cell death regulatory tection from apoptosis (Fig. 2b), which was however not factors being regulated by GSK-3, such as MCL-1 as strong as observed with cells lacking PUMA (see −/− (Fig. S1C). We next asked whether PUMA is tran- Fig. 1b). We generated p53 single-cell clones and scriptionally regulated in a GSK-3-dependent manner subjected them to IL-3 deprivation. We unexpectedly upon growth factor withdrawal. Wild-type Ba/F3 cells observed that individual Ba/F3 cell clones lacking p53 were deprived of IL-3, treated with GSK-3 inhibitor exhibited quite some variation regarding the protection (CT98014) and Puma mRNA levels were analyzed by from IL-3 withdrawal-induced apoptosis. Nevertheless, on quantitative RT-PCR. IL-3 withdrawal-induced Puma average, the protection conferred by lack of p53 was Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 3 of 13 A B 50 50 +IL3 +IL3 -IL3 -IL3 40 40 -IL3 + CT98014 -IL3 + CT98014 30 30 20 20 10 10 C D P ≤ 0.001 ns *** E F 2.5 -IL3 8h 16h 24h 2.0 -IL3 + CT98014 1.5 1.0 26kDa PUMA 0.5 55kDa TUBULIN 0.0 Fig. 1 Apoptosis induced by growth factor withdrawal requires GSK-3-dependent PUMA induction. a Ba/F3 cells were deprived of IL-3 in the presence or absence of CT98014 (0.75 µM) and analyzed for apoptosis by Annexin V staining and flow cytometry analysis. Error bars represent SD from technical replicates. b Ba/F3 cells expressing CRISPR/Cas9 targeting Luciferase (crLUC), Puma (crPuma), or Bim (crBim) were deprived of IL-3 in presence or absence of CT98014 (0.75 µM) and analyzed for apoptosis by Annexin V staining after 18 h. Error bars represent SD from technical −/− replicates. c Ba/F3 Puma single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from two independent experiments (n = 2). Significance was tested by one-way ANOVA with −/− post hoc Tukey’s multiple comparison test. d Ba/F3 Bim single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent the 95% confidence interval from two independent experiments (n = 2). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns = not significant. e Ba/F3 cells were deprived of IL-3 in presence or absence of CT98014 (0.75 µM) and harvested after the indicated time. The 0 h condition represents cells kept in medium with IL-3. RNA levels were analyzed by qRT-PCR with primers for Puma and L32 as internal reference. Data points show relative (mRNA) Puma induction compared to cells kept in medium with IL-3. Error bars represent SD from technical replicates. f Cells from a were subjected to western blotting and analyzed with the antibodies indicated. Official journal of the Cell Death Differentiation Association 8h 16h 24h crLUC +IL3 crLUC crLUC -IL3 crPuma #1 Puma-/- +IL3 crPuma#2 Puma-/- -IL3 crBim #1 crBim #2 0h 2,5h crLUC +IL3 5h crLUC -IL3 7,5 h Bim-/- +IL3 Bim-/- -IL3 fold induction % Annexin V positive cells % Annexin V positive cells % Annexin V positive cells % Annexin V positive cells +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT Schubert et al. Cell Death and Disease (2018) 9:470 Page 4 of 13 A B +/+ -/- p53 p53 +IL3 -IL3 -IL3 + CT98014 26kDa PUMA 55kDa p53 55kDa TUBULIN ns -20 -/- crLUC p53 clones D 0.8 -/- p53 clones 0.6 +- +- +- +- +- +- +- +- +- +- IL3 0.4 25kDa PUMA 0.2 GSK-3A 46kDa GSK-3B 0.0 0.8 -/- p53 clones 0.6 0.4 25kDa PUMA 0.2 GSK-3A 46kDa GSK-3B 0.0 −/− +/+ Fig. 2 p53 has a minor role for GSK-3-dependent PUMA induction. a HCT116 p53 or p53 were treated with GDC-0941 (GDC, 10 µM), CT98014 (CT, 0.75 µM), or a combination of both for 7 h. The cells were harvested, subjected to western blotting and analyzed by the antibodies indicated. b Ba/F3 expressing CRISPR/Cas9 targeting p53 or Luciferase were deprived of IL-3, in presence or absence of CT98014 (0.75 µM) for 18 h and −/− analyzed for apoptosis by Annexin V staining. Error bars represent SD from technical replicates. c Ba/F3 p53 single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from two independent −/− experiments (n= 2). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns= not significant. d Ba/F3 p53 single-cell clones and two independent cell lines of Ba/F3 cells infected with CRISPR/Cas9 targeting Luciferase were deprived of IL-3 for 12 h, harvested and analyzed by western blotting by probing with antibodies as indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels −/− were normalized to GSK-3 levels (loading control). e Ba/F3 p53 single-cell clones and two independent cell lines of Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were treated with LY294002 (10 µM) or DMSO (−) for 18 h, harvested and analyzed by western blotting with the antibodies indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels were normalized to GSK-3 levels (loading control). Official journal of the Cell Death Differentiation Association +IL3 -IL3 +IL3 -IL3 crLUC crp53 #1 crp53 #2 crLUC +IL3 crLUC -IL3 p53-/- +IL3 p53-/- -IL3 crLUC +DMSO crLUC +LY p53-/- +DMSO p53-/- +LY % Annexin V positive cells NN crLUC crLUC LY GDC crLUC crLUC LY CT #1 #1 LY GDC + CT #2 #2 LY NN #3 #3 LY GDC #4 #4 CT LY GDC + CT #5 #5 LY #6 #6 LY #7 #7 LY #8 #8 LY % Annexin V positive cells relative quantification relative quantification Schubert et al. Cell Death and Disease (2018) 9:470 Page 5 of 13 modest (Fig. 2c). Interestingly, a variation in IL-3-induced PUMA induction was absent upon treatment with apoptosis was also observed in different single-cell clones LY294002 (Fig. 4b) or IL-3 withdrawal (Fig. 4c) in these expressing CRISPR/Cas9 targeting Luciferase and—of cells. Thus, p53 and FOXO3A together are required for note—in wild-type Ba/F3 cells, indicating that individual PUMA upregulation and apoptosis upon IL-3 withdrawal, clones always seems to exhibit some variation, even in the possibly also compensating for each other to some extent absence of previous manipulation. We therefore always in cells lacking either p53 or FOXO3A. analyzed a high number of clones (Fig. S2A+B). Con- −/− sistent with the modest protection of p53 single-cell The induction of Puma by FOXO3A depends on GSK-3 clones from IL-3 deprivation, PUMA induction was still To confirm the major role of FOXO3A and its GSK-3 −/− observed in p53 single-cell clones upon IL-3 with- dependency in IL-3 withdrawal-induced apoptosis, we re- drawal (Fig. 2d) or PI3K inhibition by LY294002 (Fig. 2e) expressed FOXO3A with silent mutations, rendering it and was still dependent on GSK-3 (Fig. S2C). However, resistant to CRISPR/Cas9 cleavage, in a Ba/F3 bulk cul- the quantification of PUMA expression levels revealed ture which expressed a CRISPR/Cas9 construct targeting −/− that, while Puma was still induced, the PUMA protein Foxo3a (Fig. 5a) as well as in a Foxo3a single-cell clone −/− levels were generally somewhat reduced in p53 cells (Fig. 5b). Re-expression of FOXO3A re-established (Fig. 2e, right). Together, although there is a GSK-3- apoptosis induction to a comparable level as in control dependent effect of p53 on PUMA and apoptosis induc- cells transduced with FOXO3A in bulk culture and the tion, p53 seems not to be the main GSK-3-dependent single-cell clone (Fig. 5a, b). Importantly, restoring transcription factor responsible for the induction of FOXO3A and thereby the competence to undergo apop- PUMA and apoptosis upon IL-3 withdrawal. tosis did not relieve the requirement for GSK-3 activity, as inhibition of GSK-3 suppressed apoptosis induced by IL-3 FOXO3A is an important Puma inducer upon growth factor withdrawal in FOXO3A overexpressing cells. Thus, deprivation FOXO3A-dependent PUMA and apoptosis induction To test other transcription factors for their role in upon growth factor withdrawal requires GSK-3. Of note, inducing Puma upon IL-3 deprivation, we generated Ba/ the induction of apoptosis as well as the induction of −/− F3 expressing CRISPR/Cas9 targeting Foxo1, Foxo3a, and PUMA in Foxo3a cells was still dependent on GSK-3 the p53 relatives p63 and p73. We then subjected these (Fig. S4A+B), confirming that the regulation of PUMA by cells to IL-3 withdrawal and analyzed apoptosis induction. p53 is also controlled by GSK-3 . Among the cells we tested, only Foxo3a-targeted cells While PUMA protein levels were reduced in empty −/− showed a protection from IL-3 deprivation (Fig. 3a, vector-transduced Foxo3a cells upon IL-3 withdrawal, −/− Fig. S3A). Single-cell clones generated from these cells PUMA induction was restored in Foxo3a cells re- again showed a wide distribution of sensitivity to IL-3 expressing CRISPR/Cas9-resistant FOXO3A (Fig. 5c). withdrawal but were on average significantly protected Consistently, FOXO3A overexpression in HCT116 −/− −/− compared to control cells (Fig. 3b). The Foxo3a single- p53 cells increased PUMA induction in cells treated cell clones showed a diminished capacity to induce with the AKT inhibitor GDC-0941 (Fig. 5d). We therefore PUMA upon IL-3 withdrawal (Fig. S3B). Because of the conclude that FOXO3A induces Puma when Ba/F3 are −/− high variation of individual Foxo3a single-cell clones deprived of IL-3, while p53 contributes to this induction, to induce PUMA, they were pooled and we observed a and that both transcription factors require GSK-3 activity clear reduction of the signal for PUMA upon IL-3 with- for the induction of PUMA and apoptosis. −/− drawal (Fig. 3d). Likewise, Foxo3a single-cell clones treated with the PI3K inhibitor LY294002 exhibited FOXO3A requires GSK-3 activity for full transcriptional reduced Puma induction, as evident from the quantifi- activity cation of the PUMA expression levels (Fig. 3d). As shown above, the pharmacological inhibition of GSK-3 was sufficient to prevent growth factor Double knockout of Foxo3a and p53 fully protects cells withdrawal-induced PUMA induction and apoptosis. We from IL-3-induced apoptosis and prevents Puma induction previously demonstrated that when p53 is stabilized by We next addressed the combined role of p53 and DNA damage, GSK-3 activity regulates the capacity of p53 FOXO3A to induce apoptosis and PUMA upon IL-3 to induce Puma by phosphorylating Tip60 at S86, which withdrawal. We generated cells expressing CRISPR/Cas9 stimulates Tip60 to acetylate lysine 120 (K120) of p53 . targeting p53 and Foxo3a simultaneously and identified K120-acetylated p53 then induces Puma which leads to 12–14 −/− two single-cell clones with frameshift mutations on both apoptosis . However, in p53 cells we observed alleles of each p53 and Foxo3a (double knock out, DKO). FOXO3A-dependent PUMA induction and apoptosis, As shown in Fig. 4a, both DKO clones were protected which was also dependent on GSK-3 activity (Figs. 2a–c from IL-3 deprivation-induced apoptosis. In line with this, and 5d). To investigate the role of GSK-3 for the Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 6 of 13 A B P ≤ 0.01 +IL3 ** -IL3 80 P ≤ 0.05 -IL3 + CT -/- crLUC Foxo3a clones Foxo3a-/- crLUC +- +- IL3 PUMA 25kDa 58kDa TUBULIN D -/- Foxo3a clones PUMA 25kDa GSK-3A 46kDa GSK-3B 0.8 0.6 0.4 0.2 0.0 Fig. 3 FOXO3A is an important Puma inducer upon growth factor deprivation. a Ba/F3 expressing CRISPR/Cas9 targeting Foxo3a, Foxo1,or Luciferase were deprived of IL-3 in the presence or absence of CT98014 (0.75 µM) for 18 h and analyzed for apoptosis by Annexin V staining. b Ba/F3 −/− Foxo3a single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of three independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from three independent experiments (n = 3). Significance was tested by one-way ANOVA with post hoc Tukey’s −/− multiple comparison test. c Equal cell numbers of eight different Ba/F3 Foxo3a single-cell clones were pooled. This pool and Ba/F3 expressing CRISPR/Cas9 targeting Luciferase were deprived of IL-3 for 9 h, harvested and analyzed by western blotting with the antibodies indicated. d Ba/F3 −/− Foxo3a single-cell clones and two independent cell lines of Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were treated with LY294002 (10 µM) or DMSO (−) for 18 h, harvested and analyzed by western blotting with the antibodies indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels were normalized to GSK-3 levels (loading control). transcriptional regulation of Puma by FOXO3A, we phosphorylation of FOXO3A residues T32, S253, and generated a promoter reporter system where Luciferase S315 by AKT results in retention of the transcription expression is under control of the Puma promoter, which factor in the cytosol . We expressed a FOXO3A-triple includes a binding site for FOXO3A . It is well established mutant (TM; T32A-S253A-S315A), which cannot be that FOXO3A is controlled by the PI3K/AKT pathway as phosphorylated by AKT and is considered to be Official journal of the Cell Death Differentiation Association crLUC crFoxo1 #1 crFoxo1 #2 crFoxo3a #1 crFoxo3a #2 +IL3 -IL3 +IL3 crLUC +DMSO crLUC +LY -IL3 Foxo3a-/- +DMSO Foxo3a-/- +LY % Annexin V positive cells relative quantification crLUC LY crLUC LY #1 LY #2 LY #3 LY #4 LY #5 LY #6 % Annexin V positive cells LY #7 LY #8 LY Schubert et al. Cell Death and Disease (2018) 9:470 Page 7 of 13 P ≤ 0.001 A B crLUC DKO #1 DKO #2 *** P ≤ 0.001 - +-+-+ LY *** crLUC 100kDa FOXO3A DKO #1 DKO #2 PUMA 25kDa 32kDa 14-3-3 20 C crLUC DKO #1 DKO #2 ns + -+-+- IL3 100kDa FOXO3A PUMA 25kDa 32kDa 14-3-3 −/− Fig. 4 Double knockout of Foxo3a and p53 fully protects cells from IL-3-induced apoptosis and prevents Puma induction. a Ba/F3 p53 −/− Foxo3a single-cell clones (DKO #1 and DKO #2) and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase (crLUC) were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Error bars represent 95% confidence intervals from four independent experiments (n = 4). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns = not significant. ***P < 0,001. b The same cells were treated with LY294002 (10 µM) for 18 h or left untreated. The cells were harvested after the treatment and subjected to western blotting. The protein levels were analyzed by the antibodies indicated. c The same cells were deprived of IL-3 for 18 h, harvested after the treatment and subjected to western blotting. constitutive active, along with the Puma promoter FOXO3A-mediated transcription by GSK-3 is indepen- reporter constructs. As shown in Fig. 6a, overexpression dent of FOXO3A translocation. Interestingly, we observed of FOXO3A-TM induced Luciferase expression con- an interaction of GSK-3 with FLAG-tagged FOXO3A trolled by the Puma promoter. This was dependent on a overexpressed in 293T HEK cells (Fig. 6c). Together, the FOXO3A binding site in the promoter region, as muta- results show that activity of GSK-3 is decisive for the tion of the binding site for FOXO3A prevented Luciferase FOXO3A and p53-mediated PUMA induction in the induction. However, when we added the GSK-3 inhibitor absence of PI3K signaling. CT98014, the ability of FOXO3A-TM to induce Lucifer- ase through the Puma promoter was substantially Discussion decreased. We therefore conclude that FOXO3A, in order We had previously shown that GSK-3 phosphorylates to fully exhibit its transcriptional activity at the Puma the anti-apoptotic protein MCL-1 upon growth factor promoter, requires not only the dephosphorylation of withdrawal or PI3K inhibition, which regulates lympho- 9,15 AKT phosphorylation sites in FOXO3A, but also the cyte survival . In this study, we aimed at systematically activity of GSK-3. identifying the GSK-3-dependent pro-apoptotic factors, We next established Ba/F3 cell lines overexpressing promoting apoptosis upon depletion from growth factor. FOXO3A-TM. We expressed FOXO3A-TM with silent We showed that PUMA rather than BIM mediates IL-3 mutations, mediating resistance to CRISPR/Cas9 clea- withdrawal-induced apoptosis, although both proteins vage, in a Ba/F3 bulk culture expressing a CRISPR/Cas9 were upregulated upon IL-3 deprivation (data not shown). construct targeting Foxo3a, or in control cells with In line with our data, it was previously shown that PUMA 5,16 CRISPR/Cas9 targeting Luciferase. This led to a slightly and BIM are induced by IL-2 withdrawal . Our findings increased background of apoptosis even when IL-3 was also confirm a previous report that IL-3-dependent available. However, although FOXO3A-TM is considered myeloid cell lines from mice lacking PUMA, but not to be constitutively active, IL-3 deprivation was required BIM, were protected from IL-3 withdrawal-induced to induce apoptosis (Fig. 6b, left). Importantly, apoptosis apoptosis . could be inhibited by addition of CT98014 (Fig. 6b, right), FOXO3A and p53 were both described to be important showing that FOXO3A-TM (which is not controlled by for growth factor withdrawal-induced apoptosis. AKT) requires GSK-3 activity to induce apoptosis upon FOXO3A deficiency can protect cells from cytokine 16,18 IL-3 withdrawal. As the inhibition of GSK-3 did not affect withdrawal-induced apoptosis , and FOXO3A was the binding to 14-3-3 proteins (Fig. 6c) or the nuclear shown to be crucial for PUMA induction upon growth localization of FOXO3A (Fig. S5A), the regulation of factor withdrawal . It was also found that p53, FOXO and Official journal of the Cell Death Differentiation Association +IL3 -IL3 % Annexin V positive cells Schubert et al. Cell Death and Disease (2018) 9:470 Page 8 of 13 A B P ≤ 0.001 crLUC + EV crLUC + EV *** P ≤ 0.001 Foxo3a-/- + EV crFoxo3a + EV *** P ≤ 0.001 ns crLUC + FOXO3A crLUC + FOXO3A *** Foxo3a-/- + FOXO3A crFoxo3a + FOXO3A 0 0 emtpy vector FOXO3A -/- -/- wt Foxo3a wt Foxo3a +- -+- - +- -+- - IL3 -- + - - + -- + - - + CT PUMA 25kDa 100kDa FOXO3A 58kDa TUBULIN -+ -+ GDC 100kDa FOXO3A 25kDa PUMA 46kDa GSK-3A GSK-3B 58kDa TUBULIN Fig. 5 The induction of Puma by FOXO3A depends on GSK-3. a Ba/F3 cells expressing CRISPR/Cas9 constructs targeting Luciferase or Foxo3a were infected with retrovirus encoding CRISPR/Cas9-resistant human FOXO3A control retrovirus (empty vector, EV). The cells were deprived of IL-3 in the presence or absence of CT98014 (CT, 0.75 µM) for 18 h and analyzed for apoptosis by Annexin V staining. The significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. Error bars represent 95% confidence intervals from four independent experiments (n = 4). b −/− Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase (crLUC) or a Foxo3a single-cell clone (#4) were infected with retrovirus expressing human FOXO3A or none (empty vector, EV). The cells were deprived of IL-3 in presence or absence of CT98014 (0.75 µM, CT) for 18 h, then analyzed for apoptosis by Annexin V staining. Error bars represent SD from technical replicates. c Cells from b were harvested after 18 h and analyzed by −/− western blotting with the antibodies indicated. d HCT116 p53 cells were transfected by Lipofectamine2000® with vectors encoding FOXO3A or control vector (empty). Twenty-four hours after transfection, the cells were treated with DMSO or GDC-0941 (10 µM) for 5 h. The cells were harvested and analyzed by western blotting, probing with antibodies as indicated. Official journal of the Cell Death Differentiation Association +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT % Annexin V positive cells empty FOXO3A % Annexin V positive cells Schubert et al. Cell Death and Disease (2018) 9:470 Page 9 of 13 crLUC + EV A B Foxo3a-/- + EV crLUC + FOXO3A-TM Foxo3a-/- + FOXO3A-TM DMSO CT 0 0 Puma promoter EV FOXO3A-TM IP:FLAG Input FLAG-FOXO3A FLAG-FOXO3A -+ - + - CT98014 CT98014 -+ - + - 100kDa 100kDa FOXO3A FOXO3A 32kDa 32kDa 14-3-3 14-3-3 GSK-3A GSK-3A 46kDa 46kDa GSK-3B GSK-3B 58kDa 58kDa P53 P53 Fig. 6 FOXO3A requires GSK-3 activity for full transcriptional activity. a 293T HEK cells were transfected with a reporter plasmid with Luciferase driven by a wild type (wt) or FOXO3A binding site mutant (FoxoBSmut) Puma promoter fragment, a Renilla reporter plasmid as internal control and a construct encoding FOXO3A-TM or empty vector. Eight hours after transfection, the cells were treated with CT98014 (CT, 0.75 µM,) or DMSO for 18 h. Luciferase activity was analyzed and normalized to Renilla activity. Error bars represent SD from technical replicates. b Ba/F3 cells expressing CRISPR/ −/− Cas9 constructs targeting Luciferase or a Foxo3a single-cell clone were infected with retrovirus expressing human FOXO3A-TM or none (empty vector, EV). The cells were deprived of IL-3+/− CT98014 (CT, 0.75 µM) for 18 h, then stained with Annexin-V-FITC and analyzed by flow cytometry. Error bars represent SD from technical replicates. This experiment was done together with the one shown in Fig. 5b, and the controls are identical. c HEK 293T cell were transfected with constructs encoding wild-type, FLAG-tagged FOXO3A (wt) or FLAG-tagged FOXO3A-TM (TM) or control vector (−). Eight hours later, the cells were treated with CT98014 (0.75 µM) or left untreated for 18 h. The cells were lysed and 2% of the lysate were kept as input. FLAG immunoprecipitation was performed with the remaining lysate. After washing and elution with 3xFLAG peptide, eluate and input fractions were analyzed by western blotting with the antibodies indicated. E-box-binding transcription factors share many targeted which further supports the important apoptosis- genes in response to PI3K inhibition in Rat-1 cells and a regulatory role of the PI3K/AKT pathway also in dominant-negative p53 resulted in partial resistance to absence of p53. apoptosis upon PI3K inhibition . Likewise, HoxB8- We have shown that the induction of Puma by transformed factor-dependent myeloid (FDM) cells from FOXO3A and/or p53 is dependent on GSK-3 activity. −/− p53 mice were less sensitive for IL-3 deprivation- Importantly, we observed that even the transcriptional induced cell death and showed reduced PUMA induction. activity of a FOXO3A-TM mutant, which is considered −/− In this study, FDM cells from FOXO3A mice showed constitutively active due to the loss of the AKT phos- an even higher susceptibility to cell death after IL-3 loss . phorylation sites, required GSK-3. Our results suggest The same authors reported that PUMA induction was that the inhibition of GSK-3 is the key pro-survival independent of PI3K, a finding which is not confirmed by function of PI3K signaling, being more important than the 17,21 our data . Instead, we found that inhibition of the inactivation of FOXO3A. In line with this finding, full −/− PI3K/AKT pathway upregulated PUMA in p53 transcriptional activity of Foxo1/3/4 was shown to require HCT116 cells and Ba/F3 cells. GSK-3, as the induction of IGF-IR gene by serum star- In addition, p53 negative Ba/F3 cells were fully pro- vation or AKT inhibition required both active GSK-3 and tected from apoptosis only when GSK-3 was inhibited, Foxo1/3/4 . Supporting a PI3K-dependent regulation of Official journal of the Cell Death Differentiation Association wt FoxoBSmut wt FoxoBSmut +IL3 -IL3 -IL3 + CT relative induction to control wt wt TM TM % Annexin V positive cells wt wt TM TM - Schubert et al. Cell Death and Disease (2018) 9:470 Page 10 of 13 FOXO3A independent of the AKT phosphorylation sites, Table 1 gRNAs the DNA-binding and transcriptional activity of a triple S/ Target gRNA name gRNA sequence (20xN-NGG) A mutant of the Foxo homolog in C. elegans, DAF-16, which is considered constitutive active, was shown to be p53 Exon3 p53 gRNA #1 (759) AGTGAAGCCCTCCGAGTGTC-AGG further increased by PI3K inhibition by LY294002 and 22 p53 Exon3 p53 gRNA #2 (760) AGGAGCTCCTGACACTCGGA-GGG Wortmannin . Interestingly, promotion of FOXO3A p53 Exon3 p53 gRNA #3 (761) GACACTCGGAGGGCTTCACT-TGG activity to induce PUMA by GSK-3 was independent of the interaction of FOXO3A with 14-3-3 or its subcellular p63 Exon3 p63 gRNA #1 TCCACAAAGTTCAACTCGAT-GGG localization. p63 Exon4 p63 gRNA #2 CCGTCACGCTATTCTGTGCG-TGG It is not clear however, how GSK-3 and FOXO3A p63 Exon4 p63 gRNA #3 AGCCCCAGGTTCGTGTACTG-TGG cooperate. In a study of Terragni et al., upregulated genes p73 Exon3 p73 gRNA #1 CCGGGGTAGTCGGTATTGGA-AGG upon inhibition of PI3K were co-regulated by FOXO3A, MITF, and USF1, with the latter two being regulated by p73 Exon3 p73 gRNA #2 CGGGGTGTAGGGGCTCGCCG-GGG GSK-3 . Another explanation for the functional inter- Puma Exon1 Puma gRNA #1 ATGGCCCGCGCACGCCAGGA-GGG action of FOXO3A and GSK-3 could be provided by the Puma Exon1 Puma gRNA #2 AGCTCTCCGGAGCCCGTAGA-GGG regulation of TIP60. We could previously demonstrate the Puma Exon1 Puma gRNA #3 GGAAGGGGCGCGGACTGTCG-CGG requirement of GSK-3 for Puma induction by p53 in the context of DNA damage and subsequent p53 stabilization Bim Exon1 Bim gRNA #1 ACTTACATCAGAAGGTTGCT-TGG by the phosphorylation of the histone acetyl transferase Bim Exon1 Bim gRNA #2 TTGCGGTTCTGTCTGTAGGG-AGG Tip60 (KAT5). Increased KAT activity of Tip60 is induced Foxo1 Exon1 Foxo1 gRNA #1 TCGTCGCGCCGCAACGCGTG-GGG by GSK-3 mediated phosphorylation, resulting in the Foxo1 Exon1 Foxo1 gRNA #2 GGAGAGTGAGGACTTCGCGC-GGG acetylation of p53 in the DNA-binding domain at lysine 120, which enables p53 to promote the transcription of Foxo3a Exon1 Foxo3a gRNA #1 CACGCCGCCACCGATCACCA-TGG Puma. It is possible that GSK-3 activated Tip60 acts on Foxo3a Exon1 Foxo3a gRNA #2 TCTCGATGGCGCGGGTGATC-AGG chromatin or FOXO3A directly, thereby promoting 6 Luciferase Luciferase gRNA ACCGCTCCGGCGAAGGCGAA-NGG transcriptional Puma induction . A direct phosphorylation of FOXO3A by GSK-3 would also be a possibility as to how GSK-3 directly promotes the transcriptional activity of FOXO3A, which would be Puma (#12450), Foxo3a (#2497) were from Cell Signaling consistent with our data demonstrating a cooperation of Technologies (Danvers, MA, USA). GSK3a/b (sc-56913), FOXO3A-TM and GSK-3 for the regulation of the Puma 14-3-3 (sc-1657) and NFATc1 (sc-7294) were from Santa promoter. Cruz (Dallas, TX, USA). Tubulin (MCA77G) was from Together, in this study, we provide evidence that Puma Bio-Rad (Hercules, CA, USA). MCL1 (600-401-394S) was induction by FOXO3A is an important step in IL-3 from Rockland (Limerick, PA, USA). withdrawal-induced apoptosis, and that the Puma indu- FLAG-M2 agarose affinity beads were from Sigma- cing function of FOXO3A is dependent on GSK-3 activity. Aldrich (St. Louis, MO, USA). Thus, GSK-3 is crucial for the full activation of FOXO3A transcriptional activity when the PI3K pathway is not Generation of ko cell lines using lentiviral CRISPR/Cas9 active. As pharmacological modulation of kinase signaling The lentiCRISPRV2 system was used to generate ko pathways is a promising strategy for cancer therapy, a cells as described by others . At least two different guide more detailed understanding of the underlying mechan- RNAs for each target were designed using crispr.mit.edu isms will improve defining the crucial targets. and a guide RNA targeting Luciferase was designed as control (see Table 1: gRNAs). The guide RNAs were Materials and methods cloned into the lentiCRISPRV2 plasmid (a gift from Feng Reagents and antibodies Zhang, Addgene plasmid # 52961) and lentiviral particles LY294002 was from Sigma-Aldrich (St. Louis, MO, were produced by transfection of 5 μg lentiCRISPRv2, 1.5 USA), GDC-0941 and CT98014 were from Axon Med- μg pMISSIONVSV-G (Sigma-Aldrich) and 3 μg pMIS- chem (Groningen, Netherlands), Annexin-V-FITC was SION GAG POL (Sigma-Aldrich) with Attractene generated in our lab. Annexin-V-APC (RUO) was from (Quiagen, Hilden, Germany) into 293T HEK cells seeded Becton Dickinson (Franklin Lakes, NJ, USA). 4-OHT was at 25% confluency in a 78-cm² culture plate the day before from Sigma-Aldrich (St. Louis, MO, USA). transfection. The morning after transfection, fresh med- IL-2 and IL-3 were from Peprotech (Rocky Hill, NJ, USA). ium was added. In the evening, 4 ml medium was added. The following antibodies were used for western blotting: The next day, viral supernatants were harvested, filtered Puma (#3043) was from Prosci (Poway, CA, USA), human (0,45 μM) and supplemented with 5 μg/ml polybrene Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 11 of 13 Table 2 Primers 20 ng/ml PMA and 0.5 μg/ml ionomycin for 48 h in RPMI-1640 with 10% FSC and P/S. The cells were then Primer Sequence (5′-3′) cultured in the medium containing 100 U/ml recombi- nant IL-2 for 24 h and then used for experiments. For p53 for TGTCTGTAAATCCTGCGGGG growth factor withdrawal, cells were washed twice with p53 rev GAGGCTAAAAAGGTTCAGGGC 50 ml PBS and resuspended in RPMI-1640 with 10% FCS p63 Exon3 for TAAGACGGTGAGCCACTCCA and P/S. p63 Exon3 rev CCCACTGCAGAAAGCTGAGA Flow cytometry p63 Exon4 for GATGGGTGGCTTTACTTGGGA For apoptosis quantification by flow cytometry, BaF3 or p63 Exon4 rev ACACACCCTGGAACCTGTCT FL5.12 were deprived of IL-3 in the presence or absence p73 for CTACTCACTGTCCAGGTGGC of CT98014 (0.75 μM) for 18 h or as indicated. Activated lymphocytes were deprived of IL-2 in the presence or p73 rev ACAAGTAGTGGCCTGTTGGG absence of CT98014 (0.75 μM) for 22 h. The cells were Puma for TTCCTGGGTGGGAGTGACTT washed once with Annexin-V Binding Buffer (10 mM Puma rev AGGGACTTCCCACTCGACTT HEPES, 150 mM NaCl, 150 μM MgCl, 2.5 mM CaCl ) Bim for ACGAAATGTAGACGTCCCGC stained for 15 min in the dark with Annexin-V-FITC or Annexin-V-APC in the same buffer. The fraction of Bim rev CCCACAGCCTTGAAACCGAT Annexin-V-positive cells was measured using a FACS Foxo1 for AACCAGTCCAACTCGACCAC Calibur (BD Bioscience) or FACS LSRII (BD Bioscience). Foxo1 rev AAGTTCCCAAACGAGCCCTG Foxo3a for GGAGAGAGCAAGAGCCCAAG Western blotting Cells were harvested and washed with ice-cold PBS. Foxo3a rev GACCCTCCCTTCCCACTTTG Cells pellets were lysed for 5 min on ice with lysis buffer qRT-PCR Puma for GCCCAGCAGCACTTAGAGTC (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X- qRT-PCR Puma rev GGTGTCGATGCTGCTCTTCT 100, 1× protease inhibitor cocktail (Roche), phosphatase qRT-PCR L32 for TTAAGCGAAACTGGCGGAAAC inhibitor cocktail 1 (1:50, Sigma-Aldrich), MG132 (20 μM, Alexis Biochemicals)) or by nuclear fractionation as qRT-PCR L32 rev TTGTTGGTCCCATAACCGATG described . Lysates were cleared by centrifugation at 16.100×g for 10 min, 4 °C. Protein concentration was determined using Bradford reagent (Bio-Rad). Lämmli (Sigma-Aldrich). The target cells were infected by spin- buffer was added to 10–100 μg of protein lysate and fection at 400×g for 10 min. The following day, selection samples were boiled at 95 °C for 5 min. In some cases, the was started using 4 μg/ml puromycin (Sigma-Aldrich) for same amount of lysate was loaded on a second gel to at least 3 days and until no viable cells were detected in an probe for several antibodies. Proteins were separated by uninfected control. Mix cultures were tested for Cas9 SDS-PAGE and transferred to nitrocellulose membranes. cleavage by performing a Surveyor assay. The region of The membranes were blocked in 3% dry milk in TBS- interest was amplified by PCR using the primers listed Tween20 (0.1%) (TBS-T) and then incubated at 4 °C (Table 2: Primers). The Surveyor assay was performed overnight with the primary antibody diluted in 3% dry according to the manufacturer (Integrated DNA Tech- milk in TBS-T. The membranes were washed three times nologies). The mix cultures were used for experiments with TBS-T, incubated for 1 h with horseradish perox- and to generate single-cell clones by limited dilution. idase (HRP)-conjugated secondary antibody at room Single-cell clones were analyzed by sequencing and clones temperature and washed three times with TSB-T. Band with a bi-allelic shift in the open reading frame generating visualization was achieved using Super Signal West Pico a premature STOP codon were chosen. Chemiluminescent Substrate (Thermo Scientific, Wal- tham, USA) and the Fusion Solo imaging system (Vilber Cell culture and treatment Lourmat, Eberhardzell, Germany). −/− +/+ HCT116 p53 , HCT116 p53 (kindly provided by Bert Vogelstein) and HCT116 (ATCC) were maintained Luciferase reporter assay in DMEM containing 10% FCS and Penicillin/Strepto- 293T HEK cells in 24-well plates were transfected with a mycin (P/S). FL5.12 and BaF3 were maintained in RPMI- total amount of 1 μg DNA by Attractene. A renilla luci- 1640 with 10% FCS, P/S and 1 μg/l recombinant IL-3. To ferase expression plasmid (Promega, Madison, WI, USA) generate IL-2-dependent lymphoid cells, lymph node cells as internal control, a luciferase reporter plasmid driven by from three C57/Bl6 mice were isolated and activated by a 1.7 kb Puma promotor region (−1200 to +500 from Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 12 of 13 ATG) containing a conserved binding site for FOXO3A 1.5 μg pLXIN-hFOXO3A, plXIN-hFOXO3A-TM, or (CAAACAAT or mutated to CAGGGAAT) and pLXIN-emtpy. Only BaF3 expressing lentiCRISPRv2 FOXO3A-TM (T32A, S253A, S315A) pcDNA3.1 expres- gRNA #1 targeting mouse Foxo3a were used, as human sion plasmid were used in a 1:1:1 ratio. Empty vector was Foxo3a is also targeted by mouse Foxo3a gRNA #2. added as needed to keep the total DNA constant. Eight Selection was achieved with 50 ng/mL Geneticin™ hours after transfection DMSO or CT98014 (0.75 μM) (ThermoFisher, Waltham, MA, USA). Experiments were performed immediately after successful selection. were added. Cells were lysed using 100 μl luciferase-lysis buffer (50 mM Tris-phosphate pH 7.8, 250 mM KCl, 10% −/− Glycerol, 0.1% NP-40), lysates cleared by centrifugation at Overexpression of FOXO3A in HCT116 p53 −/− 16.100×g for 5 min, 4 °C. A volume of 10 μl of the lysate HCT116 p53 in six-well plates were transfected by was added in two black 96-well plates, renilla buffer (25 Lipofectamine® 2000 with pECE-FLAG-FOXO3A or mM Tris-phosphate, 100 mM NaCl, 1 mM EDTA, 0.05 empty vector according to the manufacturer’s protocol. mM Coelenterazin) or luciferase buffer (25 mM Tris- Twenty-four hours after transfection, the cells were phosphate, 10 mM MgSO , 2 mM ATP, 0.05 mM Luci- treated with GDC-0941 (10 μM) for 5 h and then sub- ferin) were auto-injected and firefly and renilla luciferase jected to western blotting. activities were determined by a plate reader. Statistical analysis Immunoprecipitation All data are shown as mean ± S.D. in case of technical 293T HEK cells of a 78 cm² culture plate were trans- replicates and as mean ± 95% confidence interval in case fected by PEI with pECE-FLAG-Foxo3a or pECE-FLAG- of biological replicates. The GraphPad Prism 5 software FOXO3A-TM (gifts from Michael Greenberg (Addgene (GraphPad Software Inc., La Jolla, CA, USA) was applied plasmid # 8360 and # 8361) ) and treated with CT98014 for statistical analysis using the one-way ANOVA with (0.75 μM) 8 h later. The next day, the cells were lysed in 1 post hoc Tukey’s multiple comparison test. P ≤ 0.05 was ml lysis buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, regarded as the threshold value for statistical significance. 1% Triton X-100, 1× protease inhibitor cocktail (Roche), *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001. phosphatase inhibitor cocktail 1 (1:50, Sigma-Aldrich), MG132 (20 μM, Alexis Biochemicals)). A volume of 20 μl Acknowledgements TAM We thank Martin Schuler for the p53-ER plasmid, Andreas Hecht for advice were kept as input control and the remaining lysate was and discussions, Karin Neubert for excellent technical assistance and Celia rotated for 2 h with 20 μl FLAG-M2 agarose affinity beads Jakob for initial experiments. This study was supported by Grants Ma 1967/1 (Sigma Aldrich). Beads were washed three times with lysis and Ma 1967/2 from the Deutsche Forschungsgemeinschaft to U.M., Grants buffer for 3 min. Immunoprecipitates were eluted in 50 μl 109199, 107397, and 112140 from the Deutsche Krebshilfe to U.M., by funding from the Centre for Biological Signalling Studies (BIOSS, EXC‐294), Freiburg, lysis buffer with 3× FLAG® peptide (150 ng/μl, Sigma- Germany to C.B. and U.M., and the Spemann Graduate School of Biology and Aldrich) by rotation for 30 min at 4 °C. Eluates were then Medicine (SGBM, GSC‐4), Freiburg, Germany, to C.B. and U.M. both funded by subjected to western blotting. the Excellence Initiative of the German Federal and State Governments, Germany. RT-PCR Total RNA was extracted using Trizol (Invitrogen, Author details Institute of Molecular Medicine and Cell Research, Faculty of Medicine, Albert- Carlsbad, CA, USA) according to the manufacturer’s Ludwigs-University of Freiburg, Freiburg, Germany. Spemann Graduate School protocol. 2 μg RNA were transcribed into cDNA using the of Biology and Medicine (SGBM), Albert-Ludwigs-University of Freiburg, SuperScript First Strand Synthesis Kit (Invitrogen). Freiburg, Germany. Faculty of Biology University of Freiburg Schänzlestrasse 1, 79104 Freiburg, Germany. BIOSS, Centre for Biological Signaling Studies, Transcript levels of Puma and L32 were quantified by Hebelstrasse 2, 79104 Freiburg, Germany. Functional Genomics and Cancer, quantitative RT-PCR on an CFX96TM Real Time System Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), INSERM thermocycler (Bio-Rad) with SYBR Green (Eurogentec, U964, CNRS UMR 7104, Université de Strasbourg, 1 rue Laurent Fries, Illkirch 67404, France Lüttich, Belgium). The following primers were used: mPuma: 5′-GCCCAGCAGCACTTAGAGTC-3′ and 5′- Conflict of interest GGTGTCGATGCTGCTCTTCT-3′; mL32: 5′-TTAAG- The authors declare that they have no conflict of interest. CGAAACTGGCGGAAAC-3′ and 5′-TTGTTGGTCCC- ATAACCGATG-3′. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in Re-expression of FOXO3A published maps and institutional affiliations. Production of retroviral particles and infection were performed as described above for lentiviral particles, but Supplementary Information accompanies this paper at https://doi.org/ using 1.5 μg Hit60, 1.5 μg pVSV-G (Clontech) and either 10.1038/s41419-018-0502-4. Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 13 of 13 Received: 18 December 2017 Revised: 9 March 2018 Accepted: 15 March 13. Tang, Y., Luo, J., Zhang, W. & Gu, W. Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Mol. Cell 24, 827–839 (2006). 14. Tang, Y., Zhao, W., Chen, Y., Zhao, Y. & Gu, W. Acetylation is indispensable for p53 activation. Cell 133,612–626 (2008). 15. Lindner, S. E. et al. Increased leukocyte survival and accelerated onset of References lymphoma in the absence of MCL-1 S159-phosphorylation. Oncogene 33, 1. Llambi, F. et al. A unified model of mammalian BCL-2 protein family inter- 5221–5224 (2014). actions at the mitochondria. Mol. Cell 44,517–531 (2011). 16. Stahl, M. et al. The Forkheadtranscription factor FoxO regulates tran- 2. Brunet, A. et al. Akt promotes cell survival by phosphorylating and inhibiting a scription of p27Kip1 and Bim in response to IL-2. J. Immunol. 168, Forkhead transcription factor. Cell 96, 857–868 (1999). 5024–5031 (2002). 3. Maurer, U., Preiss, F., Brauns-Schubert, P., Schlicher, L. & Charvet, C. GSK-3 17. Ekert,P.G.etal. Cell deathprovoked by loss of interleukin-3 signaling is – at the crossroads of cell death and survival. J. Cell Sci. 127, 1369–1378 independent of Bad, Bim, and PI3 kinase, but depends in part on Puma. Blood (2014). 108, 1461–1468 (2006). 4. Pap, M. & Cooper, G. M. Role of glycogen synthase kinase-3 in the phos- 18. Ekoff, M. et al. The BH3-only protein Puma plays an essential role in cytokine phatidylinositol 3-Kinase/Akt cell survival pathway. J. Biol. Chem. 273, deprivation-induced apoptosis of mast cells. Blood 110, 3209–3217 (2007). 19929–19932 (1998). 19. Nayak,G.&Cooper,G.M. p53 is amajor componentofthe transcriptionaland 5. You, H. et al. FOXO3a-dependent regulation of Puma in response to cytokine/ apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling. Cell Death Dis. growth factor withdrawal. J. Exp. Med. 203,1657–1663 (2006). 3, e400 (2012). 6. Charvet, C. et al. Phosphorylation of Tip60 by GSK-3 determines the induction 20. Jabbour,A.M.etal. Myeloidprogenitorcells lackingp53 exhibitdelayed up- of PUMA and apoptosis by p53. Mol. Cell 42,584–596 (2011). regulation of Puma and prolonged survival after cytokine deprivation. Blood 7. Ambacher, K. K. et al. The JNK- and AKT/GSK3β- signaling pathways converge 115,344–352 (2010). to regulate Puma induction and neuronal apoptosis induced by Trophic 21. Jabbour, A. M. et al. P53-dependent transcriptional responses to Interleukin-3 Factor deprivation. PLoS ONE 7, e46885 (2012). signaling. PLoS ONE 7, e31428 (2012). 8. Huo, X. et al. GSK3 protein positively regulates type I insulin-like growth factor 22. Cahill, C. M. et al. Phosphatidylinositol 3-Kinase signaling inhibits DAF-16 DNA receptor through Forkhead transcription factors FOXO1/3/4. J. Biol. Chem. 289, binding and function via 14-3-3-dependent and 14-3-3-independent path- 24759–24770 (2014). ways. J. Biol. Chem. 276,13402–13410 (2001). 9. Maurer, U., Charvet, C., Wagman, A. S., Dejardin, E. & Green, D. R. Glycogen 23. Terragni, J. et al. The E-box binding factors Max/Mnt, MITF, and USF1 act synthase kinase-3 regulates mitochondrial outer membrane permeabili- coordinately with FoxO to regulate expression of proapoptotic and cell cycle zation and apoptosis by destabilization of MCL-1. Mol. Cell 21, 749–760 control genes by phosphatidylinositol 3-kinase/akt/glycogen synthase kinase (2006). 3 signaling. J. Biol. Chem. 286, 36215–36227 (2011). 10. Nakano, K. & Vousden, K. H. PUMA, a novel proapoptotic gene, is induced by 24. Sanjana, N. E., Shalem, O. & Zhang, F. Improved vectors and genome-wide p53. Mol. Cell 7, 683–694 (2001). libraries for CRISPR screening. Nat. Methods 11,783–784 (2014). 11. Yu, J.,Zhang,L., Hwang, P. M.,Kinzler,K.W.&Vogelstein,B.PUMA 25. You, H., Yamamoto, K. & Mak, T. W. Regulation of transactivation-independent induces the rapid apoptosis of colorectal cancer cells. Mol. Cell 7, proapoptotic activity of p53 by FOXO3a. Proc. Natl Acad. Sci. USA 103, 673–682 (2001). 9051–9056 (2006). 12. Sykes,S.M.etal. Acetylationofthe p53 DNA-binding domain regulates 26. Brunet, A. et al. Stress-dependent regulation of FOXO transcription factors by apoptosis induction. Mol. Cell 24,841–851 (2006). the SIRT1 deacetylase. Science 303,2011–2015 (2004). Official journal of the Cell Death Differentiation Association http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Death & Disease Springer Journals
Free
13 pages

Loading next page...
 
/lp/springer_journal/requirement-of-gsk-3-for-puma-induction-upon-loss-of-pro-survival-pi3k-vqgQRvBhWu
Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s)
Subject
Life Sciences; Life Sciences, general; Biochemistry, general; Cell Biology; Immunology; Cell Culture; Antibodies
eISSN
2041-4889
D.O.I.
10.1038/s41419-018-0502-4
Publisher site
See Article on Publisher Site

Abstract

Growth factor withdrawal induces rapid apoptosis via mitochondrial outer membrane permeabilization. We had previously observed that cell death of IL-3-dependent Ba/F3 cells, induced by removal of the growth factor, required the activity of the kinase GSK-3. Employing CRISPR/Cas9-mediated gene knockout, we aimed to identify pro-apoptotic GSK-3 regulated factors in this process. Knockout of either Puma or Bim demonstrated that the induction of Puma, but not Bim, was crucial for apoptosis induced by IL-3 deprivation. Thus, we aimed at identifying the GSK-3-dependent PUMA regulator. Loss of FOXO3A reduced the induction of Puma, while additional loss of p53 completely repressed induction upon growth factor withdrawal. A constitutively active mutant of FOXO3A, which cannot be controlled by AKT directly, still required active GSK-3 for the full transcriptional induction of Puma and cell death upon IL-3 withdrawal. Thus, the suppression of GSK-3 is the key function of PI3K signaling in order to prevent the induction of Puma by FOXO3A and p53 and thereby apoptosis upon growth factor withdrawal. Introduction MOMP is controlled by growth factor availability, Growth factor signaling supports cell survival through which induces various pathways promoting cell survival. A key pro-survival pathway is the PI3K/AKT various pathways. Thus, deprivation of growth factor ultimately results in apoptosis. The decisive step for the signaling pathway, which can prevent MOMP and induction of intrinsic apoptosis is the mitochondrial outer apoptosis through regulating a number of substrates. membrane permeabilization (MOMP). This results in the For instance, AKT was shown to phosphorylate and release of cytochrome c and other proteins from the inactivate the transcription factor FOXO3A as well as mitochondrial intermembrane space into the cytosol, glycogen synthase kinase-3 (GSK-3). The inactivation of leading to apoptosome formation, caspase activation, and both FOXO3A and GSK-3 was shown to play an impor- apoptosis. MOMP is controlled by proteins of the BCL-2 tant role for the pro-survival activity of PI3K/AKT sig- 2–4 family. While the pro-apoptotic BCL-2 proteins BAX and naling . More specifically, it was shown that the BAK are required for the formation of a mitochondrial suppression of FOXO3A plays an essential role for the outer membrane pore, their activity is induced by BH3- suppression of Puma induction and cell death by PI3K only proteins (PUMA, BIM, Bid, and others). MOMP is signaling . prevented by related proteins with anti-apoptotic function The death promoting role of GSK-3 is instrumental for (like BCL-2, MCL-1, BCL-xL) . p53-mediated Puma induction and apoptosis: GSK-3 phosphorylates the histone acetyl transferase Tip60 (also known as KAT5), which stimulates Tip60 to acetylate p53 Correspondence: Ulrich Maurer (ulrich.maurer@mol-med.uni-freiburg.de) at K120, resulting in the transcriptional induction of Institute of Molecular Medicine and Cell Research, Faculty of Medicine, Albert- Ludwigs-University of Freiburg, Freiburg, Germany Puma and apoptosis upon induction of p53 . Interest- Spemann Graduate School of Biology and Medicine (SGBM), Albert-Ludwigs- ingly, GSK-3 was also shown to modulate the transcrip- University of Freiburg, Freiburg, Germany 7,8 tional activity of FOXO3A . Full list of author information is available at the end of the article Edited by G. Raschellà. © The Author(s) 2018 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; Schubert et al. Cell Death and Disease (2018) 9:470 Page 2 of 13 In the present study, employing knockout by CRISPR/ mRNA up to 2-fold after 7.5 h while Puma mRNA was Cas9, we systematically investigated the role of GSK-3- reduced upon treatment with CT98014 in the absence of dependent factors required for apoptosis induction by IL- IL-3 (Fig. 1e). This effect was reflected by the protein 3 deprivation. We show that PUMA is the main pro- levels of PUMA in Ba/F3 wt cells: PUMA was induced apoptotic protein responsible for apoptosis in this con- upon IL-3 withdrawal, but this upregulation was com- text, and that the induction of Puma is mediated by a pletely blocked by addition of CT98014 (Fig. 1f). Loss of PI3K is permitting GSK-3 activity by relieving the sup- FOXO3A-, p53-, and GSK-3-dependent mechanism. pression of GSK-3 by AKT-mediated phosphorylation. Results Consistently, we found that the pharmacological inhibi- Apoptosis induced by growth factor withdrawal requires tion of PI3K resulted in strong induction of PUMA GSK-3-dependent PUMA induction (Fig. S1D). When IL-3-dependent cells such as Ba/F3 or FL5.12 We next generated IL-2-dependent murine primary cells (two murine pro B cell lines) are deprived of the lymphocytes, which were deprived of the growth factor. growth factor, they undergo rapid apoptosis. Additional Consistent with the results obtained with IL-3-dependent treatment with the highly selective GSK-3 inhibitor cell lines, removal of IL-2 induced PUMA and apoptosis, CT98014 completely blocked IL-3-withdrawal-induced while this was abrogated in presence of the GSK-3 inhi- apoptosis of Ba/F3 cells as observed previously (Fig. 1a). bitor (Fig. S1E, Fig. S1F). We aimed at systematically defining the pro-apoptotic We therefore conclude that PUMA represents the main factors involved in IL-3 withdrawal-induced apoptosis and BH3-only protein mediating IL-3 and IL-2 withdrawal- at investigating their link to GSK-3. To address the role of induced apoptosis induction and that the transcriptional pro-apoptotic BH3-only proteins for growth factor- induction of Puma is dependent on GSK-3 activity. withdrawal-induced apoptosis, we transduced Ba/F3 cells with the lentiCRISPRv2 system targeting either p53 has a minor role for GSK-3-dependent PUMA induction Puma or Bim. As shown in Fig. 1b, apoptosis by IL-3 We next investigated the identity of the transcription deprivation was substantially reduced in Ba/F3 cells factor, which mediates the GSK-3-dependent transcrip- expressing CRISPR/Cas9 targeting Puma, while loss of tional induction of Puma upon loss of growth-factor- Bim conferred only moderate protection from cell death. induced PI3K signaling. Puma is a crucial pro-apoptotic 10,11 This effect was even more pronounced in the IL-3- target of p53 . While p53 is not stabilized upon growth dependent cell line FL5.12 (Fig. S1A). To further verify the factor withdrawal, p53 is nevertheless able to induce some role of PUMA in this system, clones derived from indi- of its target genes (such as Mdm2) when present at very vidual cells (single-cell clones) were generated from the low levels. Thus, even in the absence of DNA damage, we CRISPR/Cas9-transduced cultures and cells with frame- considered p53 as a candidate for GSK-3-dependent shift mutations on both Puma alleles or both Bim alleles Puma induction upon loss of pro-survival signaling dur- −/− were selected. Almost all Puma single-cell clones were ing IL-3 withdrawal. To address the role of p53 in this strongly protected from IL-3 withdrawal-induced apop- context, we inhibited PI3K by GDC-0941 in HCT116 −/− +/+ −/− tosis (Fig. 1c) while Bim single-cell clones exhibited no p53 and p53 cells in order to induce PUMA, as statistically significant survival advantage (Fig. 1d). The described before (see Fig. S1D). As shown in Fig. 2a, +/+ protective effect of Puma depletion lasted at least 24 h, inhibition of PI3K-induced PUMA in p53 as well as −/− however, the cells committed to apoptosis at later time p53 cells, indicating that p53 is not a major tran- −/− points. Puma Ba/F3 cells additionally treated with the scription factor responsible for Puma induction in this GSK-3 inhibitor CT98014 showed a similar kinetic but setting. Consistent with the data shown before, the the protective effect was more pronounced even after 40 h induction of PUMA was prevented by pharmacological (Fig. S1B). Thus, the kinase activity of GSK-3 as well as inhibition of GSK-3. To further investigate the role of p53, the induction of Puma are rate-limiting for apoptosis we knocked out p53 by CRISPR/Cas9 in Ba/F3 cells, induced by IL-3 withdrawal. The stronger anti-apoptotic which have an intact p53 signaling pathway . Upon IL-3 effect achieved by inhibition of GSK-3 than by the loss of withdrawal, Ba/F3 cells lacking p53 exhibited some pro- PUMA alone is consistent with other cell death regulatory tection from apoptosis (Fig. 2b), which was however not factors being regulated by GSK-3, such as MCL-1 as strong as observed with cells lacking PUMA (see −/− (Fig. S1C). We next asked whether PUMA is tran- Fig. 1b). We generated p53 single-cell clones and scriptionally regulated in a GSK-3-dependent manner subjected them to IL-3 deprivation. We unexpectedly upon growth factor withdrawal. Wild-type Ba/F3 cells observed that individual Ba/F3 cell clones lacking p53 were deprived of IL-3, treated with GSK-3 inhibitor exhibited quite some variation regarding the protection (CT98014) and Puma mRNA levels were analyzed by from IL-3 withdrawal-induced apoptosis. Nevertheless, on quantitative RT-PCR. IL-3 withdrawal-induced Puma average, the protection conferred by lack of p53 was Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 3 of 13 A B 50 50 +IL3 +IL3 -IL3 -IL3 40 40 -IL3 + CT98014 -IL3 + CT98014 30 30 20 20 10 10 C D P ≤ 0.001 ns *** E F 2.5 -IL3 8h 16h 24h 2.0 -IL3 + CT98014 1.5 1.0 26kDa PUMA 0.5 55kDa TUBULIN 0.0 Fig. 1 Apoptosis induced by growth factor withdrawal requires GSK-3-dependent PUMA induction. a Ba/F3 cells were deprived of IL-3 in the presence or absence of CT98014 (0.75 µM) and analyzed for apoptosis by Annexin V staining and flow cytometry analysis. Error bars represent SD from technical replicates. b Ba/F3 cells expressing CRISPR/Cas9 targeting Luciferase (crLUC), Puma (crPuma), or Bim (crBim) were deprived of IL-3 in presence or absence of CT98014 (0.75 µM) and analyzed for apoptosis by Annexin V staining after 18 h. Error bars represent SD from technical −/− replicates. c Ba/F3 Puma single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from two independent experiments (n = 2). Significance was tested by one-way ANOVA with −/− post hoc Tukey’s multiple comparison test. d Ba/F3 Bim single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent the 95% confidence interval from two independent experiments (n = 2). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns = not significant. e Ba/F3 cells were deprived of IL-3 in presence or absence of CT98014 (0.75 µM) and harvested after the indicated time. The 0 h condition represents cells kept in medium with IL-3. RNA levels were analyzed by qRT-PCR with primers for Puma and L32 as internal reference. Data points show relative (mRNA) Puma induction compared to cells kept in medium with IL-3. Error bars represent SD from technical replicates. f Cells from a were subjected to western blotting and analyzed with the antibodies indicated. Official journal of the Cell Death Differentiation Association 8h 16h 24h crLUC +IL3 crLUC crLUC -IL3 crPuma #1 Puma-/- +IL3 crPuma#2 Puma-/- -IL3 crBim #1 crBim #2 0h 2,5h crLUC +IL3 5h crLUC -IL3 7,5 h Bim-/- +IL3 Bim-/- -IL3 fold induction % Annexin V positive cells % Annexin V positive cells % Annexin V positive cells % Annexin V positive cells +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT Schubert et al. Cell Death and Disease (2018) 9:470 Page 4 of 13 A B +/+ -/- p53 p53 +IL3 -IL3 -IL3 + CT98014 26kDa PUMA 55kDa p53 55kDa TUBULIN ns -20 -/- crLUC p53 clones D 0.8 -/- p53 clones 0.6 +- +- +- +- +- +- +- +- +- +- IL3 0.4 25kDa PUMA 0.2 GSK-3A 46kDa GSK-3B 0.0 0.8 -/- p53 clones 0.6 0.4 25kDa PUMA 0.2 GSK-3A 46kDa GSK-3B 0.0 −/− +/+ Fig. 2 p53 has a minor role for GSK-3-dependent PUMA induction. a HCT116 p53 or p53 were treated with GDC-0941 (GDC, 10 µM), CT98014 (CT, 0.75 µM), or a combination of both for 7 h. The cells were harvested, subjected to western blotting and analyzed by the antibodies indicated. b Ba/F3 expressing CRISPR/Cas9 targeting p53 or Luciferase were deprived of IL-3, in presence or absence of CT98014 (0.75 µM) for 18 h and −/− analyzed for apoptosis by Annexin V staining. Error bars represent SD from technical replicates. c Ba/F3 p53 single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of two independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from two independent −/− experiments (n= 2). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns= not significant. d Ba/F3 p53 single-cell clones and two independent cell lines of Ba/F3 cells infected with CRISPR/Cas9 targeting Luciferase were deprived of IL-3 for 12 h, harvested and analyzed by western blotting by probing with antibodies as indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels −/− were normalized to GSK-3 levels (loading control). e Ba/F3 p53 single-cell clones and two independent cell lines of Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were treated with LY294002 (10 µM) or DMSO (−) for 18 h, harvested and analyzed by western blotting with the antibodies indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels were normalized to GSK-3 levels (loading control). Official journal of the Cell Death Differentiation Association +IL3 -IL3 +IL3 -IL3 crLUC crp53 #1 crp53 #2 crLUC +IL3 crLUC -IL3 p53-/- +IL3 p53-/- -IL3 crLUC +DMSO crLUC +LY p53-/- +DMSO p53-/- +LY % Annexin V positive cells NN crLUC crLUC LY GDC crLUC crLUC LY CT #1 #1 LY GDC + CT #2 #2 LY NN #3 #3 LY GDC #4 #4 CT LY GDC + CT #5 #5 LY #6 #6 LY #7 #7 LY #8 #8 LY % Annexin V positive cells relative quantification relative quantification Schubert et al. Cell Death and Disease (2018) 9:470 Page 5 of 13 modest (Fig. 2c). Interestingly, a variation in IL-3-induced PUMA induction was absent upon treatment with apoptosis was also observed in different single-cell clones LY294002 (Fig. 4b) or IL-3 withdrawal (Fig. 4c) in these expressing CRISPR/Cas9 targeting Luciferase and—of cells. Thus, p53 and FOXO3A together are required for note—in wild-type Ba/F3 cells, indicating that individual PUMA upregulation and apoptosis upon IL-3 withdrawal, clones always seems to exhibit some variation, even in the possibly also compensating for each other to some extent absence of previous manipulation. We therefore always in cells lacking either p53 or FOXO3A. analyzed a high number of clones (Fig. S2A+B). Con- −/− sistent with the modest protection of p53 single-cell The induction of Puma by FOXO3A depends on GSK-3 clones from IL-3 deprivation, PUMA induction was still To confirm the major role of FOXO3A and its GSK-3 −/− observed in p53 single-cell clones upon IL-3 with- dependency in IL-3 withdrawal-induced apoptosis, we re- drawal (Fig. 2d) or PI3K inhibition by LY294002 (Fig. 2e) expressed FOXO3A with silent mutations, rendering it and was still dependent on GSK-3 (Fig. S2C). However, resistant to CRISPR/Cas9 cleavage, in a Ba/F3 bulk cul- the quantification of PUMA expression levels revealed ture which expressed a CRISPR/Cas9 construct targeting −/− that, while Puma was still induced, the PUMA protein Foxo3a (Fig. 5a) as well as in a Foxo3a single-cell clone −/− levels were generally somewhat reduced in p53 cells (Fig. 5b). Re-expression of FOXO3A re-established (Fig. 2e, right). Together, although there is a GSK-3- apoptosis induction to a comparable level as in control dependent effect of p53 on PUMA and apoptosis induc- cells transduced with FOXO3A in bulk culture and the tion, p53 seems not to be the main GSK-3-dependent single-cell clone (Fig. 5a, b). Importantly, restoring transcription factor responsible for the induction of FOXO3A and thereby the competence to undergo apop- PUMA and apoptosis upon IL-3 withdrawal. tosis did not relieve the requirement for GSK-3 activity, as inhibition of GSK-3 suppressed apoptosis induced by IL-3 FOXO3A is an important Puma inducer upon growth factor withdrawal in FOXO3A overexpressing cells. Thus, deprivation FOXO3A-dependent PUMA and apoptosis induction To test other transcription factors for their role in upon growth factor withdrawal requires GSK-3. Of note, inducing Puma upon IL-3 deprivation, we generated Ba/ the induction of apoptosis as well as the induction of −/− F3 expressing CRISPR/Cas9 targeting Foxo1, Foxo3a, and PUMA in Foxo3a cells was still dependent on GSK-3 the p53 relatives p63 and p73. We then subjected these (Fig. S4A+B), confirming that the regulation of PUMA by cells to IL-3 withdrawal and analyzed apoptosis induction. p53 is also controlled by GSK-3 . Among the cells we tested, only Foxo3a-targeted cells While PUMA protein levels were reduced in empty −/− showed a protection from IL-3 deprivation (Fig. 3a, vector-transduced Foxo3a cells upon IL-3 withdrawal, −/− Fig. S3A). Single-cell clones generated from these cells PUMA induction was restored in Foxo3a cells re- again showed a wide distribution of sensitivity to IL-3 expressing CRISPR/Cas9-resistant FOXO3A (Fig. 5c). withdrawal but were on average significantly protected Consistently, FOXO3A overexpression in HCT116 −/− −/− compared to control cells (Fig. 3b). The Foxo3a single- p53 cells increased PUMA induction in cells treated cell clones showed a diminished capacity to induce with the AKT inhibitor GDC-0941 (Fig. 5d). We therefore PUMA upon IL-3 withdrawal (Fig. S3B). Because of the conclude that FOXO3A induces Puma when Ba/F3 are −/− high variation of individual Foxo3a single-cell clones deprived of IL-3, while p53 contributes to this induction, to induce PUMA, they were pooled and we observed a and that both transcription factors require GSK-3 activity clear reduction of the signal for PUMA upon IL-3 with- for the induction of PUMA and apoptosis. −/− drawal (Fig. 3d). Likewise, Foxo3a single-cell clones treated with the PI3K inhibitor LY294002 exhibited FOXO3A requires GSK-3 activity for full transcriptional reduced Puma induction, as evident from the quantifi- activity cation of the PUMA expression levels (Fig. 3d). As shown above, the pharmacological inhibition of GSK-3 was sufficient to prevent growth factor Double knockout of Foxo3a and p53 fully protects cells withdrawal-induced PUMA induction and apoptosis. We from IL-3-induced apoptosis and prevents Puma induction previously demonstrated that when p53 is stabilized by We next addressed the combined role of p53 and DNA damage, GSK-3 activity regulates the capacity of p53 FOXO3A to induce apoptosis and PUMA upon IL-3 to induce Puma by phosphorylating Tip60 at S86, which withdrawal. We generated cells expressing CRISPR/Cas9 stimulates Tip60 to acetylate lysine 120 (K120) of p53 . targeting p53 and Foxo3a simultaneously and identified K120-acetylated p53 then induces Puma which leads to 12–14 −/− two single-cell clones with frameshift mutations on both apoptosis . However, in p53 cells we observed alleles of each p53 and Foxo3a (double knock out, DKO). FOXO3A-dependent PUMA induction and apoptosis, As shown in Fig. 4a, both DKO clones were protected which was also dependent on GSK-3 activity (Figs. 2a–c from IL-3 deprivation-induced apoptosis. In line with this, and 5d). To investigate the role of GSK-3 for the Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 6 of 13 A B P ≤ 0.01 +IL3 ** -IL3 80 P ≤ 0.05 -IL3 + CT -/- crLUC Foxo3a clones Foxo3a-/- crLUC +- +- IL3 PUMA 25kDa 58kDa TUBULIN D -/- Foxo3a clones PUMA 25kDa GSK-3A 46kDa GSK-3B 0.8 0.6 0.4 0.2 0.0 Fig. 3 FOXO3A is an important Puma inducer upon growth factor deprivation. a Ba/F3 expressing CRISPR/Cas9 targeting Foxo3a, Foxo1,or Luciferase were deprived of IL-3 in the presence or absence of CT98014 (0.75 µM) for 18 h and analyzed for apoptosis by Annexin V staining. b Ba/F3 −/− Foxo3a single-cell clones and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Each dot represents the mean of three independent experiments analyzing an individual single-cell clone. Error bars represent 95% confidence interval from three independent experiments (n = 3). Significance was tested by one-way ANOVA with post hoc Tukey’s −/− multiple comparison test. c Equal cell numbers of eight different Ba/F3 Foxo3a single-cell clones were pooled. This pool and Ba/F3 expressing CRISPR/Cas9 targeting Luciferase were deprived of IL-3 for 9 h, harvested and analyzed by western blotting with the antibodies indicated. d Ba/F3 −/− Foxo3a single-cell clones and two independent cell lines of Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase were treated with LY294002 (10 µM) or DMSO (−) for 18 h, harvested and analyzed by western blotting with the antibodies indicated. Bands were quantified using FusionCapt Advance Solo 4 16.08. PUMA levels were normalized to GSK-3 levels (loading control). transcriptional regulation of Puma by FOXO3A, we phosphorylation of FOXO3A residues T32, S253, and generated a promoter reporter system where Luciferase S315 by AKT results in retention of the transcription expression is under control of the Puma promoter, which factor in the cytosol . We expressed a FOXO3A-triple includes a binding site for FOXO3A . It is well established mutant (TM; T32A-S253A-S315A), which cannot be that FOXO3A is controlled by the PI3K/AKT pathway as phosphorylated by AKT and is considered to be Official journal of the Cell Death Differentiation Association crLUC crFoxo1 #1 crFoxo1 #2 crFoxo3a #1 crFoxo3a #2 +IL3 -IL3 +IL3 crLUC +DMSO crLUC +LY -IL3 Foxo3a-/- +DMSO Foxo3a-/- +LY % Annexin V positive cells relative quantification crLUC LY crLUC LY #1 LY #2 LY #3 LY #4 LY #5 LY #6 % Annexin V positive cells LY #7 LY #8 LY Schubert et al. Cell Death and Disease (2018) 9:470 Page 7 of 13 P ≤ 0.001 A B crLUC DKO #1 DKO #2 *** P ≤ 0.001 - +-+-+ LY *** crLUC 100kDa FOXO3A DKO #1 DKO #2 PUMA 25kDa 32kDa 14-3-3 20 C crLUC DKO #1 DKO #2 ns + -+-+- IL3 100kDa FOXO3A PUMA 25kDa 32kDa 14-3-3 −/− Fig. 4 Double knockout of Foxo3a and p53 fully protects cells from IL-3-induced apoptosis and prevents Puma induction. a Ba/F3 p53 −/− Foxo3a single-cell clones (DKO #1 and DKO #2) and Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase (crLUC) were deprived of IL-3 for 18 h and analyzed for apoptosis by Annexin V staining. Error bars represent 95% confidence intervals from four independent experiments (n = 4). Significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. ns = not significant. ***P < 0,001. b The same cells were treated with LY294002 (10 µM) for 18 h or left untreated. The cells were harvested after the treatment and subjected to western blotting. The protein levels were analyzed by the antibodies indicated. c The same cells were deprived of IL-3 for 18 h, harvested after the treatment and subjected to western blotting. constitutive active, along with the Puma promoter FOXO3A-mediated transcription by GSK-3 is indepen- reporter constructs. As shown in Fig. 6a, overexpression dent of FOXO3A translocation. Interestingly, we observed of FOXO3A-TM induced Luciferase expression con- an interaction of GSK-3 with FLAG-tagged FOXO3A trolled by the Puma promoter. This was dependent on a overexpressed in 293T HEK cells (Fig. 6c). Together, the FOXO3A binding site in the promoter region, as muta- results show that activity of GSK-3 is decisive for the tion of the binding site for FOXO3A prevented Luciferase FOXO3A and p53-mediated PUMA induction in the induction. However, when we added the GSK-3 inhibitor absence of PI3K signaling. CT98014, the ability of FOXO3A-TM to induce Lucifer- ase through the Puma promoter was substantially Discussion decreased. We therefore conclude that FOXO3A, in order We had previously shown that GSK-3 phosphorylates to fully exhibit its transcriptional activity at the Puma the anti-apoptotic protein MCL-1 upon growth factor promoter, requires not only the dephosphorylation of withdrawal or PI3K inhibition, which regulates lympho- 9,15 AKT phosphorylation sites in FOXO3A, but also the cyte survival . In this study, we aimed at systematically activity of GSK-3. identifying the GSK-3-dependent pro-apoptotic factors, We next established Ba/F3 cell lines overexpressing promoting apoptosis upon depletion from growth factor. FOXO3A-TM. We expressed FOXO3A-TM with silent We showed that PUMA rather than BIM mediates IL-3 mutations, mediating resistance to CRISPR/Cas9 clea- withdrawal-induced apoptosis, although both proteins vage, in a Ba/F3 bulk culture expressing a CRISPR/Cas9 were upregulated upon IL-3 deprivation (data not shown). construct targeting Foxo3a, or in control cells with In line with our data, it was previously shown that PUMA 5,16 CRISPR/Cas9 targeting Luciferase. This led to a slightly and BIM are induced by IL-2 withdrawal . Our findings increased background of apoptosis even when IL-3 was also confirm a previous report that IL-3-dependent available. However, although FOXO3A-TM is considered myeloid cell lines from mice lacking PUMA, but not to be constitutively active, IL-3 deprivation was required BIM, were protected from IL-3 withdrawal-induced to induce apoptosis (Fig. 6b, left). Importantly, apoptosis apoptosis . could be inhibited by addition of CT98014 (Fig. 6b, right), FOXO3A and p53 were both described to be important showing that FOXO3A-TM (which is not controlled by for growth factor withdrawal-induced apoptosis. AKT) requires GSK-3 activity to induce apoptosis upon FOXO3A deficiency can protect cells from cytokine 16,18 IL-3 withdrawal. As the inhibition of GSK-3 did not affect withdrawal-induced apoptosis , and FOXO3A was the binding to 14-3-3 proteins (Fig. 6c) or the nuclear shown to be crucial for PUMA induction upon growth localization of FOXO3A (Fig. S5A), the regulation of factor withdrawal . It was also found that p53, FOXO and Official journal of the Cell Death Differentiation Association +IL3 -IL3 % Annexin V positive cells Schubert et al. Cell Death and Disease (2018) 9:470 Page 8 of 13 A B P ≤ 0.001 crLUC + EV crLUC + EV *** P ≤ 0.001 Foxo3a-/- + EV crFoxo3a + EV *** P ≤ 0.001 ns crLUC + FOXO3A crLUC + FOXO3A *** Foxo3a-/- + FOXO3A crFoxo3a + FOXO3A 0 0 emtpy vector FOXO3A -/- -/- wt Foxo3a wt Foxo3a +- -+- - +- -+- - IL3 -- + - - + -- + - - + CT PUMA 25kDa 100kDa FOXO3A 58kDa TUBULIN -+ -+ GDC 100kDa FOXO3A 25kDa PUMA 46kDa GSK-3A GSK-3B 58kDa TUBULIN Fig. 5 The induction of Puma by FOXO3A depends on GSK-3. a Ba/F3 cells expressing CRISPR/Cas9 constructs targeting Luciferase or Foxo3a were infected with retrovirus encoding CRISPR/Cas9-resistant human FOXO3A control retrovirus (empty vector, EV). The cells were deprived of IL-3 in the presence or absence of CT98014 (CT, 0.75 µM) for 18 h and analyzed for apoptosis by Annexin V staining. The significance was tested by one-way ANOVA with post hoc Tukey’s multiple comparison test. Error bars represent 95% confidence intervals from four independent experiments (n = 4). b −/− Ba/F3 expressing CRISPR/Cas9 constructs targeting Luciferase (crLUC) or a Foxo3a single-cell clone (#4) were infected with retrovirus expressing human FOXO3A or none (empty vector, EV). The cells were deprived of IL-3 in presence or absence of CT98014 (0.75 µM, CT) for 18 h, then analyzed for apoptosis by Annexin V staining. Error bars represent SD from technical replicates. c Cells from b were harvested after 18 h and analyzed by −/− western blotting with the antibodies indicated. d HCT116 p53 cells were transfected by Lipofectamine2000® with vectors encoding FOXO3A or control vector (empty). Twenty-four hours after transfection, the cells were treated with DMSO or GDC-0941 (10 µM) for 5 h. The cells were harvested and analyzed by western blotting, probing with antibodies as indicated. Official journal of the Cell Death Differentiation Association +IL3 -IL3 -IL3 + CT +IL3 -IL3 -IL3 + CT % Annexin V positive cells empty FOXO3A % Annexin V positive cells Schubert et al. Cell Death and Disease (2018) 9:470 Page 9 of 13 crLUC + EV A B Foxo3a-/- + EV crLUC + FOXO3A-TM Foxo3a-/- + FOXO3A-TM DMSO CT 0 0 Puma promoter EV FOXO3A-TM IP:FLAG Input FLAG-FOXO3A FLAG-FOXO3A -+ - + - CT98014 CT98014 -+ - + - 100kDa 100kDa FOXO3A FOXO3A 32kDa 32kDa 14-3-3 14-3-3 GSK-3A GSK-3A 46kDa 46kDa GSK-3B GSK-3B 58kDa 58kDa P53 P53 Fig. 6 FOXO3A requires GSK-3 activity for full transcriptional activity. a 293T HEK cells were transfected with a reporter plasmid with Luciferase driven by a wild type (wt) or FOXO3A binding site mutant (FoxoBSmut) Puma promoter fragment, a Renilla reporter plasmid as internal control and a construct encoding FOXO3A-TM or empty vector. Eight hours after transfection, the cells were treated with CT98014 (CT, 0.75 µM,) or DMSO for 18 h. Luciferase activity was analyzed and normalized to Renilla activity. Error bars represent SD from technical replicates. b Ba/F3 cells expressing CRISPR/ −/− Cas9 constructs targeting Luciferase or a Foxo3a single-cell clone were infected with retrovirus expressing human FOXO3A-TM or none (empty vector, EV). The cells were deprived of IL-3+/− CT98014 (CT, 0.75 µM) for 18 h, then stained with Annexin-V-FITC and analyzed by flow cytometry. Error bars represent SD from technical replicates. This experiment was done together with the one shown in Fig. 5b, and the controls are identical. c HEK 293T cell were transfected with constructs encoding wild-type, FLAG-tagged FOXO3A (wt) or FLAG-tagged FOXO3A-TM (TM) or control vector (−). Eight hours later, the cells were treated with CT98014 (0.75 µM) or left untreated for 18 h. The cells were lysed and 2% of the lysate were kept as input. FLAG immunoprecipitation was performed with the remaining lysate. After washing and elution with 3xFLAG peptide, eluate and input fractions were analyzed by western blotting with the antibodies indicated. E-box-binding transcription factors share many targeted which further supports the important apoptosis- genes in response to PI3K inhibition in Rat-1 cells and a regulatory role of the PI3K/AKT pathway also in dominant-negative p53 resulted in partial resistance to absence of p53. apoptosis upon PI3K inhibition . Likewise, HoxB8- We have shown that the induction of Puma by transformed factor-dependent myeloid (FDM) cells from FOXO3A and/or p53 is dependent on GSK-3 activity. −/− p53 mice were less sensitive for IL-3 deprivation- Importantly, we observed that even the transcriptional induced cell death and showed reduced PUMA induction. activity of a FOXO3A-TM mutant, which is considered −/− In this study, FDM cells from FOXO3A mice showed constitutively active due to the loss of the AKT phos- an even higher susceptibility to cell death after IL-3 loss . phorylation sites, required GSK-3. Our results suggest The same authors reported that PUMA induction was that the inhibition of GSK-3 is the key pro-survival independent of PI3K, a finding which is not confirmed by function of PI3K signaling, being more important than the 17,21 our data . Instead, we found that inhibition of the inactivation of FOXO3A. In line with this finding, full −/− PI3K/AKT pathway upregulated PUMA in p53 transcriptional activity of Foxo1/3/4 was shown to require HCT116 cells and Ba/F3 cells. GSK-3, as the induction of IGF-IR gene by serum star- In addition, p53 negative Ba/F3 cells were fully pro- vation or AKT inhibition required both active GSK-3 and tected from apoptosis only when GSK-3 was inhibited, Foxo1/3/4 . Supporting a PI3K-dependent regulation of Official journal of the Cell Death Differentiation Association wt FoxoBSmut wt FoxoBSmut +IL3 -IL3 -IL3 + CT relative induction to control wt wt TM TM % Annexin V positive cells wt wt TM TM - Schubert et al. Cell Death and Disease (2018) 9:470 Page 10 of 13 FOXO3A independent of the AKT phosphorylation sites, Table 1 gRNAs the DNA-binding and transcriptional activity of a triple S/ Target gRNA name gRNA sequence (20xN-NGG) A mutant of the Foxo homolog in C. elegans, DAF-16, which is considered constitutive active, was shown to be p53 Exon3 p53 gRNA #1 (759) AGTGAAGCCCTCCGAGTGTC-AGG further increased by PI3K inhibition by LY294002 and 22 p53 Exon3 p53 gRNA #2 (760) AGGAGCTCCTGACACTCGGA-GGG Wortmannin . Interestingly, promotion of FOXO3A p53 Exon3 p53 gRNA #3 (761) GACACTCGGAGGGCTTCACT-TGG activity to induce PUMA by GSK-3 was independent of the interaction of FOXO3A with 14-3-3 or its subcellular p63 Exon3 p63 gRNA #1 TCCACAAAGTTCAACTCGAT-GGG localization. p63 Exon4 p63 gRNA #2 CCGTCACGCTATTCTGTGCG-TGG It is not clear however, how GSK-3 and FOXO3A p63 Exon4 p63 gRNA #3 AGCCCCAGGTTCGTGTACTG-TGG cooperate. In a study of Terragni et al., upregulated genes p73 Exon3 p73 gRNA #1 CCGGGGTAGTCGGTATTGGA-AGG upon inhibition of PI3K were co-regulated by FOXO3A, MITF, and USF1, with the latter two being regulated by p73 Exon3 p73 gRNA #2 CGGGGTGTAGGGGCTCGCCG-GGG GSK-3 . Another explanation for the functional inter- Puma Exon1 Puma gRNA #1 ATGGCCCGCGCACGCCAGGA-GGG action of FOXO3A and GSK-3 could be provided by the Puma Exon1 Puma gRNA #2 AGCTCTCCGGAGCCCGTAGA-GGG regulation of TIP60. We could previously demonstrate the Puma Exon1 Puma gRNA #3 GGAAGGGGCGCGGACTGTCG-CGG requirement of GSK-3 for Puma induction by p53 in the context of DNA damage and subsequent p53 stabilization Bim Exon1 Bim gRNA #1 ACTTACATCAGAAGGTTGCT-TGG by the phosphorylation of the histone acetyl transferase Bim Exon1 Bim gRNA #2 TTGCGGTTCTGTCTGTAGGG-AGG Tip60 (KAT5). Increased KAT activity of Tip60 is induced Foxo1 Exon1 Foxo1 gRNA #1 TCGTCGCGCCGCAACGCGTG-GGG by GSK-3 mediated phosphorylation, resulting in the Foxo1 Exon1 Foxo1 gRNA #2 GGAGAGTGAGGACTTCGCGC-GGG acetylation of p53 in the DNA-binding domain at lysine 120, which enables p53 to promote the transcription of Foxo3a Exon1 Foxo3a gRNA #1 CACGCCGCCACCGATCACCA-TGG Puma. It is possible that GSK-3 activated Tip60 acts on Foxo3a Exon1 Foxo3a gRNA #2 TCTCGATGGCGCGGGTGATC-AGG chromatin or FOXO3A directly, thereby promoting 6 Luciferase Luciferase gRNA ACCGCTCCGGCGAAGGCGAA-NGG transcriptional Puma induction . A direct phosphorylation of FOXO3A by GSK-3 would also be a possibility as to how GSK-3 directly promotes the transcriptional activity of FOXO3A, which would be Puma (#12450), Foxo3a (#2497) were from Cell Signaling consistent with our data demonstrating a cooperation of Technologies (Danvers, MA, USA). GSK3a/b (sc-56913), FOXO3A-TM and GSK-3 for the regulation of the Puma 14-3-3 (sc-1657) and NFATc1 (sc-7294) were from Santa promoter. Cruz (Dallas, TX, USA). Tubulin (MCA77G) was from Together, in this study, we provide evidence that Puma Bio-Rad (Hercules, CA, USA). MCL1 (600-401-394S) was induction by FOXO3A is an important step in IL-3 from Rockland (Limerick, PA, USA). withdrawal-induced apoptosis, and that the Puma indu- FLAG-M2 agarose affinity beads were from Sigma- cing function of FOXO3A is dependent on GSK-3 activity. Aldrich (St. Louis, MO, USA). Thus, GSK-3 is crucial for the full activation of FOXO3A transcriptional activity when the PI3K pathway is not Generation of ko cell lines using lentiviral CRISPR/Cas9 active. As pharmacological modulation of kinase signaling The lentiCRISPRV2 system was used to generate ko pathways is a promising strategy for cancer therapy, a cells as described by others . At least two different guide more detailed understanding of the underlying mechan- RNAs for each target were designed using crispr.mit.edu isms will improve defining the crucial targets. and a guide RNA targeting Luciferase was designed as control (see Table 1: gRNAs). The guide RNAs were Materials and methods cloned into the lentiCRISPRV2 plasmid (a gift from Feng Reagents and antibodies Zhang, Addgene plasmid # 52961) and lentiviral particles LY294002 was from Sigma-Aldrich (St. Louis, MO, were produced by transfection of 5 μg lentiCRISPRv2, 1.5 USA), GDC-0941 and CT98014 were from Axon Med- μg pMISSIONVSV-G (Sigma-Aldrich) and 3 μg pMIS- chem (Groningen, Netherlands), Annexin-V-FITC was SION GAG POL (Sigma-Aldrich) with Attractene generated in our lab. Annexin-V-APC (RUO) was from (Quiagen, Hilden, Germany) into 293T HEK cells seeded Becton Dickinson (Franklin Lakes, NJ, USA). 4-OHT was at 25% confluency in a 78-cm² culture plate the day before from Sigma-Aldrich (St. Louis, MO, USA). transfection. The morning after transfection, fresh med- IL-2 and IL-3 were from Peprotech (Rocky Hill, NJ, USA). ium was added. In the evening, 4 ml medium was added. The following antibodies were used for western blotting: The next day, viral supernatants were harvested, filtered Puma (#3043) was from Prosci (Poway, CA, USA), human (0,45 μM) and supplemented with 5 μg/ml polybrene Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 11 of 13 Table 2 Primers 20 ng/ml PMA and 0.5 μg/ml ionomycin for 48 h in RPMI-1640 with 10% FSC and P/S. The cells were then Primer Sequence (5′-3′) cultured in the medium containing 100 U/ml recombi- nant IL-2 for 24 h and then used for experiments. For p53 for TGTCTGTAAATCCTGCGGGG growth factor withdrawal, cells were washed twice with p53 rev GAGGCTAAAAAGGTTCAGGGC 50 ml PBS and resuspended in RPMI-1640 with 10% FCS p63 Exon3 for TAAGACGGTGAGCCACTCCA and P/S. p63 Exon3 rev CCCACTGCAGAAAGCTGAGA Flow cytometry p63 Exon4 for GATGGGTGGCTTTACTTGGGA For apoptosis quantification by flow cytometry, BaF3 or p63 Exon4 rev ACACACCCTGGAACCTGTCT FL5.12 were deprived of IL-3 in the presence or absence p73 for CTACTCACTGTCCAGGTGGC of CT98014 (0.75 μM) for 18 h or as indicated. Activated lymphocytes were deprived of IL-2 in the presence or p73 rev ACAAGTAGTGGCCTGTTGGG absence of CT98014 (0.75 μM) for 22 h. The cells were Puma for TTCCTGGGTGGGAGTGACTT washed once with Annexin-V Binding Buffer (10 mM Puma rev AGGGACTTCCCACTCGACTT HEPES, 150 mM NaCl, 150 μM MgCl, 2.5 mM CaCl ) Bim for ACGAAATGTAGACGTCCCGC stained for 15 min in the dark with Annexin-V-FITC or Annexin-V-APC in the same buffer. The fraction of Bim rev CCCACAGCCTTGAAACCGAT Annexin-V-positive cells was measured using a FACS Foxo1 for AACCAGTCCAACTCGACCAC Calibur (BD Bioscience) or FACS LSRII (BD Bioscience). Foxo1 rev AAGTTCCCAAACGAGCCCTG Foxo3a for GGAGAGAGCAAGAGCCCAAG Western blotting Cells were harvested and washed with ice-cold PBS. Foxo3a rev GACCCTCCCTTCCCACTTTG Cells pellets were lysed for 5 min on ice with lysis buffer qRT-PCR Puma for GCCCAGCAGCACTTAGAGTC (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X- qRT-PCR Puma rev GGTGTCGATGCTGCTCTTCT 100, 1× protease inhibitor cocktail (Roche), phosphatase qRT-PCR L32 for TTAAGCGAAACTGGCGGAAAC inhibitor cocktail 1 (1:50, Sigma-Aldrich), MG132 (20 μM, Alexis Biochemicals)) or by nuclear fractionation as qRT-PCR L32 rev TTGTTGGTCCCATAACCGATG described . Lysates were cleared by centrifugation at 16.100×g for 10 min, 4 °C. Protein concentration was determined using Bradford reagent (Bio-Rad). Lämmli (Sigma-Aldrich). The target cells were infected by spin- buffer was added to 10–100 μg of protein lysate and fection at 400×g for 10 min. The following day, selection samples were boiled at 95 °C for 5 min. In some cases, the was started using 4 μg/ml puromycin (Sigma-Aldrich) for same amount of lysate was loaded on a second gel to at least 3 days and until no viable cells were detected in an probe for several antibodies. Proteins were separated by uninfected control. Mix cultures were tested for Cas9 SDS-PAGE and transferred to nitrocellulose membranes. cleavage by performing a Surveyor assay. The region of The membranes were blocked in 3% dry milk in TBS- interest was amplified by PCR using the primers listed Tween20 (0.1%) (TBS-T) and then incubated at 4 °C (Table 2: Primers). The Surveyor assay was performed overnight with the primary antibody diluted in 3% dry according to the manufacturer (Integrated DNA Tech- milk in TBS-T. The membranes were washed three times nologies). The mix cultures were used for experiments with TBS-T, incubated for 1 h with horseradish perox- and to generate single-cell clones by limited dilution. idase (HRP)-conjugated secondary antibody at room Single-cell clones were analyzed by sequencing and clones temperature and washed three times with TSB-T. Band with a bi-allelic shift in the open reading frame generating visualization was achieved using Super Signal West Pico a premature STOP codon were chosen. Chemiluminescent Substrate (Thermo Scientific, Wal- tham, USA) and the Fusion Solo imaging system (Vilber Cell culture and treatment Lourmat, Eberhardzell, Germany). −/− +/+ HCT116 p53 , HCT116 p53 (kindly provided by Bert Vogelstein) and HCT116 (ATCC) were maintained Luciferase reporter assay in DMEM containing 10% FCS and Penicillin/Strepto- 293T HEK cells in 24-well plates were transfected with a mycin (P/S). FL5.12 and BaF3 were maintained in RPMI- total amount of 1 μg DNA by Attractene. A renilla luci- 1640 with 10% FCS, P/S and 1 μg/l recombinant IL-3. To ferase expression plasmid (Promega, Madison, WI, USA) generate IL-2-dependent lymphoid cells, lymph node cells as internal control, a luciferase reporter plasmid driven by from three C57/Bl6 mice were isolated and activated by a 1.7 kb Puma promotor region (−1200 to +500 from Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 12 of 13 ATG) containing a conserved binding site for FOXO3A 1.5 μg pLXIN-hFOXO3A, plXIN-hFOXO3A-TM, or (CAAACAAT or mutated to CAGGGAAT) and pLXIN-emtpy. Only BaF3 expressing lentiCRISPRv2 FOXO3A-TM (T32A, S253A, S315A) pcDNA3.1 expres- gRNA #1 targeting mouse Foxo3a were used, as human sion plasmid were used in a 1:1:1 ratio. Empty vector was Foxo3a is also targeted by mouse Foxo3a gRNA #2. added as needed to keep the total DNA constant. Eight Selection was achieved with 50 ng/mL Geneticin™ hours after transfection DMSO or CT98014 (0.75 μM) (ThermoFisher, Waltham, MA, USA). Experiments were performed immediately after successful selection. were added. Cells were lysed using 100 μl luciferase-lysis buffer (50 mM Tris-phosphate pH 7.8, 250 mM KCl, 10% −/− Glycerol, 0.1% NP-40), lysates cleared by centrifugation at Overexpression of FOXO3A in HCT116 p53 −/− 16.100×g for 5 min, 4 °C. A volume of 10 μl of the lysate HCT116 p53 in six-well plates were transfected by was added in two black 96-well plates, renilla buffer (25 Lipofectamine® 2000 with pECE-FLAG-FOXO3A or mM Tris-phosphate, 100 mM NaCl, 1 mM EDTA, 0.05 empty vector according to the manufacturer’s protocol. mM Coelenterazin) or luciferase buffer (25 mM Tris- Twenty-four hours after transfection, the cells were phosphate, 10 mM MgSO , 2 mM ATP, 0.05 mM Luci- treated with GDC-0941 (10 μM) for 5 h and then sub- ferin) were auto-injected and firefly and renilla luciferase jected to western blotting. activities were determined by a plate reader. Statistical analysis Immunoprecipitation All data are shown as mean ± S.D. in case of technical 293T HEK cells of a 78 cm² culture plate were trans- replicates and as mean ± 95% confidence interval in case fected by PEI with pECE-FLAG-Foxo3a or pECE-FLAG- of biological replicates. The GraphPad Prism 5 software FOXO3A-TM (gifts from Michael Greenberg (Addgene (GraphPad Software Inc., La Jolla, CA, USA) was applied plasmid # 8360 and # 8361) ) and treated with CT98014 for statistical analysis using the one-way ANOVA with (0.75 μM) 8 h later. The next day, the cells were lysed in 1 post hoc Tukey’s multiple comparison test. P ≤ 0.05 was ml lysis buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, regarded as the threshold value for statistical significance. 1% Triton X-100, 1× protease inhibitor cocktail (Roche), *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001. phosphatase inhibitor cocktail 1 (1:50, Sigma-Aldrich), MG132 (20 μM, Alexis Biochemicals)). A volume of 20 μl Acknowledgements TAM We thank Martin Schuler for the p53-ER plasmid, Andreas Hecht for advice were kept as input control and the remaining lysate was and discussions, Karin Neubert for excellent technical assistance and Celia rotated for 2 h with 20 μl FLAG-M2 agarose affinity beads Jakob for initial experiments. This study was supported by Grants Ma 1967/1 (Sigma Aldrich). Beads were washed three times with lysis and Ma 1967/2 from the Deutsche Forschungsgemeinschaft to U.M., Grants buffer for 3 min. Immunoprecipitates were eluted in 50 μl 109199, 107397, and 112140 from the Deutsche Krebshilfe to U.M., by funding from the Centre for Biological Signalling Studies (BIOSS, EXC‐294), Freiburg, lysis buffer with 3× FLAG® peptide (150 ng/μl, Sigma- Germany to C.B. and U.M., and the Spemann Graduate School of Biology and Aldrich) by rotation for 30 min at 4 °C. Eluates were then Medicine (SGBM, GSC‐4), Freiburg, Germany, to C.B. and U.M. both funded by subjected to western blotting. the Excellence Initiative of the German Federal and State Governments, Germany. RT-PCR Total RNA was extracted using Trizol (Invitrogen, Author details Institute of Molecular Medicine and Cell Research, Faculty of Medicine, Albert- Carlsbad, CA, USA) according to the manufacturer’s Ludwigs-University of Freiburg, Freiburg, Germany. Spemann Graduate School protocol. 2 μg RNA were transcribed into cDNA using the of Biology and Medicine (SGBM), Albert-Ludwigs-University of Freiburg, SuperScript First Strand Synthesis Kit (Invitrogen). Freiburg, Germany. Faculty of Biology University of Freiburg Schänzlestrasse 1, 79104 Freiburg, Germany. BIOSS, Centre for Biological Signaling Studies, Transcript levels of Puma and L32 were quantified by Hebelstrasse 2, 79104 Freiburg, Germany. Functional Genomics and Cancer, quantitative RT-PCR on an CFX96TM Real Time System Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), INSERM thermocycler (Bio-Rad) with SYBR Green (Eurogentec, U964, CNRS UMR 7104, Université de Strasbourg, 1 rue Laurent Fries, Illkirch 67404, France Lüttich, Belgium). The following primers were used: mPuma: 5′-GCCCAGCAGCACTTAGAGTC-3′ and 5′- Conflict of interest GGTGTCGATGCTGCTCTTCT-3′; mL32: 5′-TTAAG- The authors declare that they have no conflict of interest. CGAAACTGGCGGAAAC-3′ and 5′-TTGTTGGTCCC- ATAACCGATG-3′. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in Re-expression of FOXO3A published maps and institutional affiliations. Production of retroviral particles and infection were performed as described above for lentiviral particles, but Supplementary Information accompanies this paper at https://doi.org/ using 1.5 μg Hit60, 1.5 μg pVSV-G (Clontech) and either 10.1038/s41419-018-0502-4. Official journal of the Cell Death Differentiation Association Schubert et al. Cell Death and Disease (2018) 9:470 Page 13 of 13 Received: 18 December 2017 Revised: 9 March 2018 Accepted: 15 March 13. Tang, Y., Luo, J., Zhang, W. & Gu, W. Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Mol. Cell 24, 827–839 (2006). 14. Tang, Y., Zhao, W., Chen, Y., Zhao, Y. & Gu, W. Acetylation is indispensable for p53 activation. Cell 133,612–626 (2008). 15. Lindner, S. E. et al. Increased leukocyte survival and accelerated onset of References lymphoma in the absence of MCL-1 S159-phosphorylation. Oncogene 33, 1. Llambi, F. et al. A unified model of mammalian BCL-2 protein family inter- 5221–5224 (2014). actions at the mitochondria. Mol. Cell 44,517–531 (2011). 16. Stahl, M. et al. The Forkheadtranscription factor FoxO regulates tran- 2. Brunet, A. et al. Akt promotes cell survival by phosphorylating and inhibiting a scription of p27Kip1 and Bim in response to IL-2. J. Immunol. 168, Forkhead transcription factor. Cell 96, 857–868 (1999). 5024–5031 (2002). 3. Maurer, U., Preiss, F., Brauns-Schubert, P., Schlicher, L. & Charvet, C. GSK-3 17. Ekert,P.G.etal. Cell deathprovoked by loss of interleukin-3 signaling is – at the crossroads of cell death and survival. J. Cell Sci. 127, 1369–1378 independent of Bad, Bim, and PI3 kinase, but depends in part on Puma. Blood (2014). 108, 1461–1468 (2006). 4. Pap, M. & Cooper, G. M. Role of glycogen synthase kinase-3 in the phos- 18. Ekoff, M. et al. The BH3-only protein Puma plays an essential role in cytokine phatidylinositol 3-Kinase/Akt cell survival pathway. J. Biol. Chem. 273, deprivation-induced apoptosis of mast cells. Blood 110, 3209–3217 (2007). 19929–19932 (1998). 19. Nayak,G.&Cooper,G.M. p53 is amajor componentofthe transcriptionaland 5. You, H. et al. FOXO3a-dependent regulation of Puma in response to cytokine/ apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling. Cell Death Dis. growth factor withdrawal. J. Exp. Med. 203,1657–1663 (2006). 3, e400 (2012). 6. Charvet, C. et al. Phosphorylation of Tip60 by GSK-3 determines the induction 20. Jabbour,A.M.etal. Myeloidprogenitorcells lackingp53 exhibitdelayed up- of PUMA and apoptosis by p53. Mol. Cell 42,584–596 (2011). regulation of Puma and prolonged survival after cytokine deprivation. Blood 7. Ambacher, K. K. et al. The JNK- and AKT/GSK3β- signaling pathways converge 115,344–352 (2010). to regulate Puma induction and neuronal apoptosis induced by Trophic 21. Jabbour, A. M. et al. P53-dependent transcriptional responses to Interleukin-3 Factor deprivation. PLoS ONE 7, e46885 (2012). signaling. PLoS ONE 7, e31428 (2012). 8. Huo, X. et al. GSK3 protein positively regulates type I insulin-like growth factor 22. Cahill, C. M. et al. Phosphatidylinositol 3-Kinase signaling inhibits DAF-16 DNA receptor through Forkhead transcription factors FOXO1/3/4. J. Biol. Chem. 289, binding and function via 14-3-3-dependent and 14-3-3-independent path- 24759–24770 (2014). ways. J. Biol. Chem. 276,13402–13410 (2001). 9. Maurer, U., Charvet, C., Wagman, A. S., Dejardin, E. & Green, D. R. Glycogen 23. Terragni, J. et al. The E-box binding factors Max/Mnt, MITF, and USF1 act synthase kinase-3 regulates mitochondrial outer membrane permeabili- coordinately with FoxO to regulate expression of proapoptotic and cell cycle zation and apoptosis by destabilization of MCL-1. Mol. Cell 21, 749–760 control genes by phosphatidylinositol 3-kinase/akt/glycogen synthase kinase (2006). 3 signaling. J. Biol. Chem. 286, 36215–36227 (2011). 10. Nakano, K. & Vousden, K. H. PUMA, a novel proapoptotic gene, is induced by 24. Sanjana, N. E., Shalem, O. & Zhang, F. Improved vectors and genome-wide p53. Mol. Cell 7, 683–694 (2001). libraries for CRISPR screening. Nat. Methods 11,783–784 (2014). 11. Yu, J.,Zhang,L., Hwang, P. M.,Kinzler,K.W.&Vogelstein,B.PUMA 25. You, H., Yamamoto, K. & Mak, T. W. Regulation of transactivation-independent induces the rapid apoptosis of colorectal cancer cells. Mol. Cell 7, proapoptotic activity of p53 by FOXO3a. Proc. Natl Acad. Sci. USA 103, 673–682 (2001). 9051–9056 (2006). 12. Sykes,S.M.etal. Acetylationofthe p53 DNA-binding domain regulates 26. Brunet, A. et al. Stress-dependent regulation of FOXO transcription factors by apoptosis induction. Mol. Cell 24,841–851 (2006). the SIRT1 deacetylase. Science 303,2011–2015 (2004). Official journal of the Cell Death Differentiation Association

Journal

Cell Death & DiseaseSpringer Journals

Published: Apr 23, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off