Ovine growth hormone gene duplication—structural and evolutionary implications

Ovine growth hormone gene duplication—structural and evolutionary implications Mammalian Genome 8, 770–772 (1997). © Springer-Verlag New York Inc. 1997 Ovine growth hormone gene duplication—structural and evolutionary implications Rachel Ofir, Elisha Gootwine Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Bet Dagan 50250, Israel Received: 20 January 1997 / Accepted: 2 June 1997 Table 1. Primers used to amplify different regions of the ovine GH gene The growth hormone (GH) gene belongs to a gene family that also includes the chorionic somatomammotropin (placental lactogen) Primer gene, the prolactin gene, and several prolactin-like genes, all No. Position Orientation Sequence (58 to 38) evolved through series of gene duplications (Ohta 1993; Wallis 1 145 58 38 TTATCCATTAGCACAGGCTGCCAGTG 1993, 1994, 1996). The ovine GH gene is about 1.8 kb long and 2 144 58 38 ATTATCCATTAGCACAGGCTGCCA contains five exons and four introns (Byrne et al. 1987; Orian et al. 3 453 38 58 TCAAACTTGGCCAAATGTCGGGTG 1988). Previous studies (Valinsky et al. 1990; Gootwine et al. 4 466 58 38 GGCCAAGTTTGAAATGTTCTCAG 1993) have shown that gene duplication occurred at the ovine GH 5 587 58 38 ACCTCCCTGCTCCTGGCTTTCA 6 706 58 38 GCATCAACTGGCTACTGACACC locus, and two alleles are found: the GH1 allele with a single GH 7 752 38 58 CTGGGGAGCTTACAAACTCTTT copy, http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Ovine growth hormone gene duplication—structural and evolutionary implications

Loading next page...
 
/lp/springer_journal/ovine-growth-hormone-gene-duplication-structural-and-evolutionary-NyYt6yHQfo
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag New York Inc.
Subject
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900563
Publisher site
See Article on Publisher Site

Abstract

Mammalian Genome 8, 770–772 (1997). © Springer-Verlag New York Inc. 1997 Ovine growth hormone gene duplication—structural and evolutionary implications Rachel Ofir, Elisha Gootwine Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Bet Dagan 50250, Israel Received: 20 January 1997 / Accepted: 2 June 1997 Table 1. Primers used to amplify different regions of the ovine GH gene The growth hormone (GH) gene belongs to a gene family that also includes the chorionic somatomammotropin (placental lactogen) Primer gene, the prolactin gene, and several prolactin-like genes, all No. Position Orientation Sequence (58 to 38) evolved through series of gene duplications (Ohta 1993; Wallis 1 145 58 38 TTATCCATTAGCACAGGCTGCCAGTG 1993, 1994, 1996). The ovine GH gene is about 1.8 kb long and 2 144 58 38 ATTATCCATTAGCACAGGCTGCCA contains five exons and four introns (Byrne et al. 1987; Orian et al. 3 453 38 58 TCAAACTTGGCCAAATGTCGGGTG 1988). Previous studies (Valinsky et al. 1990; Gootwine et al. 4 466 58 38 GGCCAAGTTTGAAATGTTCTCAG 1993) have shown that gene duplication occurred at the ovine GH 5 587 58 38 ACCTCCCTGCTCCTGGCTTTCA 6 706 58 38 GCATCAACTGGCTACTGACACC locus, and two alleles are found: the GH1 allele with a single GH 7 752 38 58 CTGGGGAGCTTACAAACTCTTT copy,

Journal

Mammalian GenomeSpringer Journals

Published: Oct 1, 1997

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off