OSMR gene effect on the pathogenesis of chronic autoimmune Urticaria via the JAK/STAT3 pathway

OSMR gene effect on the pathogenesis of chronic autoimmune Urticaria via the JAK/STAT3 pathway Background: Chronic autoimmune urticaria (CAU) is a common skin disease and remains unclear understanding of pathogenesis in the vast majority of cases. In order to explore a new therapy for CAU, the current study was performed to investigate the possible functioning of the Oncostatin M receptor (OSMR) gene in the autoimmunity of CAU via regulation of the JAK/STAT3 signaling pathway. Methods: CAU skin tissues from 24 CAU patients and normal skin tissues from normal subjects were collected. Hematoxylin-eosin (HE) staining was conducted to count eosinophils, and immunohistochemistry was carried out to detect the positive rate of OSMR expression in two kinds of skin tissues. A total of 72 Kunming (KM) mice were selected, and 60 mice were used for establishing CAU models and later transfected with different plasmids. The expression of inflammatory factors was evaluated by enzyme-linked immunosorbent assays (ELISA). Expressions of janus kinase (JAK), signal transducer and activator of transcription 3 (STAT3), interferon-stimulated gene 15 (ISG15), CT10-regulated kinase (CRK), and interferon regulatory factor 9 (IRF9) were identified using Western blot assay and reverse transcription quantitative polymerase chain reaction (RT-qPCR). Epithelial cell proliferation was assessed by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay, and cell cycle distribution and cell apoptosis were assessed using flow cytometry. Results: The findings confirm that OSMR protein expression and histamine release rate are highly elevated in human CAU skin tissues, and the expression of the JAK/STAT3 signaling pathway-related genes (OSMR, JAK2, STAT3, ISG15, CRK and IRF9) was up-regulated. OSMR gene silencing in CAU mice significantly decreases the content of inflammatory factors (IL-1, IL-6, IFN-γ, and IgE), the number of eosinophils, and reduces the expression of the JAK/ STAT3 signaling pathway related genes, and further enhances cell proliferation, promotes cell cycle entry and inhibits apoptosis of epithelial cells. Conclusion: All aforementioned results indicate that OSMR gene silencing inhibits the activation of the JAK/STAT3 signaling pathway, thereby suppressing the development of CAU. Keywords: OSMR gene, JAK/STAT3 signaling pathway, Chronic autoimmune urticaria, Pathogenesis, Autoimmunity * Correspondence: huawang@hospital.cqmu.edu.cn Department of Dermatology, Children’s Hospital of Chongqing Medical University, Chongqing 400014, China Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing 400014, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Luo et al. Molecular Medicine (2018) 24:28 Page 2 of 13 Background pathogenesis of chronic dermatitis, atopic dermatitis and Chronic urticaria (CU), an immune-mediated inflamma- psoriasis, and JAK inhibitors are thus promising thera- tory disease, is defined as the spontaneous or inducible ap- peutic candidates for chronic dermatitis (Tanimoto et al., pearance of hives, angioedema or both lasting at least 6 2018). Additionally, JAK inhibitors, which are also used to weeks and presenting with numerous subtypes, all greatly inhibit cytokine signaling, are assumed to be a possible damage patients’ quality of life (Bingham 3rd, 2008; mean of treating skin inflammatory disorders such as con- Gimenez-Arnau et al., 2015). CU, the potentially debilitat- tact dermatitis (Amano et al., 2016). It has been reported ing skin condition, is known to affect up to 1% of the gen- that OSM is released in inflammatory conditions, and it eral population with different durations, usually several signals primarily via the JAK/STAT pathway by combining months, but occasionally decades (Ventura et al., 2013). with its receptor complex (Hermanns, 2015). The hetero- Chronic idiopathic urticaria (CIU) is a common type of dimeric receptor complex combined with gp130 and CU accounting for over 70% cases of CU, and chronic OSMR could activate a signaling pathway involved in autoimmune urticaria (CAU), a subgroup of CIU, ac- JAKs as well as transcription factors of the STAT family counts for more than 30% of CIU. CIU is characterized by (Hintzen et al., 2008). However, further verification is re- severe and persistent wheals accompanied by redness and quired in order to explore whether the OSMR gene is in- itching (Goh & Tan, 2009; Abd El-Azim & Abd, 2011). volved in the pathogenesis of CAU through the JAK/ CAU is caused by anti-FcepsilonRI and less normally, by STAT3 signaling pathway. Therefore, the current study anti-IgE autoantibodies that result in the activation of aims to explore the role of OSMR gene silencing in the mast cells and basophils (Goh & Tan, 2009). Currently, pathogenesis of CAU and its underlying mechanism in- clinical suspicion and autologous serum skin test (ASST) volving the JAK/STAT3 signaling pathway. are regarded as the basis of CAU diagnosis (Abd El-Azim &Abd, 2011). Previously, the role of omalizumab in treat- Methods ing refractory CAU patients was studied, and proven pos- Ethics statement sible (Al-Ahmad, 2010). In addition, mizoribine was found This study was approved by the Ethics Committee of to be an effective therapy in some CAU patients, and may Children’s Hospital of Chongqing Medical University, possibly be effective for patients not responsive to trad- and signed informed consents were obtained from all itional therapy (Hashimoto et al., 2012). CAU patients are patients/guardians. In addition, the experiments were in poor responders to antihistamine therapy, which leads to accordance with the ethical standards, and all efforts the necessity of immunosuppressive therapy (Cherrez were made to minimize the suffering of the animals in- Ojeda et al., 2009). Therefore, new genetic methods are re- cluded in the study. quired to find the possible ways for the treatment of CAU. Oncostatin M (OSM), a member of the interleukin 6 Study subjects (IL-6) family of cytokines, plays important roles in vari- CAU skin tissues from 24 CAU patients of Children’s ous biological functions, including inflammatory re- Hospital of Chongqing Medical University were col- sponses and metabolic diseases (Komori et al., 2013). lected, and normal skin tissues from skin grafts of 24 OSM secreted by skin-infiltrating T-lymphocytes is con- plastic surgery patients were selected as controls. Skin sidered to be a potential keratinocyte activator correlated biopsy specimens were rapidly frozen in liquid nitrogen to skin inflammation (Boniface et al., 2007). Oncostatin in order to prevent protein denaturation until total RNA M receptor (OSMR) gene is located at 5p13.1, and can was extracted from the specimens. The 24 CAU patients bind to gp130 to mediate the biological functions of included 11 males and 13 females, with a mean age of OSM (Hong et al., 2011;Deng etal., 2009). Therapies 10 years. The average courses of disease of patients were based on OSMR have been reported for treatment of vari- 6.67 months (range 2–16 months). All patients had been ous cancers including cervical squamous cell carcinoma treated with antihistaminic agents, and some patients and lung adenocarcinomas, as well as skin diseases such as underwent treatment with corticosteroids but with poor familial primary localized cutaneous amyloidosis (Caffarel efficacy, for 16 of them complained of joint pain, gastro- & Coleman, 2014;Chenetal., 2008; Arita et al., 2008). intestinal or respiratory symptoms. Janus kinase-signal transducer and activator of transcrip- tion (JAK/STAT) transmits information received from Hematoxylin-eosin (HE) staining extracellular polypeptide signals through transmembrane Skin tissues extracted from CAU patients were fixed in receptors, directly to the target gene promoters in the 4% paraformaldehyde for 24 h, washed, dehydrated, nucleus, providing a mechanism for regulation of tran- cleared, waxed, embedded, sectioned, and made into scriptional without second messengers (Aaronson & Hor- paraffin sections. After that, the sections were stained vath, 2002). JAKs are required for numerous inflammatory with hematoxylin for observing the eosinophil infiltra- cytokine signaling pathways, and are implicated in the tion in skin tissue of patients. Luo et al. Molecular Medicine (2018) 24:28 Page 3 of 13 Immunohistochemistry number and total duration of pruritus in each mouse was The sections underwent routine dewaxing, dehydration recorded within 30 min of the 1 mL dextran injections with gradient ethanol, antigen-repair under high pres- through the tail vein. The CAU mouse model was consid- sure for 1.5 min, and cooling under tap water for ered to be successfully established if the number and total 10 min. After the remaining tap water on the sections duration of pruritus were significantly higher than the was removed under running water, the sections were normal mice (Yagami et al., 2017). A total of 60 mice added one drop of endogenous peroxidase blocking so- were successfully established as CAU models which lution, incubated at room temperature for 10 min, and were classified into: the blank group (model mice without rinsed with phosphate buffer solution (PBS) (3 min, 3 any treatment), the negative control group (NC) (model times). Then, the sections were added with suitable mice transfected with empty vector plasmid), the OSMR- amount of primary antibody, namely rabbit anti human siRNA group (model mice transfected with OSMR-siRNA immunoglobulin G (IgG) antibody for incubation over- plasmid), the anti-phospho-STAT3 (Tyr705) + OSMR- night at 4 °C, followed by rinsing with PBS after being siRNA group (model mice transfected with OSMR-siRNA taken out (3 min, 3 times), and incubation with the plasmid + the JAK/STAT3 signaling pathway agonist), and biotin-labeled secondary mouse anti rabbit monoclonal the Tyr705 group (model mice treated with the JAK/ antibody IgG/horseradish peroxidase (HRP) (dilution ra- STAT3 signaling pathway agonist) groups. The plasmids tio of 1: 1000, ab6759, Abcam, Inc., Cambridge, MA, used in the experiments were purchased from Vigene Bio- USA) at 37 °C for 30 min. After incubation with the two technology Co., Ltd. (Shandong, China). Then, attention types of antibodies, the sections were rinsed with PBS was paid to the number and total duration of pruritus (3 min, 3 times), dealt by streptomyces anti biotin catalase within 30 min. The mice were sacrificed after successful complex for 15 min, colored with 3,3′-diaminobenzidine transfection with corresponding plasmids. Then, mice (DAB), and then rinsed under tap water to terminate the skin specimens with wheal or rash were extracted and whole reaction. Later, the sections were re-stained with stored at − 80 °C. Eosinophil counting was conducted by hematoxylin, dehydrated, cleared, and mounted. PBS was routine method and the absolute value was recorded. used as the negative control instead of the primary anti- body. Finally, each section was randomly photographed under a light microscope (at 10× & 40× magnification) to Isolation and culture of mast cells get 5 non-overlapping visual fields. At last, 100 cells were The foreskin of children (1–9 years) was extracted by counted in each visual field randomly, and the percentage circumcision under aseptic conditions. The skin grafts of positive cells = positive cells/total cells. were incubated in a RPMI 1640 culture medium (con- taining 100 U/mL penicillin and 100 μg/mL strepto- CAU animal model establishment mycin) after blood was removed using normal saline. A total of 72 Kunming (KM) mice weighing 18~ 25 g Subcutaneous tissues were isolated and rinsed with (J018, Better Biotechnology Co., Ltd., Nanjing, China) modified Tyrode solution (containing 137 mmol/L NaCl, were selected for the study, amongst which 60 mice were 2.7 mmol/L KCl, 0.4 mmol/L NaH PO , 5.6 mmol/L Glu- 2 4 used for the establishment of CAU mouse models, and cose, 10 mmol/L HEPES, 1 mmol/L CaCl and 1 mmol/L the other 12 untreated mice were regarded as the nor- MgCl ). Subsequently, the skin grafts were cut sliced tis- mal group. Each intraplantar of mice was treated with sue fragments of 1 mm , and placed in RPMI 1640 culture 0.05 mL 5% physiological saline solution containing ov- medium containing 1.5 mg/mL type I collagenase and albumin (the total amount of injection for a mouse was 0.5 mg/mL hyaluronidase for 4-h culturing in an in- 0.1 mL). Meanwhile, each mouse received pertussis vac- cubator containing 5% CO in air and saturated hu- cines (4 × 10 U) via intraperitoneal injections. After midity at 37 °C. Next, the fragments were isolated in 12–14 d, the mice were sacrificed by using the neck- order to a form a cell suspension by repeated blowing breaking method and blood was drawn. Mice blood was and beating of digestive juice with a straw. The sus- collected and centrifuged in order to separate the anti- pension was filtrated with a stainless steel filter net. serum, which was stored in a refrigerator for later use After removal of the tissue fragments and larger cell (mixed antisera was selected from 5 sensitized mice). With clusters, the filtrate was collected, rinsed with icy the addition of normal saline (dilution ratio of 1: 10), Tyrode solution, re-suspended in a RPMI 1640 cul- 0.03 m L antiserum was injected into the abdominal wall ture medium containing 10% fetal bovine serum (FBS) of the mice. Subsequently, antigen attack was conducted , 100 U/mL penicillin and 100 μg/mL streptomycin, by injections of 1 mL normal saline (containing 1 mg and cultured in a 5% CO incubator with saturated ovalbumin). The indications of pruritus include systemic humidity at 37 °C for 12 h. Subsequently, the culture pruritus-head scratching by paw, torso scratching by hind medium was collected after gently shaking the culture claws, and biting all parts of the body by mouth. The bottle. Luo et al. Molecular Medicine (2018) 24:28 Page 4 of 13 Histamine release test and enzyme linked indicative of highly purified RNA. Total RNA were ex- immunosorbent assay (ELISA) tracted from 100 mg skin tissues in each group using A total of 75 μL serum samples and normal serum sam- the Trizol reagent (16,096,020, Invitrogen Inc., Carlsbad, ples obtained from CAU patients and healthy individuals CA, USA) in accordance with the instructions of the were respectively mixed with 75 μL mast cell suspension, manufacturer, and PrimeScript RT Reagent kit (Fermen- and incubated at 37 °C for 20 min, followed by centrifu- tas, Maryland, NY, USA) was performed for RNA re- gation at 1610×g for 15 min, and the supernatant was serve transcription into cDNA. The reserve transcription collected which was used for evaluation of histamine re- conditions were as follows: 70 °C for 5 min, ice-bathing lease rate (the compound tube was used for aforemen- for 3 min, 37 °C for 60 min, and 95 °C for 10 min. The tioned evaluation). The histamine release rate in CAU cDNA was temporarily preserved at − 20 °C in a refriger- patients and normal individuals was determined by ator. Primers of OSMR, JAK2, STAT3, ISG15, CRK, ELISA. Firstly, the test sample and reagent kit (ZK- IRF9, and GAPDH were synthesized by Takara (Takara G7274, Zike Biotechnology Co., Ltd., Shenzhen, China) Biotechnology Co., Ltd., Liaoning China). PCR amplifi- were subjected to acylation and dilution following the cation was performed to the target genes with 25 μL re- standard and quality control in accordance with the op- action system as follows: 300 ng cDNA, 1× PCR buffer erating procedures. Then, 50 μL test serum samples solution, 200 μmol/L dNTPs, 80 pmol/L forward and re- were obtained from CAU patients and healthy individ- verse primers, 0.5 U Taq enzyme (S10118, Yuanye Bio- uals. A total of 50 μL polyclonal anti-histamine antibody, technology Co., Ltd., Shanghai, China) with the reaction enzyme conjugates and histamine antiserum were added system of pre-denaturation at 94 °C for 5 min, denatur- into each well successively, which were mixed evenly ation at 94 °C for 30 s, annealing at 54 °C for 30 s, exten- and incubated at room temperature for 3 h, followed by sion at 72 °C for 30 s, all cycles were repeated 30 times plate rinsing five times. After that, the freshly prepared with the last reaction at 72 °C for 10 and preserved at 4 °C. 200 μL 3,3′,5,5′-tetramethylbenzidine (TMB) substrate The primer sequences of OSMR, janus kinase 2 (JAK2), solution was added into each well for further incubation signal transducer and activator of transcription3(STAT3), at room temperature for 20 min, followed by plate rins- interferon-stimulated gene 15 (ISG15), CT10-regulated ing five times, and pat to dry the plate. Later, 100 μL kinase (CRK), and interferon regulatory factor 9 (IRF9), TMB stop solution was added to each well to terminate and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) the reaction, and the absorbance (A) value measured are shown in Table 1, and GAPDH was regarded as using a microplate reader at the excitation wavelength of the internal control. The relative ratio of genes be- 450 nm. Content of histamine in samples was calculated tween experimental group and control group were -ΔΔCt using a standard curve, and the formula was as follows: calculated using the 2 method with the formula as: X = A × 50/m. The histamine spontaneous release rate = ΔΔCT = ΔC - ΔCt ,among texperimental group control group histamine spontaneous release/total histamine content × which ΔCt = Ct –Ct (Denley et al., 2013). Ct is OSMR GAPDH 100%, and histamine release rate of samples = histamine the amplification cycle number when real time content/total histamine content × 100%. Interleukin-1 fluorescence intensity reached the set threshold. At such (IL-1) ELISA kit (SBJ-M0582), IL-6 ELISA kit (SBJ- time, the amplification was in logarithmic phase of growth M0044), interferon (IFN)-γ ELISA kit (SBJ-M0038), IgE and the experiment was performed in triplicate. ELISA kit (SBJ-M0499) were used to measure the con- tents of IL-1, IL-6, IFN-γ and IgE according to the pro- Western blot analysis tocols provided by the manufacturer. All the kits were Skin tissues (100 mg) of each group were extracted, purchased from Nanjing SenBeiJia Biological Technol- placed in a glass grinder containing 1 mL tissue lysate ogy Co., Ltd. (Nanjing, Jiangsu, China). (BB-3209, Bestbio Technology, Co., Ltd., Shanghai, China), and were ground to a homogenate by ice-bath, Reverse transcription quantitative polymerase chain where after protein lysate was added in for tissue split- reaction (RT-qPCR) ting at 4 °C for 30 min, centrifuged at 1610×g, 4 °C for Skin tissues (100 mg) were collected from mice in each 15 min, and the supernatant was collected. A bicincho- group, placed into a glass grinder and added with 1 mL ninic acid (BCA) kit (2020ES76, Yeasen Company, tissue lysate (BB-3209, Bestbio Technology, Co., Ltd., Shanghai, China) was employed in order to detect the Shanghai, China), ground to an even homogenate by ice- concentration of each tissue samples. Firstly, deionized bath, and placed on a nucleic acid protein analyzer (Bio- water was added to adjust the sample quantity of 30 μg Photometer D30, Eppendorf, Hamburg, Germany) for protein lane. Then, 10% sodium dodecyl sulfate (SDS) the detection of absorbance ratio and RNA concentra- separating glue and concentration glue was prepared. tion. The results of optical density (OD) value at The sample tissues were mixed with the sample buffer, 260 nm/ that at 280 nm placed between 1.8~ 2.0 is heated to a boil for 5 min, ice-bathed, centrifuged before Luo et al. Molecular Medicine (2018) 24:28 Page 5 of 13 Table 1 RT-qPCR primer sequences 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium bromide (MTT) assay Genes Sequences Skin tissues were extracted from mice in order to obtain OSMR F: 5’-AGAAACTGGCACACCATCCT-3′ keratinocytes after detachment, isolation and culture. R: 5’-ACTGCCCTAATGACCAGTGC-3′ The cells were allowed to reach around 80% confluence, STAT3 F: 5’-GCCACGTTGGTGTTTCATAATC-3′ and were rinsed with PBS two times, and detached by R: 5’-TTCGAAGGTTGTGCTGATAGAG-3′ trypsin in order to prepare a single cell suspension. After JAK2 F: 5’-TGCTGTCCAGACAAGAATGC-3′ counting, the cells were seeded into a 96-well plate at a 3 3 R: 5’-TCCTTCTCTGCCAACGTCTT-3′ density of 3 × 10 ~6×10 cells/well, with the cell volume in each well maintained to 0.2 mL. A total of 6 duplicate ISG15 F: 5’-CACAGTCCTGCTGGTGG-3′ wells were set, and the cells were cultured in an incubator. R: 5’-GGCGATACTGCGACCCT − 3′ At the 30 min, 1 h, 6 h, 12 h, 24 h, and 48 h time periods CRK F: 5’-GGCAGGGTAGTGGAGTGAT-3′ during the incubation, the culture plate was taken out and R: 5’-AGGCTGTCTTGTCGTAGGC-3′ the original culture medium was replaced with 5 g/L 10% IRF9 F: 5’-TGCTTCCTCCAGAGCCAGAC-3′ MTT solution (GD-Y1317, Guduo Biotechnology Co., Ltd., R: 5’-CACAAGGCGGCAATCCAG-3’ Shanghai, China) for further 4-h incubation. Later, 100 μL dimethyl sulphoxide (DMSO) (D5879-100ML, Sigma- GAPDH F: CCACCCATGGCAAATTCCATGGCA Aldrich Chemical Company, St Louis, MO, USA) were R: TCTAGACGGCAGGTCAGGTCCAC added in, and gently oscillated for uniform mixing for RT-qPCR reverse transcription quantitative polymerase chain reaction, OSMR 10 min. After formazan crystals produced by living cells oncostatin M receptor, STAT3 signal transducer and activator of transcription 3, JAK2 janus kinase 2, ISG15 interferon-stimulated gene 15, CRK CT10-regulated were dissolved with DMSO, the cell plate was placed onto kinase, IRF9 interferon regulatory factor 9, GAPDH glyceraldehyde-3-phosphate a microplate reader for detecting the OD value of each well dehydrogenase, F forward, R reverse at the excitation wavelength of 490 nm. The experiment being added into each lane with a micropipette for lectro- was repeated three times and the time point was set as the phoretic separation. After that, the proteins on the mem- abscissa and the OD value as the ordinate in order to plot brane were transferred onto a nitrocellulose membrane the CAU cell activity graph. (ZY-160FP, Zeye Biology, Shanghai, China), blocked with 5% skimmed power at 4 °C overnight. Later, diluted Scratch test primary antibody, namely rabbit anti human polyclonal The mouse keratinocytes in the logarithmic phase of antibodies (dilution ratio of 1: 500), including OSMR growth were selected, and isolated and cultured for 48 h. (11226-R007, dilution ratio of 1: 400, Sino Biological Inc., The cells were seeded in a 6-well plate at a density of Beijing, China), JAK2 (ab32101, dilution ratio of 1: 1000, 1×10 cells in each well and cultured in a 5% CO Abcam Inc., Cambridge, MA, USA), STAT3 (ab68153, di- incubator at 37 °C until cell confluence reached 95%. lution ratio of 1: 1000, Abcam Inc., Cambridge, MA, Then, a vertical linear scratch was drawn using a 20 μl USA), ISG15 (LS-C211809, dilution ratio of 1: 1000, Lit- micropipette, and then serum-free medium was added tleton, Colorado, USA), IRF9 (PAB28499, dilution ratio of to the wells after the 6-well plate was washed with D- 1: 400, Lianshuo Biological Technology, Wuhan, Hubei, hanks solution. Sample cells were collected after scratch- China) and p-STAT3 (sc-56,747, Univ-bio, Shanghai, ing at 0 h and 36 h time periods with 3 visual fields at China) were added into the membrane for overnight 100X magnification were photographed under a phase incubation, followed by rinsing with PBS (5 mins, 3 contrast microscope in order to compare the different times). The secondary antibody mouse anti rabbit scratch lanes. The healing rate of the scratch line was IgG/HRP (Huabio Inc., Hangzhou, Zhejiang, China) regarded as the cell migration and healing ability. was added for rocking incubation at 37 °C for 1 h, followed by rinsing with PBS at room temperature (5 Flow cytometry mins, 3 times). At room temperature, the membrane The mouse keratinocytes were collected for detachment was reacted with enhanced chemiluminescence (ECL) with 0.25% trypsin solution after isolation and culture solution for 1 min, after which the membrane was for 48 h. The number of cell samples was adjusted to 6 − 1 amounted using cling-film with the liquid removed, 1×10 mL . Then, 1 mL cells were centrifuged at and observed under an X-ray instrument (36209ES01, 402×g for 10 min with the supernatant discarded and Qianchen Bioteachnology, Shanghai, China). GAPDH the cells collected. Per mL of the collected cells were was regarded as the internal reference, and the grey added with 2 mL PBS before undergoing centrifugation. value ratio of target band and GAPDH band was The supernatant was discarded, and the cells were fixed taken as the relative expression of sample protein. with 70% pre-cooled ethanol solution at 4 °C overnight. Each experiment was conducted three times. The following day, the fixed cells were rinsed with PBS Luo et al. Molecular Medicine (2018) 24:28 Page 6 of 13 two times, and a cell suspension of 100 μL (containing using one-way analysis of variance (ANOVA). p <0.05 6 − 1 more than 10 mL ) was selected, added with 1 mL was considered to be statistically significant. 50 mg/L propidium iodide (PI) solution (containing RNAase) for 30-min incubation avoiding light exposure. Results After that, the cells were filtered with nylon net (300 Elevated histamine releasing rate in CAU model mice mesh), and the cell cycle was analyzed using flow cytom- signifies the successful model establishing etry at an excitation wavelength of 488 nm. In order to observe the histopathological changes of skin Cell apoptosis was assessed using the Annexin V- tissues after the occurrence of CAU, 24 CAU patients fluorescein isothiocyanate (FITC)/PI double staining, and 12 model mice (blank group) were recruited in the and the cells were underwent the same process of cell current study. As shown in Fig. 1a, all CAU specimens cycle. The cells were cultured at 37 °C in an incubator exhibited vasodilation, mild dermal edema and a perivas- containing 5% CO in air, and then were collected. After cular or interstitial infiltrate composed of neutrophils, rinsing with PBS two times, the cells were centrifuged eosinophil and lymphocyte, while there were no telangi- and re-suspended in 200 μL binding buffer, followed by ectasia and congestion in addition to lymphocytic and the addition of fully-mixed 10 μL Annexin V-FITC and eosinophil infiltration around the dermal vessels in nor- 5 μL PI for 15-min reaction avoiding light exposure at mal tissues. The observation results of skin tissues ob- room temperature. Later, the cells were added with tained from CAU mice were in accordance with the 300 μL binding buffer and placed onto the flow cytome- aforementioned findings (Fig. 1b). try (6HT, Cellwar Bio-technology Co., Ltd., Wuhan, According to results of the histamine releasing by Hubei, China) for cell apoptosis detection at the excita- mast cells, the release rates of histamine by normal hu- tion wavelength of 488 nm. man serum activated mast cells were all negative, while 10 positive cases and 14 negative cases of histamine re- Statistical analysis lease out of human CAU serum were observed with the Statistical analyses were performed using the SPSS 22.0 release rate of (21.35 ± 8.40)% which was higher than software (IBM Corp. Armonk, NY, USA). Measurement the normal subjects (9.08 ± 3.42)% (p < 0.05) (Fig. 1c). In data were expressed as mean ± standard deviation. Differ- CAU model mice, CAU mice with no transfection had a ences between two groups were compared using the t test, histamine release rate of (26 ± 5.20)% compared with nor- and differences among multiple groups were analyzed mal mice which was (8.16 ± 4.28)%, signifying a highly a b 50 µm 50 µm 50 µm 50 µm Normal Chronic Urticaria Normal Chronic Urticaria c d 30 * 6 7 0 0 Normal Chronic Urticaria Normal Chronic Urticaria Fig. 1 Deteriorated pathological changes and elevated histamine release rate in CAU revealed by HE staining and Histamine Release (× 200). Note: a normal skin tissues and CAU tissues in patients with CAU after HE staining, with the red arrows indicating towards the dermal vascular wall and the surrounding neutrophils and eosinophil infiltration (× 200); b normal skin tissues and CAU tissues in CAU mice after HE staining, with the red arrows indicating towards the dermal vascular wall and the surrounding neutrophils and eosinophil infiltration, and the blue arrow indicating towards the small amount of lymphocytic infiltration surrounding the dermal vascular wall (× 200); c histamine release experiment of human serum activated mast cells (n = 24); d histamine release experiment of mice serum activated mast cells in normal and CAU tissues (n = 12); *, p < 0.05 compared with the normal group; CAU, chronic autoimmune urticaria; HE, hematoxylin-eosin Histamine release rate (%) Histamine release rate (%) Luo et al. Molecular Medicine (2018) 24:28 Page 7 of 13 increased histamine release rate in CAU model mice and STAT3 signaling pathway-related genes, including JAK2, successful establishment of CAU models (Fig. 1d). STAT3, ISG15, CRK and IRF9, were evidently elevated in CAU skin tissues (p < 0.05), and the same was con- Higher OSMR positive expression rate and elevated firmed by the Western blot analysis (p < 0.05) (Fig. 2d). expression of the JAK/STAT3 signaling pathway-related All aforementioned findings indicate that CAU exhibits genes in CAU skin tissues increased expression of OSMR and the activated JAK/ In order to better investigate the expression of OSMR in STAT3 signaling pathway. CAU skin tissues, CAU and normal skin tissues were ob- served under the light microscope. The findings indicate Inhibited expression of CAU inflammatory factors as a that OSMR positive cells were primarily located in the result of OSMR silencing superficial and middle dermis, surrounding the blood The ELISA assay was employed to determine the levels vessels and appendages in CAU skin tissues, with the of inflammatory factors such as IL-1, IL-6 and IFN-γ in positive granule largely located inside the epithelial cells. CAU skin tissues. As shown in Fig. 3a, the inflammatory The OSMR positive expression rate in CAU skin tissues factors were found to be increased in CAU skin tissues. was 34.00%. However, a relatively small number of Mice models with different vectors transfection were OSMR positive cells were observed in normal skin tis- established in order to testify the function of OSMR. Re- sues with an OSMR positive expression rate of 8.50%, sults of the ELISA assay (Fig. 3b) show that compared indicating that the OSMR positive expression rate in with the normal skin tissues, CAU tissues with no trans- CAU skin tissues was significantly higher than normal fection and transfected with blank plasmids exhibited in- skin tissues (p < 0.05) (Fig. 2a, b). creased levels of IL-1, IL-6 and IFN-γ. Compared with As OSMR plays a vital role in CAU skin tissues, RT- CAU tissues with no transfection and transfected with qPCR and Western blot assay were conducted in order blank plasmids, CAU tissues transfected with OSMR- to elucidate the relationship between OSMR and the siRNA exhibited decreased levels of IL-1, IL-6 and IFN- JAK/STAT3 signaling pathway. The results (Fig. 2c) re- γ, with an opposite trend observed in CAU skin tissues veal that the mRNA expression of OSMR and the JAK/ transfected with Tyr705. Interestingly, there was no a b 50 µm 50 µm Normal Chronic Urticaria Normal Chronic Urticaria c d 3 Normal Normal OSMR Chronic Urticaria Chronic Urticaria JAK2 4 2 * STAT3 ISG15 * CRK 2 * * * * IRF9 GAPDH OSMR JAK2 STAT3 ISG15 CRK IRF9 OSMR JAK2 STAT3 ISG15 CRK IRF9 Fig. 2 Increased protein and mRNA expressions of OSMR and JAK/STAT3 signaling pathway-related factors in skin tissues of CAU patients revealed by RT-qPCR assay and Western blot analysis (n = 24). Note: a OSMR protein expression in human CAU tissues and normal skin tissues under microscope (× 200); b comparison of OSMR protein expression rate in human CAU tissues and normal skin tissues revealed that OSMR protein expression was significantly higher in CAU tissues than the normal skin tissues; c mRNA expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 was significantly higher in CAU tissues than those in normal skin tissues detected by RT-qPCR; d Western blot assay revealed increased protein expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in CAU tissues than those in normal skin tissues; *, p <0.05 when compared with the normal skin tissues; CAU, chronic autoimmune urticaria; RT-qPCR, reverse transcription quantitative polymerase chain reaction; OSMR, Oncostatin M receptor; JAK2, janus kinase 2; STAT3, signal transducer and activator of transcription 3; ISG15, interferon-stimulated gene 15;CRK, CT10-regulated kinase; IRF9, interferon regulatory factor 9 Normal Chronic Urticaria Realative mRNA expresssion Relative protein expression Positive expression of OSMR (%) Luo et al. Molecular Medicine (2018) 24:28 Page 8 of 13 Fig. 3 Decreased inflammatory factor content after transfection with OSMR-siRNA but increased by activation of the JAK/STAT3 signaling pathway. Notes: a inflammatory factor expression in serum of CAU patients (n = 24); b inflammatory factor expression in serum of CAU mouse tissues with different transfection (n =12); *, p < 0.05 compared with the normal group; #, p < 0.05 compared with the blank group; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor; JAK, janus kinase; STAT, signal transducer and activator of transcription significant differences among CAU skin tissues with no JAK/STAT3 inhibition relieved CAU pathological reaction transfection and transfected with blank plasmids, and and decreased the eosinophils counting number. those transfected with OSMR-siRNA + Tyr705 (p >0.05). The aforementioned findings demonstrate that OSMR si- Enhanced proliferation of epithelial cells after transfected lencing inhibited while the activation of the JAK/STAT3 with OSMR silencing and the JAK/STAT3 signaling signaling pathway promoted the expression of inflamma- pathway inhibition tory factors. Cell cycle and cell apoptosis are two essential elements for assessing cell growth and death, thus, flow analysis Pathological reaction of CAU relieved and eosinophil was performed in order to explore the alterations in cell number decreased after transfection with OSMR silencing cycle and cell apoptosis after different transfection. As As CAU is characterized by pruritus and flare reaction showed by Fig. 5, cell proliferation was found to be de- in skin with an increase in eosinophils, the pathological creased significantly with the decreasing condition morphology in each group was observed under the remained for 6 h (p > 0.05). At transfection periods of 12, microscope, and the number and duration of pruritus in 24, and 48 h, cells transfected with OSMR-siRNA exhib- CAU mice was accordingly analyzed and recorded. As ited increases cell proliferation, while those transfected shown by Table 2 and Fig. 4, the recorded number and with Tyr705 had the lowest cell proliferation (p <0.05). duration of pruritus, and the eosinophils counting num- The findings reveal that OSMR silencing increased cell ber were found to be increased in CAU mice (p < 0.05). proliferation, while activation of the JAK/STAT3 signaling Compared to the CAU mice with no transfection and pathway inhibited cell proliferation. transfected with blank plasmids, CAU mice tissues As results of the flow analysis demonstrate, compared transfected with OSMR-siRNA exhibited significantly with the normal group, epithelial cells had prolonged G0/ decreased number and duration of pruritus and eosinophils G1 phases but diminished S phases, along with increased counting number, whereas the results were opposite in the cell apoptosis (p < 0.05). Compared to the cells with no CAU mice tissues transfected with Tyr705 (p < 0.05). transfection or transfected with blank plasmids, cells Thereby, it can be concluded that OSMR silencing and transfected with OSMR-siRNA demonstrated diminished Table 2 The number and duration of pruritus ratios in each group Group n Number of pruritus (time) Duration of pruritus (min) Normal 12 0 0 * * Blank 12 57.15 ± 6.72 28.00 ± 4.10 * * NC 12 55.23 ± 4.38 27.30 ± 3.90 *# *# Tyr705 12 92.50 ± 7.80 40.50 ± 350 * * OSMR-siRNA 12 18.40 ± 5.10 17.00 ± 3.35 *# *# Tyr705 + OSMR-siRNA 12 56.38 ± 5.20 29.40 ± 3.40 * # p < 0.05 compared with the normal group; p < 0.05 compared with the blank group; NC negative control, OSMR oncostatin M receptor Luo et al. Molecular Medicine (2018) 24:28 Page 9 of 13 with OSMR-siRNA, whereas it was found to be increased in cells transfected with Tyr705, while there were no sig- * nificant difference in cells transfected with Tyr705 + OSMR-siRNA (p > 0.05). The above results show that OSMR accelerated the apoptosis of epithelial cells by shortening the S phase and prolonging the G0/G1 phase of the cell cycle. Therefore, it can be concluded that OSMR silencing could shorten the G0/G1 phase, prolong the S phase of epithelial cells, thereby inhibiting epithelial cell growth, while down-regulation of the JAK/STAT3 sig- naling pathway promoted epithelial cell process. OSMR silencing inhibited the JAK/STAT3 signaling pathway thus suppressed CAU progression Lastly, in order to assess the relationship between OSMR and the JAK/STAT3 signaling pathway in epithe- lial cells, RT-qPCR and Western blot assay were per- formed in order to explore the mRNA and protein expressions of OSMR and the JAK/STAT3 pathway re- Fig. 4 CAU pathological reaction relieved and eosinophils counting lated genes in epithelial cells with different transfection. number decreased after CAU mice transfected with OSMR-siRNA As shown by Fig. 7a–c, compared to the normal cells, (n = 12). Note: *, p < 0.05 compared with the normal group; #, p <0.05 epithelial cells exhibited increased mRNA and protein compared with the blank group; CAU, chronic autoimmune urticaria; expressions of OSMR and JAK/STAT3 signaling pathway OSMR, Oncostatin M receptor related genes (p < 0.05). Compared with the epithelial cells transfected with blank vectors, epithelial cells trans- G0/G1 phases and prolonged S phases, whereas opposite fected with OSMR-siRNA displayed decreased expressions results were observed in the cells transfected with Tyr705 of OSMR and JAK/STAT3 signaling pathway related genes (p < 0.05), and the results were not significantly different (p < 0.05), while those transfected with Tyr705 exhibited in cells transfected with Tyr705 + OSMR-siRNA (p >0.05) elevated levels (p < 0.05). Interestingly, epithelial cells (Fig. 6a, b). As for changes in cell apoptosis (Fig. 6c, d), de- transfected with Tyr705 + OSMR-siRNA exhibited de- creased cell apoptosis was observed in cells transfected creased OSMR and JAK/STAT3 compared to the epithe- lial cells transfected with Tyr705, indicating that OSMR could inhibit the JAK/STAT3 signaling pathway. Normal Blank Discussion Chronic autoimmune urticaria (CAU), a commonly oc- NC 1.5 curring disease, is accompanied by various symptoms in- Tyr705 cluding transient eruption of itchy, edematous swellings OSMR-siRNA of the dermis, and erythematosus, lasting over a duration of 6 weeks (Wardhana, 2012). Recent study has shown Tyr705 + OSMR-siRNA 1.0 that OSMR plays an important role in systemic lupus ery- *# thematosus, and further leads to the stimulation of various cytokines and inflammatory substances, such as IL-6 and *# IL-11 by activating the JAK/STAT pathway and the 0.5 # * mitogen-activated protein kinase (MAPK) signaling path- *# ways (Lin et al., 2014). The current study has shown that *# *# OSMR gene silencing can restrain the development of CAU, which can be achieved through blocking the JAK/ 0.0 30 min 1 h 6 h 12 h 24 h 48 h STAT3 signaling pathway. Initially, it was found that OSMR silencing inhibits the Fig. 5 Epithelial cell proliferation ability inhibited after cells transfected with OSMR-siRNA. Note: the experiment repeated for 3 expression of the JAK/STAT3 signaling pathway related- times; *, p < 0.05 compared with the normal group; #, p <0.05 genes (JAK2, STAT3, ISG15, CRK and IRF9). JAK2 is compared with the blank and NC groups; CAU, chronic autoimmune a non-receptor tyrosine kinase responsible for diverse urticaria; OSMR, Oncostatin M receptor cellular processes via stimulating cytoplasmic signaling Normal Blank NC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA EOS numbers (10 /ml) OD (450 nm) Luo et al. Molecular Medicine (2018) 24:28 Page 10 of 13 a b Normal Blank NC Normal Blank NC Tyr705 OSMR-siRNA 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 * Tyr705 + OSMR-siRNA * * Channels(FL2-H) Channels(FL2-H) Channels(FL2-H) Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA 20 # * * * G0/G1 S G2/M 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Channels(FL2-H) Channels(FL2-H) Channels(FL2-H) c d Normal Blank NC * * 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC FITC FITC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC FITC FITC Fig. 6 Shortened epithelial cell cycle and promoted cell apoptosis after cells transfected with OSMR-siRNA thus to inhibit CAU cell growth and promote their apoptosis. Note: a flow cytometry image revealed the epithelial cell cycle in different transfection groups; b histogram image displayed the epithelial cell cycle in different transfection groups; c flow cytometry image revealed the epithelial cell apoptosis in different transfection groups; d histogram image displayed the epithelial cell apoptosis in different transfection groups; the experiment repeated 3 times; *, p < 0.05 compared with the normal group; #, p < 0.05 compared with the blank and NC groups; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor cascades (Dawson et al., 2009). STAT3, another gene could be activated, followed by further activation of of interest in the current study, is a key member of STAT3 (Hong et al., 2011). Consistently, it has been re- the JAK/STAT signaling pathway (Yau et al., 2012). vealed that the low expression of OSMRβ could decrease ISG15 is an ubiquitin-like protein whose conjugation atherogenesis by inactivating the JAK2/STAT3 signaling is involved in the antiviral immune response and pathway in macrophages (Zhang et al., 2017). The afore- regulation of the JAK/STAT signaling pathway (Osiak mentioned findings and evidence suggest that OSMR gene et al., 2005;Hsiao etal., 2010). CRK belongs to Src silencing could suppress the JAK/STAT3 signaling pathway. homology-2 (SH2) and SH3 domain comprised of Additionally, the current findings demonstrate that the proteins that controls the coordinated combination of sig- contents of IL-1, IL-6, IFN-γ and IgE in serum of mice naling complexes (Sriram et al., 2015). IRF9 is a crucial in the OSMR-siRNA group were significantly reduced, factor in the JAK/STAT signaling pathway that stimulates indicating that OSMR gene silencing suppressed the the antiproliferative function of IFN-α (Wu et al., 2017; autoimmunity of CAU by blocking the JAK/STAT3 sig- Tsuno et al., 2009). A previous study found that both type naling pathway. Notable, it was reported that regulation I and type II OSMR activated JAK1, JAK2, and TYK2 of IFN-γ-secreting T helper 1 cells could inhibit auto- receptor-associated tyrosine kinases (Auguste et al., 1997). immunity and immunopathology (Cope et al., 2011). Recently, OSM has been reported to stimulate ISG genes Previous studies have demonstrated that OSMR could participating in antigen processing as well as presentation increase IL-1 and TNF activity in synovial fibroblasts, (Hergovits et al., 2017). The OSMR protein has been re- which was consistent with the results of the current ported to be capable of heterodimerizing with IL-6 signal study (Le Goff et al., 2014). Interestingly, it was reported transducer (gp130) in order to produce type II OSMR, that inhibition of OSMR results in suppressed IL-31, and when the receptor complexes were taken in, JAK which was highly expressed in the skin of patients with Normal Blank NC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA PI PI Number Number 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 PI PI Number Number 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 10 10 10 10 10 PI PI Number Number 0 1 2 3 0 1 2 3 4 10 10 10 10 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 Cell apoptosis rate (%) Cell cycle (%) Luo et al. Molecular Medicine (2018) 24:28 Page 11 of 13 Fig. 7 mRNA and protein expression of OSMR and the JAK/STAT3 signaling pathway related genes decreased after cells transfected with OSMR-siRNA and the JAK/STAT3 signaling pathway inhibition (n = 12). Note: a mRNA expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in epithelial cells and normal skin tissues; b protein expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in epithelial cells and normal skin tissues; *, p <0.05 compared with the normal group; #, p < 0.05 compared with the blank and NC groups; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor; JAK2, janus kinase 2; STAT3, signal transducer and activator of transcription 3; ISG15, interferon-stimulated gene 15; CRK, CT10-regulated kinase; IRF9, interferon regulatory factor 9 chronic spontaneous urticaria and was released from pathway (Ji et al., 2015). Therefore, it can be hypothesized isolated basophils accompanied with anti-IgE activation that OSMR gene silencing regulates proliferation, migra- (Raap et al., 2017). Moreover, it has been reported that tion as well as apoptosis of epithelial cells in CAU by inhi- inactivation of the JAK/STAT pathway could help in biting the JAK/STAT signaling pathway. inhibiting the expression of ICAM-1 induced by IFN-γ in HaCaT human keratinocytes (Sung & Kim, 2013). Conclusion The activated JAK/STAT signaling pathway could stimu- The current study suggested that OSMR gene are highly late IFNs in order to exert an innate immune response expressed in human CAU skin tissues, and cause the up- (Cheng et al., 2014). In addition, STAT3 mutations are regulation of the JAK/STAT3 signaling pathway-related associated with autosomal dominant-hyper-IgE syn- genes. Additionally, it was demonstrated that OSMR dromes (AD-HIES) and this association might allow dif- gene silencing significantly decreases the content of in- ferentiation of AD-HIES from disorders correlated with flammatory factors, the number of eosinophils, and re- elevated serum IgE levels (Schimke et al., 2010). duces the mRNA and protein expressions of JAK/STAT3 Consequently, it was revealed that OSMR gene silen- signaling pathway-related genes, enhances cell prolifera- cing can obstruct the development of CAU by inhibiting tion, migration and inhibits apoptosis of epithelial cells. the JAK/STAT3 signaling pathway, as increased prolifer- Thereby, it can be concluded that OSMR gene silencing ation, migration and decreased apoptosis of epithelial inhibits autoimmunity in CAU mouse models by inacti- cells were observed in the OSMR-siRNA group. OSM, is vating the JAK/STAT3 signaling pathway. These findings a cytokine capable of modulating cell survival and prolif- may open novel avenues for future CAU therapies and eration, and the over-expression of OSM could result in to ultimately, raise the quality of life of CAU patients. transdifferentiation of epithelial-myofibroblast (Elbjeirami However, the limited sample size of the current study re- et al., 2010). In line with the findings of the current study, mains to be a limitation. Thus, further studies are war- it was reported that over-expression of OSM in tubular ranted in order to better the understanding of specific epithelial cells might aggravate mucosal epithelial barrier mechanisms. dysfunction (Pothoven et al., 2015). The JAK/STAT is cap- able of modulating signaling cascades exerting great ef- Acknowledgements fects on proliferation, differentiation, development as well We would like to give our sincere appreciation to the reviewers for their helpful comments on this article. as immune responses (Kim et al., 2011). Additionally, it was reported that acute nitrogen dioxide exposure en- Funding hances airway inflammation that both humoral immunity This work was supported by the National Natural Science Foundation of and cellular immunity reaction via modulating Th1/Th2 China (No. 81301362) and High End Talent Plan of Chongqing Municipal differentiation and activating the JAK/STAT signaling Health and Family Planning Commission. Luo et al. Molecular Medicine (2018) 24:28 Page 12 of 13 Authors’ contributions Dawson MA, et al. JAK2 phosphorylates histone H3Y41 and excludes HP1alpha HW and X-YL participated in the conception and design of the study. HW, QL from chromatin. Nature. 2009;461:819–22. and HY performed the analysis and interpretation of data. HY, QT and L-QG Deng G, et al. Unique methylation pattern of oncostatin m receptor gene in contributed to drafting the article. HW and F-LR revised it critically for important cancers of colorectum and other digestive organs. Clin Cancer Res. 2009; intellectual content. HW is the GUARANTOR for the article who accepts full 15:1519–26. responsibility for the work and/or the conduct of the study, had access to Denley SM, et al. Activation of the IL-6R/Jak/stat pathway is associated with a the data, and oversaw the decision to publish. All authors contributed to poor outcome in resected pancreatic ductal adenocarcinoma. J Gastrointest the revision and approved the final version of this manuscript. Surg. 2013;17:887–98. Elbjeirami WM, et al. Early differential expression of oncostatin M in obstructive nephropathy. J Interf Cytokine Res. 2010;30:513–23. Ethics approval and consent to participate Gimenez-Arnau AM, Grattan C, Zuberbier T, Toubi E. An individualized diagnostic This study was approved by the Ethics Committee of Children’s Hospital of approach based on guidelines for chronic urticaria (CU). J Eur Acad Dermatol Chongqing Medical University and all patients or their guardians signed the Venereol. 2015;29(Suppl 3):3–11. informed consent. Besides, all animals disposed in the experiment were in Goh CL, Tan KT. Chronic autoimmune urticaria: where we stand? Indian J accordance with the ethical standards. Dermatol. 2009;54:269–74. Hashimoto T, et al. Mizoribine treatment for antihistamine-resistant chronic Consent for publication autoimmune urticaria. Dermatol Ther. 2012;25:379–81. Consent for publication was obtained from the participants. Hergovits S, Mais C, Haan C, Costa-Pereira AP, Hermanns HM. Oncostatin M induces RIG-I and MDA5 expression and enhances the double-stranded RNA Competing interests response in fibroblasts. J Cell Mol Med. 2017;21:3087–99. The authors declare that they have no competing interests. Hermanns HM. Oncostatin M and interleukin-31: cytokines, receptors, signal transduction and physiology. Cytokine Growth Factor Rev. 2015;26:545–58. Hintzen C, et al. Box 2 region of the oncostatin M receptor determines Publisher’sNote specificity for recruitment of Janus kinases and STAT5 activation. J Biol Springer Nature remains neutral with regard to jurisdictional claims in Chem. 2008;283:19465–77. published maps and institutional affiliations. Hong IK, Eun YG, Chung DH, Kwon KH, Kim DY. Association of the oncostatin m receptor gene polymorphisms with papillary thyroid cancer in the korean Author details population. Clin Exp Otorhinolaryngol. 2011;4:193–8. Department of Dermatology, Children’s Hospital of Chongqing Medical Hsiao NW, et al. ISG15 over-expression inhibits replication of the Japanese University, Chongqing 400014, China. Ministry of Education Key Laboratory encephalitis virus in human medulloblastoma cells. Antivir Res. 2010;85:504–11. of Child Development and Disorders, Chongqing 400014, China. The Ji X, Han M, Yun Y, Li G, Sang N. Acute nitrogen dioxide (NO2) exposure Division of Allergy and Clinical Immunology, Johns Hopkins University School enhances airway inflammation via modulating Th1/Th2 differentiation and of Medicine, Baltimore, MD 21224, USA. China International Science and activating JAK-STAT pathway. Chemosphere. 2015;120:722–8. Technology Cooperation Base of Child Development and Critical Disorders, Kim BH, et al. Benzoxathiol derivative BOT-4-one suppresses L540 lymphoma cell Chongqing 400014, China. Chongqing Key Laboratory of Pediatrics, No.136, survival and proliferation via inhibition of JAK3/STAT3 signaling. Exp Mol Zhongshan Er Road, Yuzhong District, Chongqing 400014, China. Med. 2011;43:313–21. Komori T, Tanaka M, Senba E, Miyajima A, Morikawa Y. Lack of oncostatin M Received: 19 January 2018 Accepted: 6 May 2018 receptor beta leads to adipose tissue inflammation and insulin resistance by switching macrophage phenotype. J Biol Chem. 2013;288:21861–75. Le Goff B, et al. Oncostatin M acting via OSMR, augments the actions of IL-1 and References TNF in synovial fibroblasts. Cytokine. 2014;68:101–9. Aaronson DS, Horvath CM. A road map for those who don't know JAK-STAT. Lin YZ, et al. Association of OSMR gene polymorphisms with rheumatoid arthritis Science. 2002;296:1653–5. and systemic lupus erythematosus patients. Autoimmunity. 2014;47:23–6. Abd El-Azim M, Abd E-AS. Chronic autoimmune urticaria: frequency and Osiak A, Utermohlen O, Niendorf S, Horak I, Knobeloch KP. ISG15, an interferon- association with immunological markers. J Investig Allergol Clin Immunol. stimulated ubiquitin-like protein, is not essential for STAT1 signaling and 2011;21:546–50. responses against vesicular stomatitis and lymphocytic choriomeningitis Al-Ahmad M. Omalizumab therapy in three patients with chronic autoimmune virus. Mol Cell Biol. 2005;25:6338–45. urticaria. Ann Saudi Med. 2010;30:478–81. Pothoven KL, et al. Oncostatin M promotes mucosal epithelial barrier dysfunction, Amano W, et al. JAK inhibitor JTE-052 regulates contact hypersensitivity by and its expression is increased in patients with eosinophilic mucosal disease. downmodulating T cell activation and differentiation. J Dermatol Sci. J Allergy Clin Immunol. 2015;136:737–46 e4. 2016;84:258–65. Raap U, et al. Human basophils are a source of - and are differentially activated Arita K, et al. Oncostatin M receptor-beta mutations underlie familial primary by - IL-31. Clin Exp Allergy. 2017;47:499–508. localized cutaneous amyloidosis. Am J Hum Genet. 2008;82:73–80. Schimke LF, et al. Diagnostic approach to the hyper-IgE syndromes: immunologic Auguste P, et al. Signaling of type II oncostatin M receptor. J Biol Chem. 1997; and clinical key findings to differentiate hyper-IgE syndromes from atopic 272:15760–4. dermatitis. J Allergy Clin Immunol 126. 2010;e1:611–7. Bingham CO 3rd. Immunomodulatory approaches to the management of Sriram G, et al. Iterative tyrosine phosphorylation controls non-canonical domain chronic urticaria: an immune-mediated inflammatory disease. Curr Allergy utilization in Crk. Oncogene. 2015;34:4260–9. Asthma Rep. 2008;8:278–87. Sung YY, Kim HK. Illicium verum extract suppresses IFN-gamma-induced ICAM-1 Boniface K, et al. Oncostatin M secreted by skin infiltrating T lymphocytes is a expression via blockade of JAK/STAT pathway in HaCaT human keratinocytes. potent keratinocyte activator involved in skin inflammation. J Immunol. 2007; J Ethnopharmacol. 2013;149:626–32. 178:4615–22. Tanimoto A, et al. A novel JAK inhibitor JTE-052 reduces skin inflammation and Caffarel MM, Coleman N. Oncostatin M receptor is a novel therapeutic target in ameliorates chronic dermatitis in rodent models: comparison with cervical squamous cell carcinoma. J Pathol. 2014;232:386–90. conventional therapeutic agents. Exp Dermatol. 2018;27:22–9. Chen D, et al. Expression of short-form oncostatin M receptor as a decoy Tsuno T, et al. IRF9 is a key factor for eliciting the antiproliferative activity of IFN- receptor in lung adenocarcinomas. J Pathol. 2008;215:290–9. alpha. J Immunother. 2009;32:803–16. Cheng CH, et al. Differential regulation of Tetraodon nigroviridis mx gene promoter activity by constitutively-active forms of STAT1, STAT2, and IRF9. Ventura MT, Napolitano S, Menga R, Cecere R, Asero R. Anisakis simplex Fish Shellfish Immunol. 2014;38:230–43. hypersensitivity is associated with chronic urticaria in endemic areas. Int Arch Cherrez Ojeda I, et al. Chronic autoimmune urticaria in children. Allergol Allergy Immunol. 2013;160:297–300. Immunopathol (Madr). 2009;37:43–7. Wardhana DEA. Chronic autoimmune urticaria. Acta Med Indones. 2012;44:165–74. Cope A, Le Friec G, Cardone J, Kemper C. The Th1 life cycle: molecular control of Wu Z, et al. Interaction of IRF9 and STAT2 synergistically up-regulates IFN and IFN-gamma to IL-10 switching. Trends Immunol. 2011;32:278–86. PKR transcription in Ctenopharyngodon idella. Mol Immunol. 2017;85:273–82. Luo et al. Molecular Medicine (2018) 24:28 Page 13 of 13 Yagami A, Furue M, Togawa M, Saito A, Hide M. One-year safety and efficacy study of bilastine treatment in Japanese patients with chronic spontaneous urticaria or pruritus associated with skin diseases. J Dermatol. 2017;44:375–85. Yau WW, Rujitanaroj PO, Lam L, Chew SY. Directing stem cell fate by controlled RNA interference. Biomaterials. 2012;33:2608–28. Zhang X, et al. Oncostatin M receptor beta deficiency attenuates atherogenesis by inhibiting JAK2/STAT3 signaling in macrophages. J Lipid Res. 2017;58:895–906. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Molecular Medicine Springer Journals

OSMR gene effect on the pathogenesis of chronic autoimmune Urticaria via the JAK/STAT3 pathway

Free
13 pages
Loading next page...
 
/lp/springer_journal/osmr-gene-effect-on-the-pathogenesis-of-chronic-autoimmune-urticaria-SZsTF90BS6
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s)
Subject
Biomedicine; Molecular Medicine
ISSN
1076-1551
eISSN
1528-3658
D.O.I.
10.1186/s10020-018-0025-6
Publisher site
See Article on Publisher Site

Abstract

Background: Chronic autoimmune urticaria (CAU) is a common skin disease and remains unclear understanding of pathogenesis in the vast majority of cases. In order to explore a new therapy for CAU, the current study was performed to investigate the possible functioning of the Oncostatin M receptor (OSMR) gene in the autoimmunity of CAU via regulation of the JAK/STAT3 signaling pathway. Methods: CAU skin tissues from 24 CAU patients and normal skin tissues from normal subjects were collected. Hematoxylin-eosin (HE) staining was conducted to count eosinophils, and immunohistochemistry was carried out to detect the positive rate of OSMR expression in two kinds of skin tissues. A total of 72 Kunming (KM) mice were selected, and 60 mice were used for establishing CAU models and later transfected with different plasmids. The expression of inflammatory factors was evaluated by enzyme-linked immunosorbent assays (ELISA). Expressions of janus kinase (JAK), signal transducer and activator of transcription 3 (STAT3), interferon-stimulated gene 15 (ISG15), CT10-regulated kinase (CRK), and interferon regulatory factor 9 (IRF9) were identified using Western blot assay and reverse transcription quantitative polymerase chain reaction (RT-qPCR). Epithelial cell proliferation was assessed by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay, and cell cycle distribution and cell apoptosis were assessed using flow cytometry. Results: The findings confirm that OSMR protein expression and histamine release rate are highly elevated in human CAU skin tissues, and the expression of the JAK/STAT3 signaling pathway-related genes (OSMR, JAK2, STAT3, ISG15, CRK and IRF9) was up-regulated. OSMR gene silencing in CAU mice significantly decreases the content of inflammatory factors (IL-1, IL-6, IFN-γ, and IgE), the number of eosinophils, and reduces the expression of the JAK/ STAT3 signaling pathway related genes, and further enhances cell proliferation, promotes cell cycle entry and inhibits apoptosis of epithelial cells. Conclusion: All aforementioned results indicate that OSMR gene silencing inhibits the activation of the JAK/STAT3 signaling pathway, thereby suppressing the development of CAU. Keywords: OSMR gene, JAK/STAT3 signaling pathway, Chronic autoimmune urticaria, Pathogenesis, Autoimmunity * Correspondence: huawang@hospital.cqmu.edu.cn Department of Dermatology, Children’s Hospital of Chongqing Medical University, Chongqing 400014, China Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing 400014, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Luo et al. Molecular Medicine (2018) 24:28 Page 2 of 13 Background pathogenesis of chronic dermatitis, atopic dermatitis and Chronic urticaria (CU), an immune-mediated inflamma- psoriasis, and JAK inhibitors are thus promising thera- tory disease, is defined as the spontaneous or inducible ap- peutic candidates for chronic dermatitis (Tanimoto et al., pearance of hives, angioedema or both lasting at least 6 2018). Additionally, JAK inhibitors, which are also used to weeks and presenting with numerous subtypes, all greatly inhibit cytokine signaling, are assumed to be a possible damage patients’ quality of life (Bingham 3rd, 2008; mean of treating skin inflammatory disorders such as con- Gimenez-Arnau et al., 2015). CU, the potentially debilitat- tact dermatitis (Amano et al., 2016). It has been reported ing skin condition, is known to affect up to 1% of the gen- that OSM is released in inflammatory conditions, and it eral population with different durations, usually several signals primarily via the JAK/STAT pathway by combining months, but occasionally decades (Ventura et al., 2013). with its receptor complex (Hermanns, 2015). The hetero- Chronic idiopathic urticaria (CIU) is a common type of dimeric receptor complex combined with gp130 and CU accounting for over 70% cases of CU, and chronic OSMR could activate a signaling pathway involved in autoimmune urticaria (CAU), a subgroup of CIU, ac- JAKs as well as transcription factors of the STAT family counts for more than 30% of CIU. CIU is characterized by (Hintzen et al., 2008). However, further verification is re- severe and persistent wheals accompanied by redness and quired in order to explore whether the OSMR gene is in- itching (Goh & Tan, 2009; Abd El-Azim & Abd, 2011). volved in the pathogenesis of CAU through the JAK/ CAU is caused by anti-FcepsilonRI and less normally, by STAT3 signaling pathway. Therefore, the current study anti-IgE autoantibodies that result in the activation of aims to explore the role of OSMR gene silencing in the mast cells and basophils (Goh & Tan, 2009). Currently, pathogenesis of CAU and its underlying mechanism in- clinical suspicion and autologous serum skin test (ASST) volving the JAK/STAT3 signaling pathway. are regarded as the basis of CAU diagnosis (Abd El-Azim &Abd, 2011). Previously, the role of omalizumab in treat- Methods ing refractory CAU patients was studied, and proven pos- Ethics statement sible (Al-Ahmad, 2010). In addition, mizoribine was found This study was approved by the Ethics Committee of to be an effective therapy in some CAU patients, and may Children’s Hospital of Chongqing Medical University, possibly be effective for patients not responsive to trad- and signed informed consents were obtained from all itional therapy (Hashimoto et al., 2012). CAU patients are patients/guardians. In addition, the experiments were in poor responders to antihistamine therapy, which leads to accordance with the ethical standards, and all efforts the necessity of immunosuppressive therapy (Cherrez were made to minimize the suffering of the animals in- Ojeda et al., 2009). Therefore, new genetic methods are re- cluded in the study. quired to find the possible ways for the treatment of CAU. Oncostatin M (OSM), a member of the interleukin 6 Study subjects (IL-6) family of cytokines, plays important roles in vari- CAU skin tissues from 24 CAU patients of Children’s ous biological functions, including inflammatory re- Hospital of Chongqing Medical University were col- sponses and metabolic diseases (Komori et al., 2013). lected, and normal skin tissues from skin grafts of 24 OSM secreted by skin-infiltrating T-lymphocytes is con- plastic surgery patients were selected as controls. Skin sidered to be a potential keratinocyte activator correlated biopsy specimens were rapidly frozen in liquid nitrogen to skin inflammation (Boniface et al., 2007). Oncostatin in order to prevent protein denaturation until total RNA M receptor (OSMR) gene is located at 5p13.1, and can was extracted from the specimens. The 24 CAU patients bind to gp130 to mediate the biological functions of included 11 males and 13 females, with a mean age of OSM (Hong et al., 2011;Deng etal., 2009). Therapies 10 years. The average courses of disease of patients were based on OSMR have been reported for treatment of vari- 6.67 months (range 2–16 months). All patients had been ous cancers including cervical squamous cell carcinoma treated with antihistaminic agents, and some patients and lung adenocarcinomas, as well as skin diseases such as underwent treatment with corticosteroids but with poor familial primary localized cutaneous amyloidosis (Caffarel efficacy, for 16 of them complained of joint pain, gastro- & Coleman, 2014;Chenetal., 2008; Arita et al., 2008). intestinal or respiratory symptoms. Janus kinase-signal transducer and activator of transcrip- tion (JAK/STAT) transmits information received from Hematoxylin-eosin (HE) staining extracellular polypeptide signals through transmembrane Skin tissues extracted from CAU patients were fixed in receptors, directly to the target gene promoters in the 4% paraformaldehyde for 24 h, washed, dehydrated, nucleus, providing a mechanism for regulation of tran- cleared, waxed, embedded, sectioned, and made into scriptional without second messengers (Aaronson & Hor- paraffin sections. After that, the sections were stained vath, 2002). JAKs are required for numerous inflammatory with hematoxylin for observing the eosinophil infiltra- cytokine signaling pathways, and are implicated in the tion in skin tissue of patients. Luo et al. Molecular Medicine (2018) 24:28 Page 3 of 13 Immunohistochemistry number and total duration of pruritus in each mouse was The sections underwent routine dewaxing, dehydration recorded within 30 min of the 1 mL dextran injections with gradient ethanol, antigen-repair under high pres- through the tail vein. The CAU mouse model was consid- sure for 1.5 min, and cooling under tap water for ered to be successfully established if the number and total 10 min. After the remaining tap water on the sections duration of pruritus were significantly higher than the was removed under running water, the sections were normal mice (Yagami et al., 2017). A total of 60 mice added one drop of endogenous peroxidase blocking so- were successfully established as CAU models which lution, incubated at room temperature for 10 min, and were classified into: the blank group (model mice without rinsed with phosphate buffer solution (PBS) (3 min, 3 any treatment), the negative control group (NC) (model times). Then, the sections were added with suitable mice transfected with empty vector plasmid), the OSMR- amount of primary antibody, namely rabbit anti human siRNA group (model mice transfected with OSMR-siRNA immunoglobulin G (IgG) antibody for incubation over- plasmid), the anti-phospho-STAT3 (Tyr705) + OSMR- night at 4 °C, followed by rinsing with PBS after being siRNA group (model mice transfected with OSMR-siRNA taken out (3 min, 3 times), and incubation with the plasmid + the JAK/STAT3 signaling pathway agonist), and biotin-labeled secondary mouse anti rabbit monoclonal the Tyr705 group (model mice treated with the JAK/ antibody IgG/horseradish peroxidase (HRP) (dilution ra- STAT3 signaling pathway agonist) groups. The plasmids tio of 1: 1000, ab6759, Abcam, Inc., Cambridge, MA, used in the experiments were purchased from Vigene Bio- USA) at 37 °C for 30 min. After incubation with the two technology Co., Ltd. (Shandong, China). Then, attention types of antibodies, the sections were rinsed with PBS was paid to the number and total duration of pruritus (3 min, 3 times), dealt by streptomyces anti biotin catalase within 30 min. The mice were sacrificed after successful complex for 15 min, colored with 3,3′-diaminobenzidine transfection with corresponding plasmids. Then, mice (DAB), and then rinsed under tap water to terminate the skin specimens with wheal or rash were extracted and whole reaction. Later, the sections were re-stained with stored at − 80 °C. Eosinophil counting was conducted by hematoxylin, dehydrated, cleared, and mounted. PBS was routine method and the absolute value was recorded. used as the negative control instead of the primary anti- body. Finally, each section was randomly photographed under a light microscope (at 10× & 40× magnification) to Isolation and culture of mast cells get 5 non-overlapping visual fields. At last, 100 cells were The foreskin of children (1–9 years) was extracted by counted in each visual field randomly, and the percentage circumcision under aseptic conditions. The skin grafts of positive cells = positive cells/total cells. were incubated in a RPMI 1640 culture medium (con- taining 100 U/mL penicillin and 100 μg/mL strepto- CAU animal model establishment mycin) after blood was removed using normal saline. A total of 72 Kunming (KM) mice weighing 18~ 25 g Subcutaneous tissues were isolated and rinsed with (J018, Better Biotechnology Co., Ltd., Nanjing, China) modified Tyrode solution (containing 137 mmol/L NaCl, were selected for the study, amongst which 60 mice were 2.7 mmol/L KCl, 0.4 mmol/L NaH PO , 5.6 mmol/L Glu- 2 4 used for the establishment of CAU mouse models, and cose, 10 mmol/L HEPES, 1 mmol/L CaCl and 1 mmol/L the other 12 untreated mice were regarded as the nor- MgCl ). Subsequently, the skin grafts were cut sliced tis- mal group. Each intraplantar of mice was treated with sue fragments of 1 mm , and placed in RPMI 1640 culture 0.05 mL 5% physiological saline solution containing ov- medium containing 1.5 mg/mL type I collagenase and albumin (the total amount of injection for a mouse was 0.5 mg/mL hyaluronidase for 4-h culturing in an in- 0.1 mL). Meanwhile, each mouse received pertussis vac- cubator containing 5% CO in air and saturated hu- cines (4 × 10 U) via intraperitoneal injections. After midity at 37 °C. Next, the fragments were isolated in 12–14 d, the mice were sacrificed by using the neck- order to a form a cell suspension by repeated blowing breaking method and blood was drawn. Mice blood was and beating of digestive juice with a straw. The sus- collected and centrifuged in order to separate the anti- pension was filtrated with a stainless steel filter net. serum, which was stored in a refrigerator for later use After removal of the tissue fragments and larger cell (mixed antisera was selected from 5 sensitized mice). With clusters, the filtrate was collected, rinsed with icy the addition of normal saline (dilution ratio of 1: 10), Tyrode solution, re-suspended in a RPMI 1640 cul- 0.03 m L antiserum was injected into the abdominal wall ture medium containing 10% fetal bovine serum (FBS) of the mice. Subsequently, antigen attack was conducted , 100 U/mL penicillin and 100 μg/mL streptomycin, by injections of 1 mL normal saline (containing 1 mg and cultured in a 5% CO incubator with saturated ovalbumin). The indications of pruritus include systemic humidity at 37 °C for 12 h. Subsequently, the culture pruritus-head scratching by paw, torso scratching by hind medium was collected after gently shaking the culture claws, and biting all parts of the body by mouth. The bottle. Luo et al. Molecular Medicine (2018) 24:28 Page 4 of 13 Histamine release test and enzyme linked indicative of highly purified RNA. Total RNA were ex- immunosorbent assay (ELISA) tracted from 100 mg skin tissues in each group using A total of 75 μL serum samples and normal serum sam- the Trizol reagent (16,096,020, Invitrogen Inc., Carlsbad, ples obtained from CAU patients and healthy individuals CA, USA) in accordance with the instructions of the were respectively mixed with 75 μL mast cell suspension, manufacturer, and PrimeScript RT Reagent kit (Fermen- and incubated at 37 °C for 20 min, followed by centrifu- tas, Maryland, NY, USA) was performed for RNA re- gation at 1610×g for 15 min, and the supernatant was serve transcription into cDNA. The reserve transcription collected which was used for evaluation of histamine re- conditions were as follows: 70 °C for 5 min, ice-bathing lease rate (the compound tube was used for aforemen- for 3 min, 37 °C for 60 min, and 95 °C for 10 min. The tioned evaluation). The histamine release rate in CAU cDNA was temporarily preserved at − 20 °C in a refriger- patients and normal individuals was determined by ator. Primers of OSMR, JAK2, STAT3, ISG15, CRK, ELISA. Firstly, the test sample and reagent kit (ZK- IRF9, and GAPDH were synthesized by Takara (Takara G7274, Zike Biotechnology Co., Ltd., Shenzhen, China) Biotechnology Co., Ltd., Liaoning China). PCR amplifi- were subjected to acylation and dilution following the cation was performed to the target genes with 25 μL re- standard and quality control in accordance with the op- action system as follows: 300 ng cDNA, 1× PCR buffer erating procedures. Then, 50 μL test serum samples solution, 200 μmol/L dNTPs, 80 pmol/L forward and re- were obtained from CAU patients and healthy individ- verse primers, 0.5 U Taq enzyme (S10118, Yuanye Bio- uals. A total of 50 μL polyclonal anti-histamine antibody, technology Co., Ltd., Shanghai, China) with the reaction enzyme conjugates and histamine antiserum were added system of pre-denaturation at 94 °C for 5 min, denatur- into each well successively, which were mixed evenly ation at 94 °C for 30 s, annealing at 54 °C for 30 s, exten- and incubated at room temperature for 3 h, followed by sion at 72 °C for 30 s, all cycles were repeated 30 times plate rinsing five times. After that, the freshly prepared with the last reaction at 72 °C for 10 and preserved at 4 °C. 200 μL 3,3′,5,5′-tetramethylbenzidine (TMB) substrate The primer sequences of OSMR, janus kinase 2 (JAK2), solution was added into each well for further incubation signal transducer and activator of transcription3(STAT3), at room temperature for 20 min, followed by plate rins- interferon-stimulated gene 15 (ISG15), CT10-regulated ing five times, and pat to dry the plate. Later, 100 μL kinase (CRK), and interferon regulatory factor 9 (IRF9), TMB stop solution was added to each well to terminate and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) the reaction, and the absorbance (A) value measured are shown in Table 1, and GAPDH was regarded as using a microplate reader at the excitation wavelength of the internal control. The relative ratio of genes be- 450 nm. Content of histamine in samples was calculated tween experimental group and control group were -ΔΔCt using a standard curve, and the formula was as follows: calculated using the 2 method with the formula as: X = A × 50/m. The histamine spontaneous release rate = ΔΔCT = ΔC - ΔCt ,among texperimental group control group histamine spontaneous release/total histamine content × which ΔCt = Ct –Ct (Denley et al., 2013). Ct is OSMR GAPDH 100%, and histamine release rate of samples = histamine the amplification cycle number when real time content/total histamine content × 100%. Interleukin-1 fluorescence intensity reached the set threshold. At such (IL-1) ELISA kit (SBJ-M0582), IL-6 ELISA kit (SBJ- time, the amplification was in logarithmic phase of growth M0044), interferon (IFN)-γ ELISA kit (SBJ-M0038), IgE and the experiment was performed in triplicate. ELISA kit (SBJ-M0499) were used to measure the con- tents of IL-1, IL-6, IFN-γ and IgE according to the pro- Western blot analysis tocols provided by the manufacturer. All the kits were Skin tissues (100 mg) of each group were extracted, purchased from Nanjing SenBeiJia Biological Technol- placed in a glass grinder containing 1 mL tissue lysate ogy Co., Ltd. (Nanjing, Jiangsu, China). (BB-3209, Bestbio Technology, Co., Ltd., Shanghai, China), and were ground to a homogenate by ice-bath, Reverse transcription quantitative polymerase chain where after protein lysate was added in for tissue split- reaction (RT-qPCR) ting at 4 °C for 30 min, centrifuged at 1610×g, 4 °C for Skin tissues (100 mg) were collected from mice in each 15 min, and the supernatant was collected. A bicincho- group, placed into a glass grinder and added with 1 mL ninic acid (BCA) kit (2020ES76, Yeasen Company, tissue lysate (BB-3209, Bestbio Technology, Co., Ltd., Shanghai, China) was employed in order to detect the Shanghai, China), ground to an even homogenate by ice- concentration of each tissue samples. Firstly, deionized bath, and placed on a nucleic acid protein analyzer (Bio- water was added to adjust the sample quantity of 30 μg Photometer D30, Eppendorf, Hamburg, Germany) for protein lane. Then, 10% sodium dodecyl sulfate (SDS) the detection of absorbance ratio and RNA concentra- separating glue and concentration glue was prepared. tion. The results of optical density (OD) value at The sample tissues were mixed with the sample buffer, 260 nm/ that at 280 nm placed between 1.8~ 2.0 is heated to a boil for 5 min, ice-bathed, centrifuged before Luo et al. Molecular Medicine (2018) 24:28 Page 5 of 13 Table 1 RT-qPCR primer sequences 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium bromide (MTT) assay Genes Sequences Skin tissues were extracted from mice in order to obtain OSMR F: 5’-AGAAACTGGCACACCATCCT-3′ keratinocytes after detachment, isolation and culture. R: 5’-ACTGCCCTAATGACCAGTGC-3′ The cells were allowed to reach around 80% confluence, STAT3 F: 5’-GCCACGTTGGTGTTTCATAATC-3′ and were rinsed with PBS two times, and detached by R: 5’-TTCGAAGGTTGTGCTGATAGAG-3′ trypsin in order to prepare a single cell suspension. After JAK2 F: 5’-TGCTGTCCAGACAAGAATGC-3′ counting, the cells were seeded into a 96-well plate at a 3 3 R: 5’-TCCTTCTCTGCCAACGTCTT-3′ density of 3 × 10 ~6×10 cells/well, with the cell volume in each well maintained to 0.2 mL. A total of 6 duplicate ISG15 F: 5’-CACAGTCCTGCTGGTGG-3′ wells were set, and the cells were cultured in an incubator. R: 5’-GGCGATACTGCGACCCT − 3′ At the 30 min, 1 h, 6 h, 12 h, 24 h, and 48 h time periods CRK F: 5’-GGCAGGGTAGTGGAGTGAT-3′ during the incubation, the culture plate was taken out and R: 5’-AGGCTGTCTTGTCGTAGGC-3′ the original culture medium was replaced with 5 g/L 10% IRF9 F: 5’-TGCTTCCTCCAGAGCCAGAC-3′ MTT solution (GD-Y1317, Guduo Biotechnology Co., Ltd., R: 5’-CACAAGGCGGCAATCCAG-3’ Shanghai, China) for further 4-h incubation. Later, 100 μL dimethyl sulphoxide (DMSO) (D5879-100ML, Sigma- GAPDH F: CCACCCATGGCAAATTCCATGGCA Aldrich Chemical Company, St Louis, MO, USA) were R: TCTAGACGGCAGGTCAGGTCCAC added in, and gently oscillated for uniform mixing for RT-qPCR reverse transcription quantitative polymerase chain reaction, OSMR 10 min. After formazan crystals produced by living cells oncostatin M receptor, STAT3 signal transducer and activator of transcription 3, JAK2 janus kinase 2, ISG15 interferon-stimulated gene 15, CRK CT10-regulated were dissolved with DMSO, the cell plate was placed onto kinase, IRF9 interferon regulatory factor 9, GAPDH glyceraldehyde-3-phosphate a microplate reader for detecting the OD value of each well dehydrogenase, F forward, R reverse at the excitation wavelength of 490 nm. The experiment being added into each lane with a micropipette for lectro- was repeated three times and the time point was set as the phoretic separation. After that, the proteins on the mem- abscissa and the OD value as the ordinate in order to plot brane were transferred onto a nitrocellulose membrane the CAU cell activity graph. (ZY-160FP, Zeye Biology, Shanghai, China), blocked with 5% skimmed power at 4 °C overnight. Later, diluted Scratch test primary antibody, namely rabbit anti human polyclonal The mouse keratinocytes in the logarithmic phase of antibodies (dilution ratio of 1: 500), including OSMR growth were selected, and isolated and cultured for 48 h. (11226-R007, dilution ratio of 1: 400, Sino Biological Inc., The cells were seeded in a 6-well plate at a density of Beijing, China), JAK2 (ab32101, dilution ratio of 1: 1000, 1×10 cells in each well and cultured in a 5% CO Abcam Inc., Cambridge, MA, USA), STAT3 (ab68153, di- incubator at 37 °C until cell confluence reached 95%. lution ratio of 1: 1000, Abcam Inc., Cambridge, MA, Then, a vertical linear scratch was drawn using a 20 μl USA), ISG15 (LS-C211809, dilution ratio of 1: 1000, Lit- micropipette, and then serum-free medium was added tleton, Colorado, USA), IRF9 (PAB28499, dilution ratio of to the wells after the 6-well plate was washed with D- 1: 400, Lianshuo Biological Technology, Wuhan, Hubei, hanks solution. Sample cells were collected after scratch- China) and p-STAT3 (sc-56,747, Univ-bio, Shanghai, ing at 0 h and 36 h time periods with 3 visual fields at China) were added into the membrane for overnight 100X magnification were photographed under a phase incubation, followed by rinsing with PBS (5 mins, 3 contrast microscope in order to compare the different times). The secondary antibody mouse anti rabbit scratch lanes. The healing rate of the scratch line was IgG/HRP (Huabio Inc., Hangzhou, Zhejiang, China) regarded as the cell migration and healing ability. was added for rocking incubation at 37 °C for 1 h, followed by rinsing with PBS at room temperature (5 Flow cytometry mins, 3 times). At room temperature, the membrane The mouse keratinocytes were collected for detachment was reacted with enhanced chemiluminescence (ECL) with 0.25% trypsin solution after isolation and culture solution for 1 min, after which the membrane was for 48 h. The number of cell samples was adjusted to 6 − 1 amounted using cling-film with the liquid removed, 1×10 mL . Then, 1 mL cells were centrifuged at and observed under an X-ray instrument (36209ES01, 402×g for 10 min with the supernatant discarded and Qianchen Bioteachnology, Shanghai, China). GAPDH the cells collected. Per mL of the collected cells were was regarded as the internal reference, and the grey added with 2 mL PBS before undergoing centrifugation. value ratio of target band and GAPDH band was The supernatant was discarded, and the cells were fixed taken as the relative expression of sample protein. with 70% pre-cooled ethanol solution at 4 °C overnight. Each experiment was conducted three times. The following day, the fixed cells were rinsed with PBS Luo et al. Molecular Medicine (2018) 24:28 Page 6 of 13 two times, and a cell suspension of 100 μL (containing using one-way analysis of variance (ANOVA). p <0.05 6 − 1 more than 10 mL ) was selected, added with 1 mL was considered to be statistically significant. 50 mg/L propidium iodide (PI) solution (containing RNAase) for 30-min incubation avoiding light exposure. Results After that, the cells were filtered with nylon net (300 Elevated histamine releasing rate in CAU model mice mesh), and the cell cycle was analyzed using flow cytom- signifies the successful model establishing etry at an excitation wavelength of 488 nm. In order to observe the histopathological changes of skin Cell apoptosis was assessed using the Annexin V- tissues after the occurrence of CAU, 24 CAU patients fluorescein isothiocyanate (FITC)/PI double staining, and 12 model mice (blank group) were recruited in the and the cells were underwent the same process of cell current study. As shown in Fig. 1a, all CAU specimens cycle. The cells were cultured at 37 °C in an incubator exhibited vasodilation, mild dermal edema and a perivas- containing 5% CO in air, and then were collected. After cular or interstitial infiltrate composed of neutrophils, rinsing with PBS two times, the cells were centrifuged eosinophil and lymphocyte, while there were no telangi- and re-suspended in 200 μL binding buffer, followed by ectasia and congestion in addition to lymphocytic and the addition of fully-mixed 10 μL Annexin V-FITC and eosinophil infiltration around the dermal vessels in nor- 5 μL PI for 15-min reaction avoiding light exposure at mal tissues. The observation results of skin tissues ob- room temperature. Later, the cells were added with tained from CAU mice were in accordance with the 300 μL binding buffer and placed onto the flow cytome- aforementioned findings (Fig. 1b). try (6HT, Cellwar Bio-technology Co., Ltd., Wuhan, According to results of the histamine releasing by Hubei, China) for cell apoptosis detection at the excita- mast cells, the release rates of histamine by normal hu- tion wavelength of 488 nm. man serum activated mast cells were all negative, while 10 positive cases and 14 negative cases of histamine re- Statistical analysis lease out of human CAU serum were observed with the Statistical analyses were performed using the SPSS 22.0 release rate of (21.35 ± 8.40)% which was higher than software (IBM Corp. Armonk, NY, USA). Measurement the normal subjects (9.08 ± 3.42)% (p < 0.05) (Fig. 1c). In data were expressed as mean ± standard deviation. Differ- CAU model mice, CAU mice with no transfection had a ences between two groups were compared using the t test, histamine release rate of (26 ± 5.20)% compared with nor- and differences among multiple groups were analyzed mal mice which was (8.16 ± 4.28)%, signifying a highly a b 50 µm 50 µm 50 µm 50 µm Normal Chronic Urticaria Normal Chronic Urticaria c d 30 * 6 7 0 0 Normal Chronic Urticaria Normal Chronic Urticaria Fig. 1 Deteriorated pathological changes and elevated histamine release rate in CAU revealed by HE staining and Histamine Release (× 200). Note: a normal skin tissues and CAU tissues in patients with CAU after HE staining, with the red arrows indicating towards the dermal vascular wall and the surrounding neutrophils and eosinophil infiltration (× 200); b normal skin tissues and CAU tissues in CAU mice after HE staining, with the red arrows indicating towards the dermal vascular wall and the surrounding neutrophils and eosinophil infiltration, and the blue arrow indicating towards the small amount of lymphocytic infiltration surrounding the dermal vascular wall (× 200); c histamine release experiment of human serum activated mast cells (n = 24); d histamine release experiment of mice serum activated mast cells in normal and CAU tissues (n = 12); *, p < 0.05 compared with the normal group; CAU, chronic autoimmune urticaria; HE, hematoxylin-eosin Histamine release rate (%) Histamine release rate (%) Luo et al. Molecular Medicine (2018) 24:28 Page 7 of 13 increased histamine release rate in CAU model mice and STAT3 signaling pathway-related genes, including JAK2, successful establishment of CAU models (Fig. 1d). STAT3, ISG15, CRK and IRF9, were evidently elevated in CAU skin tissues (p < 0.05), and the same was con- Higher OSMR positive expression rate and elevated firmed by the Western blot analysis (p < 0.05) (Fig. 2d). expression of the JAK/STAT3 signaling pathway-related All aforementioned findings indicate that CAU exhibits genes in CAU skin tissues increased expression of OSMR and the activated JAK/ In order to better investigate the expression of OSMR in STAT3 signaling pathway. CAU skin tissues, CAU and normal skin tissues were ob- served under the light microscope. The findings indicate Inhibited expression of CAU inflammatory factors as a that OSMR positive cells were primarily located in the result of OSMR silencing superficial and middle dermis, surrounding the blood The ELISA assay was employed to determine the levels vessels and appendages in CAU skin tissues, with the of inflammatory factors such as IL-1, IL-6 and IFN-γ in positive granule largely located inside the epithelial cells. CAU skin tissues. As shown in Fig. 3a, the inflammatory The OSMR positive expression rate in CAU skin tissues factors were found to be increased in CAU skin tissues. was 34.00%. However, a relatively small number of Mice models with different vectors transfection were OSMR positive cells were observed in normal skin tis- established in order to testify the function of OSMR. Re- sues with an OSMR positive expression rate of 8.50%, sults of the ELISA assay (Fig. 3b) show that compared indicating that the OSMR positive expression rate in with the normal skin tissues, CAU tissues with no trans- CAU skin tissues was significantly higher than normal fection and transfected with blank plasmids exhibited in- skin tissues (p < 0.05) (Fig. 2a, b). creased levels of IL-1, IL-6 and IFN-γ. Compared with As OSMR plays a vital role in CAU skin tissues, RT- CAU tissues with no transfection and transfected with qPCR and Western blot assay were conducted in order blank plasmids, CAU tissues transfected with OSMR- to elucidate the relationship between OSMR and the siRNA exhibited decreased levels of IL-1, IL-6 and IFN- JAK/STAT3 signaling pathway. The results (Fig. 2c) re- γ, with an opposite trend observed in CAU skin tissues veal that the mRNA expression of OSMR and the JAK/ transfected with Tyr705. Interestingly, there was no a b 50 µm 50 µm Normal Chronic Urticaria Normal Chronic Urticaria c d 3 Normal Normal OSMR Chronic Urticaria Chronic Urticaria JAK2 4 2 * STAT3 ISG15 * CRK 2 * * * * IRF9 GAPDH OSMR JAK2 STAT3 ISG15 CRK IRF9 OSMR JAK2 STAT3 ISG15 CRK IRF9 Fig. 2 Increased protein and mRNA expressions of OSMR and JAK/STAT3 signaling pathway-related factors in skin tissues of CAU patients revealed by RT-qPCR assay and Western blot analysis (n = 24). Note: a OSMR protein expression in human CAU tissues and normal skin tissues under microscope (× 200); b comparison of OSMR protein expression rate in human CAU tissues and normal skin tissues revealed that OSMR protein expression was significantly higher in CAU tissues than the normal skin tissues; c mRNA expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 was significantly higher in CAU tissues than those in normal skin tissues detected by RT-qPCR; d Western blot assay revealed increased protein expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in CAU tissues than those in normal skin tissues; *, p <0.05 when compared with the normal skin tissues; CAU, chronic autoimmune urticaria; RT-qPCR, reverse transcription quantitative polymerase chain reaction; OSMR, Oncostatin M receptor; JAK2, janus kinase 2; STAT3, signal transducer and activator of transcription 3; ISG15, interferon-stimulated gene 15;CRK, CT10-regulated kinase; IRF9, interferon regulatory factor 9 Normal Chronic Urticaria Realative mRNA expresssion Relative protein expression Positive expression of OSMR (%) Luo et al. Molecular Medicine (2018) 24:28 Page 8 of 13 Fig. 3 Decreased inflammatory factor content after transfection with OSMR-siRNA but increased by activation of the JAK/STAT3 signaling pathway. Notes: a inflammatory factor expression in serum of CAU patients (n = 24); b inflammatory factor expression in serum of CAU mouse tissues with different transfection (n =12); *, p < 0.05 compared with the normal group; #, p < 0.05 compared with the blank group; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor; JAK, janus kinase; STAT, signal transducer and activator of transcription significant differences among CAU skin tissues with no JAK/STAT3 inhibition relieved CAU pathological reaction transfection and transfected with blank plasmids, and and decreased the eosinophils counting number. those transfected with OSMR-siRNA + Tyr705 (p >0.05). The aforementioned findings demonstrate that OSMR si- Enhanced proliferation of epithelial cells after transfected lencing inhibited while the activation of the JAK/STAT3 with OSMR silencing and the JAK/STAT3 signaling signaling pathway promoted the expression of inflamma- pathway inhibition tory factors. Cell cycle and cell apoptosis are two essential elements for assessing cell growth and death, thus, flow analysis Pathological reaction of CAU relieved and eosinophil was performed in order to explore the alterations in cell number decreased after transfection with OSMR silencing cycle and cell apoptosis after different transfection. As As CAU is characterized by pruritus and flare reaction showed by Fig. 5, cell proliferation was found to be de- in skin with an increase in eosinophils, the pathological creased significantly with the decreasing condition morphology in each group was observed under the remained for 6 h (p > 0.05). At transfection periods of 12, microscope, and the number and duration of pruritus in 24, and 48 h, cells transfected with OSMR-siRNA exhib- CAU mice was accordingly analyzed and recorded. As ited increases cell proliferation, while those transfected shown by Table 2 and Fig. 4, the recorded number and with Tyr705 had the lowest cell proliferation (p <0.05). duration of pruritus, and the eosinophils counting num- The findings reveal that OSMR silencing increased cell ber were found to be increased in CAU mice (p < 0.05). proliferation, while activation of the JAK/STAT3 signaling Compared to the CAU mice with no transfection and pathway inhibited cell proliferation. transfected with blank plasmids, CAU mice tissues As results of the flow analysis demonstrate, compared transfected with OSMR-siRNA exhibited significantly with the normal group, epithelial cells had prolonged G0/ decreased number and duration of pruritus and eosinophils G1 phases but diminished S phases, along with increased counting number, whereas the results were opposite in the cell apoptosis (p < 0.05). Compared to the cells with no CAU mice tissues transfected with Tyr705 (p < 0.05). transfection or transfected with blank plasmids, cells Thereby, it can be concluded that OSMR silencing and transfected with OSMR-siRNA demonstrated diminished Table 2 The number and duration of pruritus ratios in each group Group n Number of pruritus (time) Duration of pruritus (min) Normal 12 0 0 * * Blank 12 57.15 ± 6.72 28.00 ± 4.10 * * NC 12 55.23 ± 4.38 27.30 ± 3.90 *# *# Tyr705 12 92.50 ± 7.80 40.50 ± 350 * * OSMR-siRNA 12 18.40 ± 5.10 17.00 ± 3.35 *# *# Tyr705 + OSMR-siRNA 12 56.38 ± 5.20 29.40 ± 3.40 * # p < 0.05 compared with the normal group; p < 0.05 compared with the blank group; NC negative control, OSMR oncostatin M receptor Luo et al. Molecular Medicine (2018) 24:28 Page 9 of 13 with OSMR-siRNA, whereas it was found to be increased in cells transfected with Tyr705, while there were no sig- * nificant difference in cells transfected with Tyr705 + OSMR-siRNA (p > 0.05). The above results show that OSMR accelerated the apoptosis of epithelial cells by shortening the S phase and prolonging the G0/G1 phase of the cell cycle. Therefore, it can be concluded that OSMR silencing could shorten the G0/G1 phase, prolong the S phase of epithelial cells, thereby inhibiting epithelial cell growth, while down-regulation of the JAK/STAT3 sig- naling pathway promoted epithelial cell process. OSMR silencing inhibited the JAK/STAT3 signaling pathway thus suppressed CAU progression Lastly, in order to assess the relationship between OSMR and the JAK/STAT3 signaling pathway in epithe- lial cells, RT-qPCR and Western blot assay were per- formed in order to explore the mRNA and protein expressions of OSMR and the JAK/STAT3 pathway re- Fig. 4 CAU pathological reaction relieved and eosinophils counting lated genes in epithelial cells with different transfection. number decreased after CAU mice transfected with OSMR-siRNA As shown by Fig. 7a–c, compared to the normal cells, (n = 12). Note: *, p < 0.05 compared with the normal group; #, p <0.05 epithelial cells exhibited increased mRNA and protein compared with the blank group; CAU, chronic autoimmune urticaria; expressions of OSMR and JAK/STAT3 signaling pathway OSMR, Oncostatin M receptor related genes (p < 0.05). Compared with the epithelial cells transfected with blank vectors, epithelial cells trans- G0/G1 phases and prolonged S phases, whereas opposite fected with OSMR-siRNA displayed decreased expressions results were observed in the cells transfected with Tyr705 of OSMR and JAK/STAT3 signaling pathway related genes (p < 0.05), and the results were not significantly different (p < 0.05), while those transfected with Tyr705 exhibited in cells transfected with Tyr705 + OSMR-siRNA (p >0.05) elevated levels (p < 0.05). Interestingly, epithelial cells (Fig. 6a, b). As for changes in cell apoptosis (Fig. 6c, d), de- transfected with Tyr705 + OSMR-siRNA exhibited de- creased cell apoptosis was observed in cells transfected creased OSMR and JAK/STAT3 compared to the epithe- lial cells transfected with Tyr705, indicating that OSMR could inhibit the JAK/STAT3 signaling pathway. Normal Blank Discussion Chronic autoimmune urticaria (CAU), a commonly oc- NC 1.5 curring disease, is accompanied by various symptoms in- Tyr705 cluding transient eruption of itchy, edematous swellings OSMR-siRNA of the dermis, and erythematosus, lasting over a duration of 6 weeks (Wardhana, 2012). Recent study has shown Tyr705 + OSMR-siRNA 1.0 that OSMR plays an important role in systemic lupus ery- *# thematosus, and further leads to the stimulation of various cytokines and inflammatory substances, such as IL-6 and *# IL-11 by activating the JAK/STAT pathway and the 0.5 # * mitogen-activated protein kinase (MAPK) signaling path- *# ways (Lin et al., 2014). The current study has shown that *# *# OSMR gene silencing can restrain the development of CAU, which can be achieved through blocking the JAK/ 0.0 30 min 1 h 6 h 12 h 24 h 48 h STAT3 signaling pathway. Initially, it was found that OSMR silencing inhibits the Fig. 5 Epithelial cell proliferation ability inhibited after cells transfected with OSMR-siRNA. Note: the experiment repeated for 3 expression of the JAK/STAT3 signaling pathway related- times; *, p < 0.05 compared with the normal group; #, p <0.05 genes (JAK2, STAT3, ISG15, CRK and IRF9). JAK2 is compared with the blank and NC groups; CAU, chronic autoimmune a non-receptor tyrosine kinase responsible for diverse urticaria; OSMR, Oncostatin M receptor cellular processes via stimulating cytoplasmic signaling Normal Blank NC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA EOS numbers (10 /ml) OD (450 nm) Luo et al. Molecular Medicine (2018) 24:28 Page 10 of 13 a b Normal Blank NC Normal Blank NC Tyr705 OSMR-siRNA 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 * Tyr705 + OSMR-siRNA * * Channels(FL2-H) Channels(FL2-H) Channels(FL2-H) Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA 20 # * * * G0/G1 S G2/M 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Channels(FL2-H) Channels(FL2-H) Channels(FL2-H) c d Normal Blank NC * * 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC FITC FITC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC FITC FITC Fig. 6 Shortened epithelial cell cycle and promoted cell apoptosis after cells transfected with OSMR-siRNA thus to inhibit CAU cell growth and promote their apoptosis. Note: a flow cytometry image revealed the epithelial cell cycle in different transfection groups; b histogram image displayed the epithelial cell cycle in different transfection groups; c flow cytometry image revealed the epithelial cell apoptosis in different transfection groups; d histogram image displayed the epithelial cell apoptosis in different transfection groups; the experiment repeated 3 times; *, p < 0.05 compared with the normal group; #, p < 0.05 compared with the blank and NC groups; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor cascades (Dawson et al., 2009). STAT3, another gene could be activated, followed by further activation of of interest in the current study, is a key member of STAT3 (Hong et al., 2011). Consistently, it has been re- the JAK/STAT signaling pathway (Yau et al., 2012). vealed that the low expression of OSMRβ could decrease ISG15 is an ubiquitin-like protein whose conjugation atherogenesis by inactivating the JAK2/STAT3 signaling is involved in the antiviral immune response and pathway in macrophages (Zhang et al., 2017). The afore- regulation of the JAK/STAT signaling pathway (Osiak mentioned findings and evidence suggest that OSMR gene et al., 2005;Hsiao etal., 2010). CRK belongs to Src silencing could suppress the JAK/STAT3 signaling pathway. homology-2 (SH2) and SH3 domain comprised of Additionally, the current findings demonstrate that the proteins that controls the coordinated combination of sig- contents of IL-1, IL-6, IFN-γ and IgE in serum of mice naling complexes (Sriram et al., 2015). IRF9 is a crucial in the OSMR-siRNA group were significantly reduced, factor in the JAK/STAT signaling pathway that stimulates indicating that OSMR gene silencing suppressed the the antiproliferative function of IFN-α (Wu et al., 2017; autoimmunity of CAU by blocking the JAK/STAT3 sig- Tsuno et al., 2009). A previous study found that both type naling pathway. Notable, it was reported that regulation I and type II OSMR activated JAK1, JAK2, and TYK2 of IFN-γ-secreting T helper 1 cells could inhibit auto- receptor-associated tyrosine kinases (Auguste et al., 1997). immunity and immunopathology (Cope et al., 2011). Recently, OSM has been reported to stimulate ISG genes Previous studies have demonstrated that OSMR could participating in antigen processing as well as presentation increase IL-1 and TNF activity in synovial fibroblasts, (Hergovits et al., 2017). The OSMR protein has been re- which was consistent with the results of the current ported to be capable of heterodimerizing with IL-6 signal study (Le Goff et al., 2014). Interestingly, it was reported transducer (gp130) in order to produce type II OSMR, that inhibition of OSMR results in suppressed IL-31, and when the receptor complexes were taken in, JAK which was highly expressed in the skin of patients with Normal Blank NC Tyr705 OSMR-siRNA Tyr705 + OSMR-siRNA PI PI Number Number 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 PI PI Number Number 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 10 10 10 10 10 PI PI Number Number 0 1 2 3 0 1 2 3 4 10 10 10 10 10 10 10 10 10 0 200 400 600 800 0 200 400 600 800 Cell apoptosis rate (%) Cell cycle (%) Luo et al. Molecular Medicine (2018) 24:28 Page 11 of 13 Fig. 7 mRNA and protein expression of OSMR and the JAK/STAT3 signaling pathway related genes decreased after cells transfected with OSMR-siRNA and the JAK/STAT3 signaling pathway inhibition (n = 12). Note: a mRNA expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in epithelial cells and normal skin tissues; b protein expression of OSMR, JAK2, STAT3, ISG15, CRK and IRF9 in epithelial cells and normal skin tissues; *, p <0.05 compared with the normal group; #, p < 0.05 compared with the blank and NC groups; CAU, chronic autoimmune urticaria; OSMR, Oncostatin M receptor; JAK2, janus kinase 2; STAT3, signal transducer and activator of transcription 3; ISG15, interferon-stimulated gene 15; CRK, CT10-regulated kinase; IRF9, interferon regulatory factor 9 chronic spontaneous urticaria and was released from pathway (Ji et al., 2015). Therefore, it can be hypothesized isolated basophils accompanied with anti-IgE activation that OSMR gene silencing regulates proliferation, migra- (Raap et al., 2017). Moreover, it has been reported that tion as well as apoptosis of epithelial cells in CAU by inhi- inactivation of the JAK/STAT pathway could help in biting the JAK/STAT signaling pathway. inhibiting the expression of ICAM-1 induced by IFN-γ in HaCaT human keratinocytes (Sung & Kim, 2013). Conclusion The activated JAK/STAT signaling pathway could stimu- The current study suggested that OSMR gene are highly late IFNs in order to exert an innate immune response expressed in human CAU skin tissues, and cause the up- (Cheng et al., 2014). In addition, STAT3 mutations are regulation of the JAK/STAT3 signaling pathway-related associated with autosomal dominant-hyper-IgE syn- genes. Additionally, it was demonstrated that OSMR dromes (AD-HIES) and this association might allow dif- gene silencing significantly decreases the content of in- ferentiation of AD-HIES from disorders correlated with flammatory factors, the number of eosinophils, and re- elevated serum IgE levels (Schimke et al., 2010). duces the mRNA and protein expressions of JAK/STAT3 Consequently, it was revealed that OSMR gene silen- signaling pathway-related genes, enhances cell prolifera- cing can obstruct the development of CAU by inhibiting tion, migration and inhibits apoptosis of epithelial cells. the JAK/STAT3 signaling pathway, as increased prolifer- Thereby, it can be concluded that OSMR gene silencing ation, migration and decreased apoptosis of epithelial inhibits autoimmunity in CAU mouse models by inacti- cells were observed in the OSMR-siRNA group. OSM, is vating the JAK/STAT3 signaling pathway. These findings a cytokine capable of modulating cell survival and prolif- may open novel avenues for future CAU therapies and eration, and the over-expression of OSM could result in to ultimately, raise the quality of life of CAU patients. transdifferentiation of epithelial-myofibroblast (Elbjeirami However, the limited sample size of the current study re- et al., 2010). In line with the findings of the current study, mains to be a limitation. Thus, further studies are war- it was reported that over-expression of OSM in tubular ranted in order to better the understanding of specific epithelial cells might aggravate mucosal epithelial barrier mechanisms. dysfunction (Pothoven et al., 2015). The JAK/STAT is cap- able of modulating signaling cascades exerting great ef- Acknowledgements fects on proliferation, differentiation, development as well We would like to give our sincere appreciation to the reviewers for their helpful comments on this article. as immune responses (Kim et al., 2011). Additionally, it was reported that acute nitrogen dioxide exposure en- Funding hances airway inflammation that both humoral immunity This work was supported by the National Natural Science Foundation of and cellular immunity reaction via modulating Th1/Th2 China (No. 81301362) and High End Talent Plan of Chongqing Municipal differentiation and activating the JAK/STAT signaling Health and Family Planning Commission. Luo et al. Molecular Medicine (2018) 24:28 Page 12 of 13 Authors’ contributions Dawson MA, et al. JAK2 phosphorylates histone H3Y41 and excludes HP1alpha HW and X-YL participated in the conception and design of the study. HW, QL from chromatin. Nature. 2009;461:819–22. and HY performed the analysis and interpretation of data. HY, QT and L-QG Deng G, et al. Unique methylation pattern of oncostatin m receptor gene in contributed to drafting the article. HW and F-LR revised it critically for important cancers of colorectum and other digestive organs. Clin Cancer Res. 2009; intellectual content. HW is the GUARANTOR for the article who accepts full 15:1519–26. responsibility for the work and/or the conduct of the study, had access to Denley SM, et al. Activation of the IL-6R/Jak/stat pathway is associated with a the data, and oversaw the decision to publish. All authors contributed to poor outcome in resected pancreatic ductal adenocarcinoma. J Gastrointest the revision and approved the final version of this manuscript. Surg. 2013;17:887–98. Elbjeirami WM, et al. Early differential expression of oncostatin M in obstructive nephropathy. J Interf Cytokine Res. 2010;30:513–23. Ethics approval and consent to participate Gimenez-Arnau AM, Grattan C, Zuberbier T, Toubi E. An individualized diagnostic This study was approved by the Ethics Committee of Children’s Hospital of approach based on guidelines for chronic urticaria (CU). J Eur Acad Dermatol Chongqing Medical University and all patients or their guardians signed the Venereol. 2015;29(Suppl 3):3–11. informed consent. Besides, all animals disposed in the experiment were in Goh CL, Tan KT. Chronic autoimmune urticaria: where we stand? Indian J accordance with the ethical standards. Dermatol. 2009;54:269–74. Hashimoto T, et al. Mizoribine treatment for antihistamine-resistant chronic Consent for publication autoimmune urticaria. Dermatol Ther. 2012;25:379–81. Consent for publication was obtained from the participants. Hergovits S, Mais C, Haan C, Costa-Pereira AP, Hermanns HM. Oncostatin M induces RIG-I and MDA5 expression and enhances the double-stranded RNA Competing interests response in fibroblasts. J Cell Mol Med. 2017;21:3087–99. The authors declare that they have no competing interests. Hermanns HM. Oncostatin M and interleukin-31: cytokines, receptors, signal transduction and physiology. Cytokine Growth Factor Rev. 2015;26:545–58. Hintzen C, et al. Box 2 region of the oncostatin M receptor determines Publisher’sNote specificity for recruitment of Janus kinases and STAT5 activation. J Biol Springer Nature remains neutral with regard to jurisdictional claims in Chem. 2008;283:19465–77. published maps and institutional affiliations. Hong IK, Eun YG, Chung DH, Kwon KH, Kim DY. Association of the oncostatin m receptor gene polymorphisms with papillary thyroid cancer in the korean Author details population. Clin Exp Otorhinolaryngol. 2011;4:193–8. Department of Dermatology, Children’s Hospital of Chongqing Medical Hsiao NW, et al. ISG15 over-expression inhibits replication of the Japanese University, Chongqing 400014, China. Ministry of Education Key Laboratory encephalitis virus in human medulloblastoma cells. Antivir Res. 2010;85:504–11. of Child Development and Disorders, Chongqing 400014, China. The Ji X, Han M, Yun Y, Li G, Sang N. Acute nitrogen dioxide (NO2) exposure Division of Allergy and Clinical Immunology, Johns Hopkins University School enhances airway inflammation via modulating Th1/Th2 differentiation and of Medicine, Baltimore, MD 21224, USA. China International Science and activating JAK-STAT pathway. Chemosphere. 2015;120:722–8. Technology Cooperation Base of Child Development and Critical Disorders, Kim BH, et al. Benzoxathiol derivative BOT-4-one suppresses L540 lymphoma cell Chongqing 400014, China. Chongqing Key Laboratory of Pediatrics, No.136, survival and proliferation via inhibition of JAK3/STAT3 signaling. Exp Mol Zhongshan Er Road, Yuzhong District, Chongqing 400014, China. Med. 2011;43:313–21. Komori T, Tanaka M, Senba E, Miyajima A, Morikawa Y. Lack of oncostatin M Received: 19 January 2018 Accepted: 6 May 2018 receptor beta leads to adipose tissue inflammation and insulin resistance by switching macrophage phenotype. J Biol Chem. 2013;288:21861–75. Le Goff B, et al. Oncostatin M acting via OSMR, augments the actions of IL-1 and References TNF in synovial fibroblasts. Cytokine. 2014;68:101–9. Aaronson DS, Horvath CM. A road map for those who don't know JAK-STAT. Lin YZ, et al. Association of OSMR gene polymorphisms with rheumatoid arthritis Science. 2002;296:1653–5. and systemic lupus erythematosus patients. Autoimmunity. 2014;47:23–6. Abd El-Azim M, Abd E-AS. Chronic autoimmune urticaria: frequency and Osiak A, Utermohlen O, Niendorf S, Horak I, Knobeloch KP. ISG15, an interferon- association with immunological markers. J Investig Allergol Clin Immunol. stimulated ubiquitin-like protein, is not essential for STAT1 signaling and 2011;21:546–50. responses against vesicular stomatitis and lymphocytic choriomeningitis Al-Ahmad M. Omalizumab therapy in three patients with chronic autoimmune virus. Mol Cell Biol. 2005;25:6338–45. urticaria. Ann Saudi Med. 2010;30:478–81. Pothoven KL, et al. Oncostatin M promotes mucosal epithelial barrier dysfunction, Amano W, et al. JAK inhibitor JTE-052 regulates contact hypersensitivity by and its expression is increased in patients with eosinophilic mucosal disease. downmodulating T cell activation and differentiation. J Dermatol Sci. J Allergy Clin Immunol. 2015;136:737–46 e4. 2016;84:258–65. Raap U, et al. Human basophils are a source of - and are differentially activated Arita K, et al. Oncostatin M receptor-beta mutations underlie familial primary by - IL-31. Clin Exp Allergy. 2017;47:499–508. localized cutaneous amyloidosis. Am J Hum Genet. 2008;82:73–80. Schimke LF, et al. Diagnostic approach to the hyper-IgE syndromes: immunologic Auguste P, et al. Signaling of type II oncostatin M receptor. J Biol Chem. 1997; and clinical key findings to differentiate hyper-IgE syndromes from atopic 272:15760–4. dermatitis. J Allergy Clin Immunol 126. 2010;e1:611–7. Bingham CO 3rd. Immunomodulatory approaches to the management of Sriram G, et al. Iterative tyrosine phosphorylation controls non-canonical domain chronic urticaria: an immune-mediated inflammatory disease. Curr Allergy utilization in Crk. Oncogene. 2015;34:4260–9. Asthma Rep. 2008;8:278–87. Sung YY, Kim HK. Illicium verum extract suppresses IFN-gamma-induced ICAM-1 Boniface K, et al. Oncostatin M secreted by skin infiltrating T lymphocytes is a expression via blockade of JAK/STAT pathway in HaCaT human keratinocytes. potent keratinocyte activator involved in skin inflammation. J Immunol. 2007; J Ethnopharmacol. 2013;149:626–32. 178:4615–22. Tanimoto A, et al. A novel JAK inhibitor JTE-052 reduces skin inflammation and Caffarel MM, Coleman N. Oncostatin M receptor is a novel therapeutic target in ameliorates chronic dermatitis in rodent models: comparison with cervical squamous cell carcinoma. J Pathol. 2014;232:386–90. conventional therapeutic agents. Exp Dermatol. 2018;27:22–9. Chen D, et al. Expression of short-form oncostatin M receptor as a decoy Tsuno T, et al. IRF9 is a key factor for eliciting the antiproliferative activity of IFN- receptor in lung adenocarcinomas. J Pathol. 2008;215:290–9. alpha. J Immunother. 2009;32:803–16. Cheng CH, et al. Differential regulation of Tetraodon nigroviridis mx gene promoter activity by constitutively-active forms of STAT1, STAT2, and IRF9. Ventura MT, Napolitano S, Menga R, Cecere R, Asero R. Anisakis simplex Fish Shellfish Immunol. 2014;38:230–43. hypersensitivity is associated with chronic urticaria in endemic areas. Int Arch Cherrez Ojeda I, et al. Chronic autoimmune urticaria in children. Allergol Allergy Immunol. 2013;160:297–300. Immunopathol (Madr). 2009;37:43–7. Wardhana DEA. Chronic autoimmune urticaria. Acta Med Indones. 2012;44:165–74. Cope A, Le Friec G, Cardone J, Kemper C. The Th1 life cycle: molecular control of Wu Z, et al. Interaction of IRF9 and STAT2 synergistically up-regulates IFN and IFN-gamma to IL-10 switching. Trends Immunol. 2011;32:278–86. PKR transcription in Ctenopharyngodon idella. Mol Immunol. 2017;85:273–82. Luo et al. Molecular Medicine (2018) 24:28 Page 13 of 13 Yagami A, Furue M, Togawa M, Saito A, Hide M. One-year safety and efficacy study of bilastine treatment in Japanese patients with chronic spontaneous urticaria or pruritus associated with skin diseases. J Dermatol. 2017;44:375–85. Yau WW, Rujitanaroj PO, Lam L, Chew SY. Directing stem cell fate by controlled RNA interference. Biomaterials. 2012;33:2608–28. Zhang X, et al. Oncostatin M receptor beta deficiency attenuates atherogenesis by inhibiting JAK2/STAT3 signaling in macrophages. J Lipid Res. 2017;58:895–906.

Journal

Molecular MedicineSpringer Journals

Published: Jun 5, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off