Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

OsSND2, a NAC family transcription factor, is involved in secondary cell wall biosynthesis through regulating MYBs expression in rice

OsSND2, a NAC family transcription factor, is involved in secondary cell wall biosynthesis... Background: As one of the most important staple food crops, rice produces huge agronomic biomass residues that contain lots of secondary cell walls (SCWs) comprising cellulose, hemicelluloses and lignin. The transcriptional regulation mechanism underlying SCWs biosynthesis remains elusive. Results: In this study, we isolated a NAC family transcription factor (TF), OsSND2 through yeast one-hybrid screening using the secondary wall NAC-binding element (SNBE) on the promoter region of OsMYB61 which is known transcription factor for regulation of SCWs biosynthesis as bait. We used an electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation analysis (ChIP) to further confirm that OsSND2 can directly bind to the promoter of OsMYB61 both in vitro and in vivo. OsSND2, a close homolog of AtSND2, is localized in the nucleus and has transcriptional activation activity. Expression pattern analysis indicated that OsSND2 was mainly expressed in internodes and panicles. Overexpression of OsSND2 resulted in rolled leaf, increased cellulose content and up-regulated expression of SCWs related genes. The knockout of OsSND2 using CRISPR/Cas9 system decreased cellulose content and down-regulated the expression of SCWs related genes. Furthermore, OsSND2 can also directly bind to the promoters of other MYB family TFs by transactivation analysis in yeast cells and rice protoplasts. Altogether, our findings suggest that OsSND2 may function as a master regulator to mediate SCWs biosynthesis. Conclusion: OsSND2 was identified as a positive regulator of cellulose biosynthesis in rice. An increase in the expression level of this gene can improve the SCWs cellulose content. Therefore, the study of the function of OsSND2 can provide a strategy for manipulating plant biomass production. Keywords: Secondary cell wall (SCW), Rice, Cellulose synthesis, Transcription factor (TF), NAC, MYB Background surround all cells and the secondary cell walls (SCWs), a Plant cell wall is a unique structure that plays an import- thickened structures observed in specific cell types, such ant role in plant growth and development. The cell wall as xylem vessels and fibers (Keegstra, 2010). SCWs not provides mechanical strength to the plant body and only provide mechanical strength to these cells, but also responses to environmental stimuli, such as pathogen greatly contribute to the bulk of renewable plant bio- invasion (Underwood, 2012) and stress response mass (Burton and Fincher, 2014). SCWs mainly com- (Tenhaken, 2014). Plants exhibit two typical types of cell poses cellulose, hemicelluloses and lignin. Cellulose is walls, namely, the primary cell walls (PCWs) that composed of unbranched β-1, 4-glucans, and cellulose microfibrils form the main load-bearing network (Somerville, 2006). Hemicelluloses belong to a group of * Correspondence: liubm@ipp.ac.cn; xdfu@genetics.ac.cn Yafeng Ye and Kun Wu contributed equally to this work. heterogeneous polysaccharides such as xylan, glucan, Institute of Technical Biology and Agricultural Engineering, Hefei Institutes mannan, and mixed-linkage glucan (Pauly et al., 2013). of Physical Science, Chinese Academy of Sciences, Hefei, Anhui 230031, Lignin is a complex phenylpropanoid polymer that pro- People’s Republic of China State Key Laboratory of Plant Cell and Chromosome Engineering, Institute vides mechanical strength to specific cell types (Boerjan of Genetics and Developmental Biology, Chinese Academy of Sciences, et al., 2003). The understanding of the mechanism Beijing 100101, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Ye et al. Rice (2018) 11:36 Page 2 of 14 underlying SCWs biosynthesis may provide a strategy top-level master switches of SCWs biosynthesis in fibers for manipulating plant biomass production. and/or vessels (Zhong and Ye, 2015). These factors In the past decades, many genes involved in SCWs directly regulate the expression of a battery of down- biosynthesis have been cloned and characterized in both stream TFs, including SND2, SND3, MYB20, MYB42, dicot and monocot plants. Cellulose is synthesized in the MYB46, MYB52, MYB54, MYB58, MYB63, MYB83, plasma membrane by the cellulose synthase complex MYB85 and MYB103. Of these, MYB46 and its close (CSC), which contains at least three different cellulose homolog MYB83 act as the secondary-layer master synthases, encoded by CESA genes (Somerville, 2006). In switches to regulate SCWs biosynthesis (Hussey et al., Arabidopsis, CESA4, CESA7,and CESA8 genes are 2013). MYB46 and MYB83 also regulate the expression essential for SCWs cellulose biosynthesis (Taylor et al., of the direct targets of SND1 and its homologs, NST1, 2003; Taylor et al., 2000; Taylor et al., 1999). Close NST2, VND6 and VND7 (McCarthy et al., 2009; Zhong homologs of CESA4, CESA7 and CESA8 are required et al., 2007). All of these NAC and MYB TFs collectively for SCWs cellulose biosynthesis in rice, and mutations regulate the biosynthetic genes for cellulose, xylan and in any of these genes may cause a dramatic decrease in lignin. The SCWs NAC family TFs activate the down- the SCWs cellulose content, resulting in the brittle culm stream targets through binding to a 19 base pair (bp) se- phenotype (Song et al., 2013; Tanaka, 2003; Zhang et al., quence, known as SCWs NAC-binding element (SNBE) 2009). In addition to these CESA genes, some other (McCarthy et al., 2014; Zhong et al., 2010). MYB46 and genes are also involved in SCWs cellulose biosynthesis MYB83 bind to a 7 bp consensus sequence, termed as and assembly, such as the Arabidopsis KORRIGAN SCWs MYB-responsive element (SMRE) to regulate the (KOR) gene, that encodes for an endo-β-1, 4-glucanase. expression of target genes (Zhong and Ye, 2012). Mutations in this gene causes reduction in the cellulose Rice is one of the most important staple food crops content of both PCWs and SCWs (Szyjanowicz et al., and produces a large amount of agronomic biomass resi- 2004). In rice, several Brittle Culm (BC) genes are in- dues, which may be a potential source of bio-energy. volved in SCWs cellulose biosynthesis and mutations of Nevertheless, a few TFs involved in SCWs biosynthesis these genes are shown to reduce the cellulose content have been reported in rice. OsCEF1, which encodes the and mechanical strength, leading to the brittle culm OsMYB103L, regulates SCWs biosynthesis by directly phenotype (Kotake et al., 2011; Wu et al., 2012; Zhang et binding to the promoter of CESAs and BC1 genes (Ye et al., 2010; Zhou et al., 2009). Xylan and mannan are the al., 2015). The cef1 mutant shows reduction of cellulose major hemicelluloses in SCWs, and they are synthesized content, and the culm is fragile (Ye et al., 2015). in the Golgi apparatus and transported to the plasma OsMYB61 directly binds to the CESA promoters and membrane via Golgi vesicles (Pauly et al., 2013). In Ara- regulates their expression, and OsMYB61 can be acti- bidopsis, glycosyltransferase families have been impli- vated by the SCWs NAC families, including NAC29 and cated in hemicelluloses biosynthesis. Lignin is a complex NAC31 (Huang et al., 2015). Therefore, to unveil the polymer made up of p-hydroxylphenyl (H), guaiacyl (G), master transcriptional mechanism of SCWs biosynthesis and syringyl (S) units of lignin (Kumar et al., 2016). The in rice may provide valuable approach for genetically monolignols are synthesized through the phenylpropa- modifying grass crops for biofuel production. noid pathway within cells and then transported into cell In this study, we isolated a NAC family TF, named walls, where they are polymerized into lignin via oxida- OsSND2 using yeast one-hybrid screening with the tive reactions catalyzed by oxidases, such as laccases and SNBE site in the promoter region of OsMYB61 as bait. peroxidases (Boerjan et al., 2003). Several genes involved We demonstrated that OsSND2 directly binds to the in SCWs biosynthesis have been reported, however the promoter of OsMYB61 in vitro and in vivo, and regulates spatiotemporal expression of these genes remains its expression. Furthermore, molecular characterization unclear. of OsSND2 suggested that it functions as a master regu- In Arabidopsis, a detailed transcriptional regulation lator to directly mediate the expression of other MYBs mechanism of SCWs biosynthesis has been reported. A and facilitate cellulose biosynthesis. transcriptional network comprising two large family transcription factors (TFs), NAC and MYB, are involved Methods in SCWs biosynthesis (Zhong and Ye, 2015). In this Plant materials and growth conditions transcriptional network, a group of NAC family TFs, in- The all rice (Oryza sativa) plants were used in this cluding NAC SECONDARY WALL THICKENING study, including the japonica cultivar wild-type plants, PROMOTING FACTOR1 (NST1), NST2, NST3 (also wuyunjing7 (WYJ7) and the overexpression and knock- called as SND1, SECONDARY WALL-ASSOCIATED down of OsSND2 transgenic plants were grown in the NAC DOMAIN PROTEIN1), VASCULAR-RELATED experimental fields at the Institute of Technical Biology NAC-DOMAIN6 (VND6), and VND7, function as the and Agriculture Engineering, Hefei Institute of Physical Ye et al. Rice (2018) 11:36 Page 3 of 14 Science, Chinese Academy of Sciences (Hefei, China) Binary vectors construction and rice transformation and Sanya (Hainan province, China) during the natural For the overexpression construct of OsSND2, the growing season. full-length coding sequence of OsSND2 was amplified using gene-specific primers, OE-F, 5’-CCAAGCTTA TGACGTGGTGCAACAGCTT-3′ and OE-R, 5’-CGGG Yeast one-hybrid screening ATCCTCAAGGGCCACCAAAGCTGT-3′, which con- Five OsMYB61 bait fragments of pMYB61–1(− 1946, − 1258), tain HindΙΙΙ and BamHΙ restriction sites. The PCR frag- pMYB61–2(− 1607, − 1258), pMYB61–3(− 1258, − 897), ment was cloned into the intermediate vector N-Tagged pMYB61–4(− 870, − 356) and pMYB61–5(− 356, − 1) were SK (−), which encodes Myc-tag protein. Then, the cloned into the pHIS2 vector between EcoRI and SacI sequencing-confirmed vector was digested using KpnΙ/ sites and integrated into the genome of yeast strain BamHΙ and inserted into the pCAMBIA2300 between Y187 (MATα, ura3–52, his3–200, ade2–101, trp1–901, the KpnΙ and BamHΙ sites to create the p35S::My- leu2–3, 112, gal4Δ, met , gal80Δ, URA3:: GAL1 -GAL1- UAS c-OsSND2 vector. -lacZ, MEL1). For the self-activation test, promoter TATA We used CRISPR/Cas9 system for creating snd2 mu- bait strains were grown on the SD/−Trp, -His (a synthetic tants. The CRISPR/Cas9 binary vectors were constructed Trp and His dropout medium) media in the presence of as previously described (Ma et al., 2015). The Cas9 plant 0 mM, 10 mM, 30 mM and 50 mM 3-aminotriazole expression vector (pYLCRISPR/Cas9Pubi-H) and sgRNA (3-AT). We performed the yeast one-hybrid screening expression vector (pYLgRNA)wereprovidedbyProf. using the BD Matchmaker One-hybrid Library Construc- Yao-Guang Liu (South China Agricultural University). We tion and Screening Kit (K1617–1, Clontech) according to selected the Target1 (CAGCGACGTCCGCACCGCCG) the user manual (PT3529–1, Clontech). The cDNA library and Target2 (GGAGGGGCACATCTTGACG) in the first of the internodes tissue was constructed with the exon of OsSND2 (Fig. 5a) as candidate target sequences pGADT7-Rec2 vector (Clontech). The promoter bait according to the design principles of the target sequences strains were then mated with the “pGADT7-Rec2-cDNA” in the CRISPR/Cas9 system. Then, they were ligated into library and screened on the SD/−Leu -Trp -His selection two sgRNA expression cassettes of a Cas9 binary vector, media containing 30 mM 3-AT. Positive colonies were se- driven by OsU6 and OsU3 promoters, respectively. lected for yeast plasmid isolation or PCR with primers These constructs were introduced into a japonica cul- AD-F and AD-R. The PCR was performed according to tivar, wuyunjing7 (WYJ7) by the Agrobacterium-me- the following program, 95 °C 5 min, 95 °C 30 s, 56 °C 30 s, diated transformation procedure as described previously 72 °C 2 min, 36 cycles, 72 °C 10 min, 12 °C pause. (Raineri et al., 1990). RNA extraction and quantitative real-time PCR (qRT-PCR) Bioinformatics analysis of OsSND2 Total RNA was extracted from various rice tissues using A search for OsSND2 homologs in rice and Arabidopsis TRIzol reagent (Invitrogen), as described previously was performed using the NCBI BLAST server (http:// (Wadsworth et al., 1988). The first strand of cDNA was blast.ncbi.nlm.nih.gov/Blast.cgi). The alignment was per- synthesized using a reverse transcriptional kit (TransGen). formed using DNAMAN software. An unrooted phylo- qRT-PCR was performed using relevant primers and genetic tree of OsSND2 homologs in rice and qRT-PCR kit (TransGen) on a quantitative 7500 PCR sys- Arabidopsis was constructed using MEGA5 software tem (ABI). All assays were repeated at least three times, with 1000 bootstrap replications (Tamura et al., 2011). the Actin1 gene was used as an internal control. The co-expression analysis of OsSND2 with candidates in cell wall synthesis was performed using the expressing Electrophoretic mobility shift assay (EMSA) database at http://www.ricearray.org. The coding sequence of OsSND2 was amplified and cloned into the pGEX-4 T-1 vector (GE Healthcare). Subcellular localization of OsSND2 GST and GST-OsSND2 fusion proteins were purified as To observe the subcellular localization of OsSND2, a described previously (Wang et al., 2015). DNA frag- green fluorescent protein (GFP) fused to the C-terminus ments for EMSA were obtained by PCR amplification of OsSND2 and inserted into the pCAMBIA1300 be- and labeled using a biotin labeling kit (Invitrogen). DNA tween the KpnΙ and BamHΙ sites to create the gel shift assays were performed using the LightShift 35S::OsSND2-GFP vector, which was transformed into Chemiluminescent EMSA kit (Thermo Fisher Scientific). rice protoplasts by polyethylene glycol (PEG) mediated transformation method. The subcellular distribution of Chromatin immunoprecipitation (ChIP) analysis the OsSND2-GFP protein was observed using confocal The above-ground portion of p35S::Myc-OsSND2 trans- laser scanning microscope (Leica TCS SP5). genic rice plants was harvested between 2 and 3 g after Ye et al. Rice (2018) 11:36 Page 4 of 14 growth on soil for 3 to 4 weeks and immediately amplified and cloned into the pLacZi2μ vector to drive cross-linked with 1% formaldehyde under vacuum for lacZ reporter gene expression. The effectors and reporters 15 min at 15–25 °C. The cross-linking was stopped by were simultaneously transformed into the yeast strain adding glycine to the final concentration of 0.125 M for EGY48. The transformants were grown on synthetic drop- 5 min under vacuum. The cross-linked samples were out plates without tryptophan and uracil containing rinsed twice with double distilled water. The further ChIP 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside for assay based on an antibody to Myc (9E10, Santa Cruz colony coloration. The empty pB42AD and pLacZi were Biotechnology) was performed as described previously used as negative control. (Wang et al., 2015). Chromatin samples without Myc antibody immunoprecipitation were used as the control. Cell wall composition analysis Enrichment of DNA fragments was determined using The second internodes of wild type and transgenic plants qRT-PCR analysis performed on three biological repli- at mature stage were ground into powder under liquid ni- cates. The Actin1 gene exon used as negative controls. trogen and prepared alcohol-insoluble residues (AIRs). De-starched AIRs and trifluoroacetic acid (TFA) treat- Transactivation analysis in yeast cells and Rice protoplasts ment were performed as previously described (Li et al., Transactivation analysis in yeast was performed as de- 2009). For the cellulose measurement, the remains after scribed previously (Wang et al., 2012). The full length cod- TFA treatment were hydrolyzed in Updegraff reagent ing sequence of OsSND2 was amplified and cloned into (acetic acid: nitric acid: water, 8:1:2 v/v). The cooled pellets pGBKT7 vector, and then transformed into the yeast strain were washed and hydrolyzed with 72% sulfuric acid. The AH109 (MATa, trp1–901, leu2–3, 112, ura3–52, his3–200, cellulose content was measured by the anthrone assay gal4Δ, gal80Δ, LYS2::GAL1 -GAL1 -HIS3, GAL2 (Updegraff, 1969). The monosaccharide composition was UAS TATA UAS -GAL2 -ADE2, URA3::MEL1 -MEL1 -lacZ, MEL1). determined by gas chromatography-mass spectrometry as TATA UAS TATA The empty pGBKT7 (BD) and fusing the GAL4 vec- described previously (Xiong et al., 2010). The lignin con- tors were used as negative and positive controls, re- tent was measured by the acetyl bromide method as de- spectively. The transactivation activity was evaluated scribed previously (Huang et al., 2015). according to the growth on SD/−Trp and SD/−Trp – His -Ade. Microscopy Transactivation analysis was also performed in rice For the scanning electron microscope (SEM) observa- protoplasts as described previously (Wang et al., 2015). tion, the second internodes segments were sliced with For the effecter vector, the full length coding sequence Gillette razor blades and then fixed in 4% paraformalde- of TFs were amplified and fused with GAL4 binding do- hyde. After dehydration through a gradient of ethanol main (GAL4BD). The empty GAL4BD and fused with and critical point drying, the samples were sprayed with VP16 were used as negative and positive controls, re- gold particles and observed with a scanning electron spectively. For the reporter vectors, the pUC19 contain- microscope (SEM) (S-3000 N; Hitachi, Tokyo, Japan). ing the firefly luciferase (LUC) reporter gene driven by the minimal TATA box of the 35S promoter plus five Accession numbers GAL4 binding elements was used for self-activation test. Sequence data used in this manuscript can be found in The 2 kb fragments of upstream sequence from start thericegenomeannotation database(http://rice.plant- codon of the candidate genes were amplified and fused biology.msu.edu) and in the Arabidopsis information with LUC protein to generate reporter plasmids for resource (TAIR, http://www.arabidopsis.org)under the targets transactivation analysis. A pTRL plasmid contain- following accession numbers: OsMYB61 (Os01g18240), ing Renilla LUC gene driven by the CaMV (Cauliflower OsSND2 (Os05g48850), OsCESA4 (Os01g54620), mosaic virus) 35S promoter, was used as an internal OsCESA7 (Os10g32980), OsCESA9 (Os09g25490), control. The pTRL, effector and reporter were simultan- OsCESA11 (Os06g39970), OsMYB86L (Os08g36460), eously transformed into the rice protoplast system, then OsMYB61L (Os05g04820), AtSND2 (At4g28500). kept in dark for 16 h. The LUC activity was measured as described previously (Ohta et al., 2000). Results Identification of the interaction between OsSND2 and Yeast one-hybrid assay OsMYB61 promoter The OsSND2, OsMYB61L and OsMYB86L encoding se- To understand the hierarchical regulatory mechanism quence was amplified and inserted into the unique EcoRI controlling SCWs biosynthesis in rice, we conducted the and XhoI sites of the pB42AD vector (Takara) to construct yeast one-hybrid screening using five different length se- effector. For the reporter vectors, the 2 kb DNA fragments quences of OsMYB61 promoter (Additional file 1: Figure corresponding to the promoter of candidate genes were S1a) fused to HIS3 reporter as baits (Additional file 1: Ye et al. Rice (2018) 11:36 Page 5 of 14 Figure S1b) to search for novel transcription factors in- The BLAST search found a the rice full-length cDNA, volved in the regulation of OsMYB61 expression. The NM_001062858. Further sequence analysis and annotation cDNA library from the second internodes harvested dur- of this clone using RGAP database (http://rice.plantbiology. ing the heading stage of rice fused to yeast GAL4 activa- msu.edu/)showedthatthis geneis onthe locus tion domain (AD) was used as a prey. To test the bait LOC_Os05g48850, which has three exons and two in- construct self-activation, promoter bait strains were trons. LOC_Os05g48850 encodes for a NAC family grown on the SD/−Trp -His media in the presence of 0, transcription factor with a length of 314 amino acids 10, 30 and 50 mM of 3-AT, a competitive inhibitor of and a molecular mass of approximately 35 kD. Phylo- HIS3 protein. As a result, only the yeast strain with genetic analysis showed that LOC_Os05g48850 is OsMYB61-P5 bait construct was completely suppressed closely related to NAC family transcription factors in in the presence of 30 mM 3-AT (Additional file 1: Arabidopsis At4g28500 (AtSND2) (Fig. 1a). Protein se- Figure S1c). Yeast strains harbouring the other four quence alignment revealed that they are highly conserved constructs were not suppressed even with 50 mM of in the predicted NAC DNA-binding domains (Fig. 1b). 3-AT (Additional file 1: Figure S1c). Hence, we chose Therefore, we designated LOC_Os05g48850 as OsSND2 the construct OsMYB61-P5 to perform screening ex- (Oryza sativa SND2). periment with 30 mM 3-AT. Through the screening One of the significant features of transcription factors of 3.2 × 10 cDNA clones, one positive clone was ob- is nuclear localization. To determine the subcellular tained (clone 13). We isolated the yeast plasmid and localization of OsSND2, the construct of OsSND2 with subjected it to sequencing and BLAST search against C-terminus green fluorescent protein (GFP) tag was NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). cloned into a 35S::OsSND2-GFP vector. Using confocal Fig. 1 OsSND2 is a NAC family transcription factor and has a very high homology to AtSND2. a Phylogenetic analysis of the secondary wall NACs in Rice and Arabidopsis. The red rectangle indicate the OsSND2. An unrooted phylogenetic tree was generated with the full-length amino acid sequences. b Protein sequences alignment of OsSND2 and AtSND2. Black shadings indicate identical amino acids. The red underline indicate NAC domain Ye et al. Rice (2018) 11:36 Page 6 of 14 laser scanning microscopy, we confirmed that the pB42AD without OsSND2 failed to activate LacZ ex- OsSND2-GFP fusion protein was located predominantly pression (Fig. 3b). in the nucleus (Fig. 2a). We further performed the dual-luciferase reporter To investigate whether OsSND2 has a potential tran- (DLR) assay system in rice protoplasts to explore the ef- scriptional activity, we used the yeast assay system to fect of OsSND2 on the transcriptional regulation of investigate OsSND2. The growth of transformants carry- OsMYB61 expression using a reporter construct carrying ing pGBKT7-OsSND2 on selective medium (SD/−Trp) the firefly luciferase (LUC) driven by the 2 kb fragment and (SD/−Trp –His -Ade) indicated the OsSND2 of OsMYB61 promoter. DLR assay revealed an 11-fold protein has transcriptional activity, the pGBKT7-Os- increase in the transcriptional activation in the MYB103L and empty pGBKT7 were used as positive protoplasts co-expressing an effector carrying OsSND2 and negative control, respectively (Fig. 2b). We also used (Fig. 3c) and a reporter containing OsMYB61 promoter a dual-luciferase reporter (DLR) assay system in the rice to drive luciferase as compared with the negative control protoplast to test the transcriptional activation of (Fig. 3d). This result suggests that OsSND2 functions as OsSND2. In comparison with the GAL4-BD negative a transcriptional activator to directly regulate OsMYB61 control, OsSND2 can activate the LUC gene, similarly to expression. the activation by VP16 as positive control (Fig. 2c). Secondary wall-related NAC proteins regulate target genes These results indicate that OsSND2 protein exhibits expression through binding to the SNBE element, (T/ transcriptional activity (Fig. 2b and c). A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T) (Zhong et al., 2010). To determine whether the inter- OsSND2 can directly bind to the promoter of OsMYB61 action between OsSND2 and OsMYB61 promoter oc- To confirm the interaction between OsSND2 and curs through binding to SNBE site, we performed OsMYB61 promoter, we used the yeast one-hybrid sys- sequence searching within the promoter of OsMYB61 tem with LacZ reporter gene (Fig. 3a). The yeast and found it contains two SNBE sites (SNBE1 and one-hybrid assay revealed the predominant activation of SNBE2) (Additional file 2: Figure S2a). We further con- LacZ reporter gene expression by OsSND2 under the ducted chromatin immunoprecipitation (ChIP) assay in control of OsMYB61 promoter. On the contrary, wild-type and p35S::Myc-OsSND2 overexpression Fig. 2 Subcellular localization and transactivation analysis of OsSND2. a OsSND2 is a Nuclear-localized protein. A rice protoplast cell expressing OsSND2-GFP, indicating that OsSND2 is a Nuclear-localized protein. b Transactivation analysis of OsSND2 fused with the GAL4 DNA binding domain in yeast. Transformants harbouring pGBKT7-SND2, the positive control pGBKT7-MYB103L and the negative control pGBKT7 were streaked onto SD-Trp or SD-Trp, His, Ade medium to determine growth. c Transactivation analysis of OsSND2 as revealed by relative LUC activity in rice protoplasts Ye et al. Rice (2018) 11:36 Page 7 of 14 Fig. 3 OsSND2 directly regulate OsMYB61 expression. a Diagram of the effector construct and the reporter constructs used in b. b Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsMYB61 and OsCESA11 promoters and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. c Diagram of the effector construct and the reporter constructs used in d. d OsSND2 activates transcription of the OsMYB61 gene promoter. Relative luciferase activity was monitored in rice protoplasts cotransfected with different effector and reporter constructs. Mock, cotransfected with reporter construct and an empty effector construct; control, cotransfected with effector construct and an empty reporter construct (set to 1). Error bars, SE of three biological replicates. Student’s t-tests were used to generate the P values. The asterisks (**) indicate p <0.01. e ChIP assays. The diagram depicts the regions used for ChIP-qPCR analysis of extracts from the second internodes of over-expression plants carrying the p35S::Myc-OsSND2 construct. ChIP-qPCR results were quantified by normalization of the Myc immunoprecipitation signal by the corresponding input signal. Error bars, SE of three biological replicates. f EMSA analysis. Competition for OsSND2 binding was performed with unlabelled P9 fragments containing SNBE1 site at 50×, 100× and 200× the amount of labeled probe transgenic rice plants. The results showed that the two WYJ7 plants. OsSND2 expression was detected in all or- fragments (P3 and P9) containing the SNBE sites were gans, with relatively higher levels observed in internodes significantly enriched in Myc-OsSND2 overexpression and panicles. The expression level of OsSND2 was rela- plants (Fig. 3e). We used an electrophoretic mobility tively low in leaves, sheaths, and roots during the heading shift assay (EMSA) to examine whether OsSND2 bind and seedling stages (Fig. 4). We examined the expression to P9 and P3 fragments containing the SNBE1 and pattern of OsMYB61 and found it to be consistent with SNBE2, respectively. P9 and P3 were bound by the OsSND2 expression (Additional file 3: Figure S3). recombinant OsSND2 protein fused to glutathione S-transferase (GST-OsSND2), which resulted in a mo- Mutation of OsSND2 decreased cellulose content and bility shift (Fig. 3f and Additional file 2:Figure S2b). down-regulated SCWs gene expression GST alone, as a negative control, failed to induce the To investigate the biological function of OsSND2, we mobility shift (Fig. 3f and Additional file 2:FigureS2b). generated OsSND2 mutants using CRISPR/Cas9 system. The binding ability to two fragments was gradually de- We designed two sequence-specific single guide RNA creased in the presence of increasing amounts of un- (sgRNA) target sites, Target1 and Target2, which were labeled probes (Fig. 3f and Additional file 2:Figure S2b), 76-bp apart in the first exon of OsSND2 (Fig. 5a). Two thereby confirming the binding specificity. transgene-free homozygous knockout lines with different Taken together, the above results demonstrate the genotypes, snd2-c1 and snd2-c2 were obtained (Fig. 5b). function of OsSND2 as a transcription activator through Protein sequence alignments of the two homozygous its direct binding to SNBE sites in the promoter of mutants and the wild type protein revealed that snd2-c1 OsMYB61 in vitro and in vivo. and snd2-c2 showed coding frame shifts and premature translational stops (Fig. 5c). OsSND2 was mainly expressed in internodes and panicles No obvious morphological changes, except for a little To investigate whether the expression of OsSND2 is asso- early flowering in ossnd2 mutant (Fig. 5d). However, a ciated with SCWs biosynthesis, the expression pattern of significant decrease in the cellulose content was detected OsSND2 was examined by quantitative real-time PCR in snd2-c1 and snd2-c2 mutants (Fig. 5e). No significant (qRT-PCR) using RNAs isolated from various organs of alteration in the contents of xylose and lignin were Ye et al. Rice (2018) 11:36 Page 8 of 14 detected (Additional file 4: Table S1) We determined the expression levels of OsMYB61 and secondary wall CESA genesintwo mutantsand foundthatthe expression levelsof OsMYB61 and CESA genes were down-regulated (Fig. 5f). We further analyzed the wall thickness of sclerenchyma cells in the internodes of wild-type and snd2 mutant plants by SEM and found that snd2 mutant plants showed obviously thinner walls than the wild-type plants in sclerenchyma cells (Fig. 5g). Overexpression of OsSND2 increased cellulose content and up-regulated SCWs gene expression To further elucidate the biological function of OsSND2, we generated OsSND2 overexpression (OX) transgenic plants. Seventeen OX transgenic lines were obtained. We used qRT-PCR analysis to examine the expression Fig. 4 Expression pattern of OsSND2. qRT-PCR analysis of OsSND2 level of OsSND2 in these transgenic plants. Transgenic expression in various rice organs and different developmental stage, lines with significant alterations in the expression level the heading stage and seedling stage indicate the tenth day after of OsSND2 were selected for further study (Fig. 6a). flowering and the two weeks old seedlings, respectively. The Actin1 The overexpression of OsSND2 resulted in the pheno- gene was used as an internal control. Error bars, SD of three biological replicates typic characteristics such as semi-dwarf plant height and significant leaf rolling. The degree of leaf rolling in- creased with an increase in the expression level of Fig. 5 Generation and analysis of snd2 mutants. a Schematic diagram of OsSND2 gene structure and two CRISPR/Cas9 target sites. UTRs, exons, and introns are indicated by blank rectangles, black rectangles, and black lines, respectively. b DNA sequence alignments for the two homozygous snd2 mutants identified in the T1 generation, together with a wild-type (WT) control. The numbers on the right side are the sizes of the indels, with “−” and “+” showing deletion and insertion of nucleotides involved, respectively. c Deduced OsSND2 amino acid sequence alignments for the two homozygous mutants and WT. d Three-month-old plant of wild type (WT) and snd2-c1 mutant. Bar = 10 cm. e Measurement of cellulose content in WT and snd2 mutants. f Relative expression of OsMYB61 and SCWs-related CESA genes in WT and snd2 mutants. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. g Observation of sclerenchyma cell walls in the internodes from the three-month-old wild-type and snd2 mutant plants via transmission electron microscope. Bar = 2 μm Ye et al. Rice (2018) 11:36 Page 9 of 14 Fig. 6 Over-expression of OsSND2 results leaf rolling phenotype and increases cellulose content. a Three-month-old plant of wild type (WT) and over-expression (OX) transgenic lines. Bar = 10 cm (top panel). The OX lines showed upward rolled leaves compare to WT (bottom panel). b OsSND2 expression in over-expression (OX) transgenic plants as determined by qRT-PCR. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. c Measurement of cellulose content in WT and OX lines. Cellulose content (milligrams per gram of total cell wall residues) of the second internodes from WT and OX plants. Error bars, SD of three biological replicates. The asterisks (**) indicate a significant difference between transgenic plants and WT controls at P < 0.01, by Student’s t-test. d Relative expression of OsMYB61 and SCWs-related CESA genes in WT and OX lines was determined by qRT-PCR analysis. The Actin1 gene was used as an internal control. Error bars, SD of three biological replicates. e Observation of sclerenchyma cell walls in the internodes from the three-month-old wild-type and SND2- OX plants via transmission electron microscope. Bar = 2 μm OsSND2 (Fig. 6b). We measured the cellulose content in transcription regulation network controlling SCWs biosyn- OsSND2-OX plants and found that OsSND2-OX plants thesis in Arabidopsis (Zhong et al., 2008). To investigate have significantly increased cellulose content (Fig. 6c), whether OsSND2 regulates other SCWs-related but showed no significant alterations in the contents of R2R3-MYB family TFs expression in rice, we performed xylose and lignin (Additional file 4: Table S1). We fur- co-expression analysis of OsSND2 with SCWs-related ther examined the expression levels of OsMYB61 and CESAs and R2R3-type MYBs. We identified several MYB secondary wall CESA genes using qRT-PCR. Consistent candidates that may be involved in SCWs biosynthesis with the increased cellulose content, OsMYB61 and (Table 1). We further examined the expression levels of CESA genes expression level were higher in OsSND2-OX these R2R3-type MYBs in snd2-c1 mutants and OsSND2 plants (Fig. 6d). The results of anatomical analysis re- overexpression transgenic plants. qRT-PCR assay showed vealed the obvious thickness in the sclerenchyma cell that OsMYB86L (LOC_Os08g36460), OsMYB61L wall of OsSND2-OX plants as compared to wild-type (LOC_Os05g04820), and OsMYB58/63 (LOC_Os04g50770) plants (Fig. 6e). Collectively, these results suggest that were down-regulated in snd2-c1 mutants and up-regulated OsSND2 may be involved in the regulation of the bio- in the transgenic OsSND2-OX plants (Fig. 7a). The expres- synthetic pathways involved in SCW cellulose synthesis sion of OsMYB103L (LOC_Os08g05520) had no obvious and affect the thickness of sclerenchyma cell wall. difference in these transgenic lines (Fig. 7a). To further investigate if OsSND2 can directly regulate OsSND2 directly regulates the expression of other the expression of these MYBs, transcriptional activation R2R3-MYB family TFs assays were performed in yeast and rice protoplasts. Secondary wall-related NAC proteins can activate lots of OsMYB86L and OsMYB61L, but not OsMYB58/63 were R2R3-type MYB family TFs expression to start the entire directly regulated by OsSND2 (Fig. 7b and c). In addition, Ye et al. Rice (2018) 11:36 Page 10 of 14 Table 1 List of the R2R3-MYB TFs and secondary wall CESA genes and regulates their expression (Huang et al., genes coexpressed with OsSND2 in Rice 2015). Yeast one-hybrid screening is a powerful tool for Gene type Gene Gene ID PCC the identification and isolation more transcription fac- tors using promoter segments or regulatory elements of Cellulose biosynthesis genes OsCESA4 LOC_Os01g54620 0.8475 targets as baits. In this study, we isolated a NAC tran- OsCESA7 LOC_Os10g32980 0.8292 scription factor from the yeast one-hybrid screening OsCESA9 LOC_Os09g25490 0.8404 using OsMYB61 promoter region containing a SNBE site R2R3-type MYBs OsMYB103L LOC_Os08g05520 0.7664 as bait (Additional file 1: Figure S1). We named it as the OsMYB86L LOC_Os08g36460 0.7624 OsSND2 based on its closed relationship with AtSND2. OsMYB61 LOC_Os01g18240 0.7503 We confirmed the direct binding of OsSND2 on OsMYB61 promoter in vitro and in vivo (Fig. 3 and OsMYB61L LOC_Os05g04820 0.6899 Additional file 2: Figure S2). We also further investigated OsMYB58/63 LOC_Os04g50770 0.6770 OsSND2 protein function and downstream genes. Co-expression analysis of OsSND2 with R2R3-MYB TFs and secondary wall CESA genes was performed using the expressing database at http:// www.ricearray.org/coexpression/coexpression.shtml. 1, The Pearson correlation OsSND2 directly activate OsMYB61 expression coefficient (PCC). The PCC of coexpressed R2R3-MYBs and SCWs-related CESA We have demonstrated that OsSND2 can directly bind to genes was set above 0.65 and 0.75, respectively the promoter of OsMYB61 (Fig. 3b and d). In Arabidopsis, we investigated the distribution of SNBE sites and found secondary wall NAC family proteins (SWNs) activate their two and three SNBE sites in the promoter region (1.5-kb direct target genes through binding to the SNBE sites, and 5′-upstream sequence of the start codon) of OsMYB86L the binding affinities vary with different SWNs and SNBE and OsMYB61L, respectively. Hence, OsSND2 directly sequences (McCarthy et al., 2014; Zhong et al., 2010). We regulates the expression of OsMYB86L and OsMYB61L, have found two SNBE sites in OsMYB61 promoter region. probably through its binding to SNBE sites in the pro- EMSA and ChIP assay showed that OsSND2 binds to the moter regions of OsMYB86L and OsMYB61L. two SNBE sites (Fig. 3e, f and Additional file 2:Figure S2). In previous study, NAC29 and NAC31 were shown to OsMYB86L and OsMYB61L directly activate the transcription bind only to the SNBE site farther from the start codon of CESAs (Huang et al., 2015). OsCESA4, OsCESA7 and OsCESA9 are essential for The NAC family transcription factors are highly con- SCWs cellulose biosynthesis in rice. To investigate served at the N-terminal NAC binding domain and have whether OsMYB86L and OsMYB61L are involved in a highly variable C-terminal domain, which may func- SCWs biosynthesis, we performed yeast one-hybrid using tion as a transcriptional activator or repressor (Olsen et pB42AD-(OsMYB86L and OsMYB61L) fusion proteins al., 2005). A large number of SWNs function as a tran- and OsCESA4 promoter region (− 600 to −1bp upstream scriptional activator to regulate downstream genes ex- of the start codon), which contains three SCWs pression in Arabidopsis, such as SND1 and its close MYB-responsive elements (SMRE) (Fig. 7d). These results homologs (Zhong et al., 2008). Transactivation analysis provided evidence that OsMYB61L and OsMYB86L bind indicated that OsSND2 exhibits transcriptional activity to the promoter region of OsCESA4 (Fig. 7e). (Fig. 2b and c) and functions as a transcriptional activa- We performed the transcriptional activation assay in tor to initiate the transcription of OsMYB61 (Fig. 3d). rice protoplasts to investigate whether OsMYB86L and The expression of OsMYB61 was up-regulated in OsSN- OsMYB61L can activate the transcription of OsCESA4, D2-OX transgenic lines (Fig. 6d) and down-regulated in OsCESA7 and OsCESA9. The assay results show that the snd2 mutants (Fig. 5f). We also detected similar expres- luciferase activity was significantly higher for protoplasts sion patterns for OsSND2 and OsMYB61 (Fig. 4 and co-expressing the reporter carrying three CESA gene pro- Additional file 3: Figure S3). Previous study shows that moters driving luciferase and the effector containing the transcription of OsMYB61 is mainly mediated by OsMYB86L or OsMYB61L than the negative control (Fig. NAC29 and NAC31 (Huang et al., 2015). Therefore, we 7f). Thus, OsMYB86L and OsMYB61L directly activate reported OsSND2 as a new transcriptional activator to the transcription of OsCESA4, OsCESA7,and OsCESA9. directly regulate OsMYB61 expression. Discussion OsSND2 regulate secondary wall cellulose biosynthesis Secondary cell walls play a critical role in plant growth In rice, the genome was predicted to contain 151 NAC and development, and they also contain high amounts of genes (Nuruzzaman et al., 2010). The NAC family tran- lignocellulose, a key feedstock for the production of scription factors play important roles in plant growth bio-energy and bio-based products. In rice, OsMYB61 is and development (Olsen et al., 2005), especially in re- a key regulator that binds to the promoter of CESA sponse to different abiotic stresses (Fujita et al., 2004; Ye et al. Rice (2018) 11:36 Page 11 of 14 Fig. 7 OsSND2 and R2R3-MYBs regulates its target genes expression. a Relative expression of R2R3-MYBs genes in WT, OsSND2-OX and snd2-c1 mutant lines. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. b OsSND2 directly binds to OsMYB61L and OsMYB86L promoters. Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsMYB58.63, OsMYB61L, OsMYB86L, OsMYB103L promoters and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. c OsSND2 activates transcription of the OsMYB61L and OsMYB86L gene promoter. Luciferase activities in rice protoplasts contransfected with the effectors and reporters. The transactivation activity was monitored by assaying the luciferase activities, with the activity in protoplasts transfected withan empty effector construct defined as 1. Error bars, SD of three biological replicates. d Diagram of OsCESA4 showing three SMRE elements within the 600 bp OsCESA4 promoter region. Black arrows indicate the SMRE elements. The DNA sequences containing a core motif of SMREs (the red bases). The DNA sequence containing these three SMREs was subjected to the EMSA assay. e Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsCESA4 promoter containing three SMRE sites and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. f OsMYB61L and OsMYB86L activate transcription of the OsCESA4, OsCESA7 and OsCESA9 genes promoter. Luciferase activities in rice protoplasts contransfected with the effectors and reporters. The transactivation activity was monitored by assayingthe luciferase activities, with the activity in protoplasts transfected with an empty effector construct defined as 1. Error bars, SD of three biological replicates Hegedus et al., 2003; Tran et al., 2004) and SCWs for- MYB46 and MYB83, which have been reported to bind mations (Zhong and Ye, 2015), NAC proteins may have the promoter of SCWs CESAs to regulate SCWs cellu- contributed to the evolution of both water-conducting lose biosynthesis (Wang and Dixon, 2012). OsCESA4, and supporting cells during the adaptation of plants to OsCESA7 and OsCESA9 are responsible for secondary land (Xu et al., 2014). In Arabidopsis, SWNs can origin- wall cellulose biosynthesis in rice, mutation or ate entire regulation network controlling SCWs biosyn- down-regulation expression of these CESA genes results thesis, SND1 and its homologs act directly upstream of in brittle culm phenotype and reduction of the cellulose Ye et al. Rice (2018) 11:36 Page 12 of 14 content (Kotake et al., 2011; Tanaka, 2003; Zhang et al., homologs of AtSND1 in rice (Fig. 1a), they may function 2009). OsMYB61 has been reported to directly bind to as regulators to activate OsSND2 expression and initiate the promoters of CESA genes to regulate their expres- the entire SCWs biosynthetic program. OsMYB58/63, sion and cellulose biosynthesis (Huang et al., 2015). OsMYB61L and OsMYB86L act downstream of NAC29-OX, NAC31-OX and OsMYB61-OX transgenic OsSND2 (Fig. 7). We have demonstrated that plants have thick internodes, upward curved leaves, and OsMYB61L and OsMYB86L directly activate the tran- significantly increased cellulose content (Huang et al., scription of SCWs-related CESA genes (Fig. 7f). 2015). Our findings revealed the up-regulated and OsMYB58/63 was shown to directly up-regulate the ex- down-regulated expression of OsMYB61 in OsSND2-OX pression of OsCESA7 (Noda et al., 2015). Therefore, lines (Fig. 6d) and snd2 mutants (Fig. 5f), respectively. OsSND2 may act as the secondary-layer master switch Consistent with the expression level of OsMYB61, involved in the controlling of SCWs biosynthesis, thus, a up-regulation of CESA genes expression (Fig. 6d) and in- hierarchical transcriptional network similar to that of creased cellulose content were observed in OsSND2-OX Arabidopsis also exists in rice (Additional file 6: Figure lines (Fig. 6c). On the other hand, down-regulated CESA S5). These results are consistent with the previous study genes expression (Fig. 5f) and decreased cellulose con- for survey of involved in rice SCWs formation through a tent were found in snd2 mutants (Fig. 5e). Unlike co-expression network (Hirano et al., 2013). OsMYB103L, whose mutation lead to the reduction in the cellulose content and a brittle culm phenotype (Ye OsSND2 has a potential value in rice straw management et al., 2015), snd2 mutants showed normal culm and no As one of the most important staple food crops, rice obvious change in plant morphology except for lower produces huge amount of agronomic biomass residues. cellulose content and thinner sclerenchyma cell wall(Fig. The handling of biomass is a challenge for breeders, as 5b and g). These observations suggest that the function rice straws decomposition take a long time. Farmers pre- of OsSND2 may be redundant to its close homolog in fer straw burning, which is economic and convenient, rice. The contents of xylose and lignin were almost un- but may causes environmental problems. The major changed in snd2 mutants and SND2-OX plants (Add- reason underlying the difficult treatment procedure is itional file 4: Table S1). Thus, OsSND2 functions as a the high cellulose content of the cell wall of straws regulator to control SCWs cellulose biosynthesis. (Tian et al., 1992). The brittle culm (bc)ricemutants are the ideal breeds for straws treatment owing to lower Hierarchical transcriptional network regulating the SCWs cellulose content and finer breakage at harvest (Cabiles et biosynthetic program is present in rice al., 2008; Johnson et al., 2006). However, not all bc mu- In Arabidopsis, the detailed transcriptional network tants can be used for breeding because of their concomi- regulating the SCWs biosynthesis has been revealed tant phenotypes, such as dwarfism, low fertility and (Zhong and Ye, 2015). In this transcriptional network, withering of leaf apex (Zhang et al., 2009; Zhang et al., the secondary wall NAC families (SWNs) function as the 2010; Zhou et al., 2009). Mutations in OsMYB103L, a TF top-layer master switches to regulate a battery of down- regulating SCWs-related genes expression, lead to the de- stream transcription factors, including SND2, SND3, creased cellulose content and brittle culm phenotype MYB20, MYB42, MYB46, MYB83 and MYB103 to start without morphological abnormalities (Ye et al., 2015). We the entire SCWs biosynthetic program (Zhong et al., have demonstrated that OsSND2 can regulate MYBsand 2008). MYB46 and MYB83 function as the regulators of SCWs CESA genes expression (Figs. 5f, 6d and 7a), and the secondary-layer and regulate the expression of other that snd2 mutants have lower cellulose contents (Fig. 5e) MYBs and biosynthetic genes for cellulose, xylan and lig- and exhibit no change in morphology (Fig. 5d). The snd2 nin (Zhong and Ye, 2012). A few studies have investi- mutant plants exhibit a little early flowering may be gated the hierarchical transcriptional network regulating caused by the effects of the flowering genes expression SCWs formation in rice. We demonstrated that OsSND2 (Fig. 5d), but show normal morphology. Hence, snd2 mu- functions as a regulator to control the expression of tants have the potential value for rice straws management. MYBs (Fig. 7a), which can further activate the SCWs CESA genes expression. Furthermore, we proved that Conclusion AtSND2 (At4g28500) can bind to the promoter of In this study, OsSND2 was identified as a positive regula- AtMYB61 (At1g09540) in yeast one-hybrid assay (Add- tor of cellulose biosynthesis in rice. Increasing the ex- itional file 5: Figure S4). This result suggests the conser- pression level of this gene can improve the SCWs vation of the regulatory mechanism in dicot and cellulose content, but the content of xylose and lignin monocot plants. In Arabidopsis, AtSND2 acts down- were not affected. Therefore, study the function of stream of AtSND1 and its close homologs (Zhong et al., OsSND2 can provide a strategy for manipulating plant 2008). As OsSWN1 and OsSWN2/OsNAC29 are close biomass production. Ye et al. Rice (2018) 11:36 Page 13 of 14 Additional files Ethics approval and consent to participate Not applicable. Additional file 1: Figure S1. Yeast one-hybrid screening using different fragments of OsMYB61 promoter as baits. a, Diagram of OsMYB61 with Competing interests five different fragments using for bait constructs. b, Diagram of bait The authors declare that they have no competing interests. construct in yeast one-hybrid screening. c, Self-activation test of five different bait constructs. The transformants harbouring the different bait construct were streaked onto SD-Trp, His media in the presence of 0 mM, Publisher’sNote 10 mM, 30 mM and 50 mM 3-aminotriazole (3-AT) to determine growth. Springer Nature remains neutral with regard to jurisdictional claims in published (TIF 2102 kb) maps and institutional affiliations. Additional file 2: Figure S2. OsSND2 binds to the SNBE sites in the OsMYB61promoter. a, Diagram of OsMYB61 promoter containing two Author details SNBE sites. Dark brown boxes indicate the SNBE elements. The DNA Institute of Technical Biology and Agricultural Engineering, Hefei Institutes sequences containing the SNBE sites (the red bases) were subjected to of Physical Science, Chinese Academy of Sciences, Hefei, Anhui 230031, the EMSA assay. b, EMSA assay showing that the recombinant OsSND2 People’s Republic of China. Key Laboratory of High Magnetic Field and Ion protein directly bound to the biotin-labeled sequence containing SNBE2 Beam Physical Biology, Hefei Institutes of Physical Science, Chinese Academy site. (TIF 1061 kb) of Sciences, Hefei, Anhui 230031, People’s Republic of China. State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics Additional file 3: Figure S3. Expression pattern of OsMYB61. qRT-PCR and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, analysis of OsMYB61 expression in various rice organs and different China. developmental stage, the heading stage and seedling stage indicate the tenth day after flowering and the two weeks old seedlings, respectively. Received: 1 March 2018 Accepted: 23 May 2018 The Actin1 gene was used as an internal control. Error bars, SD of three biological replicates. (TIF 1176 kb) Additional file 4: Table S1. Composition analysis of sugar and lignin content of wall residues of the internodes from wild type and transgenic References rice plants. (DOC 30 kb) Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu Rev Plant Biol 54: 519–546 Additional file 5:: Figure S4. AtSND2 directly binds to the promoter of Burton RA, Fincher GB (2014) Plant cell wall engineering: applications in biofuel AtMYB61. Yeast one-hybrid assay showing the activity of LacZ reporters production and improved human health. Curr Opin Biotechnol 26:79–84 driven by AtMYB61 promoter (2 kb length sequence from the start codon) Cabiles DMS, Angeles OR, Johnson-Beebout SE, Sanchez PB, Buresh RJ (2008) and activated by AtSND2 fused with activation domain (AD). The empty Faster residue decomposition of brittle stem rice mutant due to finer pB42AD and pLacZi were used as negative control. (TIF 331 kb) breakage during threshing. Soil Tillage Res 98:211–216 Additional file 6:: Figure S5. The transcriptional regulatory model of Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi M, Tran LS, SCW formation in rice. Arrows indicate transcriptional activation, whereas Yamaguchi-Shinozaki K, Shinozaki K (2004) A dehydration-induced NAC flat-ended arrows indicate transcriptional repression. Solid arrows indicate protein, RD26, is involved in a novel ABA-dependent stress-signaling direct transcriptional activation. Dashed arrows indicate indirect transcriptional pathway. Plant J 39:863–876 activation. (TIF 136 kb) Hegedus D, Yu M, Baldwin D, Gruber M, Sharpe A, Parkin I, Whitwill S, Lydiate D (2003) Molecular characterization of Brassica napus NAC domain transcriptional activators induced in response to biotic and abiotic stress. Acknowledgements Plant Mol Biol 53:383–397 We are thankful to Dr. Jinhua Wu for critical comments on the manuscript, Hirano K, Aya K, Morinaka Y, Nagamatsu S, Sato Y, Antonio BA, Namiki N, Dr. Xiangbin Chen for providing the Chromatin immunoprecipitation (ChIP) Nagamura Y, Matsuoka M (2013) Survey of genes involved in rice secondary protocol, We also thank the Innovative Academy of Seed Design, Chinese cell wall formation through a co-expression network. Plant Cell Physiol 54: Academy of Sciences. 1803–1821 Huang D, Wang S, Zhang B, Shang-Guan K, Shi Y, Zhang D, Liu X, Wu K, Xu Z, Fu X, Zhou Y (2015) A gibberellin-mediated DELLA-NAC signaling Cascade regulates Funding cellulose synthesis in Rice. Plant Cell 27:1681–1696 This work was supported by grants from the National Natural Science Foundation Hussey SG, Mizrachi E, Creux NM, Myburg AA (2013) Navigating the of China (Grant 31701330), the Technology Service Network Initiative of Chinese transcriptional roadmap regulating plant secondary cell wall deposition. Academy of Sciences (KFJ-STS-QYZD-020, KFJ-STS-ZDTP-002), the Strategic Priority Front Plant Sci 4:325 Research Program of the Chinese Academy of Sciences (Grant XDA08040107) and Johnson SE, Angeles OR, Brar DS, Buresh RJ (2006) Faster anaerobic the State Key Laboratory of Plant Cell and Chromosome Engineering decomposition of a brittle straw rice mutant: implications for residue (PCCE-KF-2017-04). management. Soil Biol Biochem 38:1880–1892 Keegstra K (2010) Plant cell walls. Plant Physiol 154:483–486 Kotake T, Aohara T, Hirano K, Sato A, Kaneko Y, Tsumuraya Y, Takatsuji H, Availability of data and materials Kawasaki S (2011) Rice brittle culm 6 encodes a dominant-negative form of All data supporting the conclusions of this article are provided within the CesA protein that perturbs cellulose synthesis in secondary cell walls. J Exp article and its additional files (Additional file 1: Figure S1, Additional file 2: Bot 62:2053–2062 Figure S2, Additional file 3: Figure S3, Additional file 5:FigureS4, and Kumar M, Campbell L, Turner S (2016) Secondary cell walls: biosynthesis and Additional file 6:FigureS5). manipulation. J Exp Bot 67:515–531 Li M, Xiong G, Li R, Cui J, Tang D, Zhang B, Pauly M, Cheng Z, Zhou Y (2009) Rice Authors’ contributions cellulose synthase-like D4 is essential for normal cell-wall biosynthesis and YW, BL and XF together designed the experiments. YY and BL performed plant growth. Plant J 60:1055–1069 most of the experiments and wrote the manuscript. BL analyzed motifs in Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, promoter regions and performed the Ch-IP analysis. YY and KW performed Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG the yeast one hybrid screening. KW and QL performed the EMSA and yeast (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex one hybrid analysis. JC performed the subcellular localization of OsSND2 and genome editing in monocot and dicot plants. Mol Plant 8:1274–1284 transactivation analysis. All authors have discussed the results and contributed McCarthy RL, Zhong R, Ye ZH (2009) MYB83 is a direct target of SND1 and acts to the drafting of the manuscript. All authors read and approved the final redundantly with MYB46 in the regulation of secondary cell wall biosynthesis manuscript. in Arabidopsis. Plant Cell Physiol 50:1950–1964 Ye et al. Rice (2018) 11:36 Page 14 of 14 McCarthy RL, Zhong R, Ye Z-H (2014) Secondary wall NAC binding element Xu B, Ohtani M, Yamaguchi M, Toyooka K, Wakazaki M, Sato M, Kubo M, Nakano (SNBE), a key cis-acting element required for target gene activation by Y, Sano R, Hiwatashi Y, Murata T, Kurata T, Yoneda A, Kato K, Hasebe M, secondary wall NAC master switches. Plant Signal Behav 6:1282–1285 Demura T (2014) Contribution of NAC transcription factors to plant Noda S, Koshiba T, Hattori T, Yamaguchi M, Suzuki S, Umezawa T (2015) The adaptation to land. Science 343:1505–1508 expression of a rice secondary wall-specific cellulose synthase gene, Ye Y, Liu B, Zhao M, Wu K, Cheng W, Chen X, Liu Q, Liu Z, Fu X, Wu Y (2015) OsCesA7, is directly regulated by a rice transcription factor, OsMYB58/63. CEF1/OsMYB103L is involved in GA-mediated regulation of secondary wall Planta 242:589–600 biosynthesis in rice. Plant Mol Biol 89:385–401 Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, Ooka H, Kikuchi Zhang B, Deng L, Qian Q, Xiong G, Zeng D, Li R, Guo L, Li J, Zhou Y (2009) A S (2010) Genome-wide analysis of NAC transcription factor family in rice. missense mutation in the transmembrane domain of CESA4 affects protein Gene 465:30–44 abundance in the plasma membrane and results in abnormal cell wall biosynthesis in rice. Plant Mol Biol 71:509–524 Ohta M, Ohme-Takagi M, Shinshi H (2000) Three ethylene-responsive transcription Zhang M, Zhang B, Qian Q, Yu Y, Li R, Zhang J, Liu X, Zeng D, Li J, Zhou Y (2010) factors in tobacco with distinct transactivation functions. Plant J 22:29–38 Brittle culm 12, a dual-targeting kinesin-4 protein, controls cell-cycle Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors: progression and wall properties in rice. Plant J 63:312–328 structurally distinct, functionally diverse. Trends Plant Sci 10:79–87 Zhong R, Lee C, Ye ZH (2010) Global analysis of direct targets of secondary wall Pauly M, Gille S, Liu L, Mansoori N, de Souza A, Schultink A, Xiong G (2013) NAC master switches in Arabidopsis. Mol Plant 3:1087–1103 Hemicellulose biosynthesis. Planta 238:627–642 Zhong R, Lee C, Zhou J, McCarthy RL, Ye ZH (2008) A battery of transcription Raineri D, Bottino P, Gordon M, Nester E (1990) Agrobacterium–mediated factors involved in the regulation of secondary cell wall biosynthesis in transformation of Rice (Oryza sativa L.). Nat Biotechnol 8:33–38 Arabidopsis. Plant Cell 20:2763–2782 Somerville C (2006) Cellulose synthesis in higher plants. Annu Rev Cell Dev Biol Zhong R, Richardson EA, Ye ZH (2007) The MYB46 transcription factor is a direct 22:53–78 target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. Song XQ, Liu LF, Jiang YJ, Zhang BC, Gao YP, Liu XL, Lin QS, Ling HQ, Zhou YH Plant Cell 19:2776–2792 (2013) Disruption of secondary wall cellulose biosynthesis alters cadmium Zhong R, Ye ZH (2012) MYB46 and MYB83 bind to the SMRE sites and directly translocation and tolerance in rice plants. Mol Plant 6:768–780 activate a suite of transcription factors and secondary wall biosynthetic Szyjanowicz PM, McKinnon I, Taylor NG, Gardiner J, Jarvis MC, Turner SR (2004) genes. Plant Cell Physiol 53:368–380 The irregular xylem 2 mutant is an allele of korrigan that affects the Zhong R, Ye ZH (2015) Secondary cell walls: biosynthesis, patterned deposition secondary cell wall of Arabidopsis thaliana. Plant J 37:730–740 and transcriptional regulation. Plant Cell Physiol 56:195–214 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular Zhou Y, Li S, Qian Q, Zeng D, Zhang M, Guo L, Liu X, Zhang B, Deng L, Liu X, Luo evolutionary genetics analysis using maximum likelihood, evolutionary distance, G, Wang X, Li J (2009) BC10, a DUF266-containing and Golgi-located type II and maximum parsimony methods. Mol Biol Evol 28:2731–2739 membrane protein, is required for cell-wall biosynthesis in rice (Oryza sativa Tanaka K (2003) Three distinct Rice cellulose synthase catalytic subunit genes L.). Plant J 57:446–462 required for cellulose synthesis in the secondary wall. Plant Physiol 133:73–83 Taylor NG, Howells RM, Huttly AK, Vickers K, Turner SR (2003) Interactions among three distinct CesA proteins essential for cellulose synthesis. Proc Natl Acad Sci U S A 100:1450–1455 Taylor NG, Laurie S, Turner SR (2000) Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis. Plant Cell 12:2529–2540 Taylor NG, Scheible WR, Cutler S, Somerville CR, Turner SR (1999) The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis. Plant Cell 11:769–780 Tenhaken R (2014) Cell wall remodeling under abiotic stress. Front Plant Sci 5:771 Tian G, Kang B, Brussaard L (1992) Biological effects of plant residues with contrasting chemical compositions under humid tropical conditions—decomposition and nutrient release. Soil Biol Biochem 24:1051–1060 Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16:2481–2498 Underwood W (2012) The plant cell wall: a dynamic barrier against pathogen invasion. Front Plant Sci 3:85 Updegraff DM (1969) Semimicro determination of cellulose inbiological materials. Anal Biochem 32:420–424 Wadsworth GJ, Redinbaugh MG, Scandalios JG (1988) A procedure for the small- scale isolation of plant RNA suitable for RNA blot analysis. Anal Biochem 172: 279–283 Wang HZ, Dixon RA (2012) On-off switches for secondary cell wall biosynthesis. Mol Plant 5:297–303 Wang S, Li S, Liu Q, Wu K, Zhang J, Wang S, Wang Y, Chen X, Zhang Y, Gao C, Wang F, Huang H, Fu X (2015) The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality. Nat Genet 47:949–954 Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, Zhang G, Fu X (2012) Control of grain size, shape and quality by OsSPL16 in rice. Nat Genet 44:950–954 Wu B, Zhang B, Dai Y, Zhang L, Shang-Guan K, Peng Y, Zhou Y, Zhu Z (2012) Brittle culm15 encodes a membrane-associated chitinase-like protein required for cellulose biosynthesis in rice. Plant Physiol 159:1440–1452 Xiong G, Li R, Qian Q, Song X, Liu X, Yu Y, Zeng D, Wan J, Li J, Zhou Y (2010) The rice dynamin-related protein DRP2B mediates membrane trafficking, and thereby plays a critical role in secondary cell wall cellulose biosynthesis. Plant J 64:56–70 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Rice Springer Journals

OsSND2, a NAC family transcription factor, is involved in secondary cell wall biosynthesis through regulating MYBs expression in rice

Download PDF
14 pages

Loading next page...
 
/lp/springer_journal/ossnd2-a-nac-family-transcription-factor-is-involved-in-secondary-cell-l4rAq5kBOw

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Plant Sciences; Plant Genetics and Genomics; Plant Breeding/Biotechnology; Agriculture; Plant Ecology
ISSN
1939-8425
eISSN
1939-8433
DOI
10.1186/s12284-018-0228-z
Publisher site
See Article on Publisher Site

Abstract

Background: As one of the most important staple food crops, rice produces huge agronomic biomass residues that contain lots of secondary cell walls (SCWs) comprising cellulose, hemicelluloses and lignin. The transcriptional regulation mechanism underlying SCWs biosynthesis remains elusive. Results: In this study, we isolated a NAC family transcription factor (TF), OsSND2 through yeast one-hybrid screening using the secondary wall NAC-binding element (SNBE) on the promoter region of OsMYB61 which is known transcription factor for regulation of SCWs biosynthesis as bait. We used an electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation analysis (ChIP) to further confirm that OsSND2 can directly bind to the promoter of OsMYB61 both in vitro and in vivo. OsSND2, a close homolog of AtSND2, is localized in the nucleus and has transcriptional activation activity. Expression pattern analysis indicated that OsSND2 was mainly expressed in internodes and panicles. Overexpression of OsSND2 resulted in rolled leaf, increased cellulose content and up-regulated expression of SCWs related genes. The knockout of OsSND2 using CRISPR/Cas9 system decreased cellulose content and down-regulated the expression of SCWs related genes. Furthermore, OsSND2 can also directly bind to the promoters of other MYB family TFs by transactivation analysis in yeast cells and rice protoplasts. Altogether, our findings suggest that OsSND2 may function as a master regulator to mediate SCWs biosynthesis. Conclusion: OsSND2 was identified as a positive regulator of cellulose biosynthesis in rice. An increase in the expression level of this gene can improve the SCWs cellulose content. Therefore, the study of the function of OsSND2 can provide a strategy for manipulating plant biomass production. Keywords: Secondary cell wall (SCW), Rice, Cellulose synthesis, Transcription factor (TF), NAC, MYB Background surround all cells and the secondary cell walls (SCWs), a Plant cell wall is a unique structure that plays an import- thickened structures observed in specific cell types, such ant role in plant growth and development. The cell wall as xylem vessels and fibers (Keegstra, 2010). SCWs not provides mechanical strength to the plant body and only provide mechanical strength to these cells, but also responses to environmental stimuli, such as pathogen greatly contribute to the bulk of renewable plant bio- invasion (Underwood, 2012) and stress response mass (Burton and Fincher, 2014). SCWs mainly com- (Tenhaken, 2014). Plants exhibit two typical types of cell poses cellulose, hemicelluloses and lignin. Cellulose is walls, namely, the primary cell walls (PCWs) that composed of unbranched β-1, 4-glucans, and cellulose microfibrils form the main load-bearing network (Somerville, 2006). Hemicelluloses belong to a group of * Correspondence: liubm@ipp.ac.cn; xdfu@genetics.ac.cn Yafeng Ye and Kun Wu contributed equally to this work. heterogeneous polysaccharides such as xylan, glucan, Institute of Technical Biology and Agricultural Engineering, Hefei Institutes mannan, and mixed-linkage glucan (Pauly et al., 2013). of Physical Science, Chinese Academy of Sciences, Hefei, Anhui 230031, Lignin is a complex phenylpropanoid polymer that pro- People’s Republic of China State Key Laboratory of Plant Cell and Chromosome Engineering, Institute vides mechanical strength to specific cell types (Boerjan of Genetics and Developmental Biology, Chinese Academy of Sciences, et al., 2003). The understanding of the mechanism Beijing 100101, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Ye et al. Rice (2018) 11:36 Page 2 of 14 underlying SCWs biosynthesis may provide a strategy top-level master switches of SCWs biosynthesis in fibers for manipulating plant biomass production. and/or vessels (Zhong and Ye, 2015). These factors In the past decades, many genes involved in SCWs directly regulate the expression of a battery of down- biosynthesis have been cloned and characterized in both stream TFs, including SND2, SND3, MYB20, MYB42, dicot and monocot plants. Cellulose is synthesized in the MYB46, MYB52, MYB54, MYB58, MYB63, MYB83, plasma membrane by the cellulose synthase complex MYB85 and MYB103. Of these, MYB46 and its close (CSC), which contains at least three different cellulose homolog MYB83 act as the secondary-layer master synthases, encoded by CESA genes (Somerville, 2006). In switches to regulate SCWs biosynthesis (Hussey et al., Arabidopsis, CESA4, CESA7,and CESA8 genes are 2013). MYB46 and MYB83 also regulate the expression essential for SCWs cellulose biosynthesis (Taylor et al., of the direct targets of SND1 and its homologs, NST1, 2003; Taylor et al., 2000; Taylor et al., 1999). Close NST2, VND6 and VND7 (McCarthy et al., 2009; Zhong homologs of CESA4, CESA7 and CESA8 are required et al., 2007). All of these NAC and MYB TFs collectively for SCWs cellulose biosynthesis in rice, and mutations regulate the biosynthetic genes for cellulose, xylan and in any of these genes may cause a dramatic decrease in lignin. The SCWs NAC family TFs activate the down- the SCWs cellulose content, resulting in the brittle culm stream targets through binding to a 19 base pair (bp) se- phenotype (Song et al., 2013; Tanaka, 2003; Zhang et al., quence, known as SCWs NAC-binding element (SNBE) 2009). In addition to these CESA genes, some other (McCarthy et al., 2014; Zhong et al., 2010). MYB46 and genes are also involved in SCWs cellulose biosynthesis MYB83 bind to a 7 bp consensus sequence, termed as and assembly, such as the Arabidopsis KORRIGAN SCWs MYB-responsive element (SMRE) to regulate the (KOR) gene, that encodes for an endo-β-1, 4-glucanase. expression of target genes (Zhong and Ye, 2012). Mutations in this gene causes reduction in the cellulose Rice is one of the most important staple food crops content of both PCWs and SCWs (Szyjanowicz et al., and produces a large amount of agronomic biomass resi- 2004). In rice, several Brittle Culm (BC) genes are in- dues, which may be a potential source of bio-energy. volved in SCWs cellulose biosynthesis and mutations of Nevertheless, a few TFs involved in SCWs biosynthesis these genes are shown to reduce the cellulose content have been reported in rice. OsCEF1, which encodes the and mechanical strength, leading to the brittle culm OsMYB103L, regulates SCWs biosynthesis by directly phenotype (Kotake et al., 2011; Wu et al., 2012; Zhang et binding to the promoter of CESAs and BC1 genes (Ye et al., 2010; Zhou et al., 2009). Xylan and mannan are the al., 2015). The cef1 mutant shows reduction of cellulose major hemicelluloses in SCWs, and they are synthesized content, and the culm is fragile (Ye et al., 2015). in the Golgi apparatus and transported to the plasma OsMYB61 directly binds to the CESA promoters and membrane via Golgi vesicles (Pauly et al., 2013). In Ara- regulates their expression, and OsMYB61 can be acti- bidopsis, glycosyltransferase families have been impli- vated by the SCWs NAC families, including NAC29 and cated in hemicelluloses biosynthesis. Lignin is a complex NAC31 (Huang et al., 2015). Therefore, to unveil the polymer made up of p-hydroxylphenyl (H), guaiacyl (G), master transcriptional mechanism of SCWs biosynthesis and syringyl (S) units of lignin (Kumar et al., 2016). The in rice may provide valuable approach for genetically monolignols are synthesized through the phenylpropa- modifying grass crops for biofuel production. noid pathway within cells and then transported into cell In this study, we isolated a NAC family TF, named walls, where they are polymerized into lignin via oxida- OsSND2 using yeast one-hybrid screening with the tive reactions catalyzed by oxidases, such as laccases and SNBE site in the promoter region of OsMYB61 as bait. peroxidases (Boerjan et al., 2003). Several genes involved We demonstrated that OsSND2 directly binds to the in SCWs biosynthesis have been reported, however the promoter of OsMYB61 in vitro and in vivo, and regulates spatiotemporal expression of these genes remains its expression. Furthermore, molecular characterization unclear. of OsSND2 suggested that it functions as a master regu- In Arabidopsis, a detailed transcriptional regulation lator to directly mediate the expression of other MYBs mechanism of SCWs biosynthesis has been reported. A and facilitate cellulose biosynthesis. transcriptional network comprising two large family transcription factors (TFs), NAC and MYB, are involved Methods in SCWs biosynthesis (Zhong and Ye, 2015). In this Plant materials and growth conditions transcriptional network, a group of NAC family TFs, in- The all rice (Oryza sativa) plants were used in this cluding NAC SECONDARY WALL THICKENING study, including the japonica cultivar wild-type plants, PROMOTING FACTOR1 (NST1), NST2, NST3 (also wuyunjing7 (WYJ7) and the overexpression and knock- called as SND1, SECONDARY WALL-ASSOCIATED down of OsSND2 transgenic plants were grown in the NAC DOMAIN PROTEIN1), VASCULAR-RELATED experimental fields at the Institute of Technical Biology NAC-DOMAIN6 (VND6), and VND7, function as the and Agriculture Engineering, Hefei Institute of Physical Ye et al. Rice (2018) 11:36 Page 3 of 14 Science, Chinese Academy of Sciences (Hefei, China) Binary vectors construction and rice transformation and Sanya (Hainan province, China) during the natural For the overexpression construct of OsSND2, the growing season. full-length coding sequence of OsSND2 was amplified using gene-specific primers, OE-F, 5’-CCAAGCTTA TGACGTGGTGCAACAGCTT-3′ and OE-R, 5’-CGGG Yeast one-hybrid screening ATCCTCAAGGGCCACCAAAGCTGT-3′, which con- Five OsMYB61 bait fragments of pMYB61–1(− 1946, − 1258), tain HindΙΙΙ and BamHΙ restriction sites. The PCR frag- pMYB61–2(− 1607, − 1258), pMYB61–3(− 1258, − 897), ment was cloned into the intermediate vector N-Tagged pMYB61–4(− 870, − 356) and pMYB61–5(− 356, − 1) were SK (−), which encodes Myc-tag protein. Then, the cloned into the pHIS2 vector between EcoRI and SacI sequencing-confirmed vector was digested using KpnΙ/ sites and integrated into the genome of yeast strain BamHΙ and inserted into the pCAMBIA2300 between Y187 (MATα, ura3–52, his3–200, ade2–101, trp1–901, the KpnΙ and BamHΙ sites to create the p35S::My- leu2–3, 112, gal4Δ, met , gal80Δ, URA3:: GAL1 -GAL1- UAS c-OsSND2 vector. -lacZ, MEL1). For the self-activation test, promoter TATA We used CRISPR/Cas9 system for creating snd2 mu- bait strains were grown on the SD/−Trp, -His (a synthetic tants. The CRISPR/Cas9 binary vectors were constructed Trp and His dropout medium) media in the presence of as previously described (Ma et al., 2015). The Cas9 plant 0 mM, 10 mM, 30 mM and 50 mM 3-aminotriazole expression vector (pYLCRISPR/Cas9Pubi-H) and sgRNA (3-AT). We performed the yeast one-hybrid screening expression vector (pYLgRNA)wereprovidedbyProf. using the BD Matchmaker One-hybrid Library Construc- Yao-Guang Liu (South China Agricultural University). We tion and Screening Kit (K1617–1, Clontech) according to selected the Target1 (CAGCGACGTCCGCACCGCCG) the user manual (PT3529–1, Clontech). The cDNA library and Target2 (GGAGGGGCACATCTTGACG) in the first of the internodes tissue was constructed with the exon of OsSND2 (Fig. 5a) as candidate target sequences pGADT7-Rec2 vector (Clontech). The promoter bait according to the design principles of the target sequences strains were then mated with the “pGADT7-Rec2-cDNA” in the CRISPR/Cas9 system. Then, they were ligated into library and screened on the SD/−Leu -Trp -His selection two sgRNA expression cassettes of a Cas9 binary vector, media containing 30 mM 3-AT. Positive colonies were se- driven by OsU6 and OsU3 promoters, respectively. lected for yeast plasmid isolation or PCR with primers These constructs were introduced into a japonica cul- AD-F and AD-R. The PCR was performed according to tivar, wuyunjing7 (WYJ7) by the Agrobacterium-me- the following program, 95 °C 5 min, 95 °C 30 s, 56 °C 30 s, diated transformation procedure as described previously 72 °C 2 min, 36 cycles, 72 °C 10 min, 12 °C pause. (Raineri et al., 1990). RNA extraction and quantitative real-time PCR (qRT-PCR) Bioinformatics analysis of OsSND2 Total RNA was extracted from various rice tissues using A search for OsSND2 homologs in rice and Arabidopsis TRIzol reagent (Invitrogen), as described previously was performed using the NCBI BLAST server (http:// (Wadsworth et al., 1988). The first strand of cDNA was blast.ncbi.nlm.nih.gov/Blast.cgi). The alignment was per- synthesized using a reverse transcriptional kit (TransGen). formed using DNAMAN software. An unrooted phylo- qRT-PCR was performed using relevant primers and genetic tree of OsSND2 homologs in rice and qRT-PCR kit (TransGen) on a quantitative 7500 PCR sys- Arabidopsis was constructed using MEGA5 software tem (ABI). All assays were repeated at least three times, with 1000 bootstrap replications (Tamura et al., 2011). the Actin1 gene was used as an internal control. The co-expression analysis of OsSND2 with candidates in cell wall synthesis was performed using the expressing Electrophoretic mobility shift assay (EMSA) database at http://www.ricearray.org. The coding sequence of OsSND2 was amplified and cloned into the pGEX-4 T-1 vector (GE Healthcare). Subcellular localization of OsSND2 GST and GST-OsSND2 fusion proteins were purified as To observe the subcellular localization of OsSND2, a described previously (Wang et al., 2015). DNA frag- green fluorescent protein (GFP) fused to the C-terminus ments for EMSA were obtained by PCR amplification of OsSND2 and inserted into the pCAMBIA1300 be- and labeled using a biotin labeling kit (Invitrogen). DNA tween the KpnΙ and BamHΙ sites to create the gel shift assays were performed using the LightShift 35S::OsSND2-GFP vector, which was transformed into Chemiluminescent EMSA kit (Thermo Fisher Scientific). rice protoplasts by polyethylene glycol (PEG) mediated transformation method. The subcellular distribution of Chromatin immunoprecipitation (ChIP) analysis the OsSND2-GFP protein was observed using confocal The above-ground portion of p35S::Myc-OsSND2 trans- laser scanning microscope (Leica TCS SP5). genic rice plants was harvested between 2 and 3 g after Ye et al. Rice (2018) 11:36 Page 4 of 14 growth on soil for 3 to 4 weeks and immediately amplified and cloned into the pLacZi2μ vector to drive cross-linked with 1% formaldehyde under vacuum for lacZ reporter gene expression. The effectors and reporters 15 min at 15–25 °C. The cross-linking was stopped by were simultaneously transformed into the yeast strain adding glycine to the final concentration of 0.125 M for EGY48. The transformants were grown on synthetic drop- 5 min under vacuum. The cross-linked samples were out plates without tryptophan and uracil containing rinsed twice with double distilled water. The further ChIP 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside for assay based on an antibody to Myc (9E10, Santa Cruz colony coloration. The empty pB42AD and pLacZi were Biotechnology) was performed as described previously used as negative control. (Wang et al., 2015). Chromatin samples without Myc antibody immunoprecipitation were used as the control. Cell wall composition analysis Enrichment of DNA fragments was determined using The second internodes of wild type and transgenic plants qRT-PCR analysis performed on three biological repli- at mature stage were ground into powder under liquid ni- cates. The Actin1 gene exon used as negative controls. trogen and prepared alcohol-insoluble residues (AIRs). De-starched AIRs and trifluoroacetic acid (TFA) treat- Transactivation analysis in yeast cells and Rice protoplasts ment were performed as previously described (Li et al., Transactivation analysis in yeast was performed as de- 2009). For the cellulose measurement, the remains after scribed previously (Wang et al., 2012). The full length cod- TFA treatment were hydrolyzed in Updegraff reagent ing sequence of OsSND2 was amplified and cloned into (acetic acid: nitric acid: water, 8:1:2 v/v). The cooled pellets pGBKT7 vector, and then transformed into the yeast strain were washed and hydrolyzed with 72% sulfuric acid. The AH109 (MATa, trp1–901, leu2–3, 112, ura3–52, his3–200, cellulose content was measured by the anthrone assay gal4Δ, gal80Δ, LYS2::GAL1 -GAL1 -HIS3, GAL2 (Updegraff, 1969). The monosaccharide composition was UAS TATA UAS -GAL2 -ADE2, URA3::MEL1 -MEL1 -lacZ, MEL1). determined by gas chromatography-mass spectrometry as TATA UAS TATA The empty pGBKT7 (BD) and fusing the GAL4 vec- described previously (Xiong et al., 2010). The lignin con- tors were used as negative and positive controls, re- tent was measured by the acetyl bromide method as de- spectively. The transactivation activity was evaluated scribed previously (Huang et al., 2015). according to the growth on SD/−Trp and SD/−Trp – His -Ade. Microscopy Transactivation analysis was also performed in rice For the scanning electron microscope (SEM) observa- protoplasts as described previously (Wang et al., 2015). tion, the second internodes segments were sliced with For the effecter vector, the full length coding sequence Gillette razor blades and then fixed in 4% paraformalde- of TFs were amplified and fused with GAL4 binding do- hyde. After dehydration through a gradient of ethanol main (GAL4BD). The empty GAL4BD and fused with and critical point drying, the samples were sprayed with VP16 were used as negative and positive controls, re- gold particles and observed with a scanning electron spectively. For the reporter vectors, the pUC19 contain- microscope (SEM) (S-3000 N; Hitachi, Tokyo, Japan). ing the firefly luciferase (LUC) reporter gene driven by the minimal TATA box of the 35S promoter plus five Accession numbers GAL4 binding elements was used for self-activation test. Sequence data used in this manuscript can be found in The 2 kb fragments of upstream sequence from start thericegenomeannotation database(http://rice.plant- codon of the candidate genes were amplified and fused biology.msu.edu) and in the Arabidopsis information with LUC protein to generate reporter plasmids for resource (TAIR, http://www.arabidopsis.org)under the targets transactivation analysis. A pTRL plasmid contain- following accession numbers: OsMYB61 (Os01g18240), ing Renilla LUC gene driven by the CaMV (Cauliflower OsSND2 (Os05g48850), OsCESA4 (Os01g54620), mosaic virus) 35S promoter, was used as an internal OsCESA7 (Os10g32980), OsCESA9 (Os09g25490), control. The pTRL, effector and reporter were simultan- OsCESA11 (Os06g39970), OsMYB86L (Os08g36460), eously transformed into the rice protoplast system, then OsMYB61L (Os05g04820), AtSND2 (At4g28500). kept in dark for 16 h. The LUC activity was measured as described previously (Ohta et al., 2000). Results Identification of the interaction between OsSND2 and Yeast one-hybrid assay OsMYB61 promoter The OsSND2, OsMYB61L and OsMYB86L encoding se- To understand the hierarchical regulatory mechanism quence was amplified and inserted into the unique EcoRI controlling SCWs biosynthesis in rice, we conducted the and XhoI sites of the pB42AD vector (Takara) to construct yeast one-hybrid screening using five different length se- effector. For the reporter vectors, the 2 kb DNA fragments quences of OsMYB61 promoter (Additional file 1: Figure corresponding to the promoter of candidate genes were S1a) fused to HIS3 reporter as baits (Additional file 1: Ye et al. Rice (2018) 11:36 Page 5 of 14 Figure S1b) to search for novel transcription factors in- The BLAST search found a the rice full-length cDNA, volved in the regulation of OsMYB61 expression. The NM_001062858. Further sequence analysis and annotation cDNA library from the second internodes harvested dur- of this clone using RGAP database (http://rice.plantbiology. ing the heading stage of rice fused to yeast GAL4 activa- msu.edu/)showedthatthis geneis onthe locus tion domain (AD) was used as a prey. To test the bait LOC_Os05g48850, which has three exons and two in- construct self-activation, promoter bait strains were trons. LOC_Os05g48850 encodes for a NAC family grown on the SD/−Trp -His media in the presence of 0, transcription factor with a length of 314 amino acids 10, 30 and 50 mM of 3-AT, a competitive inhibitor of and a molecular mass of approximately 35 kD. Phylo- HIS3 protein. As a result, only the yeast strain with genetic analysis showed that LOC_Os05g48850 is OsMYB61-P5 bait construct was completely suppressed closely related to NAC family transcription factors in in the presence of 30 mM 3-AT (Additional file 1: Arabidopsis At4g28500 (AtSND2) (Fig. 1a). Protein se- Figure S1c). Yeast strains harbouring the other four quence alignment revealed that they are highly conserved constructs were not suppressed even with 50 mM of in the predicted NAC DNA-binding domains (Fig. 1b). 3-AT (Additional file 1: Figure S1c). Hence, we chose Therefore, we designated LOC_Os05g48850 as OsSND2 the construct OsMYB61-P5 to perform screening ex- (Oryza sativa SND2). periment with 30 mM 3-AT. Through the screening One of the significant features of transcription factors of 3.2 × 10 cDNA clones, one positive clone was ob- is nuclear localization. To determine the subcellular tained (clone 13). We isolated the yeast plasmid and localization of OsSND2, the construct of OsSND2 with subjected it to sequencing and BLAST search against C-terminus green fluorescent protein (GFP) tag was NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). cloned into a 35S::OsSND2-GFP vector. Using confocal Fig. 1 OsSND2 is a NAC family transcription factor and has a very high homology to AtSND2. a Phylogenetic analysis of the secondary wall NACs in Rice and Arabidopsis. The red rectangle indicate the OsSND2. An unrooted phylogenetic tree was generated with the full-length amino acid sequences. b Protein sequences alignment of OsSND2 and AtSND2. Black shadings indicate identical amino acids. The red underline indicate NAC domain Ye et al. Rice (2018) 11:36 Page 6 of 14 laser scanning microscopy, we confirmed that the pB42AD without OsSND2 failed to activate LacZ ex- OsSND2-GFP fusion protein was located predominantly pression (Fig. 3b). in the nucleus (Fig. 2a). We further performed the dual-luciferase reporter To investigate whether OsSND2 has a potential tran- (DLR) assay system in rice protoplasts to explore the ef- scriptional activity, we used the yeast assay system to fect of OsSND2 on the transcriptional regulation of investigate OsSND2. The growth of transformants carry- OsMYB61 expression using a reporter construct carrying ing pGBKT7-OsSND2 on selective medium (SD/−Trp) the firefly luciferase (LUC) driven by the 2 kb fragment and (SD/−Trp –His -Ade) indicated the OsSND2 of OsMYB61 promoter. DLR assay revealed an 11-fold protein has transcriptional activity, the pGBKT7-Os- increase in the transcriptional activation in the MYB103L and empty pGBKT7 were used as positive protoplasts co-expressing an effector carrying OsSND2 and negative control, respectively (Fig. 2b). We also used (Fig. 3c) and a reporter containing OsMYB61 promoter a dual-luciferase reporter (DLR) assay system in the rice to drive luciferase as compared with the negative control protoplast to test the transcriptional activation of (Fig. 3d). This result suggests that OsSND2 functions as OsSND2. In comparison with the GAL4-BD negative a transcriptional activator to directly regulate OsMYB61 control, OsSND2 can activate the LUC gene, similarly to expression. the activation by VP16 as positive control (Fig. 2c). Secondary wall-related NAC proteins regulate target genes These results indicate that OsSND2 protein exhibits expression through binding to the SNBE element, (T/ transcriptional activity (Fig. 2b and c). A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T) (Zhong et al., 2010). To determine whether the inter- OsSND2 can directly bind to the promoter of OsMYB61 action between OsSND2 and OsMYB61 promoter oc- To confirm the interaction between OsSND2 and curs through binding to SNBE site, we performed OsMYB61 promoter, we used the yeast one-hybrid sys- sequence searching within the promoter of OsMYB61 tem with LacZ reporter gene (Fig. 3a). The yeast and found it contains two SNBE sites (SNBE1 and one-hybrid assay revealed the predominant activation of SNBE2) (Additional file 2: Figure S2a). We further con- LacZ reporter gene expression by OsSND2 under the ducted chromatin immunoprecipitation (ChIP) assay in control of OsMYB61 promoter. On the contrary, wild-type and p35S::Myc-OsSND2 overexpression Fig. 2 Subcellular localization and transactivation analysis of OsSND2. a OsSND2 is a Nuclear-localized protein. A rice protoplast cell expressing OsSND2-GFP, indicating that OsSND2 is a Nuclear-localized protein. b Transactivation analysis of OsSND2 fused with the GAL4 DNA binding domain in yeast. Transformants harbouring pGBKT7-SND2, the positive control pGBKT7-MYB103L and the negative control pGBKT7 were streaked onto SD-Trp or SD-Trp, His, Ade medium to determine growth. c Transactivation analysis of OsSND2 as revealed by relative LUC activity in rice protoplasts Ye et al. Rice (2018) 11:36 Page 7 of 14 Fig. 3 OsSND2 directly regulate OsMYB61 expression. a Diagram of the effector construct and the reporter constructs used in b. b Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsMYB61 and OsCESA11 promoters and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. c Diagram of the effector construct and the reporter constructs used in d. d OsSND2 activates transcription of the OsMYB61 gene promoter. Relative luciferase activity was monitored in rice protoplasts cotransfected with different effector and reporter constructs. Mock, cotransfected with reporter construct and an empty effector construct; control, cotransfected with effector construct and an empty reporter construct (set to 1). Error bars, SE of three biological replicates. Student’s t-tests were used to generate the P values. The asterisks (**) indicate p <0.01. e ChIP assays. The diagram depicts the regions used for ChIP-qPCR analysis of extracts from the second internodes of over-expression plants carrying the p35S::Myc-OsSND2 construct. ChIP-qPCR results were quantified by normalization of the Myc immunoprecipitation signal by the corresponding input signal. Error bars, SE of three biological replicates. f EMSA analysis. Competition for OsSND2 binding was performed with unlabelled P9 fragments containing SNBE1 site at 50×, 100× and 200× the amount of labeled probe transgenic rice plants. The results showed that the two WYJ7 plants. OsSND2 expression was detected in all or- fragments (P3 and P9) containing the SNBE sites were gans, with relatively higher levels observed in internodes significantly enriched in Myc-OsSND2 overexpression and panicles. The expression level of OsSND2 was rela- plants (Fig. 3e). We used an electrophoretic mobility tively low in leaves, sheaths, and roots during the heading shift assay (EMSA) to examine whether OsSND2 bind and seedling stages (Fig. 4). We examined the expression to P9 and P3 fragments containing the SNBE1 and pattern of OsMYB61 and found it to be consistent with SNBE2, respectively. P9 and P3 were bound by the OsSND2 expression (Additional file 3: Figure S3). recombinant OsSND2 protein fused to glutathione S-transferase (GST-OsSND2), which resulted in a mo- Mutation of OsSND2 decreased cellulose content and bility shift (Fig. 3f and Additional file 2:Figure S2b). down-regulated SCWs gene expression GST alone, as a negative control, failed to induce the To investigate the biological function of OsSND2, we mobility shift (Fig. 3f and Additional file 2:FigureS2b). generated OsSND2 mutants using CRISPR/Cas9 system. The binding ability to two fragments was gradually de- We designed two sequence-specific single guide RNA creased in the presence of increasing amounts of un- (sgRNA) target sites, Target1 and Target2, which were labeled probes (Fig. 3f and Additional file 2:Figure S2b), 76-bp apart in the first exon of OsSND2 (Fig. 5a). Two thereby confirming the binding specificity. transgene-free homozygous knockout lines with different Taken together, the above results demonstrate the genotypes, snd2-c1 and snd2-c2 were obtained (Fig. 5b). function of OsSND2 as a transcription activator through Protein sequence alignments of the two homozygous its direct binding to SNBE sites in the promoter of mutants and the wild type protein revealed that snd2-c1 OsMYB61 in vitro and in vivo. and snd2-c2 showed coding frame shifts and premature translational stops (Fig. 5c). OsSND2 was mainly expressed in internodes and panicles No obvious morphological changes, except for a little To investigate whether the expression of OsSND2 is asso- early flowering in ossnd2 mutant (Fig. 5d). However, a ciated with SCWs biosynthesis, the expression pattern of significant decrease in the cellulose content was detected OsSND2 was examined by quantitative real-time PCR in snd2-c1 and snd2-c2 mutants (Fig. 5e). No significant (qRT-PCR) using RNAs isolated from various organs of alteration in the contents of xylose and lignin were Ye et al. Rice (2018) 11:36 Page 8 of 14 detected (Additional file 4: Table S1) We determined the expression levels of OsMYB61 and secondary wall CESA genesintwo mutantsand foundthatthe expression levelsof OsMYB61 and CESA genes were down-regulated (Fig. 5f). We further analyzed the wall thickness of sclerenchyma cells in the internodes of wild-type and snd2 mutant plants by SEM and found that snd2 mutant plants showed obviously thinner walls than the wild-type plants in sclerenchyma cells (Fig. 5g). Overexpression of OsSND2 increased cellulose content and up-regulated SCWs gene expression To further elucidate the biological function of OsSND2, we generated OsSND2 overexpression (OX) transgenic plants. Seventeen OX transgenic lines were obtained. We used qRT-PCR analysis to examine the expression Fig. 4 Expression pattern of OsSND2. qRT-PCR analysis of OsSND2 level of OsSND2 in these transgenic plants. Transgenic expression in various rice organs and different developmental stage, lines with significant alterations in the expression level the heading stage and seedling stage indicate the tenth day after of OsSND2 were selected for further study (Fig. 6a). flowering and the two weeks old seedlings, respectively. The Actin1 The overexpression of OsSND2 resulted in the pheno- gene was used as an internal control. Error bars, SD of three biological replicates typic characteristics such as semi-dwarf plant height and significant leaf rolling. The degree of leaf rolling in- creased with an increase in the expression level of Fig. 5 Generation and analysis of snd2 mutants. a Schematic diagram of OsSND2 gene structure and two CRISPR/Cas9 target sites. UTRs, exons, and introns are indicated by blank rectangles, black rectangles, and black lines, respectively. b DNA sequence alignments for the two homozygous snd2 mutants identified in the T1 generation, together with a wild-type (WT) control. The numbers on the right side are the sizes of the indels, with “−” and “+” showing deletion and insertion of nucleotides involved, respectively. c Deduced OsSND2 amino acid sequence alignments for the two homozygous mutants and WT. d Three-month-old plant of wild type (WT) and snd2-c1 mutant. Bar = 10 cm. e Measurement of cellulose content in WT and snd2 mutants. f Relative expression of OsMYB61 and SCWs-related CESA genes in WT and snd2 mutants. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. g Observation of sclerenchyma cell walls in the internodes from the three-month-old wild-type and snd2 mutant plants via transmission electron microscope. Bar = 2 μm Ye et al. Rice (2018) 11:36 Page 9 of 14 Fig. 6 Over-expression of OsSND2 results leaf rolling phenotype and increases cellulose content. a Three-month-old plant of wild type (WT) and over-expression (OX) transgenic lines. Bar = 10 cm (top panel). The OX lines showed upward rolled leaves compare to WT (bottom panel). b OsSND2 expression in over-expression (OX) transgenic plants as determined by qRT-PCR. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. c Measurement of cellulose content in WT and OX lines. Cellulose content (milligrams per gram of total cell wall residues) of the second internodes from WT and OX plants. Error bars, SD of three biological replicates. The asterisks (**) indicate a significant difference between transgenic plants and WT controls at P < 0.01, by Student’s t-test. d Relative expression of OsMYB61 and SCWs-related CESA genes in WT and OX lines was determined by qRT-PCR analysis. The Actin1 gene was used as an internal control. Error bars, SD of three biological replicates. e Observation of sclerenchyma cell walls in the internodes from the three-month-old wild-type and SND2- OX plants via transmission electron microscope. Bar = 2 μm OsSND2 (Fig. 6b). We measured the cellulose content in transcription regulation network controlling SCWs biosyn- OsSND2-OX plants and found that OsSND2-OX plants thesis in Arabidopsis (Zhong et al., 2008). To investigate have significantly increased cellulose content (Fig. 6c), whether OsSND2 regulates other SCWs-related but showed no significant alterations in the contents of R2R3-MYB family TFs expression in rice, we performed xylose and lignin (Additional file 4: Table S1). We fur- co-expression analysis of OsSND2 with SCWs-related ther examined the expression levels of OsMYB61 and CESAs and R2R3-type MYBs. We identified several MYB secondary wall CESA genes using qRT-PCR. Consistent candidates that may be involved in SCWs biosynthesis with the increased cellulose content, OsMYB61 and (Table 1). We further examined the expression levels of CESA genes expression level were higher in OsSND2-OX these R2R3-type MYBs in snd2-c1 mutants and OsSND2 plants (Fig. 6d). The results of anatomical analysis re- overexpression transgenic plants. qRT-PCR assay showed vealed the obvious thickness in the sclerenchyma cell that OsMYB86L (LOC_Os08g36460), OsMYB61L wall of OsSND2-OX plants as compared to wild-type (LOC_Os05g04820), and OsMYB58/63 (LOC_Os04g50770) plants (Fig. 6e). Collectively, these results suggest that were down-regulated in snd2-c1 mutants and up-regulated OsSND2 may be involved in the regulation of the bio- in the transgenic OsSND2-OX plants (Fig. 7a). The expres- synthetic pathways involved in SCW cellulose synthesis sion of OsMYB103L (LOC_Os08g05520) had no obvious and affect the thickness of sclerenchyma cell wall. difference in these transgenic lines (Fig. 7a). To further investigate if OsSND2 can directly regulate OsSND2 directly regulates the expression of other the expression of these MYBs, transcriptional activation R2R3-MYB family TFs assays were performed in yeast and rice protoplasts. Secondary wall-related NAC proteins can activate lots of OsMYB86L and OsMYB61L, but not OsMYB58/63 were R2R3-type MYB family TFs expression to start the entire directly regulated by OsSND2 (Fig. 7b and c). In addition, Ye et al. Rice (2018) 11:36 Page 10 of 14 Table 1 List of the R2R3-MYB TFs and secondary wall CESA genes and regulates their expression (Huang et al., genes coexpressed with OsSND2 in Rice 2015). Yeast one-hybrid screening is a powerful tool for Gene type Gene Gene ID PCC the identification and isolation more transcription fac- tors using promoter segments or regulatory elements of Cellulose biosynthesis genes OsCESA4 LOC_Os01g54620 0.8475 targets as baits. In this study, we isolated a NAC tran- OsCESA7 LOC_Os10g32980 0.8292 scription factor from the yeast one-hybrid screening OsCESA9 LOC_Os09g25490 0.8404 using OsMYB61 promoter region containing a SNBE site R2R3-type MYBs OsMYB103L LOC_Os08g05520 0.7664 as bait (Additional file 1: Figure S1). We named it as the OsMYB86L LOC_Os08g36460 0.7624 OsSND2 based on its closed relationship with AtSND2. OsMYB61 LOC_Os01g18240 0.7503 We confirmed the direct binding of OsSND2 on OsMYB61 promoter in vitro and in vivo (Fig. 3 and OsMYB61L LOC_Os05g04820 0.6899 Additional file 2: Figure S2). We also further investigated OsMYB58/63 LOC_Os04g50770 0.6770 OsSND2 protein function and downstream genes. Co-expression analysis of OsSND2 with R2R3-MYB TFs and secondary wall CESA genes was performed using the expressing database at http:// www.ricearray.org/coexpression/coexpression.shtml. 1, The Pearson correlation OsSND2 directly activate OsMYB61 expression coefficient (PCC). The PCC of coexpressed R2R3-MYBs and SCWs-related CESA We have demonstrated that OsSND2 can directly bind to genes was set above 0.65 and 0.75, respectively the promoter of OsMYB61 (Fig. 3b and d). In Arabidopsis, we investigated the distribution of SNBE sites and found secondary wall NAC family proteins (SWNs) activate their two and three SNBE sites in the promoter region (1.5-kb direct target genes through binding to the SNBE sites, and 5′-upstream sequence of the start codon) of OsMYB86L the binding affinities vary with different SWNs and SNBE and OsMYB61L, respectively. Hence, OsSND2 directly sequences (McCarthy et al., 2014; Zhong et al., 2010). We regulates the expression of OsMYB86L and OsMYB61L, have found two SNBE sites in OsMYB61 promoter region. probably through its binding to SNBE sites in the pro- EMSA and ChIP assay showed that OsSND2 binds to the moter regions of OsMYB86L and OsMYB61L. two SNBE sites (Fig. 3e, f and Additional file 2:Figure S2). In previous study, NAC29 and NAC31 were shown to OsMYB86L and OsMYB61L directly activate the transcription bind only to the SNBE site farther from the start codon of CESAs (Huang et al., 2015). OsCESA4, OsCESA7 and OsCESA9 are essential for The NAC family transcription factors are highly con- SCWs cellulose biosynthesis in rice. To investigate served at the N-terminal NAC binding domain and have whether OsMYB86L and OsMYB61L are involved in a highly variable C-terminal domain, which may func- SCWs biosynthesis, we performed yeast one-hybrid using tion as a transcriptional activator or repressor (Olsen et pB42AD-(OsMYB86L and OsMYB61L) fusion proteins al., 2005). A large number of SWNs function as a tran- and OsCESA4 promoter region (− 600 to −1bp upstream scriptional activator to regulate downstream genes ex- of the start codon), which contains three SCWs pression in Arabidopsis, such as SND1 and its close MYB-responsive elements (SMRE) (Fig. 7d). These results homologs (Zhong et al., 2008). Transactivation analysis provided evidence that OsMYB61L and OsMYB86L bind indicated that OsSND2 exhibits transcriptional activity to the promoter region of OsCESA4 (Fig. 7e). (Fig. 2b and c) and functions as a transcriptional activa- We performed the transcriptional activation assay in tor to initiate the transcription of OsMYB61 (Fig. 3d). rice protoplasts to investigate whether OsMYB86L and The expression of OsMYB61 was up-regulated in OsSN- OsMYB61L can activate the transcription of OsCESA4, D2-OX transgenic lines (Fig. 6d) and down-regulated in OsCESA7 and OsCESA9. The assay results show that the snd2 mutants (Fig. 5f). We also detected similar expres- luciferase activity was significantly higher for protoplasts sion patterns for OsSND2 and OsMYB61 (Fig. 4 and co-expressing the reporter carrying three CESA gene pro- Additional file 3: Figure S3). Previous study shows that moters driving luciferase and the effector containing the transcription of OsMYB61 is mainly mediated by OsMYB86L or OsMYB61L than the negative control (Fig. NAC29 and NAC31 (Huang et al., 2015). Therefore, we 7f). Thus, OsMYB86L and OsMYB61L directly activate reported OsSND2 as a new transcriptional activator to the transcription of OsCESA4, OsCESA7,and OsCESA9. directly regulate OsMYB61 expression. Discussion OsSND2 regulate secondary wall cellulose biosynthesis Secondary cell walls play a critical role in plant growth In rice, the genome was predicted to contain 151 NAC and development, and they also contain high amounts of genes (Nuruzzaman et al., 2010). The NAC family tran- lignocellulose, a key feedstock for the production of scription factors play important roles in plant growth bio-energy and bio-based products. In rice, OsMYB61 is and development (Olsen et al., 2005), especially in re- a key regulator that binds to the promoter of CESA sponse to different abiotic stresses (Fujita et al., 2004; Ye et al. Rice (2018) 11:36 Page 11 of 14 Fig. 7 OsSND2 and R2R3-MYBs regulates its target genes expression. a Relative expression of R2R3-MYBs genes in WT, OsSND2-OX and snd2-c1 mutant lines. The Actin1 gene was used as internal control. Error bars, SD of three biological replicates. b OsSND2 directly binds to OsMYB61L and OsMYB86L promoters. Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsMYB58.63, OsMYB61L, OsMYB86L, OsMYB103L promoters and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. c OsSND2 activates transcription of the OsMYB61L and OsMYB86L gene promoter. Luciferase activities in rice protoplasts contransfected with the effectors and reporters. The transactivation activity was monitored by assaying the luciferase activities, with the activity in protoplasts transfected withan empty effector construct defined as 1. Error bars, SD of three biological replicates. d Diagram of OsCESA4 showing three SMRE elements within the 600 bp OsCESA4 promoter region. Black arrows indicate the SMRE elements. The DNA sequences containing a core motif of SMREs (the red bases). The DNA sequence containing these three SMREs was subjected to the EMSA assay. e Yeast one-hybrid assay showing the activity of LacZ reporters driven by OsCESA4 promoter containing three SMRE sites and activated by activation domain (AD) fusion effectors. The empty pB42AD and pLacZi were used as negative control. f OsMYB61L and OsMYB86L activate transcription of the OsCESA4, OsCESA7 and OsCESA9 genes promoter. Luciferase activities in rice protoplasts contransfected with the effectors and reporters. The transactivation activity was monitored by assayingthe luciferase activities, with the activity in protoplasts transfected with an empty effector construct defined as 1. Error bars, SD of three biological replicates Hegedus et al., 2003; Tran et al., 2004) and SCWs for- MYB46 and MYB83, which have been reported to bind mations (Zhong and Ye, 2015), NAC proteins may have the promoter of SCWs CESAs to regulate SCWs cellu- contributed to the evolution of both water-conducting lose biosynthesis (Wang and Dixon, 2012). OsCESA4, and supporting cells during the adaptation of plants to OsCESA7 and OsCESA9 are responsible for secondary land (Xu et al., 2014). In Arabidopsis, SWNs can origin- wall cellulose biosynthesis in rice, mutation or ate entire regulation network controlling SCWs biosyn- down-regulation expression of these CESA genes results thesis, SND1 and its homologs act directly upstream of in brittle culm phenotype and reduction of the cellulose Ye et al. Rice (2018) 11:36 Page 12 of 14 content (Kotake et al., 2011; Tanaka, 2003; Zhang et al., homologs of AtSND1 in rice (Fig. 1a), they may function 2009). OsMYB61 has been reported to directly bind to as regulators to activate OsSND2 expression and initiate the promoters of CESA genes to regulate their expres- the entire SCWs biosynthetic program. OsMYB58/63, sion and cellulose biosynthesis (Huang et al., 2015). OsMYB61L and OsMYB86L act downstream of NAC29-OX, NAC31-OX and OsMYB61-OX transgenic OsSND2 (Fig. 7). We have demonstrated that plants have thick internodes, upward curved leaves, and OsMYB61L and OsMYB86L directly activate the tran- significantly increased cellulose content (Huang et al., scription of SCWs-related CESA genes (Fig. 7f). 2015). Our findings revealed the up-regulated and OsMYB58/63 was shown to directly up-regulate the ex- down-regulated expression of OsMYB61 in OsSND2-OX pression of OsCESA7 (Noda et al., 2015). Therefore, lines (Fig. 6d) and snd2 mutants (Fig. 5f), respectively. OsSND2 may act as the secondary-layer master switch Consistent with the expression level of OsMYB61, involved in the controlling of SCWs biosynthesis, thus, a up-regulation of CESA genes expression (Fig. 6d) and in- hierarchical transcriptional network similar to that of creased cellulose content were observed in OsSND2-OX Arabidopsis also exists in rice (Additional file 6: Figure lines (Fig. 6c). On the other hand, down-regulated CESA S5). These results are consistent with the previous study genes expression (Fig. 5f) and decreased cellulose con- for survey of involved in rice SCWs formation through a tent were found in snd2 mutants (Fig. 5e). Unlike co-expression network (Hirano et al., 2013). OsMYB103L, whose mutation lead to the reduction in the cellulose content and a brittle culm phenotype (Ye OsSND2 has a potential value in rice straw management et al., 2015), snd2 mutants showed normal culm and no As one of the most important staple food crops, rice obvious change in plant morphology except for lower produces huge amount of agronomic biomass residues. cellulose content and thinner sclerenchyma cell wall(Fig. The handling of biomass is a challenge for breeders, as 5b and g). These observations suggest that the function rice straws decomposition take a long time. Farmers pre- of OsSND2 may be redundant to its close homolog in fer straw burning, which is economic and convenient, rice. The contents of xylose and lignin were almost un- but may causes environmental problems. The major changed in snd2 mutants and SND2-OX plants (Add- reason underlying the difficult treatment procedure is itional file 4: Table S1). Thus, OsSND2 functions as a the high cellulose content of the cell wall of straws regulator to control SCWs cellulose biosynthesis. (Tian et al., 1992). The brittle culm (bc)ricemutants are the ideal breeds for straws treatment owing to lower Hierarchical transcriptional network regulating the SCWs cellulose content and finer breakage at harvest (Cabiles et biosynthetic program is present in rice al., 2008; Johnson et al., 2006). However, not all bc mu- In Arabidopsis, the detailed transcriptional network tants can be used for breeding because of their concomi- regulating the SCWs biosynthesis has been revealed tant phenotypes, such as dwarfism, low fertility and (Zhong and Ye, 2015). In this transcriptional network, withering of leaf apex (Zhang et al., 2009; Zhang et al., the secondary wall NAC families (SWNs) function as the 2010; Zhou et al., 2009). Mutations in OsMYB103L, a TF top-layer master switches to regulate a battery of down- regulating SCWs-related genes expression, lead to the de- stream transcription factors, including SND2, SND3, creased cellulose content and brittle culm phenotype MYB20, MYB42, MYB46, MYB83 and MYB103 to start without morphological abnormalities (Ye et al., 2015). We the entire SCWs biosynthetic program (Zhong et al., have demonstrated that OsSND2 can regulate MYBsand 2008). MYB46 and MYB83 function as the regulators of SCWs CESA genes expression (Figs. 5f, 6d and 7a), and the secondary-layer and regulate the expression of other that snd2 mutants have lower cellulose contents (Fig. 5e) MYBs and biosynthetic genes for cellulose, xylan and lig- and exhibit no change in morphology (Fig. 5d). The snd2 nin (Zhong and Ye, 2012). A few studies have investi- mutant plants exhibit a little early flowering may be gated the hierarchical transcriptional network regulating caused by the effects of the flowering genes expression SCWs formation in rice. We demonstrated that OsSND2 (Fig. 5d), but show normal morphology. Hence, snd2 mu- functions as a regulator to control the expression of tants have the potential value for rice straws management. MYBs (Fig. 7a), which can further activate the SCWs CESA genes expression. Furthermore, we proved that Conclusion AtSND2 (At4g28500) can bind to the promoter of In this study, OsSND2 was identified as a positive regula- AtMYB61 (At1g09540) in yeast one-hybrid assay (Add- tor of cellulose biosynthesis in rice. Increasing the ex- itional file 5: Figure S4). This result suggests the conser- pression level of this gene can improve the SCWs vation of the regulatory mechanism in dicot and cellulose content, but the content of xylose and lignin monocot plants. In Arabidopsis, AtSND2 acts down- were not affected. Therefore, study the function of stream of AtSND1 and its close homologs (Zhong et al., OsSND2 can provide a strategy for manipulating plant 2008). As OsSWN1 and OsSWN2/OsNAC29 are close biomass production. Ye et al. Rice (2018) 11:36 Page 13 of 14 Additional files Ethics approval and consent to participate Not applicable. Additional file 1: Figure S1. Yeast one-hybrid screening using different fragments of OsMYB61 promoter as baits. a, Diagram of OsMYB61 with Competing interests five different fragments using for bait constructs. b, Diagram of bait The authors declare that they have no competing interests. construct in yeast one-hybrid screening. c, Self-activation test of five different bait constructs. The transformants harbouring the different bait construct were streaked onto SD-Trp, His media in the presence of 0 mM, Publisher’sNote 10 mM, 30 mM and 50 mM 3-aminotriazole (3-AT) to determine growth. Springer Nature remains neutral with regard to jurisdictional claims in published (TIF 2102 kb) maps and institutional affiliations. Additional file 2: Figure S2. OsSND2 binds to the SNBE sites in the OsMYB61promoter. a, Diagram of OsMYB61 promoter containing two Author details SNBE sites. Dark brown boxes indicate the SNBE elements. The DNA Institute of Technical Biology and Agricultural Engineering, Hefei Institutes sequences containing the SNBE sites (the red bases) were subjected to of Physical Science, Chinese Academy of Sciences, Hefei, Anhui 230031, the EMSA assay. b, EMSA assay showing that the recombinant OsSND2 People’s Republic of China. Key Laboratory of High Magnetic Field and Ion protein directly bound to the biotin-labeled sequence containing SNBE2 Beam Physical Biology, Hefei Institutes of Physical Science, Chinese Academy site. (TIF 1061 kb) of Sciences, Hefei, Anhui 230031, People’s Republic of China. State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics Additional file 3: Figure S3. Expression pattern of OsMYB61. qRT-PCR and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, analysis of OsMYB61 expression in various rice organs and different China. developmental stage, the heading stage and seedling stage indicate the tenth day after flowering and the two weeks old seedlings, respectively. Received: 1 March 2018 Accepted: 23 May 2018 The Actin1 gene was used as an internal control. Error bars, SD of three biological replicates. (TIF 1176 kb) Additional file 4: Table S1. Composition analysis of sugar and lignin content of wall residues of the internodes from wild type and transgenic References rice plants. (DOC 30 kb) Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu Rev Plant Biol 54: 519–546 Additional file 5:: Figure S4. AtSND2 directly binds to the promoter of Burton RA, Fincher GB (2014) Plant cell wall engineering: applications in biofuel AtMYB61. Yeast one-hybrid assay showing the activity of LacZ reporters production and improved human health. Curr Opin Biotechnol 26:79–84 driven by AtMYB61 promoter (2 kb length sequence from the start codon) Cabiles DMS, Angeles OR, Johnson-Beebout SE, Sanchez PB, Buresh RJ (2008) and activated by AtSND2 fused with activation domain (AD). The empty Faster residue decomposition of brittle stem rice mutant due to finer pB42AD and pLacZi were used as negative control. (TIF 331 kb) breakage during threshing. Soil Tillage Res 98:211–216 Additional file 6:: Figure S5. The transcriptional regulatory model of Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi M, Tran LS, SCW formation in rice. Arrows indicate transcriptional activation, whereas Yamaguchi-Shinozaki K, Shinozaki K (2004) A dehydration-induced NAC flat-ended arrows indicate transcriptional repression. Solid arrows indicate protein, RD26, is involved in a novel ABA-dependent stress-signaling direct transcriptional activation. Dashed arrows indicate indirect transcriptional pathway. Plant J 39:863–876 activation. (TIF 136 kb) Hegedus D, Yu M, Baldwin D, Gruber M, Sharpe A, Parkin I, Whitwill S, Lydiate D (2003) Molecular characterization of Brassica napus NAC domain transcriptional activators induced in response to biotic and abiotic stress. Acknowledgements Plant Mol Biol 53:383–397 We are thankful to Dr. Jinhua Wu for critical comments on the manuscript, Hirano K, Aya K, Morinaka Y, Nagamatsu S, Sato Y, Antonio BA, Namiki N, Dr. Xiangbin Chen for providing the Chromatin immunoprecipitation (ChIP) Nagamura Y, Matsuoka M (2013) Survey of genes involved in rice secondary protocol, We also thank the Innovative Academy of Seed Design, Chinese cell wall formation through a co-expression network. Plant Cell Physiol 54: Academy of Sciences. 1803–1821 Huang D, Wang S, Zhang B, Shang-Guan K, Shi Y, Zhang D, Liu X, Wu K, Xu Z, Fu X, Zhou Y (2015) A gibberellin-mediated DELLA-NAC signaling Cascade regulates Funding cellulose synthesis in Rice. Plant Cell 27:1681–1696 This work was supported by grants from the National Natural Science Foundation Hussey SG, Mizrachi E, Creux NM, Myburg AA (2013) Navigating the of China (Grant 31701330), the Technology Service Network Initiative of Chinese transcriptional roadmap regulating plant secondary cell wall deposition. Academy of Sciences (KFJ-STS-QYZD-020, KFJ-STS-ZDTP-002), the Strategic Priority Front Plant Sci 4:325 Research Program of the Chinese Academy of Sciences (Grant XDA08040107) and Johnson SE, Angeles OR, Brar DS, Buresh RJ (2006) Faster anaerobic the State Key Laboratory of Plant Cell and Chromosome Engineering decomposition of a brittle straw rice mutant: implications for residue (PCCE-KF-2017-04). management. Soil Biol Biochem 38:1880–1892 Keegstra K (2010) Plant cell walls. Plant Physiol 154:483–486 Kotake T, Aohara T, Hirano K, Sato A, Kaneko Y, Tsumuraya Y, Takatsuji H, Availability of data and materials Kawasaki S (2011) Rice brittle culm 6 encodes a dominant-negative form of All data supporting the conclusions of this article are provided within the CesA protein that perturbs cellulose synthesis in secondary cell walls. J Exp article and its additional files (Additional file 1: Figure S1, Additional file 2: Bot 62:2053–2062 Figure S2, Additional file 3: Figure S3, Additional file 5:FigureS4, and Kumar M, Campbell L, Turner S (2016) Secondary cell walls: biosynthesis and Additional file 6:FigureS5). manipulation. J Exp Bot 67:515–531 Li M, Xiong G, Li R, Cui J, Tang D, Zhang B, Pauly M, Cheng Z, Zhou Y (2009) Rice Authors’ contributions cellulose synthase-like D4 is essential for normal cell-wall biosynthesis and YW, BL and XF together designed the experiments. YY and BL performed plant growth. Plant J 60:1055–1069 most of the experiments and wrote the manuscript. BL analyzed motifs in Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, promoter regions and performed the Ch-IP analysis. YY and KW performed Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG the yeast one hybrid screening. KW and QL performed the EMSA and yeast (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex one hybrid analysis. JC performed the subcellular localization of OsSND2 and genome editing in monocot and dicot plants. Mol Plant 8:1274–1284 transactivation analysis. All authors have discussed the results and contributed McCarthy RL, Zhong R, Ye ZH (2009) MYB83 is a direct target of SND1 and acts to the drafting of the manuscript. All authors read and approved the final redundantly with MYB46 in the regulation of secondary cell wall biosynthesis manuscript. in Arabidopsis. Plant Cell Physiol 50:1950–1964 Ye et al. Rice (2018) 11:36 Page 14 of 14 McCarthy RL, Zhong R, Ye Z-H (2014) Secondary wall NAC binding element Xu B, Ohtani M, Yamaguchi M, Toyooka K, Wakazaki M, Sato M, Kubo M, Nakano (SNBE), a key cis-acting element required for target gene activation by Y, Sano R, Hiwatashi Y, Murata T, Kurata T, Yoneda A, Kato K, Hasebe M, secondary wall NAC master switches. Plant Signal Behav 6:1282–1285 Demura T (2014) Contribution of NAC transcription factors to plant Noda S, Koshiba T, Hattori T, Yamaguchi M, Suzuki S, Umezawa T (2015) The adaptation to land. Science 343:1505–1508 expression of a rice secondary wall-specific cellulose synthase gene, Ye Y, Liu B, Zhao M, Wu K, Cheng W, Chen X, Liu Q, Liu Z, Fu X, Wu Y (2015) OsCesA7, is directly regulated by a rice transcription factor, OsMYB58/63. CEF1/OsMYB103L is involved in GA-mediated regulation of secondary wall Planta 242:589–600 biosynthesis in rice. Plant Mol Biol 89:385–401 Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, Ooka H, Kikuchi Zhang B, Deng L, Qian Q, Xiong G, Zeng D, Li R, Guo L, Li J, Zhou Y (2009) A S (2010) Genome-wide analysis of NAC transcription factor family in rice. missense mutation in the transmembrane domain of CESA4 affects protein Gene 465:30–44 abundance in the plasma membrane and results in abnormal cell wall biosynthesis in rice. Plant Mol Biol 71:509–524 Ohta M, Ohme-Takagi M, Shinshi H (2000) Three ethylene-responsive transcription Zhang M, Zhang B, Qian Q, Yu Y, Li R, Zhang J, Liu X, Zeng D, Li J, Zhou Y (2010) factors in tobacco with distinct transactivation functions. Plant J 22:29–38 Brittle culm 12, a dual-targeting kinesin-4 protein, controls cell-cycle Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors: progression and wall properties in rice. Plant J 63:312–328 structurally distinct, functionally diverse. Trends Plant Sci 10:79–87 Zhong R, Lee C, Ye ZH (2010) Global analysis of direct targets of secondary wall Pauly M, Gille S, Liu L, Mansoori N, de Souza A, Schultink A, Xiong G (2013) NAC master switches in Arabidopsis. Mol Plant 3:1087–1103 Hemicellulose biosynthesis. Planta 238:627–642 Zhong R, Lee C, Zhou J, McCarthy RL, Ye ZH (2008) A battery of transcription Raineri D, Bottino P, Gordon M, Nester E (1990) Agrobacterium–mediated factors involved in the regulation of secondary cell wall biosynthesis in transformation of Rice (Oryza sativa L.). Nat Biotechnol 8:33–38 Arabidopsis. Plant Cell 20:2763–2782 Somerville C (2006) Cellulose synthesis in higher plants. Annu Rev Cell Dev Biol Zhong R, Richardson EA, Ye ZH (2007) The MYB46 transcription factor is a direct 22:53–78 target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. Song XQ, Liu LF, Jiang YJ, Zhang BC, Gao YP, Liu XL, Lin QS, Ling HQ, Zhou YH Plant Cell 19:2776–2792 (2013) Disruption of secondary wall cellulose biosynthesis alters cadmium Zhong R, Ye ZH (2012) MYB46 and MYB83 bind to the SMRE sites and directly translocation and tolerance in rice plants. Mol Plant 6:768–780 activate a suite of transcription factors and secondary wall biosynthetic Szyjanowicz PM, McKinnon I, Taylor NG, Gardiner J, Jarvis MC, Turner SR (2004) genes. Plant Cell Physiol 53:368–380 The irregular xylem 2 mutant is an allele of korrigan that affects the Zhong R, Ye ZH (2015) Secondary cell walls: biosynthesis, patterned deposition secondary cell wall of Arabidopsis thaliana. Plant J 37:730–740 and transcriptional regulation. Plant Cell Physiol 56:195–214 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular Zhou Y, Li S, Qian Q, Zeng D, Zhang M, Guo L, Liu X, Zhang B, Deng L, Liu X, Luo evolutionary genetics analysis using maximum likelihood, evolutionary distance, G, Wang X, Li J (2009) BC10, a DUF266-containing and Golgi-located type II and maximum parsimony methods. Mol Biol Evol 28:2731–2739 membrane protein, is required for cell-wall biosynthesis in rice (Oryza sativa Tanaka K (2003) Three distinct Rice cellulose synthase catalytic subunit genes L.). Plant J 57:446–462 required for cellulose synthesis in the secondary wall. Plant Physiol 133:73–83 Taylor NG, Howells RM, Huttly AK, Vickers K, Turner SR (2003) Interactions among three distinct CesA proteins essential for cellulose synthesis. Proc Natl Acad Sci U S A 100:1450–1455 Taylor NG, Laurie S, Turner SR (2000) Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis. Plant Cell 12:2529–2540 Taylor NG, Scheible WR, Cutler S, Somerville CR, Turner SR (1999) The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis. Plant Cell 11:769–780 Tenhaken R (2014) Cell wall remodeling under abiotic stress. Front Plant Sci 5:771 Tian G, Kang B, Brussaard L (1992) Biological effects of plant residues with contrasting chemical compositions under humid tropical conditions—decomposition and nutrient release. Soil Biol Biochem 24:1051–1060 Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16:2481–2498 Underwood W (2012) The plant cell wall: a dynamic barrier against pathogen invasion. Front Plant Sci 3:85 Updegraff DM (1969) Semimicro determination of cellulose inbiological materials. Anal Biochem 32:420–424 Wadsworth GJ, Redinbaugh MG, Scandalios JG (1988) A procedure for the small- scale isolation of plant RNA suitable for RNA blot analysis. Anal Biochem 172: 279–283 Wang HZ, Dixon RA (2012) On-off switches for secondary cell wall biosynthesis. Mol Plant 5:297–303 Wang S, Li S, Liu Q, Wu K, Zhang J, Wang S, Wang Y, Chen X, Zhang Y, Gao C, Wang F, Huang H, Fu X (2015) The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality. Nat Genet 47:949–954 Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, Zhang G, Fu X (2012) Control of grain size, shape and quality by OsSPL16 in rice. Nat Genet 44:950–954 Wu B, Zhang B, Dai Y, Zhang L, Shang-Guan K, Peng Y, Zhou Y, Zhu Z (2012) Brittle culm15 encodes a membrane-associated chitinase-like protein required for cellulose biosynthesis in rice. Plant Physiol 159:1440–1452 Xiong G, Li R, Qian Q, Song X, Liu X, Yu Y, Zeng D, Wan J, Li J, Zhou Y (2010) The rice dynamin-related protein DRP2B mediates membrane trafficking, and thereby plays a critical role in secondary cell wall cellulose biosynthesis. Plant J 64:56–70

Journal

Rice – Springer Journals

Published: May 31, 2018

There are no references for this article.