Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

p62 is linked to mitophagy in oleic acid-induced adipogenesis in human adipose-derived stromal cells

p62 is linked to mitophagy in oleic acid-induced adipogenesis in human adipose-derived stromal cells Background: Obesity is closely related to the abnormal differentiation of adipocytes, which are subjected to high plasma levels of free fatty acids (FFAs). As the most abundant FFA in the bloodstream, oleic acid (OA) has the ability to induce adipogenic differentiation in human adipose-derived stromal cells (hADSCs). Recently, p62, an autophagy mediator, has been shown to play a role in obesity and adipose tissue metabolism. Therefore, the aim of this study was to investigate the roles of autophagy and mitochondrial function at different stages of OA (in combination with insulin and dexamethasone)-induced adipogenesis in hADSCs. Methods: The hADSCs were incubated with OA, insulin, and dexamethasone after pretreatment with autophagy inhibitors or knockdown of p62 with shRNA. The adiposeness level was then analyzed by oil red O staining in the cells. The related proteins or mRNA levels were detected by western blot analysis or quantitative real-time polymerase chain reaction (PCR). Results: Treatment with 80 μM OA (substituted for isobutylmethylxantine; IBMX) for 10 days successfully induced hADSCs to adipocytes. During OA-induced adipogenesis, autophagy was induced, with an increased LC3II/I ratio on day 3 andadecreasedprotein levelofp62on andafter day3.Inhibition of autophagy with 3-methyladenine (3MA) at the early stage (day 0 to day 3) of differentiation, but not at the middle or late stage, significantly decreased OA-induced adipogenesis; while knockdown of p62 with shRNA significantly promoted adipogenesis in hADSCs. Moreover, the copy number of mtDNA (the ND1 gene) and the protein level of TOM20, a mitochondrial membrane protein, were increased following OA treatment, which was related to the stability of mitochondria. Interestingly, knockdown of p62 increased the mito-LC3II/I and cyto-LC3II/I ratios by 110.1% and 73.3%, respectively. The increase in the ratio of mito-LC3II/I was higher than that of cyto-LC3II/I. Furthermore, p62 knockdown-enhanced adipogenesis in hADSCs was abolished by inhibiting mitophagy with cyclosporine A. Conclusions: These results suggested that p62 plays a protective role in adipogenesis of hADSCs through regulating mitophagy. Background Studies have shown that 3 T3-L1 murine preadipocytes are Obesity is characterized by excess adipose tissue growth able to be induced to accumulate lipid droplets in a serum- probably due to the increased proliferation and differenti- free medium supplemented with OA without the use of in- ation of adipose-derived stromal cells (ADSCs), in addition duction medium, including isobutylmethylxantine (IBMX), to adipocyte hypertrophy [1, 2]. Besides, obesity, which is insulin, and dexamethasone [6, 7]. In addition, OA pro- correlated with insulin resistance, is associated with in- motes the formation of triglyceride-rich lipid droplets and creased plasma levels of free fatty acids (FFAs) [3–5]. Oleic induces autophagy in hepatocytes [8]. Unlike other induc- acid (OA) is the most abundant FFA in the bloodstream. tion medium components, IBMX is a chemical that is not present in the human body. Therefore, in this study, OA * Correspondence: [email protected] was used as a substitute for IBMX to induce adipogenic dif- Department of Tissue Engineering, School of Fundamental Sciences, China ferentiation in human ADSCs (hADSCs), which may more Medical University, Shenyang 110001, China closely mimic human physiological conditions. Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 2 of 10 Autophagy is upregulated in adipose tissue from obese containing 0.1% collagenase I. The digested tissue was individuals and is correlated with the degree of obesity, then filtered through 100-μm mesh and pelleted by cen- visceral fat distribution, and adipocyte hypertrophy [9]. trifugation at 600×g for 5 min. hADSCs were grown in Recent studies have demonstrated that inhibition of plastic dishes with low-glucose Dulbecco’s modified autophagy by RNA interference against autophagy re- Eagle medium supplemented with 10% fetal bovine lated 5 (Atg5) or Atg7 blocks adipogenic differentiation serum (FBS) in an atmosphere of 5% CO and 100% in 3 T3-L1 preadipocytes and in adipose tissue [10]. humidity at 37 °C. For each experiment, three parallel Consistently, pharmacological inhibition of autophagy cultivations were prepared. Two days after reaching con- prevents body weight gain and fat mass expansion, pro- fluence (day 0), differentiation was initiated by switching tecting against metabolic syndrome components such as to differentiation medium containing 10% FBS, 10 μg/mL glucose intolerance and insulin resistance. p62, a multi- insulin, 1 μM dexamethasone, and 50 μΜ,80 μM, or functional protein and an important mediator in the au- 100 μM OA (O1008, Sigma-Aldrich, St. Louis, MO, USA). tophagy–lysosome pathway, may play a role in obesity and adipose tissue metabolism [11–13]. In addition, p62 Oil red O staining and quantification of intracellular lipids gene-knockout mice develop obesity and insulin resist- After adipogenic induction, cells were washed twice with ance as well as show fat accumulation in the white adi- phosphate-buffered saline (PBS) and fixed in 4% parafor- pose tissue, slow basic lipid hydrolysis, and increased maldehyde at room temperature for 30 min. Next, the lipid synthesis. However, whether p62 regulates adipo- cells were stained with an oil red O solution (60% oil red cyte differentiation and the underlying mechanism are O stock solution and 40% H O) for 15 min and then not clear. The p62-deficient mice also show metabolic washed three times with PBS. The cell phenotype was changes, suggesting that p62 promotes a negative energy observed under a light microscope (Olympus Provis balance by inhibiting adipogenesis and favoring energy BX41). For quantification, intracellular lipids were ex- combustion [11]. This study will address the role of p62 tracted using isopropanol, and the absorbance was mea- and its relationship with autophagy in adipogenic differ- sured at a wavelength of 500 nm [15]. entiation of hADSCs. Mitophagy is the term for mitochondrial selective au- p62 lentiviral silencing tophagy. A specific receptor in the autophagic vacuole hADSCs were infected with lentivirus encoding p62 membrane can be identified by damaged mitochondria shRNA (GCAGATGAGGAAGATCGCCTT) or scram- and then targeted degradation happens; this process is bled control shRNA, according to the manufacturer’s very important to maintain a normal number and func- instructions. Lentiviral particles were purchased from tion of mitochondria. The adipose differentiation process GeneChem (Shanghai, China). is accompanied by the formation of lipid droplets and the synthesis of triglycerides. Mitochondria are key to Immunofluorescence fatty acid oxidation, so this study will provide further Cells were fixed in 4% paraformaldehyde, permeabilized understanding of the relationship between mitophagy in 0.25% Triton X-100, and blocked with 5% normal and p62 after identifying the basic function of autophagy donkey serum. Next, the cells were incubated with rabbit in hADSC adipose differentiation. It will illustrate the anti-microtubule-associated protein light chain 3 molecular mechanism of human adipocyte differenti- (LC3) B monoclonal antibody (L7543, Sigma-Aldrich) ation and provide a new way to identify novel drug tar- in a cold room overnight and stained with goat anti- gets for obesity. rabbit IgG Alexa Fluor 488 antibody (SAB4600389, Based on the above discussion, we built an OA- Sigma-Aldrich) at room temperature for 1 h. The induced hADSC model and knocked down p62 in this cells were subsequently viewed under a fluorescence model with lentiviral shRNA to explore the effects of microscope (TE2000-U, Nikon, Japan). p62 and mitophagy on the adipogenesis of hADSCs. Western blot Methods To prepare total cell lysates, monolayers of hADSCs Culture and differentiation of hADSCs were scraped with RIPA buffer containing protease in- All experiments were reviewed and approved by the In- hibitors and phosphatase inhibitors. To separate mito- stitutional Review Board of China Medical University. chondrial and cytoplasmic fractions, the cells were Thigh adipose tissue was obtained from females (30– scraped in mitochondrial isolation buffer. The collected 35 years old) during liposuction surgeries. Isolation of cells were then mechanically disrupted. Cell slurries hADSCs and differentiation into adipocytes were con- were centrifuged at 600×g for 5 min. The supernatant ducted as described previously [14]. Briefly, tissue was fractions were collected and centrifuged again at 8000×g minced and enzymatically digested for 45 min in a buffer for 15 min to pellet the mitochondria. The supernatant Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 3 of 10 fractions represented the cytosolic fraction. The mito- Statistical analysis chondrial pellet was washed by resuspension in mito- All data were expressed as the mean ± standard devi- chondrial isolation buffer, spun again at 8000×g for ation (SD). Comparisons of data among groups were 15 min, and lysed in RIPA buffer. Equal amounts of performed by one-way analysis of variance, and differ- protein were separated in 4–20% Tris-glycine sodium ences between two groups were analyzed by the Stu- dodecyl sulfate–polyacrylamide gel electrophoresis gels dent–Newman–Keuls test using SPSS 17.0 software. A (Dalian TaKaRa) and transferred to nitrocellulose mem- p-value of less than 0.05 was considered to be a signifi- branes. Membranes were blocked in 5% nonfat dry milk cant difference. in Tris-buffered saline for 1 h at room temperature and then incubated with primary antibody diluted in 5% Results nonfat dry milk overnight at 4 °C [16]. The primary anti- OA-induced adipogenesis of hADSCs bodies used were as follows: β-actin (Abp50151, Abcam, Adipogenesis was measured after treatment with different Cambridge, MA, USA), LC3, peroxisome proliferator acti- concentrations (50, 80, and 100 μM) of OA in combin- vated receptor γ (PPARγ; 101,700–500, Abcam), p62 ation with insulin and dexamethasone. We found that (P0067, Sigma-Aldrich), dynamin-related protein 1 (DRP- OA, which was substituted for IBMX, successfully in- 1; ABP51203, Abcam), mitofusin 1 (MFN-1; SAB2106161, duced hADSCs to adipocytes, with visible cytoplasmic Sigma-Aldrich), and mitochondrial outer membrane 20 lipid droplets that were stained red by oil red O (Fig. 1a). (TOM20; HPA011562, Sigma-Aldrich). Membranes were In the group treated with 80 μM OA, the intracellular washed in Tris-buffered saline containing Tween 20 lipid content (Fig. 1b) and the protein expression level of (TBS-T) and incubated with horseradish peroxidase- PPARγ (Fig. 1c–d) were the highest among the three conjugated anti-rabbit IgG secondary antibody (1:2000, groups treated with different concentrations of OA (p <0. Sigma) at room temperature for 1 h. The membranes were 01). Based on these results, 80 μM OA was chosen for the washed again in TBS-T, developed with an ECL Substrate subsequent experiments. (K820–50, Abcam), and imaged using a GelDoc XR System. Densitometry of the probed bands was analyzed Autophagy was induced during adipogenesis of hADSCs by Image J2x. To examine whether autophagy is involved in OA- induced adipogeneses of hADSCs, we detected the ex- pression of the autophagy marker molecule LC3 at dif- Quantitative real-time polymerase chain reaction (PCR) ferent time points [17, 18]. Immunofluorescence staining Total RNA was extracted from cells using TRIZOL® Re- of LC3 showed that punctiform accumulation of LC3 II agent (Promega), according to the manufacturer’s in- was increased from day 1 to day 3, while it decreased structions. cDNA was synthesized using a First-Strand from day 4 to day 7, and then it returned to the undiffer- cDNA Synthesis Kit (Dalian TaKaRa). Real-time PCR entiated level at day 9 (Fig. 2a). Western blot analysis was carried out with an ABI PRISM 7300 real-time PCR showed that the LC3II/I ratios were higher during adipo- machine. The fold-change in gene expression relative to genesis, compared with that on the first day (Fig. 2b–c), -ΔΔCT the control was calculated by the 2 method. The indicating that high autophagic levels were maintained experiments were repeated three times, and every throughout the whole differentiation process. The sample was assayed in triplicate. The primers used in LC3II/I ratio on day 3 was significantly higher than that the experiment are listed in Table 1. on the following days, and there was no significant difference in the LC3II/I ratios among days 5, 7, and 9 Determination of mitochondrial DNA (mtDNA) copy (Fig. 2b–c). p62, a key factor of autophagy, was also de- number tected during adipogenesis. The protein level of p62 was The mtDNA copy number per cell was quantified as the the highest on day 1 and then decreased during the later amplicon ratio from the PCR with specific primers phase of differentiation (Fig. 2b and d), suggesting that it against a gene (NADH dehydrogenase subunit 1; Nd1) might play a vital role in the adipogenesis of hADSCs. encoded by mtDNA and a gene (GAPDH) encoded by Table 1 Sequences of primers used for real-time PCR nuclear DNA. Total DNA was isolated from the cells Gene Primer (5′→ 3′) using a DNA Extraction Kit (Omega). Quantification of mitochondrial and genomic genes was performed by the Forward Reverse quantitative PCR method using the primer sequences PPARG AGCCTCATGAAGAGCCTTCCA ACCCTTGCATCCTTCACAAGC -ΔΔCT listed in Table 1. The 2 method was performed as ACTB ACTCTTCCAGCCTTCCTTCC GTACTTGCGCTCAGGAGGAG -ΔΔCT described in the previous paragraph. The ratio of 2 ND1 CCCTAAAACCCGCCACATC GAGCGATGGTGAGAGCTAAGGT -ΔΔCT mito/2 nuclear was calculated for the combination GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA of determined mitochondrial and nuclear genes. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 4 of 10 Inhibition of autophagy at the early stage of as p62, and finally the phagophore closes to form an differentiation in hADSCs prevented adipogenesis autophagosome [19, 20]. p62 is expected to play a key We investigated the effects of autophagy inhibition on role in adipogenic differentiation of hADSCs. Therefore, adipogenesis in hADSCs with 3-methyladenine (3MA) at in this study, we investigated the function of p62 in adi- different stages of differentiation (Fig. 3a). The conver- pogenic differentiation of hADSCs by knocking it down sion of LCI to LCII in hADSCs was significantly de- with a lentiviral p62 shRNA (shp62). The results showed creased when the cells were incubated with 10 mM that the oil red O-positive cells (Fig. 4a) as well as the 3MA for 24 h (Fig. 3b), indicating that treatment with mRNA (Fig. 4b) and protein (Fig. 4c and e) levels of 3MA could successfully inhibit autophagy. In addition, PPARγ at day 10 of differentiation were significantly adipogenesis, in terms of oil red O staining and the increased after knockdown of p62 in hADSCs, indicating intracellular lipid content, was significantly reduced by that knockdown of p62 promoted OA-induced adipo- treatment with 3MA during the early stage (days 0–3) as genesis in hADSCs. As expected, the protein expression well as throughout the whole differentiation process (days of p62 was substantially decreased after treatment with 0–10), compared with the control group (Fig. 3c–d). How- shp62 (Fig. 4c–d). ever, inhibition of autophagy with 3MA during the middle stage (days 4–7) or the late stage (days 8–10) of differenti- OA increased mitochondrial content during adipogenic ation did not affect OA-induced adipogenesis in hADSCs differentiation (Fig. 3c–d). In addition, changes in the protein ex- It is not yet known whether mitophagy is induced during pression of PPARγ and C/EBPα showed a similar pat- adipogenesis or whether a general increase in nonspecific tern as the oil red O staining and intracellular lipid autophagic degradation of mitochondria affects adipogene- analysis results (Fig. 3e). These findings suggest that sis [21]. To investigate the mitochondrial content in OA- autophagy may play a vital role at the early stage of induced adipogenic differentiation, we measured the copy adipogenic differentiation in hADSCs. number of mtDNA (ND1 gene) by quantitative PCR and the protein level of TOM20, a mitochondrial membrane Knockdown of p62 enhanced OA-induced adipogenesis of protein, by western blot analysis. As shown in Fig. 5a,the hADSCs ND1 DNA copy number was increased following OA treat- The phagophore elongates and engulfs autophagic cargo, ment. Compared with baseline (day 0), the protein expres- whose recognition is mediated by adaptor proteins such sion of TOM20 was significantly increased in differentiated Fig. 1 Adipogenesis of hADSCs induced by oleic acid (OA) in combination with insulin and dexamethasone. Cells were exposed to various concentrations of OA (50, 80, and 100 μM) or IBMX in combination with insulin and dexamethasone for 10 days. a Intracellular lipids were visualized by oil red O staining at day 10. b Quantification of intracellular lipids at the end of the incubation period (day 10). Briefly, oil red O-stained lipids were extracted with isopropanol, and the absorbance at 500 nm was determined by spectrophotometry. c and d The PPARγ protein expression ## level was analyzed by western blot at day 10. Data are shown as the mean ± SD (n =3). **p < 0.01 vs. control, p <0.01 vs. IBMX Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 5 of 10 cells at day 8 (p <0.01, Fig. 5b–c). These results showed Mito-LC3II/I was detected as a marker of mitophagy. that mitochondrial content was significantly increased at Meanwhile, cyto-LC3II/I was also measured as a marker the end of differentiation and that the energy-producing of autophagy. Western blot analysis showed that knock- ability was further improved by the increased mitochondrial down of p62 increased the mito-LC3II/I ratio by 110.1% membrane protein level. The quality of mitochondria was and the cyto-LC3II/I ratio by 73.3% (Fig. 6a–b). These re- increased greatly by mitophagy, which ensured the refresh- sults indicated that knockdown of p62 promoted mito- ment of mitochondria. Therefore, we further investigated phagy during OA-induced adipogenesis in hADSCs. p62 the correlative index of mitophagy during adipogenic differ- knockdown-induced mitophagy is unlikely secondary to entiation. Mitochondrial fusion and fission have a close re- autophagy as there was a trend towards a higher mito- lationship with mitophagy, so we measured the protein LC3II/I ratio than the cyto-LC3II/I ratio. expression of the mitochondrial fission protein DRP-1 and To further investigate whether the increase of mito- the fusion protein MFN-1 during adipogenesis. No notable phagy caused by p62 silencing is related to the increase change in expression of MFN-1 occurred during adipogen- of adipogenesis, cyclosporine A, a selective inhibitor of esis (Fig. 5d and f). Interestingly, DRP-1 was upregulated at mitochondrial autophagy, was used at the early stage of day 3, but it returned to the baseline level on day 5 and day differentiation (days 0–3). The results showed that p62 8(Fig. 5d–e). These data showed that the balance between knockdown-induced increases in oil red O-positive cells mitochondrial fusion and fission was broken and that the and protein expression of PPARγ were abolished by mitochondria tended to become instable, indicating that treatment with cyclosporine A (Fig. 7a–c). These data mitophagy was increased during this period. suggested that p62 knockdown-enhanced adipogenesis may be dependent on mitophagy at the early stage of Knockdown of p62 enhanced OA-induced adipogenesis of differentiation and that p62 may affect adipogenesis of hADSCs by increasing mitophagy hADSCs through regulating mitophagy. Since autophagy played a role mainly in the early stage of adipogenesis, the following parameters were detected at Discussion day 3 of differentiation. After mitochondrial autophagy oc- Obesity and insulin resistance have been observed in p62 curred, mitochondria combined to form autophagosomes. gene-knockout mice, and the basal lipolytic hydrolysis is Fig. 2 Autophagy at different stages of oleic acid (OA)-induced adipogenesis in hADSCs. a Representative immunofluorescence staining of LC3 in hADSCs at days 1, 3, 5, 7, and 9 of adipogenesis. b Western blot of LC3 and p62 in hADSCs during differentiation. c Quantification of the LC3II/I ** # ratio. d Quantification of the p62 protein level. Data are shown as the mean ± SD (n = 3). p < 0.01 vs. d1, p < 0.05 vs. d3 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 6 of 10 slower than that of wild-type mice. In addition, the num- differentiation in hADSCs. The results showed that au- ber of intracellular lipid droplets, synthesis of triglycerides, tophagy in hADSCs was at a very low level at baseline, and the size of adipocytes are increased in p62 gene- which is conducive to the maintenance of homeostasis. knockout mice [13]. In the present study, knockdown of After adipogenic induction with OA, the autophagy level p62 significantly enhanced OA-induced adipogenesis in was significantly increased at the early stage, and then it hADSCs. These results were similar to those observed in decreased at the later stage of adipogenic differentiation. p62 gene-knockout mice, suggesting that loss of p62 ex- Inhibition of autophagy using 3MA at the early stage re- pression increases adipogenic differentiation and that p62 sulted in a significant decrease in adipogenesis, while plays an important role in human adipocyte differenti- 3MA treatment at the middle or late stage did not affect ation. Therefore, it is speculated that p62 may play a pro- adipogenesis. These findings suggest that autophagy is tective role in the development of obesity that is caused required for replacing cellular components during adipo- by an increased number of adipocytes. genic differentiation. Otherwise, it would be difficult to OA-induced adipogenesis is probably due to increased achieve the switch of cellular components and functional FFA uptake. In this study, we found that OA increased transformation, which would enable the cells to maintain the protein expression of the adipogenesis-related gene their original undifferentiated state. Interestingly, au- PPARγ, which promotes FFA uptake into adipocytes. Yu tophagy is crucial during the initiation of adipogenesis. et al. have reported that OA and linoleic acid promote A possible reason is that the relevant proteins that deter- lipid accumulation in adipocytes, probably through regu- mine the new phenotype and function of the cells are lating PPARγ phosphorylation [22], which is consistent mainly transformed at the early stage of adipogenesis. In with our results. contrast, the later stages of differentiation may be com- It has been reported that autophagy is involved in the prised of a cascade reaction, and the autophagic activity differentiation of 3 T3-L1 pre-adipocytes [23, 24]. In the only needs to be maintained at a basal level. Recent present study, we observed that OA-induced adipogene- studies have found that mitochondria play a vital role in sis and autophagic activity changed at different stages of self-renewal and directional differentiation of stem cells. Fig. 3 Effects of autophagy inhibition at different stages of differentiation on oleic acid (OA)-induced adipogenesis in hADSCs. a Adipogenic differentiation in hADSCs was induced with 80 μM OA, and the cells were treated with 3MA (10 mM) for different periods of time. b Western blot analysis of LC3II/I in hADSCs treated with 3MA for 24 h. c Oil red O staining at the end of differentiation (day 10). d Quantification of intracellular ** lipids at day 10. e Western blot analysis of PPARγ and C/EBPα at day 10. Data are shown as the mean ± SD (n = 3). p < 0.01 vs. control Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 7 of 10 Fig. 4 Knockdown of p62 enhanced adipogenesis of hADSCs. hADSCs were infected with shp62 for 72 h, and then adipogenic differentiation was induced with 80 μM oleic acid (OA). a Intracellular lipids were stained with oil red O at the end of differentiation (day 10). b Gene expression of PPARγ at day 10. c Western blot of p62 and PPARγ at day 10. d Quantification of p62 protein expression. e Quantification of PPARγ protein expression. Values are the mean ± SD (n = 3). **p < 0.01 vs. control Fig. 5 The number and fusion–fission balance of mitochondria in hADSCs during adipogenic differentiation. a The mtDNA (Nd1 gene) copy number was measured by quantitative PCR at days 0, 3, 5, and 8 of adipogenic differentiation. Western blot (b) and quantification (c)of the mitochondrial membrane protein TOM20. d Western blot of DRP-1 and MFN-1. e Quantification of the DRP-1 protein expression level. f Quantification of the MFN-1 protein expression level. Values are the mean ± SD (n =3). **p <0.01 vs. d0 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 8 of 10 Fig. 6 Knockdown of p62 promoted mitophagy at the early stage of adipogenesis in hADSCs. a Western blot of mitochondrial and cytoplasmic LC3II/I at day 3 of adipogenic differentiation in hADSCs treated with shp62 or control shRNA. b Quantification of the mitochondrial and ** cytoplasmic LC3II/I ratios. Values are the mean ± SD (n = 3). p < 0.01 vs. control When stem cells are differentiated, mitochondria grad- The results of this study showed that p62 knockdown ually become “mature” and their number and function enhanced mitophagy. The reason may be related to the increase [25, 26]. The expression of the mitochondrial duality of p62 on mitochondria: p62 does not only medi- marker protein TOM20 and the mtDNA copy number ate the genesis of mitophagy, but it also stabilizes mito- can reflect mitochondrial content to a certain degree chondria from injury to prevent mitophagy. Based on [27–29]. The results showed that both parameters were our results, we speculated that knockdown of p62 in continuously increasing during OA-induced adipogen- hADSCs resulted in a significant reduction of its esis in hADSCs, which further verified the existing stabilization function, resulting in increased mitophagy. speculation. The increase of mitochondrial content Alternatively, knockdown of p62 increased the activity of during adipogenesis may have two functions. First, other mediators to initiate mitophagy. In this case, p62 the process of cell differentiation requires mitochon- as a mediator for mitophagy is not necessary. In adipo- dria to provide enough ATP to enable the cells to genic differentiation of hADSCs, knockdown of p62 led undergo re-establishment. Second, mitochondria may to an uneven distribution of autophagic fluxes: a rela- be necessary for the synthesis of triglycerides and the tively increased mitophagy flux. Thus, the refreshment formation of lipid droplets. of a large number of mitochondria was ensured, which Fig. 7 Inhibition of mitophagy abolished p62 knockdown-enhanced adipogenesis of hADSCs. hADSCs were pretreated with shp62 for 72 h and then induced by 80 μM oleic acid (OA) with or without 5 μM cyclosporine A (CsA), a mitophagy inhibitor. Differentiated cells were analyzed on day 10. a Oil red O staining. b Western blot of PPARγ. c Quantification of PPARγ protein expression. Values are the mean ± SD (n = 3). **p < 0.01 ## vs. control, p < 0.01 vs. shp62 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 9 of 10 further promoted lipid synthesis and differentiation Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in progression. published maps and institutional affiliations. A limitation of this study was that heterogeneity of the primary cultured adipocytes may affect both adipogene- Author details Department of Tissue Engineering, School of Fundamental Sciences, China sis and mitophagy. A previous study has demonstrated Medical University, Shenyang 110001, China. Department of Anatomy, that the most commonly utilized adipose tissue extrac- College of Basic Medical Sciences, Jinzhou Medical University, Jinzhou tion technique leads to a heterogeneous cell population 121001, China. Liaoning Key Laboratory of Follicular Development and Reproductive Health, Jinzhou 121001, China. Department of Pathogenic [30]. In addition, primary cultured adipocytes partially Biology, College of Basic Medical Sciences, Jinzhou Medical University, retain the phenotypic properties of the tissue donor, Jinzhou 121001, China. such as gender, age, or body weight [14]. Moreover, the Received: 13 February 2018 Accepted: 3 April 2018 heterogeneity of mesenchymal stem cells in the final dif- ferentiation stage is variable. However, this variability is largely reduced under proinflammatory conditions or by References knockdown of certain genes [31, 32]. In this study, 1. Hausman DB, DiGirolamo M, Bartness TJ, Hausman GJ, Martin RJ. The knockdown of p62 in differentiating hADSCs reduced biology of white adipocyte proliferation. Obes Rev. 2001;2(4):239–54. the heterogeneity of hADSCs. Nevertheless, further 2. Gesta S, Tseng YH, Kahn CR. Developmental origin of fat: tracking obesity to its source. Cell. 2007;131(2):242–56. studies using homogeneous adipocytes are warranted. 3. Boden G. Obesity, insulin resistance and free fatty acids. Curr Opin Endocrinol Diabetes Obes. 2011;18(2):139–43. 4. Toledo K, Aranda M, Asenjo S, Saez K, Bustos P. Unsaturated fatty acids and Conclusions insulin resistance in childhood obesity. J Pediatr Endocrinol Metab. 2014; In combination with insulin and dexamethasone, OA 27(5–6):503–10. can successfully induce adipogenesis of hADSCs. Au- 5. Arner P, Ryden M. Fatty acids, obesity and insulin resistance. Obes Facts. 2015;8(2):147–55. tophagy plays a vital role at the early stage of adipogene- 6. Kokta TA, Strat AL, Papasani MR, Szasz JI, Dodson MV, Hill RA. Regulation of sis; thus, knockdown of p62 may promote adipogenesis lipid accumulation in 3T3-L1 cells: insulin-independent and combined by increasing the activity of mitophagy. effects of fatty acids and insulin. Animal. 2008;2(1):92–9. 7. Cheguru P, Chapalamadugu KC, Doumit ME, Murdoch GK, Hill RA. Adipocyte differentiation-specific gene transcriptional response to C18 Abbreviations unsaturated fatty acids plus insulin. Pflugers Archiv. 2012;463(3):429–47. 3MA: 3-methyladenine; Atg5: Autophagy related 5; DRP-1: Dynamin-related 8. Mei S, Ni HM, Manley S, Bockus A, Kassel KM, Luyendyk JP, et al. Differential protein 1; FFAs: Free fatty acids; hADSCs: Human adipose-derived stromal roles of unsaturated and saturated fatty acids on autophagy and apoptosis cells; IBMX: Isobutylmethylxantine; LC3: Microtubule-associated protein light in hepatocytes. J Pharmacol Exp Ther. 2011;339(2):487–98. chain 3; MFN-1: Mitofusin 1; ND1: NADH dehydrogenase subunit 1; OA: Oleic 9. Kovsan J, Bluher M, Tarnovscki T, Kloting N, Kirshtein B, Madar L, et al. acid; PPARγ: Peroxisome proliferator activated receptor γ; Altered autophagy in human adipose tissues in obesity. J Clin Endocrinol TOM20: Mitochondrial outer membrane 20 Metab. 2011;96(2):E268–77. 10. Singh R, Xiang Y, Wang Y, Baikati K, Cuervo AM, Luu YK, et al. Autophagy Acknowledgments regulates adipose mass and differentiation in mice. J Clin Invest. 2009; This manuscript has been edited and proofread by Medjaden Bioscience 119(11):3329–39. Limited. 11. Rodriguez A, Duran A, Selloum M, Champy MF, Diez-Guerra FJ, Flores JM, et al. Mature-onset obesity and insulin resistance in mice deficient in the signaling adapter p62. Cell Metab. 2006;3(3):211–22. Funding 12. Lee SJ, Pfluger PT, Kim JY, Nogueiras R, Duran A, Pages G, et al. A functional This work was supported by the National Natural Science Foundation of role for the p62-ERK1 axis in the control of energy homeostasis and China (No. 30772215), the Education Department of Liaoning Province (No. adipogenesis. EMBO Rep. 2010;11(3):226–32. L2015313), and the Technology Department of Liaoning Province (No. 13. Muller TD, Lee SJ, Jastroch M, Kabra D, Stemmer K, Aichler M, et al. p62 links 2015020340). beta-adrenergic input to mitochondrial function and thermogenesis. J Clin Invest. 2013;123(1):469–78. Availability of data and materials 14. Skurk T, Hauner H. Primary culture of human adipocyte precursor cells: The data that support the findings of this study are available upon request expansion and differentiation. Methods Mol Biol. 2012;806:215–26. to the corresponding author. 15. Skop V, Cahova M, Dankova H, Papackova Z, Palenickova E, Svoboda P, et al. Autophagy inhibition in early but not in later stages prevents 3T3-L1 differentiation: effect on mitochondrial remodeling. Differentiation. 2014; Authors’ contributions 87(5):220–9. Conceived and designed the experiments: RXZ and SLB; performed the 16. Sin J, Andres AM, Taylor DJ, Weston T, Hiraumi Y, Stotland A, et al. experiments: RXZ, YF, and YBZ; data collection and analysis: RXZ, YF, and Mitophagy is required for mitochondrial biogenesis and myogenic YBZ; wrote the manuscript: RXZ and YBZ. All authors have read and differentiation of C2C12 myoblasts. Autophagy. 2016;12(2):369–80. approved the final manuscript. 17. Zhang J. Teaching the basics of autophagy and mitophagy to redox biologists– mechanisms and experimental approaches. Redox Biol. 2015;4:242–59. Ethics approval and consent to participate 18. Kim BW, Kwon DH, Song HK. Structure biology of selective autophagy This study was approved by the ethics committee of The Affiliated Hospital receptors. BMB Rep. 2016;49(2):73–80. of Jinzhou Medical University and conducted in accordance with the ethics 19. Lin X, Li S, Zhao Y, Ma X, Zhang K, He X, et al. Interaction domains of principles described by the Declaration of Helsinki. p62: a bridge between p62 and selective autophagy. DNA Cell Biol. 2013;32(5):220–7. Competing interests 20. Komatsu M, Kageyama S, Ichimura Y. p62/SQSTM1/A170: physiology and The authors declare that they have no competing interests. pathology. Pharmacol Res. 2012;66(6):457–62. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 10 of 10 21. Goldman SJ, Zhang Y, Jin S. Autophagic degradation of mitochondria in white adipose tissue differentiation. Antioxid Redox Signal. 2011;14(10):1971–8. 22. Yu C, Xi L, Chen J, Jiang Q, Yi H, Wang Y, et al. PAM, OLA, and LNA are differentially taken up and trafficked via different metabolic pathways in porcine adipocytes. Lipids. 2017;52(11):929–38. 23. Zhang Y, Ye M, Chen LJ, Li M, Tang Z, Wang C. Role of the ubiquitin- proteasome system and autophagy in regulation of insulin sensitivity in serum-starved 3T3-L1 adipocytes. Endocr J. 2015;62(8):673–86. 24. Hahm JR, Noh HS, Ha JH, Roh GS, Kim DR. Alpha-lipoic acid attenuates adipocyte differentiation and lipid accumulation in 3T3-L1 cells via AMPK- dependent autophagy. Life Sci. 2014;100(2):125–32. 25. Hu C, Fan L, Cen P, Chen E, Jiang Z, Li L. Energy metabolism plays a critical role in stem cell maintenance and differentiation. Int J Mol Sci. 2016;17(2):253. 26. Margineantu DH, Hockenbery DM. Mitochondrial functions in stem cells. Curr Opin Genet Dev. 2016;38:110–7. 27. Gehrke S, Wu Z, Klinkenberg M, Sun Y, Auburger G, Guo S, et al. PINK1 and Parkin control localized translation of respiratory chain component mRNAs on mitochondria outer membrane. Cell Metab. 2015;21(1):95–108. 28. Grillon E, Farion R, Reuveni M, Glidle A, Remy C, Coles JA. Spatial profiles of markers of glycolysis, mitochondria, and proton pumps in a rat glioma suggest coordinated programming for proliferation. BMC Res Notes. 2015;8:207. 29. Eliyahu E, Pnueli L, Melamed D, Scherrer T, Gerber AP, Pines O, et al. Tom20 mediates localization of mRNAs to mitochondria in a translation-dependent manner. Mol Cell Biol. 2010;30(1):284–94. 30. Conway RF, Okarski KM, Szivek JA. A purification technique for adipose- derived stromal cell cultures leads to a more regenerative cell population. J Invest Surg 2018:1–12. 31. Szabo E, Fajka-Boja R, Kriston-Pal E, Hornung A, Makra I, Kudlik G, et al. Licensing by inflammatory cytokines abolishes heterogeneity of immunosuppressive function of Mesenchymal stem cell population. Stem Cells Dev. 2015;24(18):2171–80. 32. Mitterberger MC, Lechner S, Mattesich M, Kaiser A, Probst D, Wenger N, et al. DLK1(PREF1) is a negative regulator of adipogenesis in CD105(+ )/CD90(+)/CD34(+)/CD31(−)/FABP4(−) adipose-derived stromal cells from subcutaneous abdominal fat pats of adult women. Stem Cell Res. 2012; 9(1):35–48. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Lipids in Health and Disease Springer Journals

p62 is linked to mitophagy in oleic acid-induced adipogenesis in human adipose-derived stromal cells

Download PDF
10 pages

Loading next page...
 
/lp/springer_journal/p62-is-linked-to-mitophagy-in-oleic-acid-induced-adipogenesis-in-human-si8P5wYeNm

References (33)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Lipidology; Medical Biochemistry; Clinical Nutrition
eISSN
1476-511X
DOI
10.1186/s12944-018-0733-5
pmid
29866118
Publisher site
See Article on Publisher Site

Abstract

Background: Obesity is closely related to the abnormal differentiation of adipocytes, which are subjected to high plasma levels of free fatty acids (FFAs). As the most abundant FFA in the bloodstream, oleic acid (OA) has the ability to induce adipogenic differentiation in human adipose-derived stromal cells (hADSCs). Recently, p62, an autophagy mediator, has been shown to play a role in obesity and adipose tissue metabolism. Therefore, the aim of this study was to investigate the roles of autophagy and mitochondrial function at different stages of OA (in combination with insulin and dexamethasone)-induced adipogenesis in hADSCs. Methods: The hADSCs were incubated with OA, insulin, and dexamethasone after pretreatment with autophagy inhibitors or knockdown of p62 with shRNA. The adiposeness level was then analyzed by oil red O staining in the cells. The related proteins or mRNA levels were detected by western blot analysis or quantitative real-time polymerase chain reaction (PCR). Results: Treatment with 80 μM OA (substituted for isobutylmethylxantine; IBMX) for 10 days successfully induced hADSCs to adipocytes. During OA-induced adipogenesis, autophagy was induced, with an increased LC3II/I ratio on day 3 andadecreasedprotein levelofp62on andafter day3.Inhibition of autophagy with 3-methyladenine (3MA) at the early stage (day 0 to day 3) of differentiation, but not at the middle or late stage, significantly decreased OA-induced adipogenesis; while knockdown of p62 with shRNA significantly promoted adipogenesis in hADSCs. Moreover, the copy number of mtDNA (the ND1 gene) and the protein level of TOM20, a mitochondrial membrane protein, were increased following OA treatment, which was related to the stability of mitochondria. Interestingly, knockdown of p62 increased the mito-LC3II/I and cyto-LC3II/I ratios by 110.1% and 73.3%, respectively. The increase in the ratio of mito-LC3II/I was higher than that of cyto-LC3II/I. Furthermore, p62 knockdown-enhanced adipogenesis in hADSCs was abolished by inhibiting mitophagy with cyclosporine A. Conclusions: These results suggested that p62 plays a protective role in adipogenesis of hADSCs through regulating mitophagy. Background Studies have shown that 3 T3-L1 murine preadipocytes are Obesity is characterized by excess adipose tissue growth able to be induced to accumulate lipid droplets in a serum- probably due to the increased proliferation and differenti- free medium supplemented with OA without the use of in- ation of adipose-derived stromal cells (ADSCs), in addition duction medium, including isobutylmethylxantine (IBMX), to adipocyte hypertrophy [1, 2]. Besides, obesity, which is insulin, and dexamethasone [6, 7]. In addition, OA pro- correlated with insulin resistance, is associated with in- motes the formation of triglyceride-rich lipid droplets and creased plasma levels of free fatty acids (FFAs) [3–5]. Oleic induces autophagy in hepatocytes [8]. Unlike other induc- acid (OA) is the most abundant FFA in the bloodstream. tion medium components, IBMX is a chemical that is not present in the human body. Therefore, in this study, OA * Correspondence: [email protected] was used as a substitute for IBMX to induce adipogenic dif- Department of Tissue Engineering, School of Fundamental Sciences, China ferentiation in human ADSCs (hADSCs), which may more Medical University, Shenyang 110001, China closely mimic human physiological conditions. Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 2 of 10 Autophagy is upregulated in adipose tissue from obese containing 0.1% collagenase I. The digested tissue was individuals and is correlated with the degree of obesity, then filtered through 100-μm mesh and pelleted by cen- visceral fat distribution, and adipocyte hypertrophy [9]. trifugation at 600×g for 5 min. hADSCs were grown in Recent studies have demonstrated that inhibition of plastic dishes with low-glucose Dulbecco’s modified autophagy by RNA interference against autophagy re- Eagle medium supplemented with 10% fetal bovine lated 5 (Atg5) or Atg7 blocks adipogenic differentiation serum (FBS) in an atmosphere of 5% CO and 100% in 3 T3-L1 preadipocytes and in adipose tissue [10]. humidity at 37 °C. For each experiment, three parallel Consistently, pharmacological inhibition of autophagy cultivations were prepared. Two days after reaching con- prevents body weight gain and fat mass expansion, pro- fluence (day 0), differentiation was initiated by switching tecting against metabolic syndrome components such as to differentiation medium containing 10% FBS, 10 μg/mL glucose intolerance and insulin resistance. p62, a multi- insulin, 1 μM dexamethasone, and 50 μΜ,80 μM, or functional protein and an important mediator in the au- 100 μM OA (O1008, Sigma-Aldrich, St. Louis, MO, USA). tophagy–lysosome pathway, may play a role in obesity and adipose tissue metabolism [11–13]. In addition, p62 Oil red O staining and quantification of intracellular lipids gene-knockout mice develop obesity and insulin resist- After adipogenic induction, cells were washed twice with ance as well as show fat accumulation in the white adi- phosphate-buffered saline (PBS) and fixed in 4% parafor- pose tissue, slow basic lipid hydrolysis, and increased maldehyde at room temperature for 30 min. Next, the lipid synthesis. However, whether p62 regulates adipo- cells were stained with an oil red O solution (60% oil red cyte differentiation and the underlying mechanism are O stock solution and 40% H O) for 15 min and then not clear. The p62-deficient mice also show metabolic washed three times with PBS. The cell phenotype was changes, suggesting that p62 promotes a negative energy observed under a light microscope (Olympus Provis balance by inhibiting adipogenesis and favoring energy BX41). For quantification, intracellular lipids were ex- combustion [11]. This study will address the role of p62 tracted using isopropanol, and the absorbance was mea- and its relationship with autophagy in adipogenic differ- sured at a wavelength of 500 nm [15]. entiation of hADSCs. Mitophagy is the term for mitochondrial selective au- p62 lentiviral silencing tophagy. A specific receptor in the autophagic vacuole hADSCs were infected with lentivirus encoding p62 membrane can be identified by damaged mitochondria shRNA (GCAGATGAGGAAGATCGCCTT) or scram- and then targeted degradation happens; this process is bled control shRNA, according to the manufacturer’s very important to maintain a normal number and func- instructions. Lentiviral particles were purchased from tion of mitochondria. The adipose differentiation process GeneChem (Shanghai, China). is accompanied by the formation of lipid droplets and the synthesis of triglycerides. Mitochondria are key to Immunofluorescence fatty acid oxidation, so this study will provide further Cells were fixed in 4% paraformaldehyde, permeabilized understanding of the relationship between mitophagy in 0.25% Triton X-100, and blocked with 5% normal and p62 after identifying the basic function of autophagy donkey serum. Next, the cells were incubated with rabbit in hADSC adipose differentiation. It will illustrate the anti-microtubule-associated protein light chain 3 molecular mechanism of human adipocyte differenti- (LC3) B monoclonal antibody (L7543, Sigma-Aldrich) ation and provide a new way to identify novel drug tar- in a cold room overnight and stained with goat anti- gets for obesity. rabbit IgG Alexa Fluor 488 antibody (SAB4600389, Based on the above discussion, we built an OA- Sigma-Aldrich) at room temperature for 1 h. The induced hADSC model and knocked down p62 in this cells were subsequently viewed under a fluorescence model with lentiviral shRNA to explore the effects of microscope (TE2000-U, Nikon, Japan). p62 and mitophagy on the adipogenesis of hADSCs. Western blot Methods To prepare total cell lysates, monolayers of hADSCs Culture and differentiation of hADSCs were scraped with RIPA buffer containing protease in- All experiments were reviewed and approved by the In- hibitors and phosphatase inhibitors. To separate mito- stitutional Review Board of China Medical University. chondrial and cytoplasmic fractions, the cells were Thigh adipose tissue was obtained from females (30– scraped in mitochondrial isolation buffer. The collected 35 years old) during liposuction surgeries. Isolation of cells were then mechanically disrupted. Cell slurries hADSCs and differentiation into adipocytes were con- were centrifuged at 600×g for 5 min. The supernatant ducted as described previously [14]. Briefly, tissue was fractions were collected and centrifuged again at 8000×g minced and enzymatically digested for 45 min in a buffer for 15 min to pellet the mitochondria. The supernatant Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 3 of 10 fractions represented the cytosolic fraction. The mito- Statistical analysis chondrial pellet was washed by resuspension in mito- All data were expressed as the mean ± standard devi- chondrial isolation buffer, spun again at 8000×g for ation (SD). Comparisons of data among groups were 15 min, and lysed in RIPA buffer. Equal amounts of performed by one-way analysis of variance, and differ- protein were separated in 4–20% Tris-glycine sodium ences between two groups were analyzed by the Stu- dodecyl sulfate–polyacrylamide gel electrophoresis gels dent–Newman–Keuls test using SPSS 17.0 software. A (Dalian TaKaRa) and transferred to nitrocellulose mem- p-value of less than 0.05 was considered to be a signifi- branes. Membranes were blocked in 5% nonfat dry milk cant difference. in Tris-buffered saline for 1 h at room temperature and then incubated with primary antibody diluted in 5% Results nonfat dry milk overnight at 4 °C [16]. The primary anti- OA-induced adipogenesis of hADSCs bodies used were as follows: β-actin (Abp50151, Abcam, Adipogenesis was measured after treatment with different Cambridge, MA, USA), LC3, peroxisome proliferator acti- concentrations (50, 80, and 100 μM) of OA in combin- vated receptor γ (PPARγ; 101,700–500, Abcam), p62 ation with insulin and dexamethasone. We found that (P0067, Sigma-Aldrich), dynamin-related protein 1 (DRP- OA, which was substituted for IBMX, successfully in- 1; ABP51203, Abcam), mitofusin 1 (MFN-1; SAB2106161, duced hADSCs to adipocytes, with visible cytoplasmic Sigma-Aldrich), and mitochondrial outer membrane 20 lipid droplets that were stained red by oil red O (Fig. 1a). (TOM20; HPA011562, Sigma-Aldrich). Membranes were In the group treated with 80 μM OA, the intracellular washed in Tris-buffered saline containing Tween 20 lipid content (Fig. 1b) and the protein expression level of (TBS-T) and incubated with horseradish peroxidase- PPARγ (Fig. 1c–d) were the highest among the three conjugated anti-rabbit IgG secondary antibody (1:2000, groups treated with different concentrations of OA (p <0. Sigma) at room temperature for 1 h. The membranes were 01). Based on these results, 80 μM OA was chosen for the washed again in TBS-T, developed with an ECL Substrate subsequent experiments. (K820–50, Abcam), and imaged using a GelDoc XR System. Densitometry of the probed bands was analyzed Autophagy was induced during adipogenesis of hADSCs by Image J2x. To examine whether autophagy is involved in OA- induced adipogeneses of hADSCs, we detected the ex- pression of the autophagy marker molecule LC3 at dif- Quantitative real-time polymerase chain reaction (PCR) ferent time points [17, 18]. Immunofluorescence staining Total RNA was extracted from cells using TRIZOL® Re- of LC3 showed that punctiform accumulation of LC3 II agent (Promega), according to the manufacturer’s in- was increased from day 1 to day 3, while it decreased structions. cDNA was synthesized using a First-Strand from day 4 to day 7, and then it returned to the undiffer- cDNA Synthesis Kit (Dalian TaKaRa). Real-time PCR entiated level at day 9 (Fig. 2a). Western blot analysis was carried out with an ABI PRISM 7300 real-time PCR showed that the LC3II/I ratios were higher during adipo- machine. The fold-change in gene expression relative to genesis, compared with that on the first day (Fig. 2b–c), -ΔΔCT the control was calculated by the 2 method. The indicating that high autophagic levels were maintained experiments were repeated three times, and every throughout the whole differentiation process. The sample was assayed in triplicate. The primers used in LC3II/I ratio on day 3 was significantly higher than that the experiment are listed in Table 1. on the following days, and there was no significant difference in the LC3II/I ratios among days 5, 7, and 9 Determination of mitochondrial DNA (mtDNA) copy (Fig. 2b–c). p62, a key factor of autophagy, was also de- number tected during adipogenesis. The protein level of p62 was The mtDNA copy number per cell was quantified as the the highest on day 1 and then decreased during the later amplicon ratio from the PCR with specific primers phase of differentiation (Fig. 2b and d), suggesting that it against a gene (NADH dehydrogenase subunit 1; Nd1) might play a vital role in the adipogenesis of hADSCs. encoded by mtDNA and a gene (GAPDH) encoded by Table 1 Sequences of primers used for real-time PCR nuclear DNA. Total DNA was isolated from the cells Gene Primer (5′→ 3′) using a DNA Extraction Kit (Omega). Quantification of mitochondrial and genomic genes was performed by the Forward Reverse quantitative PCR method using the primer sequences PPARG AGCCTCATGAAGAGCCTTCCA ACCCTTGCATCCTTCACAAGC -ΔΔCT listed in Table 1. The 2 method was performed as ACTB ACTCTTCCAGCCTTCCTTCC GTACTTGCGCTCAGGAGGAG -ΔΔCT described in the previous paragraph. The ratio of 2 ND1 CCCTAAAACCCGCCACATC GAGCGATGGTGAGAGCTAAGGT -ΔΔCT mito/2 nuclear was calculated for the combination GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA of determined mitochondrial and nuclear genes. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 4 of 10 Inhibition of autophagy at the early stage of as p62, and finally the phagophore closes to form an differentiation in hADSCs prevented adipogenesis autophagosome [19, 20]. p62 is expected to play a key We investigated the effects of autophagy inhibition on role in adipogenic differentiation of hADSCs. Therefore, adipogenesis in hADSCs with 3-methyladenine (3MA) at in this study, we investigated the function of p62 in adi- different stages of differentiation (Fig. 3a). The conver- pogenic differentiation of hADSCs by knocking it down sion of LCI to LCII in hADSCs was significantly de- with a lentiviral p62 shRNA (shp62). The results showed creased when the cells were incubated with 10 mM that the oil red O-positive cells (Fig. 4a) as well as the 3MA for 24 h (Fig. 3b), indicating that treatment with mRNA (Fig. 4b) and protein (Fig. 4c and e) levels of 3MA could successfully inhibit autophagy. In addition, PPARγ at day 10 of differentiation were significantly adipogenesis, in terms of oil red O staining and the increased after knockdown of p62 in hADSCs, indicating intracellular lipid content, was significantly reduced by that knockdown of p62 promoted OA-induced adipo- treatment with 3MA during the early stage (days 0–3) as genesis in hADSCs. As expected, the protein expression well as throughout the whole differentiation process (days of p62 was substantially decreased after treatment with 0–10), compared with the control group (Fig. 3c–d). How- shp62 (Fig. 4c–d). ever, inhibition of autophagy with 3MA during the middle stage (days 4–7) or the late stage (days 8–10) of differenti- OA increased mitochondrial content during adipogenic ation did not affect OA-induced adipogenesis in hADSCs differentiation (Fig. 3c–d). In addition, changes in the protein ex- It is not yet known whether mitophagy is induced during pression of PPARγ and C/EBPα showed a similar pat- adipogenesis or whether a general increase in nonspecific tern as the oil red O staining and intracellular lipid autophagic degradation of mitochondria affects adipogene- analysis results (Fig. 3e). These findings suggest that sis [21]. To investigate the mitochondrial content in OA- autophagy may play a vital role at the early stage of induced adipogenic differentiation, we measured the copy adipogenic differentiation in hADSCs. number of mtDNA (ND1 gene) by quantitative PCR and the protein level of TOM20, a mitochondrial membrane Knockdown of p62 enhanced OA-induced adipogenesis of protein, by western blot analysis. As shown in Fig. 5a,the hADSCs ND1 DNA copy number was increased following OA treat- The phagophore elongates and engulfs autophagic cargo, ment. Compared with baseline (day 0), the protein expres- whose recognition is mediated by adaptor proteins such sion of TOM20 was significantly increased in differentiated Fig. 1 Adipogenesis of hADSCs induced by oleic acid (OA) in combination with insulin and dexamethasone. Cells were exposed to various concentrations of OA (50, 80, and 100 μM) or IBMX in combination with insulin and dexamethasone for 10 days. a Intracellular lipids were visualized by oil red O staining at day 10. b Quantification of intracellular lipids at the end of the incubation period (day 10). Briefly, oil red O-stained lipids were extracted with isopropanol, and the absorbance at 500 nm was determined by spectrophotometry. c and d The PPARγ protein expression ## level was analyzed by western blot at day 10. Data are shown as the mean ± SD (n =3). **p < 0.01 vs. control, p <0.01 vs. IBMX Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 5 of 10 cells at day 8 (p <0.01, Fig. 5b–c). These results showed Mito-LC3II/I was detected as a marker of mitophagy. that mitochondrial content was significantly increased at Meanwhile, cyto-LC3II/I was also measured as a marker the end of differentiation and that the energy-producing of autophagy. Western blot analysis showed that knock- ability was further improved by the increased mitochondrial down of p62 increased the mito-LC3II/I ratio by 110.1% membrane protein level. The quality of mitochondria was and the cyto-LC3II/I ratio by 73.3% (Fig. 6a–b). These re- increased greatly by mitophagy, which ensured the refresh- sults indicated that knockdown of p62 promoted mito- ment of mitochondria. Therefore, we further investigated phagy during OA-induced adipogenesis in hADSCs. p62 the correlative index of mitophagy during adipogenic differ- knockdown-induced mitophagy is unlikely secondary to entiation. Mitochondrial fusion and fission have a close re- autophagy as there was a trend towards a higher mito- lationship with mitophagy, so we measured the protein LC3II/I ratio than the cyto-LC3II/I ratio. expression of the mitochondrial fission protein DRP-1 and To further investigate whether the increase of mito- the fusion protein MFN-1 during adipogenesis. No notable phagy caused by p62 silencing is related to the increase change in expression of MFN-1 occurred during adipogen- of adipogenesis, cyclosporine A, a selective inhibitor of esis (Fig. 5d and f). Interestingly, DRP-1 was upregulated at mitochondrial autophagy, was used at the early stage of day 3, but it returned to the baseline level on day 5 and day differentiation (days 0–3). The results showed that p62 8(Fig. 5d–e). These data showed that the balance between knockdown-induced increases in oil red O-positive cells mitochondrial fusion and fission was broken and that the and protein expression of PPARγ were abolished by mitochondria tended to become instable, indicating that treatment with cyclosporine A (Fig. 7a–c). These data mitophagy was increased during this period. suggested that p62 knockdown-enhanced adipogenesis may be dependent on mitophagy at the early stage of Knockdown of p62 enhanced OA-induced adipogenesis of differentiation and that p62 may affect adipogenesis of hADSCs by increasing mitophagy hADSCs through regulating mitophagy. Since autophagy played a role mainly in the early stage of adipogenesis, the following parameters were detected at Discussion day 3 of differentiation. After mitochondrial autophagy oc- Obesity and insulin resistance have been observed in p62 curred, mitochondria combined to form autophagosomes. gene-knockout mice, and the basal lipolytic hydrolysis is Fig. 2 Autophagy at different stages of oleic acid (OA)-induced adipogenesis in hADSCs. a Representative immunofluorescence staining of LC3 in hADSCs at days 1, 3, 5, 7, and 9 of adipogenesis. b Western blot of LC3 and p62 in hADSCs during differentiation. c Quantification of the LC3II/I ** # ratio. d Quantification of the p62 protein level. Data are shown as the mean ± SD (n = 3). p < 0.01 vs. d1, p < 0.05 vs. d3 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 6 of 10 slower than that of wild-type mice. In addition, the num- differentiation in hADSCs. The results showed that au- ber of intracellular lipid droplets, synthesis of triglycerides, tophagy in hADSCs was at a very low level at baseline, and the size of adipocytes are increased in p62 gene- which is conducive to the maintenance of homeostasis. knockout mice [13]. In the present study, knockdown of After adipogenic induction with OA, the autophagy level p62 significantly enhanced OA-induced adipogenesis in was significantly increased at the early stage, and then it hADSCs. These results were similar to those observed in decreased at the later stage of adipogenic differentiation. p62 gene-knockout mice, suggesting that loss of p62 ex- Inhibition of autophagy using 3MA at the early stage re- pression increases adipogenic differentiation and that p62 sulted in a significant decrease in adipogenesis, while plays an important role in human adipocyte differenti- 3MA treatment at the middle or late stage did not affect ation. Therefore, it is speculated that p62 may play a pro- adipogenesis. These findings suggest that autophagy is tective role in the development of obesity that is caused required for replacing cellular components during adipo- by an increased number of adipocytes. genic differentiation. Otherwise, it would be difficult to OA-induced adipogenesis is probably due to increased achieve the switch of cellular components and functional FFA uptake. In this study, we found that OA increased transformation, which would enable the cells to maintain the protein expression of the adipogenesis-related gene their original undifferentiated state. Interestingly, au- PPARγ, which promotes FFA uptake into adipocytes. Yu tophagy is crucial during the initiation of adipogenesis. et al. have reported that OA and linoleic acid promote A possible reason is that the relevant proteins that deter- lipid accumulation in adipocytes, probably through regu- mine the new phenotype and function of the cells are lating PPARγ phosphorylation [22], which is consistent mainly transformed at the early stage of adipogenesis. In with our results. contrast, the later stages of differentiation may be com- It has been reported that autophagy is involved in the prised of a cascade reaction, and the autophagic activity differentiation of 3 T3-L1 pre-adipocytes [23, 24]. In the only needs to be maintained at a basal level. Recent present study, we observed that OA-induced adipogene- studies have found that mitochondria play a vital role in sis and autophagic activity changed at different stages of self-renewal and directional differentiation of stem cells. Fig. 3 Effects of autophagy inhibition at different stages of differentiation on oleic acid (OA)-induced adipogenesis in hADSCs. a Adipogenic differentiation in hADSCs was induced with 80 μM OA, and the cells were treated with 3MA (10 mM) for different periods of time. b Western blot analysis of LC3II/I in hADSCs treated with 3MA for 24 h. c Oil red O staining at the end of differentiation (day 10). d Quantification of intracellular ** lipids at day 10. e Western blot analysis of PPARγ and C/EBPα at day 10. Data are shown as the mean ± SD (n = 3). p < 0.01 vs. control Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 7 of 10 Fig. 4 Knockdown of p62 enhanced adipogenesis of hADSCs. hADSCs were infected with shp62 for 72 h, and then adipogenic differentiation was induced with 80 μM oleic acid (OA). a Intracellular lipids were stained with oil red O at the end of differentiation (day 10). b Gene expression of PPARγ at day 10. c Western blot of p62 and PPARγ at day 10. d Quantification of p62 protein expression. e Quantification of PPARγ protein expression. Values are the mean ± SD (n = 3). **p < 0.01 vs. control Fig. 5 The number and fusion–fission balance of mitochondria in hADSCs during adipogenic differentiation. a The mtDNA (Nd1 gene) copy number was measured by quantitative PCR at days 0, 3, 5, and 8 of adipogenic differentiation. Western blot (b) and quantification (c)of the mitochondrial membrane protein TOM20. d Western blot of DRP-1 and MFN-1. e Quantification of the DRP-1 protein expression level. f Quantification of the MFN-1 protein expression level. Values are the mean ± SD (n =3). **p <0.01 vs. d0 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 8 of 10 Fig. 6 Knockdown of p62 promoted mitophagy at the early stage of adipogenesis in hADSCs. a Western blot of mitochondrial and cytoplasmic LC3II/I at day 3 of adipogenic differentiation in hADSCs treated with shp62 or control shRNA. b Quantification of the mitochondrial and ** cytoplasmic LC3II/I ratios. Values are the mean ± SD (n = 3). p < 0.01 vs. control When stem cells are differentiated, mitochondria grad- The results of this study showed that p62 knockdown ually become “mature” and their number and function enhanced mitophagy. The reason may be related to the increase [25, 26]. The expression of the mitochondrial duality of p62 on mitochondria: p62 does not only medi- marker protein TOM20 and the mtDNA copy number ate the genesis of mitophagy, but it also stabilizes mito- can reflect mitochondrial content to a certain degree chondria from injury to prevent mitophagy. Based on [27–29]. The results showed that both parameters were our results, we speculated that knockdown of p62 in continuously increasing during OA-induced adipogen- hADSCs resulted in a significant reduction of its esis in hADSCs, which further verified the existing stabilization function, resulting in increased mitophagy. speculation. The increase of mitochondrial content Alternatively, knockdown of p62 increased the activity of during adipogenesis may have two functions. First, other mediators to initiate mitophagy. In this case, p62 the process of cell differentiation requires mitochon- as a mediator for mitophagy is not necessary. In adipo- dria to provide enough ATP to enable the cells to genic differentiation of hADSCs, knockdown of p62 led undergo re-establishment. Second, mitochondria may to an uneven distribution of autophagic fluxes: a rela- be necessary for the synthesis of triglycerides and the tively increased mitophagy flux. Thus, the refreshment formation of lipid droplets. of a large number of mitochondria was ensured, which Fig. 7 Inhibition of mitophagy abolished p62 knockdown-enhanced adipogenesis of hADSCs. hADSCs were pretreated with shp62 for 72 h and then induced by 80 μM oleic acid (OA) with or without 5 μM cyclosporine A (CsA), a mitophagy inhibitor. Differentiated cells were analyzed on day 10. a Oil red O staining. b Western blot of PPARγ. c Quantification of PPARγ protein expression. Values are the mean ± SD (n = 3). **p < 0.01 ## vs. control, p < 0.01 vs. shp62 Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 9 of 10 further promoted lipid synthesis and differentiation Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in progression. published maps and institutional affiliations. A limitation of this study was that heterogeneity of the primary cultured adipocytes may affect both adipogene- Author details Department of Tissue Engineering, School of Fundamental Sciences, China sis and mitophagy. A previous study has demonstrated Medical University, Shenyang 110001, China. Department of Anatomy, that the most commonly utilized adipose tissue extrac- College of Basic Medical Sciences, Jinzhou Medical University, Jinzhou tion technique leads to a heterogeneous cell population 121001, China. Liaoning Key Laboratory of Follicular Development and Reproductive Health, Jinzhou 121001, China. Department of Pathogenic [30]. In addition, primary cultured adipocytes partially Biology, College of Basic Medical Sciences, Jinzhou Medical University, retain the phenotypic properties of the tissue donor, Jinzhou 121001, China. such as gender, age, or body weight [14]. Moreover, the Received: 13 February 2018 Accepted: 3 April 2018 heterogeneity of mesenchymal stem cells in the final dif- ferentiation stage is variable. However, this variability is largely reduced under proinflammatory conditions or by References knockdown of certain genes [31, 32]. In this study, 1. Hausman DB, DiGirolamo M, Bartness TJ, Hausman GJ, Martin RJ. The knockdown of p62 in differentiating hADSCs reduced biology of white adipocyte proliferation. Obes Rev. 2001;2(4):239–54. the heterogeneity of hADSCs. Nevertheless, further 2. Gesta S, Tseng YH, Kahn CR. Developmental origin of fat: tracking obesity to its source. Cell. 2007;131(2):242–56. studies using homogeneous adipocytes are warranted. 3. Boden G. Obesity, insulin resistance and free fatty acids. Curr Opin Endocrinol Diabetes Obes. 2011;18(2):139–43. 4. Toledo K, Aranda M, Asenjo S, Saez K, Bustos P. Unsaturated fatty acids and Conclusions insulin resistance in childhood obesity. J Pediatr Endocrinol Metab. 2014; In combination with insulin and dexamethasone, OA 27(5–6):503–10. can successfully induce adipogenesis of hADSCs. Au- 5. Arner P, Ryden M. Fatty acids, obesity and insulin resistance. Obes Facts. 2015;8(2):147–55. tophagy plays a vital role at the early stage of adipogene- 6. Kokta TA, Strat AL, Papasani MR, Szasz JI, Dodson MV, Hill RA. Regulation of sis; thus, knockdown of p62 may promote adipogenesis lipid accumulation in 3T3-L1 cells: insulin-independent and combined by increasing the activity of mitophagy. effects of fatty acids and insulin. Animal. 2008;2(1):92–9. 7. Cheguru P, Chapalamadugu KC, Doumit ME, Murdoch GK, Hill RA. Adipocyte differentiation-specific gene transcriptional response to C18 Abbreviations unsaturated fatty acids plus insulin. Pflugers Archiv. 2012;463(3):429–47. 3MA: 3-methyladenine; Atg5: Autophagy related 5; DRP-1: Dynamin-related 8. Mei S, Ni HM, Manley S, Bockus A, Kassel KM, Luyendyk JP, et al. Differential protein 1; FFAs: Free fatty acids; hADSCs: Human adipose-derived stromal roles of unsaturated and saturated fatty acids on autophagy and apoptosis cells; IBMX: Isobutylmethylxantine; LC3: Microtubule-associated protein light in hepatocytes. J Pharmacol Exp Ther. 2011;339(2):487–98. chain 3; MFN-1: Mitofusin 1; ND1: NADH dehydrogenase subunit 1; OA: Oleic 9. Kovsan J, Bluher M, Tarnovscki T, Kloting N, Kirshtein B, Madar L, et al. acid; PPARγ: Peroxisome proliferator activated receptor γ; Altered autophagy in human adipose tissues in obesity. J Clin Endocrinol TOM20: Mitochondrial outer membrane 20 Metab. 2011;96(2):E268–77. 10. Singh R, Xiang Y, Wang Y, Baikati K, Cuervo AM, Luu YK, et al. Autophagy Acknowledgments regulates adipose mass and differentiation in mice. J Clin Invest. 2009; This manuscript has been edited and proofread by Medjaden Bioscience 119(11):3329–39. Limited. 11. Rodriguez A, Duran A, Selloum M, Champy MF, Diez-Guerra FJ, Flores JM, et al. Mature-onset obesity and insulin resistance in mice deficient in the signaling adapter p62. Cell Metab. 2006;3(3):211–22. Funding 12. Lee SJ, Pfluger PT, Kim JY, Nogueiras R, Duran A, Pages G, et al. A functional This work was supported by the National Natural Science Foundation of role for the p62-ERK1 axis in the control of energy homeostasis and China (No. 30772215), the Education Department of Liaoning Province (No. adipogenesis. EMBO Rep. 2010;11(3):226–32. L2015313), and the Technology Department of Liaoning Province (No. 13. Muller TD, Lee SJ, Jastroch M, Kabra D, Stemmer K, Aichler M, et al. p62 links 2015020340). beta-adrenergic input to mitochondrial function and thermogenesis. J Clin Invest. 2013;123(1):469–78. Availability of data and materials 14. Skurk T, Hauner H. Primary culture of human adipocyte precursor cells: The data that support the findings of this study are available upon request expansion and differentiation. Methods Mol Biol. 2012;806:215–26. to the corresponding author. 15. Skop V, Cahova M, Dankova H, Papackova Z, Palenickova E, Svoboda P, et al. Autophagy inhibition in early but not in later stages prevents 3T3-L1 differentiation: effect on mitochondrial remodeling. Differentiation. 2014; Authors’ contributions 87(5):220–9. Conceived and designed the experiments: RXZ and SLB; performed the 16. Sin J, Andres AM, Taylor DJ, Weston T, Hiraumi Y, Stotland A, et al. experiments: RXZ, YF, and YBZ; data collection and analysis: RXZ, YF, and Mitophagy is required for mitochondrial biogenesis and myogenic YBZ; wrote the manuscript: RXZ and YBZ. All authors have read and differentiation of C2C12 myoblasts. Autophagy. 2016;12(2):369–80. approved the final manuscript. 17. Zhang J. Teaching the basics of autophagy and mitophagy to redox biologists– mechanisms and experimental approaches. Redox Biol. 2015;4:242–59. Ethics approval and consent to participate 18. Kim BW, Kwon DH, Song HK. Structure biology of selective autophagy This study was approved by the ethics committee of The Affiliated Hospital receptors. BMB Rep. 2016;49(2):73–80. of Jinzhou Medical University and conducted in accordance with the ethics 19. Lin X, Li S, Zhao Y, Ma X, Zhang K, He X, et al. Interaction domains of principles described by the Declaration of Helsinki. p62: a bridge between p62 and selective autophagy. DNA Cell Biol. 2013;32(5):220–7. Competing interests 20. Komatsu M, Kageyama S, Ichimura Y. p62/SQSTM1/A170: physiology and The authors declare that they have no competing interests. pathology. Pharmacol Res. 2012;66(6):457–62. Zeng et al. Lipids in Health and Disease (2018) 17:133 Page 10 of 10 21. Goldman SJ, Zhang Y, Jin S. Autophagic degradation of mitochondria in white adipose tissue differentiation. Antioxid Redox Signal. 2011;14(10):1971–8. 22. Yu C, Xi L, Chen J, Jiang Q, Yi H, Wang Y, et al. PAM, OLA, and LNA are differentially taken up and trafficked via different metabolic pathways in porcine adipocytes. Lipids. 2017;52(11):929–38. 23. Zhang Y, Ye M, Chen LJ, Li M, Tang Z, Wang C. Role of the ubiquitin- proteasome system and autophagy in regulation of insulin sensitivity in serum-starved 3T3-L1 adipocytes. Endocr J. 2015;62(8):673–86. 24. Hahm JR, Noh HS, Ha JH, Roh GS, Kim DR. Alpha-lipoic acid attenuates adipocyte differentiation and lipid accumulation in 3T3-L1 cells via AMPK- dependent autophagy. Life Sci. 2014;100(2):125–32. 25. Hu C, Fan L, Cen P, Chen E, Jiang Z, Li L. Energy metabolism plays a critical role in stem cell maintenance and differentiation. Int J Mol Sci. 2016;17(2):253. 26. Margineantu DH, Hockenbery DM. Mitochondrial functions in stem cells. Curr Opin Genet Dev. 2016;38:110–7. 27. Gehrke S, Wu Z, Klinkenberg M, Sun Y, Auburger G, Guo S, et al. PINK1 and Parkin control localized translation of respiratory chain component mRNAs on mitochondria outer membrane. Cell Metab. 2015;21(1):95–108. 28. Grillon E, Farion R, Reuveni M, Glidle A, Remy C, Coles JA. Spatial profiles of markers of glycolysis, mitochondria, and proton pumps in a rat glioma suggest coordinated programming for proliferation. BMC Res Notes. 2015;8:207. 29. Eliyahu E, Pnueli L, Melamed D, Scherrer T, Gerber AP, Pines O, et al. Tom20 mediates localization of mRNAs to mitochondria in a translation-dependent manner. Mol Cell Biol. 2010;30(1):284–94. 30. Conway RF, Okarski KM, Szivek JA. A purification technique for adipose- derived stromal cell cultures leads to a more regenerative cell population. J Invest Surg 2018:1–12. 31. Szabo E, Fajka-Boja R, Kriston-Pal E, Hornung A, Makra I, Kudlik G, et al. Licensing by inflammatory cytokines abolishes heterogeneity of immunosuppressive function of Mesenchymal stem cell population. Stem Cells Dev. 2015;24(18):2171–80. 32. Mitterberger MC, Lechner S, Mattesich M, Kaiser A, Probst D, Wenger N, et al. DLK1(PREF1) is a negative regulator of adipogenesis in CD105(+ )/CD90(+)/CD34(+)/CD31(−)/FABP4(−) adipose-derived stromal cells from subcutaneous abdominal fat pats of adult women. Stem Cell Res. 2012; 9(1):35–48.

Journal

Lipids in Health and Disease – Springer Journals

Published: Jun 4, 2018

There are no references for this article.