Ovine growth hormone gene duplication—structural and evolutionary implications

Ovine growth hormone gene duplication—structural and evolutionary implications Mammalian Genome 8, 770–772 (1997). © Springer-Verlag New York Inc. 1997 Ovine growth hormone gene duplication—structural and evolutionary implications Rachel Ofir, Elisha Gootwine Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Bet Dagan 50250, Israel Received: 20 January 1997 / Accepted: 2 June 1997 Table 1. Primers used to amplify different regions of the ovine GH gene The growth hormone (GH) gene belongs to a gene family that also includes the chorionic somatomammotropin (placental lactogen) Primer gene, the prolactin gene, and several prolactin-like genes, all No. Position Orientation Sequence (58 to 38) evolved through series of gene duplications (Ohta 1993; Wallis 1 145 58 38 TTATCCATTAGCACAGGCTGCCAGTG 1993, 1994, 1996). The ovine GH gene is about 1.8 kb long and 2 144 58 38 ATTATCCATTAGCACAGGCTGCCA contains five exons and four introns (Byrne et al. 1987; Orian et al. 3 453 38 58 TCAAACTTGGCCAAATGTCGGGTG 1988). Previous studies (Valinsky et al. 1990; Gootwine et al. 4 466 58 38 GGCCAAGTTTGAAATGTTCTCAG 1993) have shown that gene duplication occurred at the ovine GH 5 587 58 38 ACCTCCCTGCTCCTGGCTTTCA 6 706 58 38 GCATCAACTGGCTACTGACACC locus, and two alleles are found: the GH1 allele with a single GH 7 752 38 58 CTGGGGAGCTTACAAACTCTTT copy, http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Ovine growth hormone gene duplication—structural and evolutionary implications

Loading next page...
 
/lp/springer_journal/ovine-growth-hormone-gene-duplication-structural-and-evolutionary-NyYt6yHQfo
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag New York Inc.
Subject
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900563
Publisher site
See Article on Publisher Site

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial